WO2000037679A2 - Method for determining the susceptibility to developing sepsis and therapeutics for the treatment of sepsis - Google Patents

Method for determining the susceptibility to developing sepsis and therapeutics for the treatment of sepsis Download PDF

Info

Publication number
WO2000037679A2
WO2000037679A2 PCT/US1999/025633 US9925633W WO0037679A2 WO 2000037679 A2 WO2000037679 A2 WO 2000037679A2 US 9925633 W US9925633 W US 9925633W WO 0037679 A2 WO0037679 A2 WO 0037679A2
Authority
WO
WIPO (PCT)
Prior art keywords
allele
sepsis
pattern
primer
kit
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1999/025633
Other languages
English (en)
French (fr)
Other versions
WO2000037679A3 (en
Inventor
Francesco S. Di Giovine
Gordon W. Duff
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Interleukin Genetics Inc
Original Assignee
Interleukin Genetics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Interleukin Genetics Inc filed Critical Interleukin Genetics Inc
Priority to DE69939269T priority Critical patent/DE69939269D1/de
Priority to CA002346960A priority patent/CA2346960A1/en
Priority to IL14243899A priority patent/IL142438A0/xx
Priority to AU39956/00A priority patent/AU779772B2/en
Priority to JP2000589732A priority patent/JP2002533096A/ja
Priority to EP99972008A priority patent/EP1127168B1/en
Publication of WO2000037679A2 publication Critical patent/WO2000037679A2/en
Publication of WO2000037679A3 publication Critical patent/WO2000037679A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2535/00Reactions characterised by the assay type for determining the identity of a nucleotide base or a sequence of oligonucleotides
    • C12Q2535/131Allele specific probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/172Haplotypes

Definitions

  • Clinical infection is the biological end result of a number of factors, including the nature of the invading organism, its intrinsic virulence, the microenvironment of the invaded tissue or organ, and the responsiveness of the host. Any means by which bacteria can be introduced into the tissues can result in an infection. However, the nature of the introduction can influence the severity of the infection and can alter the host's ability to respond. As injuries, a cutaneous laceration, for example, differs from an extensive surgical dissection, which in turn differs from a perforated gastrointestinal viscus. Similarly, a lung infection (a pneumonia) occurring in an area of atelectasis is different from a lung infection that takes place as a result of an aspiration event.
  • the severity of an infection in part relates to the extent of the injury that accompanies or precedes it. More severe injury (e.g., an extensive accidental or surgical trauma) interferes with host integrity more substantially, permitting freer access to host tissues and compromising intrinsic host defenses.
  • the severity of an infection depends upon the number and kind of micro-organisms responsible for the infection. If a polymicrobial infection is diagnosed or suspected, early and aggressive antibiotic intervention is commonly warranted, often with broad-spectrum agents with activity against a number of possible invaders.
  • Virulence factors have been associated with specific microorganisms, making invasion carried out by these cells more destructive.
  • Virulence factors are of three general types: 1) biological products produced and secreted by the infecting agent that attack cells in the host or that affect host homeostatic mechanisms to produce clinical disease; 2) structural components of the normal bacterial cell which, when shed within the host's internal environment or when released following death and lysis of the bacterial cell, have toxic effects on the host; 3) responses of the microorganism to antibiotics that make them resistant to these chemotherapeutic agents.
  • Particular microorganisms characteristically manifest specific virulence factors.
  • Staphylococcus aureus produces coagulase, which acts as a powerful virulence factor.
  • Staph. and Streptococcal species also produce leukocidins.
  • strains of B.fragilis produce superoxide dismutase, which converts superoxide anions to hydrogen peroxide;
  • strains of E. coli produce catalase, which reduces hydrogen peroxide to water, thereby rendering possible a synergism between these two organisms.
  • a wide variety of other virulence factors have been identified.
  • ⁇ ndotoxin is derived from the lipopolysaccharide outer membrane that is found in virtually all Gram negative bacteria. ⁇ ndotoxin induces an extensive array of biological effects. It is understood directly to stimulate the complement cascade, to provoke platelet aggregation, to induce fever, to activate phagocytosis and the immune system, and to stimulate the synthesis of numerous cytokines. Kremer, et al., "Interleukin-1, -6 and tumor necrosis factor-alpha release is down-regulated in whole blood from septic patients", Acta Haemmatol. 95(3-4):268-273, 1996.
  • Factors relevant to host susceptibility include the ease of entry by which a microorganism first gains access to the host, the impediments placed in the microorganism's path as it spreads within the host, and the ability of the host ultimately to contain the invasion before suffering substantial injury.
  • Certain hosts are known to be more vulnerable than others. Newborns, for example, are particularly prone to severe infections and sepsis. Similarly, pediatric patients can develop sepsis in response to bacterial infections that are much more benign in the adult population. Infections in the elderly are also more likely to progress to sepsis than similar infections in younger patients.
  • Certain pathological conditions are also understood to increase the host's susceptibility to infections and sepsis. Severe trauma, such as that which characterizes major burns, predisposes the patient to microbial infections and sepsis to such an extent that these patients are considered immunocompromised hosts.
  • Host defenses represent an important variable in determining the severity of a clinical infection.
  • Non-specific host defenses serve to limit the initial extent of microbial invasion. Examples include the epiglottis mechanism of the trachea, the vibrissae of the nasal airway, the alveolar macrophage system and the acid environment of the stomach. More specific responses are set into motion on the cellular level once tissue injury or microbial contamination take place. As part of this specific response, the phagocytic-inflammatory components of host defense are initially mobilized with trauma or with the invasion of infecting agents. Phagocytosis and inflammation are intended to contain and destroy the organisms before they gain sufficient systemic access to cause a clinically significant infection.
  • clinical infection represents a set of nonspecific inflammatory responses elicited by every injury and every microbial contamination.
  • the insult is active and progressive, providing a sustained injury that drives the inflammatory response until the offending agents are eradicated.
  • complement cascade An early component of this inflammatory response is the complement cascade.
  • This system is understood to be activated by various mechanisms of local tissue injury or microvascular trauma and disruption, leading to the release of opsonins and chemotactic signals that are complement cleavage products having the effect of attracting phagocytes and facilitating their functioning.
  • Mast cells release inflammatory proteins such as kinins and histamines that increase vascular permeability and thus facilitate the access of intravascular proteins and cells into the affected area.
  • Neutrophils are the first phagocytic cells to arrive on the scene. About 24 hours afterwards, activated macrophages arrive.
  • Macrophages are derived from monocytes that enter the tissues from the bloodstream. Monocytes recruited into the tissues differentiate into macrophages and become activated. In the activated state, macrophages produce a large number of inflammatory and cytokine proteins. An important cytokine released by the activated macrophage is TNF, which has autocrine and paracrine effects. TNF provides auto- stimulation to monocytes and macrophages to maintain full activation. TNF further stimulates neutrophils to full activation. In acute inflammation such as that found with acute infection, the activated neutrophil acts as the primary phagocyte, responsible for ingesting and killing the invading organisms.
  • These cells may further release free oxygen radicals and lysosomal enzymes into the tissue fluid, causing extracellular killing of pathogens.
  • Side-effects of the release of these cellular cytotoxic products include tissue necrosis, further inflammation and the activation of the coagulation cascade.
  • neutrophils themselves are killed as these processes progress.
  • the end result of this localized response to microbial invasion, with liquified necrotic cells and necrotic tissue is known clinically as pus.
  • neutrophils are attracted from adjacent micro vessels by the release of complement cleavage products and TNF. Platelets and coagulation proteins are also activated in the adjacent microcirculation, leading to localized thrombosis. Platelets activated during the process of thrombosis produce thromboxane A2 by way of the cyclooxygenase- thromboxane synthetase pathway of prostaglandin biosynthesis. Thromboxane A2 is a potent vasoconstrictor. The combination of obstruction and vasoconstriction diminishes the inflow of circulation into the localized area of infection, but also blocks the access of pathogens to the general circulation. Activated neutrophils attracted to the periphery of the wound marginate within the microvasculature, leading to endothelial damage, increased vascular permeability and subsequent exudation of cells and serum proteins into the tissue space.
  • Macrophages provide the connection between the local containment aspect of host defense and the systemic response. Activated macrophages release numerous secretion products, including cytokines that have systemic as well as local effects. Nathan, "Secretory products of macrophages," J. Clin. fnvest. 79:319-326,
  • Interleukin-1 is a cytokine released by the macrophage that can be disseminated systemically and induce a systemic response to local injury or infection. IL-1, when locally released, diffuses into the circulation, where it is ultimately carried to the hypothalamus. There, it acts to stimulate the production of prostaglandin-E which acts as an inflammatory mediator and an endogenous pyrogen.
  • IL-1 is known to incite a variety of other systemic responses: it mobilizes neutrophils, stimulates liver production of acute phase proteins and complements, and interacts with tumor necrosis factor (TNF) to amplify the effects of TNF. Dinarello, "Interleukin-1,” Rev. Infect. Disease 6:51-94, 1984. IL-1 further interacts with other cytokines and growth factors, for example mediating the sepsis induced changes in IGF and the accompanying changes in muscle protein synthesis. Lang, et al, "IL-1 receptor antagonist attentuates sepsis-induced alterations in the IGF system and protein synthesis", Am. J. Physiol.
  • IL-1 is also responsible for the increases in circulating eicosanoid levels, levels of IL-6 and levels of
  • SIRS systemic inflammatory response syndrome
  • Late mortality after sepsis and septic shock is equally poor, with only 30% surviving the first year after hospital admission.
  • Schoenberg, et al. "Outcome of patients with sepsis and shock after ICU treatment", Langenbecks Arch. Surg. 383(l):44-48, 1998.
  • a patient can decompensate from Stage A to Stage C with no Stage B interval.
  • a patient can be sustained in Stage B for a prolonged time, setting the stage for a number of sepsis-related sequelae such as multiple organ failure even though no frank shock has supervened. It would be desirable to identify those patients whose septic course is more likely to be progressive. This would allow early and aggressive therapies to be directed towards those patients who face the most dire prognoses.
  • Horn, K.D. "Evolving strategies in the treatment of sepsis and systemic inflammatory response syndrome (SIRS)", OJ 91(4):265-277, 1998.
  • supportive measures can be instituted at early stages to forestall the consequences of multiple organ failure.
  • systemic complement activation and systemic macrophage activation lead to systemic neutrophil activation, in analogy to the interrelated local behaviors of complement, macrophages and neutrophils.
  • Schirmer et al. "Complement activation produces hemodynamic changes characteristic of sepsis," Arch. Surg. 123:316-321, 1989; Schirmer et al.,
  • neutrophils When neutrophils are systemically activated, their actions are diffuse and unchanneled. Systemic neutrophil activation also entails diffuse neutrophil margination. In this situation, the neutrophils attach to the endothelium of vessels throughout the body and exert their effects on all tissues they encounter. Endothelial injury results from secretion of neutrophil products, leading to increased vascular permeability. As neutrophils attach to the endothelium and enter the tissues, they also release oxygen free radicals and lysozymal enzymes which contribute to a systemic inflammatory response. Release of these products into the bloodstream catalyzes further systemic responses.
  • Endothelial injury from the secreted products of activated neutrophils further results in platelet activation and induction of the coagulation cascade.
  • Sutton, et al "Endothelial structural integrity is maintained during endotoxic shock in an interleukin-1 type 1 receptor knockout mouse” Shock 7(2): 105- 110, 1997 Thromboxane A2 is thereupon released.
  • plugs are formed in the microvascular system from the combination of neutrophils, platelets and fibrin. These plugs, combined with the vasoconstrictive effects of thromboxane, cause focal tissue ischemia.
  • Chang, et al. "Interleukin-1 in ischemia-reperfusion acute lung injury", Am. J. Respir.
  • Tissue necrosis both locally and distantly, in its turn provides a stimulus for further inflammation. Rapid evolution of these processes can lead to the progression from Stage C sepsis to Stage D sepsis, with a fatal outcome common. Alternatively, if Stage B sepsis is prolonged in the face of these microcirculatory events, focal but disseminated tissue necrosis can extend to culminate in multiple organ failure.
  • thrombosis enhances monocyte secretion of tumor necrosis factor and interleukin-1 beta by two distinct mechanisms
  • Blood Cells Mol. Dis. 21(2): 156- 167, 1995 Gando, et al., "Cytokines, soluble thrombomodulin and disseminated intravascular coagulation in patients with systemic inflammatory response syndrome” Thromb. Res. 80(6):519-526, 1995.
  • IL-1 and TNF have been identified as circulating factors that integrate and perpetuate these effects
  • therapies designed to antagonize the effects of these agents can be designed to have clinical utility in ameliorating the sequences involved in sepsis.
  • IL-1 has been identified as playing an important role in Group B streptococcal sepsis and septic shock in the newborn; it is suggested that IL1-RN treatment may ameliorate the cardiovascular alterations associated with this disease in the newborn population.
  • IL-1 has been identified as markers for poor prognosis in patients with ARDS, a common concomitant of sepsis.
  • Meduri, et al. "Persistent elevation of inflammatory cytokines predicts a poor outcome in ARDS. Plasma IL-1 beta and IL-6 levels are consistent and efficient predictors of outcome over time", Chest 107(4): 1062- 1073, 1995.
  • Plasmapherisis may be appropriate to remove the inflammatory elements from the septic patient's bloodstream in those who are prone to exaggerated inflammatory response.
  • Haupt, et al. "Selective cytokine release induced by serum and separated plasma from septic patients", Eur. J. Surg. 162(10): 769-776, 1996; Stegmayr, B.G. "Plasmapheresis in severe sepsis or septic shock", Blood Purif 14(1):94-101, 1996.
  • Manipulating the complement system may provide an additional strategy for treating the patient with severe inflammatory response in sepsis. Kirschfink, M. "Controlling the complement system in inflammation", Immunopharmacology 38(1- 2):51-62, 1997. Or, realizing the additional inflammatory burden imposed by surgery in certain septic patients may further provide the clinician information about the timing of surgical interventions in sepsis, and will guide the clinician in possible forms of adjuvant therapy.
  • IL-1 ra has been measured in high risk neonates and noted to be elevated one or more days before the onset of clinical sepsis
  • the IL-1 gene cluster is on the long arm of chromosome 2 (2ql3) and contains at least the genes for IL-l ⁇ (IL-1A), IL-l ⁇ (IL-1B), and the IL-1 receptor antagonist (IL-1RN), within a region of 430 Kb (Nicklin, et al. (1994) Genomics, 19: 382-4).
  • the agonist molecules, IL-l ⁇ and IL-l ⁇ have potent pro-inflammatory activity and are at the head of many inflammatory cascades. Their actions, often via the induction of other cytokines such as IL-6 and IL-8, lead to activation and recruitment of leukocytes into damaged tissue, local production of vasoactive agents, fever response in - the brain and hepatic acute phase response.
  • IL-1 molecules bind to type I and to type II IL-1 receptors, but only the type I receptor transduces a signal to the interior of the cell. In contrast, the type II receptor is shed from the cell membrane and acts as a decoy receptor.
  • the receptor antagonist and the type II receptor therefore, are both anti-inflammatory in their actions.
  • IL-1 Inappropriate production of IL-1 plays a central role in the pathology of many autoimmune and inflammatory diseases, including rheumatoid arthritis, inflammatory bowel disorder, psoriasis, and the like. In addition, there are stable inter- individual differences in the rates of production of IL-1, and some of this variation may be accounted for by genetic differences at IL-1 gene loci. Thus, the IL-1 genes are reasonable candidates for determining part of the genetic susceptibility to inflammatory diseases, most of which have a multifactorial etiology with a polygenic component.
  • IL-1RN (VNTR) allele 2 has been shown to be associated with osteoporosis (U.S. Patent No. 5,698,399), nephropathy in diabetes mellitus (Blakemore, et al. (1996) Hum. Genet. 97(3): 369-74), alopecia areata (Cork, et al, (1995) J. Invest. Dermatol. 104(5 Supp.): 15S-16S; Cork et al. (1996) Dermatol Clin 14: 671-8), Graves disease (Blakemore, et al. (1995) J. Clin. Endocrinol.
  • IL-1 A allele 2 from marker -889 and IL-IB (Taql) allele 2 from marker +3954 have been found to be associated with periodontal disease (U.S. Patent No. 5,686,246; Kornman and diGiovine (1998) Ann Periodont 3: 327-38; Hart and Kornman (1997) Periodontol 2000 14: 202-15; Newman (1997) Compend Contin Educ Dent 18: 881-4; Kornman et al. (1997) J. Clin Periodontol 24: 72-77).
  • the IL-1 A allele 2 from marker -889 has also been found to be associated with juvenile chronic arthritis, particularly chronic iridocyclitis (McDowell, et al.
  • IL-IB (Taql) allele 2 from marker +3954 of IL-IB has also been found to be associated with psoriasis and insulin dependent diabetes in DR3/4 patients (di Giovine, et al. (1995) Cytokine 7: 606; Pociot, et al. (1992) Eur J. Clin. Invest. 22: 396- 402). Additionally, the IL-1RN (VNTR) allele 1 has been found to be associated with diabetic retinopathy (see USSN 09/037472, and PCT/GB97/02790).
  • heritable diseases have depended on either the identification of abnormal gene products (e.g., sickle cell anemia) or an abnormal phenotype (e.g., mental retardation). These methods are of limited utility for heritable diseases with late onset and no easily identifiable phenotypes such as, for example, vascular disease. With the development of simple and inexpensive genetic screening methodology, it is now possible to identify polymorphisms that indicate a propensity to develop disease, even when the disease is of polygenic origin. The number of diseases that can be screened by molecular biological methods continues to grow with increased understanding of the genetic basis of multifactorial disorders.
  • abnormal gene products e.g., sickle cell anemia
  • phenotype e.g., mental retardation
  • Genetic screening can be broadly defined as testing to determine if a patient has mutations (or alleles or polymorphisms) that either cause a disease state or are "linked" to the mutation causing a disease state.
  • Linkage refers to the phenomenon wherein DNA sequences which are close together in the genome have a tendency to be inherited together. Two sequences may be linked because of some selective advantage of co-inheritance. More typically, however, two polymorphic sequences are co-inherited because of the relative infrequency with which meiotic recombination events occur within the region between the two polymo ⁇ hisms.
  • the co-inherited polymo ⁇ hic alleles are said to be in linkage disequilibrium with one another because, in a given human population, they tend to either both occur together or else not occur at all in any particular member of the population. Indeed, where multiple polymo ⁇ hisms in a given chromosomal region are found to be in linkage disequilibrium with one another, they define a quasi-stable genetic "haplotype.” In contrast, recombination events occurring between two polymo ⁇ hic loci cause them to become separated onto distinct homologous chromosomes.
  • one or more polymo ⁇ hic alleles of the haplotype can be used as a diagnostic or prognostic indicator of the likelihood of developing the disease.
  • This association between otherwise benign polymo ⁇ hisms and a disease-causing polymo ⁇ hism occurs if the disease mutation arose in the recent past, so that sufficient time has not elapsed for equilibrium to be achieved through recombination events. Therefore identification of a human haplotype which spans or is linked to a disease-causing mutational change, serves as a predictive measure of an individual's likelihood of having inherited that disease-causing mutation.
  • prognostic or diagnostic procedures can be utilized without necessitating the identification and isolation of the actual disease-causing lesion. This is significant because the precise determination of the molecular defect involved in a disease process can be difficult and laborious, especially in the case of multifactorial diseases such as inflammatory disorders.
  • the statistical correlation between an inflammatory disorder and an IL-1 polymo ⁇ hism does not necessarily indicate that the polymo ⁇ hism directly causes the disorder. Rather the correlated polymo ⁇ hism may be a benign allelic variant which is linked to (i.e. in linkage disequilibrium with) a disorder-causing mutation which has occurred in the recent human evolutionary past, so that sufficient time has not elapsed for equilibrium to be achieved through recombination events in the intervening chromosomal segment.
  • these other polymo ⁇ hic loci will also be prognostic or diagnostic of the likelihood of having inherited the disease-causing polymo ⁇ hic locus.
  • a broad- spanning human haplotype describing the typical pattern of co-inheritance of alleles of a set of linked polymo ⁇ hic markers
  • the determination of an individual's likelihood for developing a particular disease of condition can be made by characterizing one or more disease-associated polymo ⁇ hic alleles (or even one or more disease-associated haplotypes) without necessarily determining or characterizing the causative genetic variation.
  • a means for measuring a patient's propensity for exaggerated inflammatory response as an indicator of his or her response to septic stimuli is needed.
  • the invention features assays for determining a subject's susceptibility to developing sepsis or prognosticating on the rapidity and/or ultimate progression of sepsis in that subject.
  • the method comprises the step of genotyping a nucleic acid sample obtained from the subject to determine whether the subject's DNA contains at least one allele of an IL-1 genetic pattern that leads to a dysregulated inflammatory response.
  • the IL-1 genetic pattern that leads to a dysregulated inflammatory response is an IL-1 pattern 2.
  • the allele of an IL-1 genetic pattern is detected by one of the following methods: 1) performing a hybridization reaction between the nucleic acid sample and a probe or probes that are capable of hybridizing to a particular allele in the subject; 2) sequencing at least a portion of at least one allele; or 3) determining the electrophoretic mobility of at least one allele.
  • an allele of an IL-1 genetic pattern that leads to a dysregulated inflammatory response is subject to an amplification step, prior to performance of the detection step.
  • Preferred amplification steps are selected from the group consisiting of: the polymerase chain reaction (PCR), the ligase chain reaction (LCR), strand displacement amplification (SDA), cloning, and variations of the above (e.g. RT-PCR and allele specific amplification).
  • the sample is hybridized with a set of primers, which hybridize 5' and 3' to a sense or antisense sequence of an allele of an IL-1 genetic pattern that leads to a dysregulated inflammatory response and is subject to a PCR amplification.
  • the invention features kits for performing the above- described assays.
  • the kit can include DNA sample collection means and a means for determining at least one allele of an IL-1 genetic pattern that leads to a dysregulated inflammatory response of the subject.
  • the kit may also comprise control samples or standards.
  • Information obtained using the assays and kits described herein is useful for predicting whether a subject is likely to develop sepsis.
  • the information alone or in conjunction with information on another genetic defect contributing to sepsis allows customization of sepsis therapy to the individual's genetic profile. For example, this information can enable a doctor to: 1) more effectively prescribe a drug that will address the molecular basis of the cascade resulting in sepsis; and 2) better determine the appropriate dosage of a particular sepsis drug for a particular patient.
  • the ability to target patient populations expected to show the highest clinical benefit can enable: 1) the repositioning of marketed drugs with disappointing market results; 2) the rescue of drug candidates whose clinical development has been discontinued as a result of safety or efficacy limitations, which are patient subgroup- specific; and 3) an accelerated and less costly development for drug candidates and more optimal drug labeling.
  • the invention features methods for treating or preventing the development of sepsis in a subject by administering to the subject an appropriate therapeutic of the invention.
  • the invention provides in vitro or in vivo assays for screening test compounds to identify sepsis therapeutics.
  • an aberrant activity refers to an activity which differs from the activity of a native polypeptide or which differs from the activity of the polypeptide in a healthy subject.
  • An activity of a polypeptide can be aberrant because it is stronger than the activity of its native counte ⁇ art.
  • an activity can be aberrant because it is weaker or absent relative to the activity of its native counte ⁇ art.
  • An aberrant activity can also be a change in an activity.
  • an aberrant polypeptide can interact with a different target peptide.
  • a cell can have an aberrant IL-1 activity due to overexpression or underexpression of an IL-1 locus gene encoding an IL-1 locus polypeptide.
  • allele refers to the different sequence variants found at different polymo ⁇ hic regions.
  • IL-1RN VNTR
  • the sequence variants may be single or multiple base changes, including without limitation insertions, deletions, or substitutions, or may be a variable number of sequence repeats.
  • allelic pattern refers to the identity of an allele or alleles at one or more polymo ⁇ hic regions.
  • an allelic pattern may consist of a single allele at a polymo ⁇ hic site, as for IL-1RN (VNTR) allele 1, which is an allelic pattern having at least one copy of IL-1 RN allele 1 at the VNTR of the IL-1RN gene loci.
  • an allelic pattern may consist of either a homozygous or heterozygous state at a single polymo ⁇ hic site.
  • an allelic pattern in which there are two copies of the second allele at the VNTR marker of IL-1 RN and that corresponds to the homozygous IL-RN (VNTR) allele 2 state.
  • an allelic pattern may consist of the identity of alleles at more than one polymo ⁇ hic site.
  • antibody as used herein is intended to refer to a binding agent including a whole antibody or a binding fragment thereof which is specifically reactive with an IL-IB polypeptide.
  • Antibodies can be fragmented using conventional techniques and the fragments screened for utility in the same manner as described above for whole antibodies. For example, F(ab)2 fragments can be generated by treating an antibody with pepsin. The resulting F(ab)2 fragment can be treated to reduce disulfide bridges to produce Fab fragments.
  • the antibody of the present invention is further intended to include bispecific, single-chain, and chimeric and humanized molecules having affinity for an IL-IB polypeptide conferred by at least one CDR region of the antibody.
  • Bioactivity or “bioactivity” or “activity” or “biological function”, which are used interchangeably, for the pu ⁇ oses herein when applied to IL-1 means an effector or antigenic function that is directly or indirectly performed by an IL-1 polypeptide (whether in its native or denatured conformation), or by any subsequence (fragment) thereof.
  • a biological activity can include binding, effecting signal transduction from a receptor, modulation of gene expression or an antigenic effector function.
  • bioactive fragment of an IL-1 polypeptide refers to a fragment of a full-length IL-1 polypeptide, wherein the fragment specifically mimics or antagonizes the activity of a wild-type IL-1 polypeptide.
  • the bioactive fragment preferably is a fragment capable of interacting with an interleukin receptor.
  • Cells Cells
  • host cells or “recombinant host cells” are terms used interchangeably herein to refer not only to the particular subject cell, but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact be identical to the parent cell, but is still included within the scope of the term as used herein.
  • a “chimera,” “mosaic,” “chimeric mammal” and the like, refers to a transgenic mammal with a knock-out or knock-in construct in at least some of its genome-containing cells.
  • control refers to any sample appropriate to the detection technique employed.
  • the control sample may contain the products of the allele detection technique employed or the material to be tested. Further, the controls may be positive or negative controls.
  • the control sample may comprise DNA fragments of an appropriate size.
  • the control sample may comprise a sample of a mutant protein.
  • the control sample comprises the material to be tested.
  • the controls may be a sample of genomic DNA or a cloned portion of the IL-1 gene cluster.
  • the control sample is preferably a highly purified sample of genomic DNA.
  • the phrases "disruption of the gene” and “targeted disruption” or any similar phrase refers to the site specific interruption of a native DNA sequence so as to prevent expression of that gene in the cell as compared to the wild-type copy of the gene.
  • the interruption may be caused by deletions, insertions or modifications to the gene, or any combination thereof.
  • haplotype refers to a set of alleles that are inherited together as a group (are in linkage disequilibrium) at statistically significant levels (p corr ⁇ 0.05).
  • an IL-1 haplotype refers to a haplotype in the IL-1 loci.
  • An "IL-1 agonist” as used herein refers to an agent that mimics, upregulates (potentiates or supplements) or otherwise increases an IL-1 bioactivity or a bioactivity of a gene in an IL-1 biological pathway.
  • IL-1 agonists may act on any of a variety of different levels, including regulation of IL-1 gene expression at the promoter region, regulation of mRNA splicing mechanisms, stabilization of mRNA, phosphorylation of proteins for translation, conversion of proIL-1 to mature IL-1 and secretion of IL-1.
  • Agonists that increase IL-1 synthesis include: lipopolysaccharides, IL-IB, cAMP inducing agents, NficB activating agents, AP-1 activating agents, TNF- ⁇ , oxidized LDL, advanced glycosylation end products (AGE), sheer stress, hypoxia, hyperoxia, ischemia reperfusion injury, histamine, prostaglandin E 2 (PGE2), IL-2, IL-3, IL-12, granulocyte macrophage-colony stimulating factor (GM-CSF), monocyte colony stimulating factor (M-CSF), stem cell factor, platelet derived growth factor (PDGF), complement C5A, complement C5b9, fibrin degradation products, plasmin, thrombin, 9- hydroxyoctadecaenoic acid, 13-hydroxyoctadecaenoic acid, platelet activating factor (PAF), factor H, retinoic acid, uric acid, calcium pyrophosphate, polynucleosides,
  • HLA-DR HLA-DR
  • anti-IgM anti- CD3, phytohemagglutinin (CD2)
  • sCD23 phytohemagglutinin
  • ultraviolet B radiation gamma radiation
  • substance P substance P
  • isoproterenol methamphetamine and melatonin.
  • Agonists that stabilize IL-1 mRNA include bacterial endotoxin and IL-1.
  • Other agonists, that function by increasing the number of IL-1 type 1 receptors available, include IL-1, PKC activators, dexamethasone, IL-2, IL-4 and PGE2.
  • IL-1 signal transduction factors activated by IL-1 or utilized in an IL-1 signal transduction pathway
  • IL-1 signal transduction pathway e.g NFkB and AP-1, PI3 kinase, phospholipase A2, protein kinase C, JNK-1, 5-lipoxygenase, cyclooxygenase 2, tyrosine phosphorylation, iNOS pathway, Rac, Ras, TRAF.
  • Still other agonists increase the bioactivity of genes whose expression is induced by IL-1, including: IL-1, IL-lRa, TNF, IL-2, IL-3, IL-6, - IL-12, GM-CSF, G-CSF, TGF- ⁇ , fibrinogen, urokinase plasminogen inhibitor, Type 1 and type 2 plasminogen activator inhibitor, p-selectin (CD62), fibrinogen receptor, CD-I 1/CD18, protease nexin-1, CD44, Matrix metalloproteinase-1 (MMP-l),MMP-3, Elastase, Collagenases, Tissue inhibitor of metalloproteinases-1 (TIMP-1), Collagen,
  • IL-1 antagonist refers to an agent that downregulates or otherwise decreases an IL-1 bioactivity.
  • IL-1 antagonists may act on any of a variety of different levels, including regulation of IL-1 gene expression at the promoter region, regulation of mRNA splicing mechanisms, stabilization of mRNA, phosphorylation of proteins for translation, conversion of proIL-1 to mature IL-1 and secretion of IL-1.
  • Antagonists of IL-1 production include: corticosteroids, lipoxygenase inhibitors, cyclooxygenase inhibitors, ⁇ -interferon, IL-4, IL-10, IL-13, transforming growth factor ⁇ (TGF- ⁇ ), ACE inhibitors, n-3 polyunsaturated fatty acids, antioxidants and lipid reducing agents.
  • Antagonists that destabilize IL-lmRNA include agents that promote deadenylation.
  • Antagonists that inhibit or prevent phosphorylation of IL-1 proteins for translation include pyridinyl-imadazole compounds, such as tebufelone and compounds that inhibit microtubule formation (e.g. colchicine, vinblastine and vincristine).
  • Antagonists that inhibit or prevent the conversion of proIL-1 to mature IL-1 include interleukin converting enzyme (ICE) inhibitors, such as ⁇ lCE isoforms, ICE ⁇ , ⁇ , and ⁇ isoform antibodies, CXrm-A, transcript X, endogenous tetrapeptide competitive substrate inhibitor, trypsin, elastase, chymotrypsin, chymase, and other nonspecific proteases.
  • Antagonists that prevent or inhibit the scretion of IL-1 include agents that block anion transport.
  • Antagonists that interefere with IL-1 receptor interactions include: agents that inhibit glycosylation of the type I IL-1 receptor, antisense oligonucleotides against IL-1RI, antibodies to IL-1RI and antisense oligonucleotides against IL-lRacP.
  • Other antagonists, that function by decreasing the number of IL-1 type 1 receptors available include TGF- ⁇ , COX inhibitors, factors that increase IL-1 type II receptors, dexamethasone, PGE2, IL-1 and IL-4.
  • IL-1 signal transduction factors activated by IL-1 or utilized in an IL-1 signal transduction pathway
  • signal transduction factors e.g NFkB and AP-1, PI3 kinase, phospholipase A2, protein kinase C, JNK-1, 5-lipoxygenase, cyclooxygenase 2, tyrosine phosphorylation, iNOS pathway, Rac, Ras, TRAF.
  • Still other antagonists interfere with the bioactivity of genes whose expression is induced by IL-1, including: IL-1, IL-lRa, TNF, IL-2, IL-3, IL-6,
  • IL-12 IL-12, GM-CSF, G-CSF, TGF- ⁇ , fibrinogen, urokinase plasminogen inhibitor, Type 1 and type 2 plasminogen activator inhibitor, p-selectin (CD62), fibrinogen receptor, CD-I 1/CD18, protease nexin-1, CD44, Matrix metalloproteinase-1 (MMP-l),MMP-3, Elastase, Collagenases, Tissue inhibitor of metalloproteinases-1 (TIMP-l),Collagen, Triglyceride increasing Apo Oil, Apolipoprotein, ICAM-1, ELAM-1, VCAM-1,
  • L-selectin Decorin, stem cell factor, Leukemia inhibiting factor, IFNa,b,g, L-8, IL-2 receptor, IL-3 receptor, IL-5 receptor, c-kit receptor, GM-CSF receptor, Cyclooxygenase-2 (COX-2), Type 2 phospholipase A2, Inducible nitric oxide synthase (iNOS), Endothelin-1,3, Gamma glutamyl transferase, Mn superoxide dismutase, C- reactive protein, Fibrinogen, Serum amyloid A, Metallothioneins, Ceruloplasmin,
  • Lysozyme Xanthine dehydrogenase, Xanthine oxidase, Platelet derived growth factor A chain (PDGF), Melanoma growth stimulatory activity (gro-a,b,g), Insulin- like growth factor- 1 (IGF-1), Activin A, Pro-opiomelanocortiotropin, corticotropin releasing factor, B amyloid precursor, Basement membrane protein-40, Laminin Bl and B2, Constitutive heat shock protein p70, P42 mitogen, activating protein kinase, ornithine decarboxylase, heme oxygenase and G-protein a subunit).
  • Other preferred antagonists include: hymenialdisine, herbimycines (e.g.
  • CK-103A herbamycin A
  • CK-103A and its derivatives e.g. 4,6-dihydropyridazino[4,5-c]pyridazin-5 (lH)-one
  • CK-119 e.g. 4,6-dihydropyridazino[4,5-c]pyridazin-5 (lH)-one
  • CK-119 e.g. 4,6-dihydropyridazino[4,5-c]pyridazin-5 (lH)-one
  • CK-119 e.g. 4,6-dihydropyridazino[4,5-c]pyridazin-5 (lH)-one
  • CK-119 e.g. 4,6-dihydropyridazino[4,5-c]pyridazin-5 (lH)-one
  • CK-119 e.g. 4,6-dihydropyridazino[4,5-c]pyridazin-5
  • Steroid derivatives Steroid derivatives, glucocorticoids, Quercetin, Theophylline, NO-synthetase inhibitors, RWJ 68354, Euclyptol (1.8-cineole), Magnosalin, N-Acetylcysteine, Alpha-Melatonin-Stimulating Hormone (a-MSH), Triclosan (2,4,4 '-trichloro-2'-hydroxyldiphenyl ether), Prostaglandin E2 and 4-aminopyridine Ethacrynic acid and 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid (DIDS), Glucose, Lipophosphoglycan, aspirin, Catabolism-blocking agents, Diacerhein, Thiol-modulating agents, Zinc, Mo ⁇ hine, Leukotriene biosynthesis inhibitors (e.g.
  • Platelet-activating factor receptor antagonists e.g. WEB 2086
  • Amiodarone e.g. Tranilast
  • S-methyl-L-thiocitrulline e.g.S-adrenoreceptor agonists
  • Beta-adrenoreceptor agonists e.g.Procaterol, Clenbuterol, Fenoterol, Terbutaline, Hyaluronic acid
  • anti-TNF-a antibodies anti-IL-la autoantibodies
  • IL-1 receptor antagonist e.g.Procaterol, Clenbuterol, Fenoterol, Terbutaline, Hyaluronic acid, anti-TNF-a antibodies, anti-IL-la autoantibodies, IL-1 receptor antagonist, IL-1R- associated kinase, soluble TNF receptors and antiinflammatory cytokines (e.g IL-4, IL-13, IL-10, IL-6, TGF-b, angiotensin II, Soluble IL-1 type II receptor, So
  • Val-Thr-Asp-Phe-Tyr-Phe Interferon alpha2b, Interferon beta, IL-1 -beta analogues (e.g. IL-1-beta tripeptide: Lys-D-Pro-Thr), glycosylated IL-1-alpha, and IL- Ira peptides.
  • IL-1 -beta analogues e.g. IL-1-beta tripeptide: Lys-D-Pro-Thr
  • glycosylated IL-1-alpha e.g. IL-1-beta tripeptide: Lys-D-Pro-Thr
  • IL- Ira peptides e.g. IL-1-beta tripeptide: Lys-D-Pro-Thr
  • IL-1 gene cluster and "IL-1 loci” as used herein include all the nucleic acid at or near the 2ql3 region of chromosome 2, including at least the IL- 1A, IL-IB and IL-IRN genes and any other linked sequences.
  • IL-1A refers to the genes coding for IL-l , IL-l ⁇ , and IL-1 receptor antagonist, respectively.
  • the gene accession number for IL-1 A, IL-IB, and IL-IRN are X03833, X04500, and X64532, respectively.
  • IL-1 functional mutation refers to a mutation within the IL-1 gene cluster that results in an altered phenotype (i.e. affects the function of an IL-1 gene or protein). Examples include: IL-lA(+4845) allele 2, IL-IB (+3954) allele 2, IL-IB (- 511) allele 1 and IL-IRN (+2018) allele 1.
  • IL-1X (Z) allele Y refers to a particular allelic form, designated Y, occurring at an IL-1 locus polymo ⁇ hic site in gene X, wherein X is IL-1 A, B, or RN or some other gene in the IL-1 gene loci, and positioned at or near nucleotide Z, wherein nucleotide Z is numbered relative to the major transcriptional start site, which is nucleotide +1, of the particular IL-1 gene X.
  • IL-1X allele (Z) refers to all alleles of an IL-1 polymo ⁇ hic site in gene X positioned at or near nucleotide Z.
  • IL-IRN (+2018) allele refers to alternative forms of the IL-IRN gene at marker +2018.
  • IL-IRN (+2018) allele 1 refers to a form of the IL-IRN gene which contains a cytosine (C) at position +2018 of the sense strand.
  • C cytosine
  • IL-IRN (+2018) allele 2 refers to a form of the IL-IRN gene which contains a thymine (T) at position +2018 of the plus strand.
  • IL-IRN (+2018) allele 2 refers to the homozygous IL-1 RN (+2018) allele 2 state.
  • IL- 1 RN (+2018) allele 1,1 refers to the homozygous IL- 1 RN
  • IL-IRN (+2018) allele 1 state refers to the heterozygous allele 1 and 2 state.
  • IL-1 related as used herein is meant to include all genes related to the human IL-1 locus genes on human chromosome 2 (2q 12-14). These include IL-1 genes of the human IL-1 gene cluster located at chromosome 2 (2q 13-14) which include: the
  • IL-1 A gene which encodes interleukin-1 ⁇ the IL-IB gene which encodes interleukin- l ⁇ , and the IL-IRN (or IL-lra) gene which encodes the interleukin-1 receptor antagonist.
  • these IL-1 related genes include the type I and type II human IL-1 receptor genes located on human chromosome 2 (2ql2) and their mouse homo logs located on mouse chromosome 1 at position 19.5 cM.
  • Interleukin-1 ⁇ , interleukin-1 ⁇ , and interleukin-1 RN are related in so much as they all bind to IL-1 type I receptors, however only interleukin-1 ⁇ and interleukin-1 ⁇ are agonist ligands which activate IL-1 type I receptors, while interleukin-1 RN is a naturally occurring antagonist ligand.
  • IL-1 is used in reference to a gene product or polypeptide, it is meant to refer to all gene products encoded by the interleukin-1 locus on human chromosome 2
  • IL-1 thus includes secreted polypeptides which promote an inflammatory response, such as IL-l ⁇ and IL-l ⁇ , as well as a secreted polypeptide which antagonize inflammatory responses, such as IL-1 receptor antagonist and the IL-1 type II (decoy) receptor.
  • IL-1 receptor refers to various cell membrane bound protein receptors capable of binding to and/or transducing a signal from IL-1 locus- encoded ligand.
  • the term applies to any of the proteins which are capable of binding interleukin-1 (IL-1) molecules and, in their native configuration as mammalian plasma membrane proteins, presumably play a role in transducing the signal provided by IL-1 to a cell.
  • IL-1 interleukin-1
  • the term includes analogs of native proteins with IL-1 -binding or signal transducing activity. Examples include the human and murine IL-1 receptors described in U.S. Patent No. 4,968,607.
  • IL-1 nucleic acid refers to a nucleic acid encoding an IL-1 protein.
  • IL-1 polypeptide and IL-1 protein are intended to encompass polypeptides comprising the amino acid sequence encoded by the IL-1 genomic DNA sequences shown in Figures 1, 2, and 3, or fragments thereof, and homologs thereof and include agonist and antagonist polypeptides.
  • Increased risk refers to a statistically higher frequency of occurrence of the disease or disorder in an individual in comparison to the frequency of occurrence of the disease or disorder in a population.
  • a factor identified to be associated with increased risk is termed a "risk factor.”
  • Carrying a particular polymo ⁇ hic allele is a risk factor for a particular cardiovascular disease, and is associated with an increased risk of the particular disease.
  • interact as used herein is meant to include detectable relationships or associations (e.g. biochemical interactions) between molecules, such as interactions between protein-protein, protein-nucleic acid, nucleic acid-nucleic acid and protein-small molecule or nucleic acid-small molecule in nature.
  • nucleic acids such as DNA
  • DNA or RNA refers to molecules separated from other DNAs, or RNAs, respectively, that are present in the natural source of the macromolecule.
  • an isolated nucleic acid encoding one of the subject IL-1 polypeptides preferably includes no more than 10 kilobases (kb) of nucleic acid sequence which naturally immediately flanks the IL-1 gene in genomic DNA, more preferably no more than 5kb of such naturally occurring flanking sequences, and most preferably less than 1.5kb of such naturally occurring flanking sequence.
  • isolated as used herein also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized.
  • isolated nucleic acid is meant to include nucleic acid fragments which are not naturally occurring as fragments and would not be found in the natural state.
  • isolated is also used herein to refer to polypeptides which are isolated from other cellular proteins and is meant to encompass both purified and recombinant polypeptides.
  • a “knock-in” transgenic animal refers to an animal that has had a modified gene introduced into its genome and the modified gene can be of exogenous or endogenous origin.
  • a “knock-out " transgenic animal refers to an animal in which there is partial or complete suppression of the expression of an endogenous gene (e.g, based on deletion of at least a portion of the gene, replacement of at least a portion of the gene with a second sequence, introduction of stop codons, the mutation of bases encoding critical amino acids, or the removal of an intron junction, etc.).
  • a “knock-out construct” refers to a nucleic acid sequence that can be used to decrease or suppress expression of a protein encoded by endogenous DNA sequences in a cell.
  • the knock-out construct is comprised of a gene, such as the IL-IRN gene, with a deletion in a critical portion of the gene so that active protein cannot be expressed therefrom.
  • a number of termination codons can be added to the native gene to cause early termination of the protein or an intron junction can be inactivated.
  • IL-IRN 57neo/ IL-IRN 3' where IL-1RN5' and IL-IRN 3', refer to genomic or cDNA sequences which are, respectively, upstream and downstream relative to a portion of the IL-IRN gene and where neo refers to a neomycin resistance gene.
  • a second selectable marker is added in a flanking position so that the gene can be represented as: IL-lRN/neo/IL-lRN/TK, where TK is a thymidine kinase gene which can be added to either the IL-1RN5' or the IL-1RN3' sequence of the preceding construct and which further can be selected against (i.e. is a negative selectable marker) in appropriate media.
  • TK is a thymidine kinase gene which can be added to either the IL-1RN5' or the IL-1RN3' sequence of the preceding construct and which further can be selected against (i.e. is a negative selectable marker) in appropriate media.
  • This two-marker construct allows the selection of homologous recombination events, which removes the flanking TK marker, from non-homologous recombination events which typically retain the TK sequences.
  • the gene deletion and/or replacement can be from the exons, introns, especially in
  • Linkage disequilibrium refers to co-inheritance of two alleles at frequencies greater than would be expected from the separate frequencies of occurrence of each allele in a given control population.
  • the expected frequency of occurrence of two alleles that are inherited independently is the frequency of the first allele multiplied by the frequency of the second allele. Alleles that co-occur at expected frequencies are said to be in "linkage disequilibrium”.
  • the cause of linkage disequilibrium is often unclear. It can be due to selection for certain allele combinations or to recent admixture of genetically heterogeneous populations.
  • an association of an allele (or group of linked alleles) with the disease gene is expected if the disease mutation occurred in the recent - past, so that sufficient time has not elapsed for equilibrium to be achieved through recombination events in the specific chromosomal region.
  • allelic patterns that are comprised of more than one allele a first allelic pattern is in linkage disequilibrium with a second allelic pattern if all the alleles that comprise the first allelic pattern are in linkage disequilibrium with at least one of the alleles of the second allelic pattern.
  • linkage disequilibrium is that which occurs between the alleles at the IL-IRN (+2018) and IL-IRN (VNTR) polymo ⁇ hic sites.
  • the two alleles at IL- IRN (+2018) are 100% in linkage disequilibrium with the two most frequent alleles of IL-IRN (VNTR), which are allele 1 and allele 2.
  • the term "marker” refers to a sequence in the genome that is known to vary among individuals.
  • the IL-IRN gene has a marker that consists of a variable number of tandem repeats (VNTR).
  • Modulate refers to the ability of a substance to regulate bioactivity.
  • an agonist or antagonist can modulate bioactivity for example by agonizing or antagonizing an IL-1 synthesis, receptor interaction, or IL-1 mediated signal transduction mechanism.
  • a “mutated gene” or “mutation” or “functional mutation” refers to an allelic form of a gene, which is capable of altering the phenotype of a subject having the mutated gene relative to a subject which does not have the mutated gene.
  • the altered phenotype caused by a mutation can be corrected or compensated for by certain agents. If a subject must be homozygous for this mutation to have an altered phenotype, the mutation is said to be recessive. If one copy of the mutated gene is sufficient to alter the phenotype of the subject, the mutation is said to be dominant. If a subject has one copy of the mutated gene and has a phenotype that is intermediate between that of a homozygous and that of a heterozygous subject (for that gene), the mutation is said to be co-dominant.
  • a “non-human animal” of the invention includes mammals such as rodents, non-human primates, sheep, dogs, cows, goats, etc. amphibians, such as members of the Xenopus genus, and transgenic avians (e.g. chickens, birds, etc.).
  • the term “chimeric animal” is used herein to refer to animals in which the recombinant gene is found, or in which the recombinant gene is expressed in some but not all cells of the animal.
  • tissue-specific chimeric animal indicates that one of the recombinant IL-1 genes is present and/or expressed or disrupted in some tissues but not- others.
  • non-human mammal refers to any member of the class Mammalia, except for humans.
  • nucleic acid refers to polynucleotides or oligonucleotides such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA).
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • the term should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs (e.g. peptide nucleic acids) and as applicable to the embodiment being described, single (sense or antisense) and double-stranded polynucleotides.
  • polymo ⁇ hism refers to the coexistence of more than one form of a gene or portion (e.g., allelic variant) thereof.
  • a specific genetic sequence at a polymo ⁇ hic region of a gene is an allele.
  • a polymo ⁇ hic region can be a single nucleotide, the identity of which differs in different alleles.
  • a polymo ⁇ hic region can also be several nucleotides long.
  • propensity to disease means that certain alleles are hereby discovered to be associated with or predictive of a subject's incidence of developing a particular disease (herein, a cardiovascular disease).
  • the alleles are thus over-represented in frequency in individuals with disease as compared to healthy individuals. Thus, these alleles can be used to predict disease even in pre-symptomatic or pre-diseased individuals.
  • These alleles are understood to relate to the disorder underlying the disease.
  • a "risk factor” is a factor identified to be associated with an increased risk of developing sepsis or for prognosticating on the rapidity and/or ultimate progression of sepsis in a subject.
  • Sepsis refers to those biochemical and physiological responses that have been identified as systemic manifestations of uncontrolled infection. Sepsis is a nonspecific response of the host to any of a variety of factors, including: 1) disseminated microorganisms or their biochemical products from a nidus of infection, 2) microorganisms or their biochemical products without an infected primary source and 3) local inflammatory mediators from an infectious source or from a sterile site without the participation of microorganisms or their biochemical products.
  • Organisms commonly involved in provoking sepsis include Gram positive bacteria, Gram negative bacteria and fungi.
  • strep and staph species can produce sepsis either from a local focus of infection (a pneumonia or a meningitis, for example) or from a systemic insult (as in toxic shock syndrome).
  • sepsis is a well-known concomitant of a genitourinary infection, so- called urosepsis, where the infecting agent is usually a Gram negative organism.
  • urosepsis where the infecting agent is usually a Gram negative organism.
  • Neisseria meningiditis may occasion a fulminant, rapidly progressive sepsis accompanying a meningitis.
  • Gram negative organisms commonly produce endotoxin, understood to be bacterial wall lipopolysaccharides that can mediate the responses of sepsis.
  • the physiological and biochemical responses characterizing sepsis include: 1) hyperdynamic cardiac parameters, 2) a reduced peripheral vascular resistance, 3) a narrowed arteriovenous oxygen difference and 4) elevated serum lactate levels.
  • the stages of sepsis are understood to be similar to the stages for other types of shock. Shock may result from any serious assault on the body's homeostatic mechanisms, whether from hemorrhage, trauma, burn injury, myocardial infarction or sepsis. Shock consists of widespread hypoperfusion at the tissue level, due to reduction of blood volume, reduction of cardiac output or redistribution of effective circulation.
  • Stages of sepsis similarly have early reversible changes and later irreversible changes.
  • a staging system has been established to evaluate the extent of the patient's septic deterioration.
  • Siegel's Stage A compensatory mechanisms are activated and vital organ perfusion is maintained.
  • Neonatal infections refers to the set of septic responses, as defined herein, manifest in the newborn infant or the fetus. Neonatal infections may be characterized according to their timing: early neonatal infections tend to occur within several days of birth, while late onset neonatal sepsis becomes manifest after a latent period. Infections with Group B strep or with Escherichia coli tend to develop symptoms including sepsis, pneumonia and/or meningitis within four or five days of birth.
  • Infections with Listeria or Candida are later in onset. Infections in infants are termed neonatal infections through the first few months of life. Later infections in infants under age two may also give rise to sepsis.
  • the evaluation of a high fever in this population typically requires vigorous diagnostic interventions to identify a source. A fever of unknown origin (where no source can be found) may be treated aggressively with antibiotics until the possibility of bacteremia can be conclusively ruled out with blood cultures.
  • Small molecule as used herein, is meant to refer to a composition, which has a molecular weight of less than about 5kD and most preferably less than about 4kD.
  • Small molecules can be nucleic acids, peptides, peptidomimetics, carbohydrates, lipids or other organic or inorganic molecules.
  • the term “specifically hybridizes” or “specifically detects” refers to the ability of a nucleic acid molecule to hybridize to at least approximately 6 consecutive nucleotides of a sample nucleic acid.
  • Transcriptional regulatory sequence is a generic term used throughout the specification to refer to DNA sequences, such as initiation signals, enhancers, and promoters, which induce or control transcription of protein coding sequences with which they are operably linked.
  • transgene means a nucleic acid sequence (encoding, e.g., one of the IL-1 polypeptides, or an antisense transcript thereto) which has been introduced into a cell.
  • a transgene could be partly or entirely heterologous, i.e., foreign, to the transgenic animal or cell into which it is introduced, or, is homologous to an endogenous gene of the transgenic animal or cell into which it is introduced, but which is designed to be inserted, or is inserted, into the animal's genome in such a way as to alter the genome of the cell into which it is inserted (e.g., it is inserted at a location which differs from that of the natural gene or its insertion results in a knockout).
  • a transgene can also be present in a cell in the form of an episome.
  • a transgene can include one or more transcriptional regulatory sequences and any other nucleic acid, such as introns, that may be necessary for optimal expression of a selected nucleic acid.
  • a "transgenic animal” refers to any animal, preferably a non-human mammal, bird or an amphibian, in which one or more of the cells of the animal contain heterologous nucleic acid introduced by way of human intervention, such as by transgenic techniques well known in the art.
  • the nucleic acid is introduced into the cell, directly or indirectly by introduction into a precursor of the cell, by way of deliberate genetic manipulation, such as by microinjection or by infection with a recombinant virus.
  • the term genetic manipulation does not include classical cross-breeding, or in vitro fertilization, but rather is directed to the introduction of a recombinant DNA molecule. This molecule may be integrated within a chromosome, or it may be extrachromosomally replicating DNA.
  • transgene causes cells to express a recombinant form of one of an IL-1 polypeptide, e.g. either agonistic or antagonistic forms.
  • transgenic animals in which the recombinant gene is silent are also contemplated, as for example, the FLP or CRE recombinase dependent constructs described below.
  • transgenic animal also includes those recombinant animals in which gene disruption of one or more genes is caused by human intervention, including both recombination and antisense techniques. The term is intended to include all progeny generations. Thus, the founder animal and all FI, F2, F3, and so on, progeny thereof are included.
  • vector refers to a nucleic acid molecule, which is capable of transporting another nucleic acid to which it has been linked.
  • One type of preferred vector is an episome, i.e., a nucleic acid capable of extra-chromosomal replication.
  • Preferred vectors are those capable of autonomous replication and/or expression of nucleic acids to which they are linked.
  • Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors”. O 00/37679
  • expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids" which refer generally to circular double stranded DNA loops which, in their vector form are not bound to the chromosome.
  • plasmid and “vector” are used interchangeably as the plasmid is the most commonly used form of vector.
  • the invention is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto.
  • wild-type allele refers to an allele of a gene which, when present in two copies in a subject results in a wild-type phenotype. There can be several different wild-type alleles of a specific gene, since certain nucleotide changes in a gene may not affect the phenotype of a subject having two copies of the gene with the nucleotide changes.
  • the present invention provides methods and kits for determining whether a subject has or is likely to develop sepsis and/or the likely rate or extent of progression of the septicemia.
  • Applicants have determined identified the following three haplotype patterns defined by four polymo ⁇ hic loci in the IL-1 gene cluster as shown below.
  • the "Pattern 2 (44112332) haplotype” comprises at least the following markers: allele 4 of the 222/223 marker of IL-1 A allele 4 of the gz5/gz6 marker of IL-1 A allele 2 of the +2018 marker of IL-IRN allele 1 of the +4845 marker of IL-1 A
  • pattern 2 includes markers that are in linkage disequilibrium with the markers set forth above.
  • allele 2 of the IL-IRN (+2018) polymo ⁇ hism (Clay et al. (1996) Hum Genet 97: 723-26), also referred to as exon 2 (8006) (GenBank:X64532 at 8006) is known to be in linkage disequilibrium with allele 2 of the IL-IRN (VNTR) polymo ⁇ hic locus, which in turn is a part of the 44112332 human haplotype.
  • allele 2 of the IL-IRN (+2018) locus i.e.
  • the IL- IRN exon lie (1812) polymo ⁇ hism (GenBank:X77090 at 1812); the IL-IRN exon lie (1868) polymo ⁇ hism (GenBank:X77090 at 1868); and the IL-IRN exon lie (1887) polymo ⁇ hism (GenBank:X77090 at 1887).
  • the Pic (1731) polymo ⁇ hism (GenBank:X77090 at 1731)
  • VNTR IL-IRN
  • the allele 2 sequence variant has been determined to be in linkage disequilibrium with allele 2 of the IL-IRN (VNTR) locus (Clay et al. (1996) Hum Genet 97: 723-26).
  • the pattern 2 haplotype appears to be associated with decreased levels of IL-1 receptor antagonist.
  • allelic patterns In addition to the allelic patterns described above, as described herein, one of skill in the art can readily identify other alleles (including polymo ⁇ hisms and mutations) that are in linkage disequilibrium with a pattern 2 marker. For example, one could genotype a large population and perform statistical analysis to determine which alleles appear more commonly together than expected. Preferably the group is chosen to be comprised of genetically related individuals. Genetically related individuals include individuals from the same race, the same ethnic group, or even the same family. As the degree of genetic relatedness between a control group and a test group increases, so does the predictive value of polymo ⁇ hic alleles which are ever more distantly linked to a disease-causing allele.
  • race-specific, ethnic-specific, and even family-specific diagnostic genotyping assays can be developed to allow for the detection of disease alleles which arose at ever more recent times in human evolution, e.g., after divergence of the major human races, after the separation of human populations into distinct ethnic groups, and even within the recent history of a particular family line.
  • Linkage disequilibrium between two polymo ⁇ hic markers or between one polymo ⁇ hic marker and a disease-causing mutation is a meta-stable state. Absent selective pressure or the sporadic linked reoccurrence of the underlying mutational events, the polymo ⁇ hisms will eventually become disassociated by chromosomal recombination events and will thereby reach linkage equilibrium through the course of human evolution. Thus, the likelihood of finding a polymo ⁇ hic allele in linkage disequilibrium with a disease or condition may increase with changes in at least two factors: decreasing physical distance between the polymo ⁇ hic marker and the disease- causing mutation, and decreasing number of meiotic generations available for the dissociation of the linked pair.
  • the oligonucleotides present in one embodiment of a kit according to the present invention may be used for amplification of the region of interest or for direct allele specific oligonucleotide (ASO) hybridization to the markers in question.
  • ASO allele specific oligonucleotide
  • the oligonucleotides may either flank the marker of interest (as required for PCR amplification) or directly overlap the marker (as in ASO hybridization).
  • primers for use in the above described detection methods include:
  • IL-1 A (+4845) polymo ⁇ hic locus which can be used to amplify and type the human IL-1 A (+4845) polymo ⁇ hic locus.
  • Appropriate probes may be designed to hybridize to a specific gene of the- IL-1 locus, such as IL-1 A, IL-IB or IL-IRN or a related gene. Alternatively, these probes may inco ⁇ orate other regions of the relevant genomic locus, including intergenic sequences. Indeed the IL-1 region of human chromosome 2 spans some 400,000 base pairs and, assuming an average of one single nucleotide polymo ⁇ hism every 1,000 base pairs, includes some 400 SNPs loci alone. Yet other polymo ⁇ hisms available for use with the immediate invention are obtainable from various public sources.
  • the human genome database collects intragenic SNPs, is searchable by sequence and currently contains approximately 2,700 entries (http://hgbase.interactiva.de). Also available is a human polymo ⁇ hism database maintained by the Massachusetts Institute of Technology (MIT SNP database).
  • IL-1 locus genes are flanked by a centromere proximal polymo ⁇ hic marker designated microsatellite marker AFM220ze3 at 127.4 cM (centiMorgans) (see GenBank Ace. No. Z17008) and a distal polymo ⁇ hic marker designated microsatellite anchor marker AFM087xal at 127.9 cM (see GenBank Ace. No. Z16545).
  • These human polymo ⁇ hic loci are both CA dinucleotide repeat microsatellite polymo ⁇ hisms, and, as such, show a high degree of heterozygosity in human populations.
  • one allele of AFM220ze3 generates a 211 bp PCR amplification product with a 5' primer of the sequence
  • TGTACCTAAGCCCACCCTTTAGAGC (SEQ ID No.l 1) and a 3' primer of the sequence TGGCCTCCAGAAACCTCCAA (SEQ ID No.12 ).
  • one allele of AFM087xal generates a 177 bp PCR amplification product with a 5' primer of the sequence GCTGATATTCTGGTGGGAAA (SEQ ID No.13) and a 3' primer of the sequence GGCAAGAGCAAAACTCTGTC (SEQ ID No. 14 ).
  • Equivalent primers corresponding to unique sequences occurring 5' and 3' to these human chromosome 2 CA dinucleotide repeat polymo ⁇ hisms will be apparent to one of skill in the art.
  • Reasonable equivalent primers include those which hybridize within about 1 kb of the designated primer, and which further are anywhere from about 17 bp to about 27 bp in length.
  • T melt [2 x (# of A or T) + 4 x (# of G or C)].
  • a number of other human polymo ⁇ hic loci occur between these two CA . dinucleotide repeat polymo ⁇ hisms and provide additional targets for determination of a cardio-vascular disorder prognostic allele in a family or other group of genetically related individuals.
  • nucleotide segments of the invention may be used for their ability to selectively form duplex molecules with complementary stretches of human chromosome 2 q 12-13 or cDNAs from that region or to provide primers for amplification of DNA or cDNA from this region.
  • the design of appropriate probes for this pu ⁇ ose requires consideration of a number of factors. For example, fragments having a length of between 10, 15, or 18 nucleotides to about 20, or to about 30 nucleotides, will find particular utility. Longer sequences, e.g., 40, 50, 80, 90, 100, even up to full length, are even more preferred for certain embodiments.
  • oligonucleotides of at least about 18 to 20 nucleotides are well accepted by those of skill in the art as sufficient to allow sufficiently specific hybridization so as to be useful as a molecular probe.
  • relatively stringent conditions For applications requiring high selectivity, one will typically desire to employ relatively stringent conditions to form the hybrids.
  • relatively low salt and/or high temperature conditions such as provided by 0.02 M-0.15M NaCl at temperatures of about 50 ° C to about 70° C. Such selective conditions may tolerate little, if any, mismatch between the probe and the template or target strand.
  • the method comprises genotyping a nucleic acid sample obtained from the subject to determine at least one allele of an IL-1 gene that leads to a dysregulated inflammatory response.
  • an allele can be detected, for example, by determining the transcription rate or mRNA and/or protein level of an IL-1 gene or protein, such as by Northern blot analysis, reverse transcription-polymerase chain reaction (RT-PCR), in situ hybridization, immunoprecipitation, Western blot hybridization, or immunohistochemistry.
  • cells are obtained from a subject and the IL-1 protein or mRNA level is determined and compared to the level of IL-1 protein or mRNA level in a subject that is not susceptible to the development of sepsis or is not likely to progress rapidly into septic shock.
  • the method comprises measuring at least one activity of an IL-1 protein. For example, the constant of affinity of an IL-1 a or ⁇ protein of a subject with a receptor can be determined. The results obtained can then be compared with results from the same analysis performed on a subject, who is known to be susceptible to sepsis or is known to not be susceptible to the development of sepsis.
  • the method is characterized as comprising genotyping a nucleic acid sample obtained from the subject to determine at least one allele of an IL-1 genetic pattern that leads to a dysregulated inflammatory response.
  • a nucleic acid composition comprising a nucleic acid probe including a region of nucleotide sequence which is capable of hybridizing to a sense or antisense sequence of at least one allele of an IL-1 genetic pattern that leads to a dysregulated inflammatory response.
  • the nucleic acid can be rendered accessible for hybridization, the probe contacted with the nucleic acid of the sample, and the hybridization of the probe to the sample nucleic acid detected.
  • Such technique can be used to detect alterations or allelic variants at either the genomic or mRNA level as well as to determine mRNA transcript levels.
  • a preferred detection method is allele specific hybridization using probes overlapping a region of at least one allele of an IL-1 genetic pattern that leads to a dysregulated inflammatory response and having about 5, 10, 20, 25, or 30 nucleotides around the mutation or polymo ⁇ hic region.
  • several probes capable of hybridizing specifically to other allelic variants involved in sepsis are attached to a solid phase support, e.g., a "chip" (which can hold up to about 250,000 oligonucleotides).
  • Oligonucleotides can be bound to a solid support by a variety of processes, including lithography. Mutation detection analysis using these chips comprising oligonucleotides, also termed "DNA probe arrays" is described e.g., in
  • a chip comprises all the allelic variants of at least one polymo ⁇ hic region of a gene.
  • the solid phase support is then contacted with a test nucleic acid and hybridization to the specific probes is detected. Accordingly, the identity of numerous allelic variants of one or more genes can be identified in a simple hybridization experiment.
  • Amplification techniques are known to those of skill in the art and include, but are not limited to cloning, polymerase chain reaction (PCR), polymerase chain reaction of specific alleles (ASA), ligase chain reaction (LCR), nested polymerase chain reaction, self sustained sequence replication (Guatelli, J.C. et al., 1990, Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh, D.Y. et al, 1989, Proc. Natl. Acad. Sci. USA 86:1173-1177), and Q-Beta Replicase (Lizardi, P.M. et al., 1988, Bio/Technology 6:1197).
  • Amplification products may be assayed in a variety of ways, including size analysis, restriction digestion followed by size analysis, detecting specific tagged oligonucleotide primers in the reaction products, allele-specific oligonucleotide (ASO) hybridization, allele specific 5' exonuclease detection, sequencing, hybridization, and the like.
  • ASO allele-specific oligonucleotide
  • PCR based detection means can include multiplex amplification of a plurality of markers simultaneously. For example, it is well known in the art to select
  • PCR primers to generate PCR products that do not overlap in size and can be analyzed simultaneously.
  • hybridization based detection means allow the differential detection of multiple PCR products in a sample.
  • Other techniques are known in the art to allow multiplex analyses of a plurality of markers.
  • the method includes the steps of (i) collecting a sample of cells from a patient, (ii) isolating nucleic acid (e.g., genomic, mRNA or both) from the cells of the sample, (iii) contacting the nucleic acid sample with one or more primers which specifically hybridize 5' and 3' to at least one allele of an IL-1 genetic pattern that leads to a dysregulated inflammatory response under conditions such that hybridization and amplification of the allele occurs, and (iv) detecting the amplification product.
  • nucleic acid e.g., genomic, mRNA or both
  • the allele of an IL-1 genetic pattern that leads to a dysregulated inflammatory response is identified by alterations in restriction enzyme cleavage patterns.
  • sample and control DNA is isolated, amplified (optionally), digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis.
  • any of a variety of sequencing reactions known in the art can be used to directly sequence the allele.
  • Exemplary sequencing reactions include those based on techniques developed by Maxim and Gilbert (Proc. Natl Acad Sci USA (1977) 74:560) or Sanger (Sanger et al (1977) Proc. Nat. Acad. Sci 74:5463).
  • any of a variety of automated sequencing procedures may be utilized when performing the subject assays (Biotechniques (1995) 19:448), including sequencing by mass spectrometry (see, for example PCT publication WO 94/16101; Cohen et al. (1996) Adv Chromatogr 36:127-162; and Griffin et al.
  • protection from cleavage agents can be used to detect mismatched bases in RNA/RNA or RNA/DNA or DNA DNA heteroduplexes (Myers, et al. (1985) Science 230:1242).
  • cleavage agents such as a nuclease, hydroxylamine or osmium tetroxide and with piperidine
  • cleavage agents such as a nuclease, hydroxylamine or osmium tetroxide and with piperidine
  • RNA/DNA duplexes can be treated with RNase and DNA/DNA hybrids treated with SI nuclease to enzymatically digest the mismatched regions.
  • either DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium tetroxide and with piperidine in order to digest mismatched regions. After digestion of the mismatched regions, the resulting material is then separated by size on denaturing polyacrylamide gels to determine the site of mutation. See, for example, Cotton et al (1988) Proc. Natl Acad Sci USA 85:4397; Saleeba et al (1992) Methods Enzymol. 217:286-295.
  • control DNA or RNA can be labeled for detection.
  • the mismatch cleavage reaction employs one or more proteins that recognize mismatched base pairs in double-stranded DNA (so called "DNA mismatch repair" enzymes).
  • DNA mismatch repair enzymes
  • the mutY enzyme of E. coli cleaves A at G/A mismatches and the thymidine DNA glycosylase from HeLa cells cleaves T at G/T mismatches (Hsu et al. (1994) Carcinogenesis 15:1657-1662).
  • a probe based on IL-1 ⁇ allele 1 (+6912) is hybridized to a cDNA or other DNA product from a test cell(s).
  • duplex is treated with a DNA mismatch repair enzyme, and the cleavage products, if any, can be detected from electrophoresis protocols or the like. See, for example, U.S. Patent No. 5,459,039.
  • alterations in electrophoretic mobility will be used to identify the allele.
  • single strand conformation polymo ⁇ hism may be used to detect differences in electrophoretic mobility between mutant and wild type nucleic acids (Orita et al. (1989) Proc Natl. Acad. Sci USA 86:2766, see also Cotton (1993) Mutat Res 285:125-144; and Hayashi (1992) Genet Anal Tech Appl 9:73-79).
  • Single-stranded DNA fragments of the sample and control allele are denatured and allowed to renature.
  • the secondary structure of single-stranded nucleic acids varies according to sequence, the resulting alteration in electrophoretic mobility enables the detection of even a single base change.
  • the DNA fragments may be labeled or detected with labeled probes.
  • the sensitivity of the assay may be enhanced by using RNA (rather than DNA), in which the secondary structure is more sensitive to a change in sequence.
  • the subject method utilizes heteroduplex analysis to separate double stranded heteroduplex molecules on the basis of changes in electrophoretic mobility (Keen et al. (1991) Trends Genet 7:5).
  • the movement of alleles in polyacrylamide gels containing a gradient of denaturant is assayed using denaturing gradient gel electrophoresis (DGGE) (Myers et al (1985) Nature 313 :495).
  • DGGE denaturing gradient gel electrophoresis
  • DNA will be modified to insure that it does not completely denature, for example by adding a GC clamp of approximately 40 bp of high-melting GC-rich DNA by PCR.
  • a temperature gradient is used in place of a denaturing agent gradient to identify differences in the mobility of control and sample DNA (Rosenbaum and Reissner (1987) Biophys Chem 265:12753).
  • oligonucleotide primers may be prepared in which the known mutation or nucleotide difference (e.g., in allelic variants) is placed centrally and then hybridized to target DNA under conditions which permit hybridization only if a perfect match is found (Saiki et al. (1986) Nature 324:163); Saiki et al (1989) Proc. Natl Acad. Sci USA 86:6230).
  • Such allele specific oligonucleotide hybridization techniques may be used to test one mutation or polymo ⁇ hic region per reaction when oligonucleotides are hybridized to PCR amplified target DNA or a number of different mutations or polymo ⁇ hic regions when the oligonucleotides are attached to the hybridizing membrane and hybridized with labelled target DNA.
  • Oligonucleotides used as primers for specific amplification may carry the mutation or polymo ⁇ hic region of interest in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al (1989) Nucleic Acids Res. 17:2437- 2448) or at the extreme 3' end of one primer where, under appropriate conditions, mismatch can prevent, or reduce polymerase extension (Prossner (1993) T ⁇ btech 11:238.
  • amplification may also be performed using Taq ligase for amplification (Barany (1991) Proc. Natl. Acad. Sci USA 88:189). In such cases, ligation will occur only if there is a perfect match at the 3' end of the 5' sequence making it possible to detect the presence of a known mutation at a specific site by looking for the presence or absence of amplification.
  • identification of the allelic variant is carried out using an oligonucleotide ligation assay (OLA), as described, e.g., in U.S. Pat. No. 4,998,617 and in Landegren, U. et al., Science 241 :1077-1080 (1988).
  • OLA oligonucleotide ligation assay
  • the OLA protocol uses two oligonucleotides which are designed to be capable of hybridizing to abutting sequences of a single strand of a target.
  • One of the oligonucleotides is linked to a separation marker, e.g,. biotinylated, and the other is detectably labeled.
  • oligonucleotides will hybridize such that their termini abut, and create a ligation substrate. Ligation then permits the labeled oligonucleotide to be recovered using avidin, or another biotin ligand.
  • Nickerson, D. A. et al. have described a nucleic acid detection assay that combines attributes of PCR and OLA (Nickerson, D. A. et al., Proc. Natl. Acad. Sci. (U.S.A.) 87:8923-8927 (1990). In this method, PCR is used to achieve the exponential amplification of target DNA, which is then detected using OLA.
  • U.S. Patent No. 5,593,826 discloses an OLA using an oligonucleotide having 3 '-amino group and a 5 '-phosphorylated oligonucleotide to form a conjugate having a phosphoramidate linkage.
  • OLA OLA combined with PCR permits typing of two alleles in a single microtiter well. By marking each of the allele-specific primers with a unique hapten, i.e.
  • each OLA reaction can be detected by using hapten specific antibodies that are labeled with different enzyme reporters, alkaline phosphatase or horseradish peroxidase.
  • This system permits the detection of the two alleles using a high throughput format that leads to the production of two different colors.
  • Several methods have been developed to facilitate analysis of single nucleotide polymo ⁇ hisms.
  • the single base polymo ⁇ hism can be detected by using a specialized exonuclease-resistant nucleotide, as disclosed, e.g., in Mundy, C. R. (U.S. Pat. No.4,656,127).
  • a primer complementary to the allelic sequence immediately 3' to the polymo ⁇ hic site is permitted to hybridize to a target molecule obtained from a particular animal or human. If the polymo ⁇ hic site on the target molecule contains a nucleotide that is complementary to the particular exonuclease-resistant nucleotide derivative present, then that derivative will be inco ⁇ orated onto the end of the hybridized primer. Such inco ⁇ oration renders the primer resistant to exonuclease, and thereby permits its detection.
  • a solution-based method is used for determining the identity of the nucleotide of a polymo ⁇ hic site.
  • Cohen, D. et al. (French Patent 2,650,840; PCT Appln. No. WO91/02087).
  • a primer is employed that is complementary to allelic sequences immediately 3' to a polymo ⁇ hic site. The method determines the identity of the nucleotide of that site using labeled dideoxynucleotide derivatives, which, if complementary to the nucleotide of the polymo ⁇ hic site will become inco ⁇ orated onto the terminus of the primer.
  • GBA TM Genetic Bit Analysis
  • Goelet, P. et al. PCT Appln. No. 92/157112.
  • the method of Goelet, P. et al. uses mixtures of labeled terminators and a primer that is complementary to the sequence 3' to a polymo ⁇ hic site.
  • the labeled terminator that is inco ⁇ orated is thus determined by, and complementary to, the nucleotide present in the polymo ⁇ hic site of the target molecule being evaluated.
  • the method of Goelet, P. et al. is preferably a heterogeneous phase assay, in which the primer or the target molecule is immobilized to a solid phase.
  • RNA is initially isolated from available tissue and reverse-transcribed, and the segment of interest is amplified by PCR. The products of reverse transcription PCR are then used as a template for nested PCR amplification with a primer that contains an
  • RNA polymerase promoter and a sequence for initiating eukaryotic translation.
  • the unique motifs inco ⁇ orated into the primer permit sequential in vitro transcription and translation of the PCR products.
  • sodium dodecyl sulfate-polyacrylamide gel electrophoresis of translation products the appearance of truncated polypeptides signals the presence of a mutation that causes premature termination of translation.
  • DNA as opposed to RNA is used as a PCR template when the target region of interest is derived from a single exon.
  • nucleic acid samples for use in the diagnostics described herein.
  • the DNA sample is obtained from a bodily fluid, e.g, blood, obtained by known techniques (e.g. venipuncture) or saliva.
  • nucleic acid tests can be performed on dry samples (e.g. hair or skin).
  • the cells or tissues that may be utilized must express the IL-1 gene. Diagnostic procedures may also be performed in situ directly upon tissue sections (fixed and/or frozen) of patient tissue obtained from biopsies or resections, such that no nucleic acid purification is necessary.
  • Nucleic acid reagents may be used as probes and/or primers for such in situ procedures (see, for example, Nuovo, G.J., 1992, PCR in situ hybridization: protocols and applications, Raven Press, NY).
  • profiles may also be assessed in such detection schemes. Finge ⁇ rint profiles may be generated, for example, by utilizing a differential display procedure, Northern analysis and/or RT-PCR.
  • Another embodiment of the invention is directed to kits for detecting a predisposition for developing sepsis and/or for progressing more rapidly or severely.
  • This kit may contain one or more oligonucleotides, including 5' and 3' oligonucleotides that hybridize 5' and 3' to at least one allele of an IL-1 proinflammatory haplotype.
  • PCR amplification oligonucleotides should hybridize between 25 and 2500 base pairs apart, preferably between about 100 and about 500 bases apart, in order to produce a
  • oligonucleotides may be any of a variety of natural and/or synthetic compositions such as synthetic oligonucleotides, restriction fragments, cDNAs, synthetic peptide nucleic acids (PNAs), and the like.
  • the assay kit and method may also employ labeled oligonucleotides to allow ease of identification in the assays.
  • labels examples include radio-labels, enzymes, fluorescent compounds, streptavidin, avidin, biotin, magnetic moieties, metal binding moieties, antigen or antibody moieties, and the like.
  • the kit may, optionally, also include DNA sampling means such as the AmpliCardTM (University of Sheffield, Sheffield, England S 10 2 JF; Tarlow, JW, et al. ,
  • DNA purification reagents such as NucleonTM kits, lysis buffers, proteinase solutions and the like
  • PCR reagents such as lOx reaction buffers, thermostable polymerase, dNTPs, and the like
  • allele detection means such as the Hinfi restriction enzyme, allele specific oligonucleotides, degenerate oligonucleotide primers for nested PCR from dried blood.
  • IL-1 polymo ⁇ hisms that are predictive of sepsis, alone or in conjunction with information on other genetic defects contributing to sepsis (the genetic profile of sepsis) allows a customization of the therapy for a particular disease to the individual's genetic profile, the goal of "pharmacogenomics". For example, subjects carrying a pattern 2 allele may be predisposed to developing sepsis or for progressing more rapidly or severely into sepsis related sequelae.
  • comparison of an individual's IL-1 genetic profile to the population profile for sepsis permits the selection or design of drugs that are expected to be safe and efficacious for a particular patient or patient population (i.e., a group of patients having the same genetic alteration).
  • the ability to target populations expected to show the highest clinical benefit, based on the IL-1 genetic profile, can enable: 1) the repositioning of marketed sepsis drugs with disappointing market results; 2) the rescue of sepsis drug candidates whose clinical development has been discontinued as a result of safety or efficacy limitations, which are patient subgroup-specific; and 3) an accelerated and less costly development for sepsis drug candidates and more optimal drug labeling.
  • Cells of a subject may also be obtained before and after administration of a therapeutic to detect the level of expression of genes other than IL- 1 , to verify that the therapeutic does not increase or decrease the expression of genes which could be deleterious. This can be done, e.g., by using the method of transcriptional profiling.
  • mRNA from cells exposed in vivo to a therapeutic and mRNA from the same type of cells that were not exposed to the therapeutic could be reverse transcribed and hybridized to a chip containing DNA from numerous genes, to thereby compare the expression of genes in cells treated and not treated with the therapeutic.
  • Modulators of IL-1 e.g. IL-l ⁇ , IL-l ⁇ or IL-1 receptor antagonist
  • a protein encoded by a gene that is in linkage disequilibrium with an IL-1 gene can comprise any type of compound, including a protein, peptide, peptidomimetic, small molecule, or nucleic acid.
  • Preferred IL-1 agonists include nucleic acids (e.g. encoding an IL-1 protein or a gene that is up- or down-regulated by an IL-1 protein), proteins (e.g. IL-1 proteins or a protein that is up- or down-regulated thereby) or a small molecule (e.g. that regulates expression or binding of an IL-1 protein).
  • Preferred IL-1 antagonists include nucleic acids (e.g. single (antisense) or double stranded (triplex) DNA or PNA and ribozymes), protein (e.g. antibodies) and small molecules that act to suppress or inhibit IL-1 transcription and/or protein activity.
  • nucleic acids e.g. single (antisense) or double stranded (triplex) DNA or PNA and ribozymes
  • protein e.g. antibodies
  • small molecules that act to suppress or inhibit IL-1 transcription and/or protein activity.
  • Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining The LD50 (the dose lethal to 50% of the population) and the Edso (the dose therapeutically effective in 50% of the population).
  • the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50.
  • Compounds which exhibit large therapeutic indices are preferred. While _ compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissues in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
  • the data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans.
  • the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity.
  • the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
  • the therapeutically effective dose can be estimated initially from cell culture assays.
  • a dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture.
  • IC50 i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms
  • levels in plasma may be measured, for example, by high performance liquid chromatography.
  • compositions for use in accordance with the present invention may be formulated in a conventional manner using one or more physiologically acceptable carriers or excipients.
  • the compounds and their physiologically acceptable salts and solvates may be formulated for administration by, for example, injection, inhalation or insufflation (either through the mouth or the nose) or oral, buccal, parenteral or rectal administration.
  • the compounds of the invention can be formulated for a variety of loads of administration, including systemic and topical or localized administration. Techniques and formulations generally may be found in Remmington's Pharmaceutical Sciences, Meade Publishing Co., Easton, PA.
  • injection is preferred, including intramuscular, intravenous, intraperitoneal, and subcutaneous.
  • the compounds of the invention can be formulated in liquid solutions, preferably in physiologically compatible buffers such as Hank's solution or Ringer's solution.
  • physiologically compatible buffers such as Hank's solution or Ringer's solution.
  • the compounds may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms are also included.
  • compositions may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulfate).
  • binding agents e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose
  • fillers e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate
  • lubricants e.g., magnesium stearate, talc or silica
  • disintegrants e.g., potato starch or
  • Liquid preparations for oral administration may take the form of, for example, solutions, syrups or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use.
  • Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., ationd oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e-g-, methyl or propyl-p-hydroxybenzoates or sorbic acid).
  • the preparations may also contain buffer salts, flavoring, coloring and sweetening agents as appropriate.
  • Preparations for oral administration may be suitably formulated to give controlled release of the active compound.
  • the compositions may take the form of tablets or lozenges formulated in conventional manner.
  • the compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of e.g., gelatin for use in an inhaler or insufflator may be
  • the compounds may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
  • the compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulating agents such as suspending, stabilizing and/or dispersing agents.
  • the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
  • the compounds may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
  • the compounds may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection.
  • the compounds may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
  • suitable delivery systems include microspheres which offer the possibility of local noninvasive delivery of drugs over an extended period of time. This technology utilizes microspheres of precapillary size which can be injected via a coronary catheter into any selected part of the e.g. heart or other organs without causing inflammation or ischemia. The administered therapeutic is slowly released from these microspheres and taken up by surrounding tissue cells (e.g. endothelial cells).
  • Systemic administration can also be by transmucosal or transdermal means.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art, and include, for example, for transmucosal administration bile salts and fusidic acid derivatives.
  • detergents may be used to facilitate permeation.
  • Transmucosal administration may be through nasal sprays or using suppositories.
  • the oligomers of the invention are formulated into ointments, salves, gels, or creams as generally known in the art.
  • a wash solution can be used locally to treat an injury or inflammation to accelerate healing.
  • compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient.
  • the pack may for example comprise metal or plastic foil, such as a blister pack.
  • the pack or dispenser device may be accompanied by instructions for administration.
  • the invention further features cell-based or cell free assays, e.g., for identifying sepsis therapeutics.
  • a cell expressing an IL-1 receptor, or a receptor for a protein that is encoded by a gene which is in linkage disequilibrium with an IL-1 gene, on the outer surface of its cellular membrane is incubated in the presence of a test compound alone or in the presence of a test compound and another protein and the interaction between the test compound and the receptor or between the protein (preferably a tagged protein) and the receptor is detected, e.g., by using a microphysiometer (McConnell et al.
  • This assay system thus provides a means of identifying molecular antagonists which, for example, function by interfering with protein- receptor interactions, as well as molecular agonist which, for example, function by activating a receptor.
  • Cellular or cell-free assays can also be used to identify compounds which modulate expression of an IL-1 gene or a gene in linkage disequilibrium therewith, modulate translation of an mRNA, or which modulate the stability of an mRNA or protein. Accordingly, in one embodiment, a cell which is capable of producing an IL-1, or other protein is incubated with a test compound and the amount of protein produced in the cell medium is measured and compared to that produced from a cell which has not been contacted with the test compound. The specificity of the compound vis a vis the protein can be confirmed by various control analysis, e.g., measuring the expression of one or more control genes. In particular, this assay can be used to determine the efficacy of antisense, ribozyme and triplex compounds.
  • Cell-free assays can also be used to identify compounds which are capable of interacting with a protein, to thereby modify the activity of the protein.
  • a compound can, e.g., modify the structure of a protein thereby effecting its ability to bind to a receptor.
  • cell-free assays for identifying such compounds consist essentially in a reaction mixture containing a protein and a test compound or a library of test compounds in the presence or absence of a binding partner.
  • a test compound can be, e.g., a derivative of a binding partner, e.g., a biologically inactive target peptide, or a small molecule.
  • one exemplary screening assay of the present invention includes the steps of contacting a protein or functional fragment thereof with a test compound or library of test compounds and detecting the formation of complexes.
  • the molecule can be labeled with a specific marker and the test compound or library of test compounds labeled with a different marker.
  • Interaction of a test compound with a protein or fragment thereof can then be detected by determining the level of the two labels after an incubation step and a washing step. The presence of - two labels after the washing step is indicative of an interaction.
  • An interaction between molecules can also be identified by using realtime BIA (Biomolecular Interaction Analysis, Pharmacia Biosensor AB) which detects surface plasmon resonance (SPR), an optical phenomenon. Detection depends on changes in the mass concentration of macromolecules at the biospecific interface, and does not require any labeling of interactants.
  • a library of test compounds can be immobilized on a sensor surface, e.g., which forms one wall of a micro-flow cell. A solution containing the protein or functional fragment thereof is then flown continuously over the sensor surface. A change in the resonance angle as shown on a signal recording, indicates that an interaction has occurred. This technique is further described, e.g., in BIAtechnology Handbook by Pharmacia.
  • Another exemplary screening assay of the present invention includes the steps of (a) forming a reaction mixture including: (i) an IL-1 or other protein, (ii) an appropriate receptor, and (iii) a test compound; and (b) detecting interaction of the protein and receptor.
  • the compounds of this assay can be contacted simultaneously.
  • a protein can first be contacted with a test compound for an appropriate amount of time, following which the receptor is added to the reaction mixture.
  • the efficacy of the compound can be assessed by generating dose response curves from data obtained using various concentrations of the test compound. Moreover, a control assay can also be performed to provide a baseline for comparison.
  • Complex formation between a protein and receptor may be detected by a variety of techniques. Modulation of the formation of complexes can be quantitated using, for example, detectably labeled proteins such as radiolabeled, fluorescently labeled, or enzymatically labeled proteins or receptors, by immunoassay, or by chromatographic detection. Typically, it will be desirable to immobilize either the protein or the receptor to facilitate separation of complexes from uncomplexed forms of one or both of the proteins, as well as to accommodate automation of the assay.
  • Binding of protein and receptor can be accomplished in any vessel suitable for containing the reactants. Examples include microtitre plates, test tubes, and micro-centrifuge tubes.
  • a fusion protein can be provided which adds a domain that allows the protein to be bound to a matrix.
  • glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, MO) or glutathione derivatized microtitre plates, which are then combined with the receptor, e.g. an 35s-labeled receptor, and the test compound, and the mixture incubated under conditions conducive to complex formation, e.g.
  • the beads are washed to remove any unbound label, and the matrix immobilized and radiolabel determined directly (e.g. beads placed in scintillant), or in the supernatant after the complexes are subsequently dissociated.
  • the complexes can be dissociated from the matrix, separated by SDS-PAGE, and the level of protein or receptor found in the bead fraction quantitated from the gel using standard electrophoretic techniques such as described in the appended examples.
  • Other techniques for immobilizing proteins on matrices are also available for use in the subject assay. For instance, either protein or receptor can be immobilized utilizing conjugation of biotin and streptavidin.
  • Transgenic animals can also be made to identify agonists and antagonists or to confirm the safety and efficacy of a candidate therapeutic.
  • Transgenic animals of the invention can include non-human animals containing a sepsis causative mutation under the control of an appropriate endogenous promoter or under the control of a heterologous promoter.
  • the transgenic animals can also be animals containing a transgene, such as reporter gene, under the control of an appropriate promoter or fragment thereof. These animals are useful, e.g., for identifying drugs that modulate the activity of an IL-1 protein, such as by modulating gene expression. Methods for obtaining transgenic non- human animals are well known in the art.
  • the expression of the sepsis causative mutation is restricted to specific subsets of cells, tissues or developmental stages utilizing, for example, cis-acting sequences that control expression in the desired pattern.
  • mosaic expression of a protein can be essential for many forms of lineage analysis and can additionally provide a means to assess the effects of, for example, expression level which might grossly alter development in small patches of tissue within an otherwise normal embryo.
  • tissue-specific regulatory sequences and conditional regulatory sequences can be used to control expression of the mutation in certain spatial patterns.
  • temporal patterns of expression can be provided by, for example, conditional recombination systems or prokaryotic transcriptional regulatory sequences. Genetic techniques, which allow for the expression of a mutation can be regulated via site- specific genetic manipulation in vivo, are known to those skilled in the art.
  • the transgenic animals of the present invention all include within a plurality of their cells a sepsis causative mutation transgene of the present invention, which transgene alters the phenotype of the "host cell".
  • a sepsis causative mutation transgene of the present invention which transgene alters the phenotype of the "host cell".
  • either the cre/loxP recombinase system of bacteriophage PI Lakso et al. (1992) PNAS 89:6232-6236; Orban et al. (1992) PNAS 89:6861-6865
  • FLP recombinase system of Saccharomyces cerevisiae O'Gorman et al.
  • Cre recombinase catalyzes the site-specific recombination of an intervening target sequence located between loxP sequences.
  • loxP sequences are 34 base pair nucleotide repeat sequences to which the Cre recombinase binds and are required for Cre recombinase mediated genetic recombination.
  • the orientation o ⁇ loxP sequences determines whether the intervening target sequence is excised or inverted when Cre recombinase is present (Abremski et al. (1984) J Biol. Chem. 259:1509-
  • genetic recombination of the target sequence is dependent on expression of the Cre recombinase.
  • Expression of the recombinase can be regulated by promoter elements which are subject to regulatory control, e.g., tissue-specific, developmental stage-specific, inducible or repressible by externally added agents. This regulated control will result in genetic recombination of the target sequence only in cells where recombinase expression is mediated by the promoter element.
  • the activation of expression of the causative mutation transgene can be regulated via control of recombinase expression.
  • crelloxP recombinase system to regulate expression of a causative mutation transgene requires the construction of a transgenic animal containing transgenes encoding both the Cre recombinase and the subject protein. Animals containing both the Cre recombinase and the sepsis causative mutation transgene can be provided through the construction of "double" transgenic animals. A convenient method for providing such animals is to mate two transgenic animals each containing a transgene.
  • prokaryotic promoter sequences which require prokaryotic proteins to be simultaneous expressed in order to facilitate expression of the transgene.
  • Exemplary promoters and the corresponding trans-activating prokaryotic proteins are given in U.S. Patent No. 4,833,080.
  • conditional transgenes can be induced by gene therapy-like methods wherein a gene encoding the transactivating protein, e.g. a recombinase or a prokaryotic protein, is delivered to the tissue and caused to be expressed, such as in a cell-type specific manner.
  • a gene encoding the transactivating protein e.g. a recombinase or a prokaryotic protein
  • the transgene could remain silent into adulthood until "turned on” by the introduction of the transactivator.
  • the "transgenic non-human animals" of the invention are produced by introducing transgenes into the germline of the non-human animal. Embryonal target cells at various developmental stages can be used to introduce transgenes. Different methods are used depending on the stage of development of the embryonal target cell.
  • the specific line(s) of any animal used to practice this invention are selected for general good health, good embryo yields, good pronuclear visibility in the embryo, and good reproductive fitness.
  • the haplotype is a significant factor.
  • strains such as C57BL/6 or FVB lines are often used (Jackson Laboratory, Bar Harbor, ME).
  • Preferred strains are those with H-2 b , H-2 d or H-2 ⁇ 1 haplotypes such as C57BL/6 or DBA/1.
  • the line(s) used to practice this invention may themselves be transgenics, and/or may be knockouts (i.e., obtained from animals which have one or more genes partially or completely suppressed) .
  • the transgene construct is introduced into a single stage embryo.
  • the zygote is the best target for microinjection.
  • the male pronucleus reaches the size of approximately 20 micrometers in diameter which allows reproducible injection of 1-2 pi of DNA solution.
  • the use of zygotes as a target for gene transfer has a major advantage in that in most cases the injected DNA will be inco ⁇ orated into the host gene before the first cleavage (Brinster et al. (1985) PNAS 82:4438-4442). As a consequence, all cells of the transgenic animal will carry the inco ⁇ orated transgene. This will in general also be reflected in the efficient transmission of the transgene to offspring of the founder since 50% of the germ cells will harbor the transgene.
  • the nucleotide sequence comprising the transgene is introduced into the female or male pronucleus as described below. In some species such as mice, the male pronucleus is preferred. It is most preferred that the exogenous genetic material be added to the male DNA complement of the zygote prior to its being processed by the ovum nucleus or the zygote female pronucleus.
  • the exogenous genetic material be added to the male complement of DNA or any other complement of DNA prior to its being affected by the female pronucleus.
  • the exogenous genetic material is added to the early male pronucleus, as soon as possible after the formation of the male pronucleus, which is when the male and female pronuclei are well separated and both are located close to the cell membrane.
  • the exogenous genetic material could be added to the nucleus of the sperm after it has been induced to undergo decondensation.sperm containing the exogenous genetic material can then be added to the ovum or the decondensed sperm could be added to the ovum with the transgene constructs being added as soon as possible thereafter.
  • transgene nucleotide sequence into the embryo may be accomplished by any means known in the art such as, for example, microinjection, electroporation, or lipofection.
  • the embryo may be incubated in vitro for varying amounts of time, or reimplanted into the surrogate host, or both. In vitro incubation to maturity is within the scope of this invention.
  • a zygote is essentially the formation of a diploid cell which is capable of developing into a complete organism.
  • the zygote will be comprised of an egg containing a nucleus formed, either naturally or artificially, by the fusion of two haploid nuclei from a gamete or gametes.
  • the gamete nuclei must be ones which are naturally compatible, i.e., ones which result in a viable zygote capable of undergoing differentiation and developing into a functioning organism.
  • a euploid zygote is preferred. If an aneuploid zygote is obtained, then the number of chromosomes should not vary by more than one with respect to the euploid number of the organism from which either gamete originated.
  • DNA sequences will vary depending upon the particular zygote and functions of the exogenous genetic material and will be readily apparent to one skilled in the art, because the genetic material, including the exogenous genetic material, of the resulting zygote must be biologically capable of initiating and maintaining the differentiation and development of the zygote into a functional organism.
  • the number of copies of the transgene constructs which are added to the zygote is dependent upon the total amount of exogenous genetic material added and will be the amount which enables the genetic transformation to occur. Theoretically only one copy is required; however, generally, numerous copies are utilized, for example, 1 ,000- 20,000 copies of the transgene construct, in order to insure that one copy is functional.
  • exogenous genetic material is preferentially inserted into the nucleic genetic material by microinjection.
  • Microinjection of cells and cellular structures is known and is used in the art. Reimplantation is accomplished using standard methods. Usually, the surrogate host is anesthetized, and the embryos are inserted into the oviduct. The number of embryos implanted into a particular host will vary by species, but will usually be comparable to the number of off spring the species naturally produces.
  • Transgenic offspring of the surrogate host may be screened for the presence and/or expression of the transgene by any suitable method. Screening is often accomplished by Southern blot or Northern blot analysis, using a probe that is complementary to at least a portion of the transgene. Western blot analysis using an antibody against the protein encoded by the transgene may be employed as an alternative or additional method for screening for the presence of the transgene product.
  • DNA is prepared from tail tissue and analyzed by Southern analysis or PCR for the transgene.
  • the tissues or cells believed to express the transgene at the highest levels are tested for the presence and expression of the transgene using Southern analysis or PCR, although any tissues or cell types may be used for this analysis.
  • Alternative or additional methods for evaluating the presence of the transgene include, without limitation, suitable biochemical assays such as enzyme and/or immunological assays, histological stains for particular marker or enzyme activities, flow cytometric analysis, and the like. Analysis of the blood may also be useful to detect the presence of the transgene product in the blood, as well as to evaluate the effect of the transgene on the levels of various types of blood cells and other blood constituents.
  • suitable biochemical assays such as enzyme and/or immunological assays, histological stains for particular marker or enzyme activities, flow cytometric analysis, and the like.
  • Analysis of the blood may also be useful to detect the presence of the transgene product in the blood, as well as to evaluate the effect of the transgene on the levels of various types of blood cells and other blood constituents.
  • Progeny of the transgenic animals may be obtained by mating the transgenic animal with a suitable partner, or by in vitro fertilization of eggs and/or sperm obtained from the transgenic animal.
  • the partner may or may not be transgenic and/or a knockout; where it is transgenic, it may contain the same or a different transgene, or both.
  • the partner may be a parental line.
  • in vitro fertilization is used, the fertilized embryo may be implanted into a surrogate host or incubated in vitro, or both. Using either method, the progeny may be evaluated for the presence of the transgene using methods described above, or other appropriate methods.
  • the transgenic animals produced in accordance with the present invention will include exogenous genetic material. Further, in such embodiments the sequence will be attached to a transcriptional control element, e.g., a promoter, which preferably allows the expression of the transgene product in a specific type of cell. Retroviral infection can also be used to introduce the transgene into a non-human animal. The developing non-human embryo can be cultured in vitro to the blastocyst stage. During this time, the blastomeres can be targets for retroviral infection (Jaenich, R. (1976) PNAS 73:1260-1264).
  • retroviral infection can also be used to introduce the transgene into a non-human animal. The developing non-human embryo can be cultured in vitro to the blastocyst stage. During this time, the blastomeres can be targets for retroviral infection (Jaenich, R. (1976) PNAS 73:1260-1264).
  • Efficient infection of the blastomeres is obtained by enzymatic treatment to remove the zona pellucida (Manipulating the Mouse Embryo, Hogan eds. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1986).
  • the viral vector system used to introduce the transgene is typically a replication- defective retrovirus carrying the transgene (Jahner et al. (1985) PNAS 82:6927-6931; Nan der Putten et al. (1985) PNAS 82:6148-6152).
  • Transfection is easily and efficiently obtained by culturing the blastomeres on a monolayer of virus-producing cells (Nan der Putten, supra; Stewart et al. (1987) EMBO J. 6:383-388).
  • infection can be performed at a later stage.
  • Virus or virus-producing cells can be injected into the blastocoele (Jahner et al. (1982) Nature 298:623-628).
  • Most of the founders will be mosaic for the transgene since inco ⁇ oration occurs only in a subset of the cells which formed the transgenic non-human animal. Further, the founder may contain various retroviral insertions of the transgene at different positions in the genome which generally will segregate in the offspring.
  • ES cells are obtained from pre-implantation embryos cultured in vitro and fused with embryos (Evans et al. (1981) Nature 292:154-156; Bradley et al. (1984)
  • Transgenes can be efficiently introduced into the ES cells by D ⁇ A transfection or by retrovirus-mediated transduction. Such transformed ES cells can thereafter be combined with blastocysts from a non-human animal. The ES cells thereafter colonize the embryo and contribute to the germ line of the resulting chimeric animal. For review see Jaenisch, R. (1988) Science 240:1468-1474.
  • EXAMPLE 1 A polymorphism of the Interleukin-1 Gene and Death in Meningococcal Disease
  • IL-1 A (+4845) IL-IB (+3964) IL-IB (-511) IL- IRA (+2018) TNF (-308)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Veterinary Medicine (AREA)
  • Molecular Biology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
PCT/US1999/025633 1998-10-30 1999-11-01 Method for determining the susceptibility to developing sepsis and therapeutics for the treatment of sepsis Ceased WO2000037679A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
DE69939269T DE69939269D1 (de) 1998-10-30 1999-11-01 Verfahren zur bestimmung der suzeptibilität zur sepsisentwicklung und arzneimittel zur behandlung von sepsis
CA002346960A CA2346960A1 (en) 1998-10-30 1999-11-01 Diagnostic and therapeutics for sepsis
IL14243899A IL142438A0 (en) 1998-10-30 1999-11-01 Diagnostic and therapeutics for sepsis
AU39956/00A AU779772B2 (en) 1998-10-30 1999-11-01 Diagnostic and therapeutics for sepsis
JP2000589732A JP2002533096A (ja) 1998-10-30 1999-11-01 敗血症の診断法および治療法
EP99972008A EP1127168B1 (en) 1998-10-30 1999-11-01 Method for determining the susceptibility to developing sepsis and therapeutics for the treatment of sepsis

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US09/183,850 1998-10-30
US09/183,850 US6251598B1 (en) 1998-10-30 1998-10-30 Methods for diagnosing sepsis

Publications (2)

Publication Number Publication Date
WO2000037679A2 true WO2000037679A2 (en) 2000-06-29
WO2000037679A3 WO2000037679A3 (en) 2001-01-11

Family

ID=22674558

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/025633 Ceased WO2000037679A2 (en) 1998-10-30 1999-11-01 Method for determining the susceptibility to developing sepsis and therapeutics for the treatment of sepsis

Country Status (10)

Country Link
US (2) US6251598B1 (https=)
EP (1) EP1127168B1 (https=)
JP (1) JP2002533096A (https=)
AT (1) ATE403745T1 (https=)
AU (1) AU779772B2 (https=)
CA (1) CA2346960A1 (https=)
DE (1) DE69939269D1 (https=)
ES (1) ES2308861T3 (https=)
IL (1) IL142438A0 (https=)
WO (1) WO2000037679A2 (https=)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002024951A1 (en) * 2000-09-20 2002-03-28 Genaissance Pharmaceuticals, Inc. Haplotypes of the il1b gene
RU2286154C2 (ru) * 2005-02-17 2006-10-27 Владимир Алексеевич Шатров Способ лечения воспалительных заболеваний головного мозга
JP2007527718A (ja) * 2004-03-04 2007-10-04 ザ ユニバーシティ オブ ブリティッシュ コロンビア 患者結果(OutcomeofPatients)を予測するトール様受容体2(TLR−2)ハプロタイプ
US8293521B2 (en) 2005-03-30 2012-10-23 Shimadzu Corporation Method of dispensing nonvolatile liquid in reaction vessel and reaction vessel processing apparatus

Families Citing this family (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9711040D0 (en) * 1997-05-29 1997-07-23 Duff Gordon W Prediction of inflammatory disease
US20050032077A1 (en) * 1998-03-10 2005-02-10 Duff Gordon W. Detecting genetic predisposition to sight-threatening diabetic retinopathy
US6251598B1 (en) * 1998-10-30 2001-06-26 Interleukin Genetics, Inc. Methods for diagnosing sepsis
US20040028651A1 (en) * 2001-03-29 2004-02-12 Karrupiah Muthumani Composition and methods of using hiv vpr
JP2005523879A (ja) * 2001-10-05 2005-08-11 ザ・トラスティーズ・オブ・ザ・ユニバーシティ・オブ・ペンシルバニア Sirs/sepsisを治療及び予防するための組成物及び方法
WO2003044176A2 (en) * 2001-11-19 2003-05-30 Interleukin Genetics, Inc. Functional polymorphisms of the interleukin-1 locus affecting transcription and susceptibility to inflammatory and infectious diseases
US20080311581A1 (en) * 2001-11-19 2008-12-18 David Wyllie Functional polymorphisms of the interleukin-1 locus affecting transcription and susceptibility to inflammatory and infectious diseases
BR0316232A (pt) * 2002-11-12 2005-10-04 Becton Dickinson Co Métodos para determinar o estado de sepsia, para prognosticar o começo de sepsia e para diagnosticar a sìndrome de resposta inflamatória sistêmica em um indivìduo
CA2505843A1 (en) * 2002-11-12 2004-05-27 Becton, Dickinson And Company Diagnosis of sepsis or sirs using biomarker profiles
MXPA05005073A (es) * 2002-11-12 2005-11-17 Becton Dickinson Co Diagnostico de la sepsis o sirs usando perfiles de biomarcadores.
WO2005038427A2 (en) * 2003-06-05 2005-04-28 Medical Gene Center Ltd. Rapid identification of viruses of the upper respiratory tract infection including sars causing coronus viruses
PT1673472E (pt) * 2003-10-06 2011-05-12 Novartis Ag Utiliza??o de polimorfismos gen?ticos na predi??o de hepatotoxicidade induzida por f?rmacos
AU2005219472A1 (en) * 2004-03-04 2005-09-15 The University Of British Columbia Thrombomodulin (THBD) haplotypes predict outcome of patients
US8034553B2 (en) * 2004-06-24 2011-10-11 Kimberly-Clark Worldwide, Inc. Biomarkers for wound healing
US20060157647A1 (en) * 2005-01-18 2006-07-20 Becton, Dickinson And Company Multidimensional liquid chromatography/spectrometry
EP2361933A3 (en) 2005-01-26 2012-05-02 Amgen Fremont Inc. Antibodies against interleukin-1 beta
JP2008538007A (ja) 2005-04-15 2008-10-02 ベクトン,ディッキンソン アンド カンパニー 敗血症の診断
US8669113B2 (en) 2008-04-03 2014-03-11 Becton, Dickinson And Company Advanced detection of sepsis
WO2010070136A2 (en) * 2008-12-19 2010-06-24 Centre de Recherche Public de la Santé Novel caviidae allergens and uses thereof
KR101451357B1 (ko) 2011-02-18 2014-10-15 주식회사 스템디알 Sirt1 발현 유도 물질을 포함하는 패혈증 또는 패혈증 쇼크의 예방 또는 치료용 조성물
US10126305B2 (en) 2013-06-25 2018-11-13 University of Pittsburg—Of the Commonwealth System of Higher Education Proteomic biomarkers of sepsis in elderly patients
WO2017123696A1 (en) 2016-01-12 2017-07-20 Interleukin Genetics, Inc. Methods for predicting response to treatment
US10337070B2 (en) 2017-01-12 2019-07-02 Cardioforecast Ltd. Methods and kits for treating cardiovascular disease
US20220249660A1 (en) 2019-06-06 2022-08-11 Sitokine Limited Compositions and methods for treating lung, colorectal and breast cancer
WO2021028469A1 (en) 2019-08-12 2021-02-18 Sitokine Limited Compositions and methods for treating cytokine release syndrome and neurotoxicity
WO2021205013A1 (en) 2020-04-09 2021-10-14 Sitokine Limited Compositions and methods for treating covid-19

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4965188A (en) * 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
AU655766B2 (en) 1990-05-01 1995-01-12 Chiron Corporation Interleukin-1 antagonist and uses thereof
US5916891A (en) 1992-01-13 1999-06-29 Smithkline Beecham Corporation Pyrimidinyl imidazoles
WO1995001997A1 (en) 1993-07-09 1995-01-19 Smithkline Beecham Corporation RECOMBINANT AND HUMANIZED IL-1β ANTIBODIES FOR TREATMENT OF IL-1 MEDIATED INFLAMMATORY DISORDERS IN MAN
DE4408890A1 (de) 1994-03-16 1995-09-21 Knoll Ag Verwendung von Il-1-Antagonisten als Arzneimittel zur Behandlung von Erkrankungen mit einem erhöhten Interleukin-6 Serumspiegel
US5686246A (en) * 1995-08-03 1997-11-11 Kornman; Kenneth S. Detecting genetic predisposition to periodontal disease
US5942390A (en) * 1996-01-12 1999-08-24 Cedars-Sinai Medical Center Method of diagnosing predisposition for ulcerative colitis in Jewish population by detection of interleukin-1 receptor antagonist polymorphism
AU2213697A (en) 1996-03-18 1997-10-10 Medical Science Systems, Inc. A method for periodontal disease treatment
GB9621129D0 (en) 1996-10-10 1996-11-27 Duff Gordon W Detecting genetic predisposition to sight-threatening diabetic retinopathy
US6210877B1 (en) 1997-03-10 2001-04-03 Interleukin Genetics, Inc. Prediction of coronary artery disease
GB9711040D0 (en) 1997-05-29 1997-07-23 Duff Gordon W Prediction of inflammatory disease
ES2297900T3 (es) 1997-11-07 2008-05-01 Interleukin Genetics, Inc. Diagnosis y terapia para la enfermedad obstructiva cronica de las vias respiratorias.
US6251598B1 (en) * 1998-10-30 2001-06-26 Interleukin Genetics, Inc. Methods for diagnosing sepsis

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002024951A1 (en) * 2000-09-20 2002-03-28 Genaissance Pharmaceuticals, Inc. Haplotypes of the il1b gene
JP2007527718A (ja) * 2004-03-04 2007-10-04 ザ ユニバーシティ オブ ブリティッシュ コロンビア 患者結果(OutcomeofPatients)を予測するトール様受容体2(TLR−2)ハプロタイプ
RU2286154C2 (ru) * 2005-02-17 2006-10-27 Владимир Алексеевич Шатров Способ лечения воспалительных заболеваний головного мозга
US8293521B2 (en) 2005-03-30 2012-10-23 Shimadzu Corporation Method of dispensing nonvolatile liquid in reaction vessel and reaction vessel processing apparatus

Also Published As

Publication number Publication date
ES2308861T3 (es) 2008-12-01
US6251598B1 (en) 2001-06-26
US6551785B2 (en) 2003-04-22
DE69939269D1 (de) 2008-09-18
JP2002533096A (ja) 2002-10-08
IL142438A0 (en) 2002-03-10
AU779772B2 (en) 2005-02-10
EP1127168B1 (en) 2008-08-06
WO2000037679A3 (en) 2001-01-11
ATE403745T1 (de) 2008-08-15
CA2346960A1 (en) 2000-06-29
EP1127168A2 (en) 2001-08-29
AU3995600A (en) 2000-07-12
US20010034032A1 (en) 2001-10-25

Similar Documents

Publication Publication Date Title
EP1127168B1 (en) Method for determining the susceptibility to developing sepsis and therapeutics for the treatment of sepsis
AU780318B2 (en) Diagnostics and therapeutics for cardiovascular disorders
US20090191564A1 (en) Diagnostics and therapeutics for cardiovascular disorders
AU784224B2 (en) Diagnostics and therapeutics for diseases associated with an IL-1 inflammatory haplotype
AU2006203097B2 (en) Diagnostics and therapeutics for osteoporosis
WO2001016377A9 (en) Diagnostics and therapeutics for osteoporosis
EP1680513B1 (en) Diagnostic for osteoporosis
US20090023147A1 (en) Diagnostics and therapeutics for osteoporosis
EP1192277B1 (en) Diagnosis of restenosis
WO2005108619A2 (en) Diagnostics and therapeutics for diseases associated with an il-1 inflammatory haplotype
HK1093757B (en) Diagnostic for osteoporosis

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

WWE Wipo information: entry into national phase

Ref document number: 142438

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 39956/00

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2346960

Country of ref document: CA

Ref country code: CA

Ref document number: 2346960

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 589732

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1999972008

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1999972008

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

CR1 Correction of entry in section i

Free format text: PAT. BUL. 19/2002 UNDER (81) ADD "US"

WWG Wipo information: grant in national office

Ref document number: 39956/00

Country of ref document: AU