WO2000037094A2 - Applications therapeutiques de polypeptides flint - Google Patents
Applications therapeutiques de polypeptides flint Download PDFInfo
- Publication number
- WO2000037094A2 WO2000037094A2 PCT/US1999/030734 US9930734W WO0037094A2 WO 2000037094 A2 WO2000037094 A2 WO 2000037094A2 US 9930734 W US9930734 W US 9930734W WO 0037094 A2 WO0037094 A2 WO 0037094A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mflint
- cells
- fasl
- flint
- fas
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70578—NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
- A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
Definitions
- FasL also called CD95L and APOIL
- FasL is expressed on various cell types and can produce biological responses such as proliferation, differentiation, immunoregulation, inflammatory response, cytotoxicity, and apoptosis.
- FasL the ligand for the TNFR- family receptor FAS/APO (Suda et al . , 1993, Cell 75:1169-78, are associated with autoimmunity (Fisher et al . , 1995, Cell 81:935-46), while overproduction of FasL may be implicated in drug-induced hepatitis.
- FasL is expressed in immune- privileged tissues of the eye, testis, brain and some tumors.
- Apoptosis plays a central role in both development and in homeostasis.
- Cells die by apoptosis in the developing embryo during morphogenesis or synaptogenesis and in the adult animal during tissue turnover or at the end of an immune response.
- apoptosis is crucial, aberration of this process can be detrimental.
- unscheduled apoptosis of certain brain neurons contributes to disorders such as Alzheimer's and Parkinson's disease, whereas the failure of dividing cells to initiate apoptosis after sustaining severe DNA damage contributes to cancer.
- survival signals from the cell's environment and internal sensors for cellular integrity normally keep a cell's apoptotic machinery in check. In the event that a cell loses contact with its surroundings or sustains irreparable damage, the cell initiates apoptosis. A cell that simultaneously receives conflicting signals driving or attenuating its division cycle also triggers apoptosis. Mammals have evolved yet another mechanism that enables the organism actively to direct individual cells to self- destruct. This kind of "instructive" apoptosis is important especially in the immune system. Death receptors-cell surface receptors that transmit apoptosis signals initiated by specific "death ligands" - play a central role in instructive role apoptosis . These receptors can activate death caspases within seconds of ligands binding, causing an apoptotic demise of the cell within hours.
- Death receptors belong to the tumor necrosis factor (TNF) receptor gene superfamily, which is defined by similar, cysteine-rich extracellular domains.
- TNF tumor necrosis factor
- the death receptors contain in additional a homologous cytoplasmic sequence termed the "death domain" .
- Death domains typically enable death receptors to engage the cell's apoptotic machinery, but in some instances they mediate functions that are distinct from or even counteract apoptosis .
- Fas (also called CD95 or Apol) is a well-characterized death receptor. Fas and Fas ligand (FasL) play an important role in apoptosis. Fas L is a homotrimeric molecule. It is suggested that each FasL timer binds three Fas molecules . Because death domains have a propensity to associate with one another, Fas ligation leads to clustering of the receptors' death domains. An adapter protein called FADD (Fas-associated death domain; also called Mortl) then binds through its own death domain to the clustered receptor death domains.
- FADD Fas-associated death domain
- FADD also contains a "death effector domain" that binds to an analogous domain repeated in tandem within the zymogen form of caspase-8 (also called FLICE, or MACH) .
- caspase-8 oligomerization drives its activation through self-cleavage.
- Caspase-8 then activates downstream effector caspases such as caspase-9 committing the cell to apoptosis.
- Ashkenazi A., et al "Death Receptors: Signaling and Modulation Science 281, 1305-1308 (August 1998) .
- FasL is also proinflammatory. FasL has been shown to stimulate neutrophils, also called polymorphonuclear leukocytes (PMNs) , activation.
- PMNs polymorphonuclear leukocytes
- FasL-Fas binding has been implicated in clonal deletions of autoreactive lymphocytes in peripheral lymphoid tissues and in elimination of autoreactive lymphocyte populations, thus contributing to homeostasis of the immune system.
- FasL-Fas binding has been implicated in clonal deletions of autoreactive lymphocytes in peripheral lymphoid tissues and in elimination of autoreactive lymphocyte populations, thus contributing to homeostasis of the immune system.
- FasL on myotubes or pancreatic islets of transgenic mice induces a granulocytic response that accelerates graft rejection (Allison J.
- FasL-Fas receptor binding At least one of the effects of FasL-Fas receptor binding is apoptosis, which is necessary for homeostasis. However, sometimes the balance of ligand-receptors binding is upset in stress, disease or trauma. One of the negative effects of unregulated FasL-Fas binding is runaway or aberrant apoptosis. Another effect of said binding is the destruction of healthy cells caused by neutrophils that have been activated by FasL. For example, one of the more tragic outcomes of runaway apoptosis in a specific organ is acute liver failure. Acute liver failure is characterized by an over-activation of the apoptotic pathway where there is massive apoptosis of hepatocytes and hemorrhagic liver changes.
- Acute liver failure can happen as a result of viral infections affecting the liver, bacterial infections affecting the liver, hepatitis, hepatocellular injury and/or other conditions where hepatocytes undergo massive apoptosis.
- viral infections affecting the liver bacterial infections affecting the liver
- hepatitis hepatocellular injury and/or other conditions where hepatocytes undergo massive apoptosis.
- an infection resulting in acute liver failure is bacterium- induced fulminant hepatitis.
- the invention encompasses an isolated nucleic acid molecule having the sequence of Figure 1, an isolated nucleic acid molecule having the sequence of Figure 3 , isolated polypeptide having the sequence of Figure 1, and an isolated polypeptide having the sequence of Figure 3.
- the invention also includes a transgenic mouse comprising a transgene having the sequence of Figure 1.
- mFLINT is provided for use in treating the following conditions: acute liver failure; inflammation of the liver; abnormal hepatocyte apoptosis; sepsis; a disorder associated with inflammation; hepatitis; treating abnormal apoptosis; an ischemia-associated injury or disorder; injury or disorder is associated with hypercoagulation, including use with agent selected from the group selected from thrombolytic and antithrombotic agents, like activated protein C; a reperfusion-associated injury or disorder; damage to a cardiac myocyte resulting from abnormal myocardial ischemia; Type I diabetes; cancer; damage to an innocent bystander tissue that is induced by a chemotherapeutic agent or therapeutic irradiation, including bone marrow, intestinal epithelium, oral cavity epithelium; injury to hematopoietic progenitor cells that have been exposed to therapeutic radiation or chemotherapy; cell damage from therapeutic irradiation or chemotherapy, including damage to intestinal epithelial cells, hematopoietic pro
- compositions, having mFLINT as an active ingredient that are adapted for the treatment of the following: acute liver failure; inflammation of the liver; abnormal hepatocyte apoptosis; sepsis; a disorder associated with inflammation; hepatitis; treating abnormal apoptosis; an ischemia-associated injury or disorder; injury or disorder is associated with hypercoagulation, including use with agent selected from the group selected from thrombolytic and antithrombotic agents, like activated protein C; a reperfusion-associated injury or disorder; damage to a cardiac myocyte resulting from abnormal myocardial ischemia; Type I diabetes; cancer; damage to an innocent bystander tissue that is induced by a chemotherapeutic agent or therapeutic irradiation, including bone marrow, intestinal epithelium, oral cavity epithelium; injury to hematopoietic progenitor cells that have been exposed to therapeutic radiation or chemotherapy; cell damage from therapeutic irradiation or chemotherapy, including damage to intestinal epithelial cells,
- mFLINT as an active ingredient that are adapted for promoting the growth or differentiation of hematopoietic progenitor cells and promoting the growth or differentiation of CD34+ cells.
- embodiments of the invention include the use of mFLINT in the preparation of medicaments useful in treating the following conditions: acute liver failure; inflammation of the liver; abnormal hepatocyte apoptosis; sepsis; a disorder associated with inflammation; hepatitis; treating abnormal apoptosis; an ischemia-associated injury or disorder; injury or disorder is associated with hypercoagulation, including use with agent selected from the group selected from thrombolytic and antithrombotic agents, like activated protein C; a reperfusion-associated injury or disorder; damage to a cardiac myocyte resulting from abnormal myocardial ischemia; Type I diabetes; cancer; damage to an innocent bystander tissue that is induced by a chemotherapeutic agent or therapeutic irradiation, including bone marrow, intestinal epithe
- the invention include the use of mFLINT in the preparation of medicaments useful in promoting the growth or differentiation of hematopoietic progenitor cells and promoting the growth or differentiation of CD34+ cells.
- the present invention encompasses a method for treating an individual suffering from abnormal hepatocyte apoptosis, comprising administration of a therapeutically amount of mFLINT protein to said individual.
- the invention also includes a method of treating an individual suffering from a disorder associated with inflammation, comprising administration of a therapeutically amount of mFLINT protein to said individual .
- the invention includes a method of treating an individual suffering from abnormal apoptosis, comprising administration of a therapeutically effective amount of mFLINT protein to said individual.
- the present invention further includes the use of mFLINT to treat a variety of disorders of the liver.
- the invention encompasses a method of treating an individual suffering from acute liver failure, comprising administration of a therapeutically amount of mFLINT protein to said individual.
- the invention also includes a method of treating an individual suffering from inflammation of the liver, comprising administration of a therapeutically amount of mFLINT protein to said individual .
- Another method of the invention is for treating an individual suffering from hepatitis, comprising administration of a therapeutically effective amount of mFLINT protein to said individual.
- the invention also encompasses a method of treating an individual suffering from sepsis, comprising administration of a therapeutically amount of mFLINT protein to said individual .
- Also included within the present invention is a method for treating an individual suffering from an ischemia- associated injury or disorder, comprising administration of a therapeutically effective amount of mFLINT protein to said individual.
- an injury or disorder may associated with hypercoagulation.
- the invention also includes treating a disorder associated with hypercoagulation, comprising administration of a therapeutically effective amount of mFLINT, in combination with an thrombolytic agent or an antithrombotic agent.
- an antithrombotic agent is activated protein C.
- the invention also includes a method of treating an individual suffering from a reperfusion-associated injury or disorder, comprising administration of a therapeutically effective amount of mFLINT protein to said individual.
- the invention further encompasses a method of preventing damage to a cardiac myocyte in an individual that has suffered from abnormal myocardial ischemia, comprising administration of a therapeutically effective amount of mFLINT protein to said individual .
- Also included in the invention is a method of treating an individual suffering from Type I diabetes, comprising administration of a therapeutically amount of mFLINT protein to said individual .
- Yet another method encompassed by the present invention is a method of treating an individual suffering from cancer, comprising administration of a therapeutically effective amount of mFLINT protein to said individual .
- the invention also includes a method of treating damage to an innocent bystander tissue that is induced by a chemotherapeutic agent or therapeutic irradiation, in an individual treated with said agent or irradiation, comprising administration of a therapeutically effective amount of mFLINT to said individual.
- Such tissues include, bone marrow and intestinal epithelium, including the epithelium of the oral cavity.
- the invention encompasses method for treating hematopoietic progenitor cells that have been exposed to therapeutic radiation or chemotherapy, comprising administering mFLINT to said cells. Such a method promotes the recover of hematopoietic progenitor cells from the adverse effects of therapeutic radiation or chemotherapy.
- the invention also includes a method of promoting the growth or differentiation of a hematopoietic progenitor cell, comprising administering mFLINT to said cell.
- the invention further includes a method of promoting the growth or differentiation of a CD34+ cell, comprising administering mFLINT to said cell.
- the invention also includes a method for treating cancer, comprising treating bone marrow cells in vitro with mFLINT, and administering said cells to said patient, wherein said administration occurs after said patient has been treated with therapeutic irradiation or chemotherapy.
- the bone marrow cells may be autologous, i.e., from the patient being treated, or heterologous, i . e . , from an individual other the patient.
- the invention also encompasses a method of treating cell damage in a patient who receives therapeutic irradiation or chemotherapy, comprising administering to said patient, a therapeutically effective amount of mFLINT with said irradiation or chemotherapy.
- the cell damage may be to an intestinal epithelial cell, a hematopoietic progenitor cell, or a peripheral blood cell.
- the invention also contemplates methods of treating aplastic anemia, myelodysplastic syndrome or a pancytopenic condition, comprising administering a therapeutically effective amount of mFLINT to a patient suffering from aplastic anemia.
- the invention also relates to a method for treating and/or inhibiting acute respiratory distress syndrome.
- the invention also relates to a method for treating and/or inhibiting ulcerative colitis.
- the invention also relates to a method for treating and/or inhibiting ischemia injury during organ transplantation.
- Figure 1 shows the combined amino acid and nucleotide sequences of human FLINT.
- Figure 2 shows the combined amino acid and nucleotide sequences of human FLINT.
- Figure 3 shows the combined amino acid and nucleotide sequences of human mFLINT.
- Figure 4 shows the combined amino acid and nucleotide sequences of human mFLINT.
- Figure 5 compares the performance of mFLINT with other agents in an animal sepsis model after different times of LPS administration.
- Figure 6 left panel, shows an experiment comparing mFLINT with anti-TNF in an animal sepsis model.
- the right panel compares a lower dose of mFLINT against anti-TNF in the same model .
- Figure 7 shows an experiment comparing intravenous and intraperitoneal delivery of mFLINT and anti-TNF in an animal sepsis model .
- Figure 8 shows reduction in B16 melanoma tumor volume in response to treatment with mFLINT.
- Figure 9 shows mFLINT promoted recovery of bone marrow progenitor cells following irradiation.
- Figure 10 shows mFLINT promoted recovery of bone marrow progenitor cells following treatment with 5-fluorouracil .
- FasL-Fas receptor binding apoptosis .
- FasL-Fas receptor binding neutrophil activation wherein cells are destroyed by neutrophils activated by FasL.
- FasL induces in peritoneal exudate cells (PEC) the processing and release of IL-l ⁇ that is responsible for the neutrophil infiltration.
- PEC peritoneal exudate cells
- FLINT polypeptides bind to FasL with at least the same, if not greater, affinity than the Fas receptor itself. As a result of binding FasL, FLINT polypeptides can interfere with FasL binding to Fas receptor and interfere with events downstream. Using various in vitro and animal models, presented below in the examples, the inventors have demonstrated the ability of FLINT polypeptides to prevent Fas-mediated deleterious effects. It is apparent from these data that FLINT can act on both the apoptotic and proinflammatory aspects of FasL activity, which implicates its use in several disease and injury states discussed below.
- mFLINT inhibits both FasL apoptosis-inducing activity and proinflammatory activity.
- mFLINT polypeptides can modulate the destruction of healthy cells caused both by neutrophils activated by FasL and by apoptotic damage mediated directly by FasL-Fas interaction.
- the present methods of treatment utilizing mFLINT are useful in the treatment and prevention of disorders associated with the direct apoptotic effects of FasL and/or the damage mediated by the proinflammatory effects of FasL, whether or not these represent distinct physiological pathways.
- the invention relates to methods preventing or treating conditions caused or exacerbated by "abnormal apoptosis," in particular, apoptosis induced by Fas ligand (FasL) and Fas receptor (Fas) binding (also referred to as FasL-Fas binding) .
- This invention also relates to methods of preventing or treating conditions caused by a proinflammatory response, more particularly, a proinflammatory response caused by FasL induced neutrophil activation.
- FLINT refers to any full length FLINT polypeptide. Such a full-length polypeptide includes the leader sequence, which is amino acids 1-29 of a FLINT polypeptide.
- FLINT include a protein having the amino acid sequence set forth in Figure 1, which is a human FLINT, and Figure 2, which is a human FLINT variant .
- mFLINT refers to a mature FLINT, i.e., FLINT which does not have a leader (also known as signal) peptide.
- Examples of mFLINT include a protein having the amino acid sequence set forth in Figure 3, which is the protein of Figure 1 without its leader peptide, and a protein having the amino acid sequence set forth in Figure 4, which is the protein of Figure 2 without amino acids 1-29.
- an "mFLINT gene” is a nucleic acid that encodes an mFLINT polypeptide.
- the nucleic acids set forth in Figures 3 and 4 are examples of mFLINT genes according to the present invention.
- FasL or Fas expression or interaction As used here, with reference to FasL or Fas expression or interaction, and to any resulting apoptosis, the terms “inappropriate” and “abnormal” should be read to include any deviation from normal expression, interaction or apoptosis levels. Such deviations include temporal, quantitative and qualitative abnormalities. FasL or Fas "expression” refers not only transcription, translation and associated events, but also to any process that results in increased the availability of active FasL or Fas, such as transport and cell surface availability/accessibility.
- abnormal apoptosis refers to excessive and/or improper apoptosis.
- abnormal apoptosis is observed in cells and tissues that have undergone physical, chemical or biological insult.
- insults include, but are not limited to physical injury, viral infection, bacterial infection, ischemia, irradiation, chemotherapy, and the like.
- fusion protein denotes a hybrid protein molecule not found in nature comprising a translational fusion or enzymatic fusion in which two or more different proteins or fragments thereof are covalently linked on a single polypeptide chain.
- “Host cell” refers to any eucaryotic or prokaryotic cell that is suitable for propagating and/or expressing a cloned gene contained on a vector that is introduced into said host cell by, for example, transformation or transfection, or the like.
- inhibitor or “inhibiting” includes the generally accepted meaning, which includes prohibiting, preventing, restraining, slowing, stopping, or reversing progression or severity of a disease or condition.
- isolated nucleic acid compound refers to any RNA or DNA sequence, however constructed or synthesized, which is locationally distinct from its natural location.
- plasmid refers to an extrachromosomal genetic element.
- the plasmids disclosed herein are commercially available, publicly available on an unrestricted basis, or can be constructed from readily available plasmids in accordance with published procedures.
- a "primer” is a nucleic acid fragment which functions as an initiating substrate for enzymatic or synthetic elongation of, for example, a nucleic acid compound.
- promoter refers to a nucleic acid sequence that directs transcription, for example, of DNA to RNA.
- An inducible promoter is one that is regulatable by environmental signals, such as carbon source, heat, or metal ions, for example.
- a constitutive promoter generally operates at a constant level and is not regulatable.
- Recombinant DNA cloning vector refers to any autonomously replicating agent, including, but not limited to, plasmids and phages, comprising a DNA molecule to which one or more additional DNA segments can or have been incorporated.
- recombinant DNA expression vector or "expression vector” as used herein refers to any recombinant DNA cloning vector, for example a plasmid or phage, in which a promoter and other regulatory elements are present thereby enabling transcription of an inserted DNA, which may encode a polypeptide.
- selective binding refers to the ability of FLINT polypeptides to bind FasL but not TNFoc.
- substantially pure used in reference to a peptide or protein means that said peptide or protein is separated from other cellular and non-cellular molecules, including other protein molecules .
- a substantially pure preparation would be about at least 85% pure; preferably about at least 95% pure.
- a "substantially pure” protein as described herein could be prepared by a variety of techniques well known to the skilled artisan, including, for example, the IMAC protein purification method.
- treatment or “treating” as used herein, describes the management and care of a patient for the purpose of combating a disease, condition, or disorder and includes the administration of FLINT to prevent the onset of the symptoms or complications, alleviating the symptoms or complications thereof.
- vector refers to a nucleic acid compound used for introducing exogenous or endogenous DNA into host cells.
- a vector comprises a nucleotide sequence which may encode one or more protein molecules . Plasmids, cosmids, viruses, and bacteriophages, in the natural state or which have undergone recombinant engineering, are examples of commonly used vectors.
- FLINT is a newly identified member of the TNFR superfamily. This family of receptors mediates a variety of biological effects of TNF ligands, including but not limited to cell proliferation, cell differentiation, immune regulation, inflammatory response, cytotoxicity, and apoptosis.
- the FLINT polypeptide of the present invention is a soluble receptor comprising extracellular domains. FLINT polypeptide does not include any transmembrane domains and is, therefore, soluble. FLINT has also been called OPG3 (osteoprotegrin 3) or TNFRsol . FLINT is believed to be closely related to TNFR 6 ⁇ and TNFR 6 ⁇ discussed in O98/30694 claiming priority to U.S.S.N. 60/035,496 and TR4 , discussed in EP 0861850A1.
- LIGHT is a 29kDa type II transmembrane TNF superfamily member protein produced by activated T cells. Mauri D.M., Immunity, 8:21 (1998) .
- FasL evidence links LIGHT with neutrophil infiltration and with apoptosis. Zhai et al . , J. Clin. Investig. 102:1142-51, 1998.
- mFLINT-mediated inhibition of LIGHT activity is expected to be therapeutically useful substantially as described below for mFLINT-mediated inhibition of FasL, especially in immune modulation and cancer therapy.
- mFLINT prevents in vitro FasL-induced apoptosis of Jurkat cells.
- Anti-CD3 antibodies activate these cells and cause them to express FasL and undergo apoptosis.
- mFLINT also was effective in inhibiting in vitro anti-CD3-induced apoptosis of Jurkat cells, in a dose-dependent manner.
- the present invention is applicable to the treatment and/or inhibition of disorders that may be associated with an inappropriate or abnormal interaction of FasL with Fas, because mFLINT prevents this interaction.
- This inappropriate interaction may arise, for example, due to increased expression or availability of FasL and/or Fas. Since it is known that FasL-Fas interaction induces apoptosis, the inventive methods further generally apply to disorders characterized by inappropriate or abnormal apoptosis.
- the present invention relates to a method of preventing or treating conditions caused or exacerbated by FasL-Fas binding including FasL-mediated apoptosis and/or a proinflammatory response, more particularly, a proinflammatory response caused by FasL induced neutrophil activation.
- mFLINT may be employed in treating Down's syndrome.
- Enhanced apoptosis of neuronal cells may be implicated in Down Syndrome.
- Seidi, et al . Neuroscience Lett . 260:9 (1999)
- Fas-associated apoptosis may be an important feature of neurodegeneration in Down syndrome.
- treatment of a Down syndrome patient with mFLINT may be effective.
- the present inventors have shown that mFLINT binds FasL, prevents Fas-FasL binding, and inhibits apoptosis.
- apoptosis has been linked to
- mFLINT Alzheimer's disease and other neurodegenerative diseases.
- Administration of mFLINT is expected to decrease the enhanced apoptosis associated with Down syndrome, Alzheimer's disease and other neurodegenerative disorders.
- the inventors have tested mFLINT in a variety of model systems that are indicative of various disease and injury states.
- Some exemplary disorders include, but are not limited to, antibody-dependent cytotoxicity, infection with human immunodeficiency virus, hemolytic uremic syndrome, allergies and bronchopulmonary dysplasia.
- Some exemplary disorders include, but are not limited to, antibody-dependent cytotoxicity, infection with human immunodeficiency virus, hemolytic uremic syndrome, allergies and bronchopulmonary dysplasia.
- the following section discusses diseases and injury states in the context of corresponding model systems.
- the present invention also encompasses the production of transgenic animals that contain a FLINT transgene.
- the inventors have produced transgenic mice that produce measurable levels of mFLINT. Animals such as these are useful for assessing the effects of mFLINT on a variety of disorders, detailed below, such as endotoxin-induced shock, cerebral ischemia, cardiac reperfusion injury, and damage induced by cancer therapies, such as therapeutic irradiation and chemotherapy.
- FasL has been implicated in acute liver failure including but not limited to the damage caused to the liver in hepatitis.
- administration of anti-FasL antibody to mice caused liver failure induced by apoptosis in hepatocytes and the animals die within hours.
- Kondo et al 1997 Nature Medicine 3 (4) :409-413.
- Galle et al J. Exp. Med, November 1995, 182:1223-1230.
- Tsuji et al. (1998), Infect. Immun. 65:1892-1898, describes a model system for bacterially induced fluminant hepatitis. As detailed below, this system is predictive of a variety of disorders of the liver and other tissues.
- mice were injected with Propionibacterium acnes, and are subsequently injected with lipopolysaccharide (LPS) .
- LPS lipopolysaccharide
- the first injection causes granuloma formation in the liver, while the second injection induces massive apoptosis and consequent liver damage.
- Tsuji et al employed this method to implicate TNFRp55 in granuloma formation, and TNFRp55 and Fas in apoptosis.
- target diseases generally involve either a tissue inappropriately (e . g. , temporally, qualitatively or quantitatively) expressing Fas or inappropriately coming into contact with FasL while expressing Fas. Many of these diseases follow a general pathological model of inappropriate upregulation of Fas, followed by FasL-mediated induction of apoptosis.
- Fas may be induced, for example, by inflammatory insult, with certain inflammation-associated cyokines likely inducing expression.
- inflammation-associated cyokines likely inducing expression.
- IL- 1 , IL-1 and TNF- can induce Fas expression.
- This increased Fas expression may, in effect, sensitize the affected tissue to FasL-bearing effector cells, like natural killer cells and cytotoxic T cells.
- FasL- bearing effectors with Fas-bearing targets induces apoptosis of the latter.
- this hepatic injury model is an in vivo surrogate for certain disease characterized by (a) inflammatory insult and/or (b) FasL-Fas-mediated apoptosis and/or necrosis.
- GVHD graft versus host disease
- afferent phase is characterized by recognition of host antigens and proliferation of donor T cells.
- efferent phase tissues like the skin, liver and gastrointestinal tract become inflamed, and it is characterized by mononuclear cell infiltration and histopathological damage.
- FasL-defective mice in fact, show that FasL plays a key role in the development of hepatic, cutaneous and lymphoid organ damage in GVHD.
- GVHD follows the paradigm of inflammatory insult and Fas-mediated apoptosis.
- Hashimoto's thyroiditis (HT) also fits this paradigm.
- HT results from an autoimmune response against the thyroid follicular cells.
- Normal thyrocytes produce FasL and express negligible levels of Fas.
- the resulting inflammation results in IL-1 secretion by activated macrophages, which then induces the thyrocytes to produce Fas. This sets up a fatal FasL-Fas autocrine loop that results in apoptosis.
- OxLDL oxidized low density lipoprotein
- Chronic renal failure is correlated secretion of IL-1 and TNF- , both of which have been shown to induce Fas expression in renal tubular epithelial cells.
- This disorder is characterized by the depletion of tubular epithelial cells, via the FasL-Fas apoptosis pathway.
- the same cytokine-mediated induction of Fas expression in tubule cells is observed in the endotoxic shock (sepsis) model of acute renal failure.
- Acute liver failure can be found in viral infections affecting the liver, bacterial infections affecting the liver, hepatitis, hepatocellular injury and/or other conditions where hepatocytes undergo massive apoptosis.
- Galle et al . knew that FasL-Fas mediated apoptosis was a mechanism to eliminate senescent hepatocytes.
- lipophyllic compounds e.g., phenobarbitol
- activated T cells attacked hepatocytes. Fas is constitutively expressed in hepatocytes. That is, FasL was expressed in T cells upon activation. It is thought that activated T cells might kill hepatitis B (HBV) antigen-expressing hepatocytes in an effort to clear HBV from the liver.
- HBV hepatitis B
- mFLINT is useful in treating and preventing sepsis.
- Sepsis is characterized by the presence of one or more pathogenic organisms, or their toxins, in the blood or tissues.
- sepsis is characterized by a systemic inflammatory response to infection that is associated with and mediated by the activation of a number of host defense mechanisms including the cytokine network, leukocytes, and the complement and coagulation/fibrinolysis systems. See Mesters, et al . Blood, 88:881 (1996).
- TNF tissue necrosis factor
- mFLINT may be beneficially used in combination with other agents useful in treating sepsis.
- U.S. Patent No. 5,009,889 demonstrates that activated protein C (aPC) is effective in treating a baboon sepsis model .
- aPC activated protein C
- Such a model may be employed to determine appropriate combination treatment protocols using, for example, mFLINT and aPC.
- aPC may prevent the sepsis-associated disseminated intravascular coagulation and widespread deposition of fibrin in the microvasculature, which is an early manifestation of sepsis/septic shock.
- ARDS acute respiratory distress syndrome
- goiter heptatocellular injury (viral, bacterial, cancer, trauma) ; mononucleosis; mucocites (inflammation of the mucosa) ; pancreatitis; periodontal disease/gingivitis; renal failure; satellite organ failure; systemic inflammatory response syndrome (SIRS) ; surgery; vascular bleeds; vascular leak syndrome; whole organ transplant; multiple organ dysfunction (MODS) ; coronary artery bypass grafting; allograft rejection; transplant rejection; infection ( e . g.
- HCV hepatitis C
- HBV hepatitis B
- Ebola hemolytic fever
- EBV Epstein-Barr
- the invention contemplates methods for treating disorders associated with inflammation.
- disorders include but are not limited to, GVHD, Hashimoto's thyroiditis, ARDS, heptatocellular injury (viral, bacterial, cancer, trauma) ; mucocites (inflammation of the mucosa) ; pancreatitis, periodontal disease/gingivitis; renal failure; satellite organ failure; systemic inflammatory response syndrome (SIRS) ; whole organ transplant; multiple organ dysfunction (MODS) ; coronary artery bypass grafting; allograft rejection; transplant rejection; infection ( e . g.
- HCV hepatitis C
- HBV hepatitis B
- Ebola hemolytic fever
- EBV Epstein-Barr
- Ischemia is characterized by the reduced blood flow to a tissue, which results in the accumulation of a variety of toxic metabolites. These metabolites contribute to cell death resulting from necrosis and/or apoptosis. Perhaps surprisingly, when a tissue is reperfused, apoptotic damage is increased. This is likely due to the generation of free radicals and other toxins through the reaction of ischemia- induced metabolites with serum components. In any event, studies have shown that the apopototic damage results at least in part from Fas-mediated pathways. Experiments presented below demonstrate that mFLINT can be used to block ischemia/reperfusion injury, likely by inhibiting FasL.
- mFLINT compositions in treating or preventing disorders associated with cerebral ischemia, like stroke and head trauma, is confirmed by data presented below.
- a model is presented that uses a live gerbil model of global stroke. Cerebral ischemia was induced by a transient occlusion of the common carotid arteries followed by a treatment of mFLINT or a vehicle control . Data show that the mFLINT-treated gerbils retained markedly more living neurons than the vehicle treated control group.
- Fas-mediated apoptosis has been linked to ischemia reperfusion injury in a myocardial infarction model.
- Kajstura et al . Laboratory investigation 74:86-107 (1996) .
- the foregoing gerbil model likely is predictive of generalized ischemia reperfusion injury.
- the inventors conducted in an in vitro assay using cardiac myocytes.
- cardiomyocytes were incubated under hypoxia conditions for 8 hours, followed by 16 hours of culture under normal 0 2 , which mimics the hypoxic conditions found in ischemic cardiac tissue.
- Experimental results showed that treating the cardiomycetes with mFLINT protected the cells against apoptosis induced by hypoxia.
- mFLINT stroke; spinal cord ischemia; eclampsia/preeclampsia; reperfusion injury; myocardial infarction, its acute, subacute and chronic sequelae and related clinical syndromes, including but not limited to congestive heart failure.
- FLINT is useful in promoting myocardial salvage and preventing decompensatory myocardial hypertrophy.
- Reperfusion injury may be in a number of tissues and result from a variety of insults, including the bowel, burns, cardiac bypass machine injury, hepatic (trauma- induced) , hemolytic fever (Ebola) , infant toxicity
- mFLINT is useful in the prevention/attenuation of apoptosis of cardiac myocytes following acute myocarial infarction, and generally in preventing damage to cardiac and other tissue due to hypoxia.
- mFLINT is useful prophylactically to prevent the apoptosis associated with ischemia reperfusion injury to the organ once it is removed from the donor.
- FLINT is administered to the organ donor prior to harvesting the organ. After harvesting the organ, FLINT is added to a suitable medium for transport/storage of the organ. Alternatively, the harvested organ is perfused with a medium containing FLINT prior to transplantation into a recipient. Suitable media for this purpose are known, for example, the media disclosed in EP 0356367 A2 , herein incorporated by reference. The method may also include treating the transplant recipient with FLINT prior to and/or after the transplant surgery.
- a typical method involves pre-treating the organ donor with an effective amount of mFLINT prior to organ harvesting.
- the harvested organ may be perfused or bathed in a mFLINT-containing solution.
- This method may be employed, for example, with kidney, heart, lung and other organs and tissues.
- mFLINT is useful in treating the ischemia reperfusion injury associated with thrombus formation or hypercoagulation.
- thrombolytic agents e . g. , urokinase and streptokinase
- antithrombotics like activated protein C (aPC) .
- 5,350,578 describes the antithrombotic activity of aPC.
- the baboon animal model disclosed therein may be used to ascertain a beneficial dosing regimen for the contemplated combination therapy.
- eclampsia and preeclampsia which are characterized by a state of increased coagulopathy
- HELLP preeclampsia complicated by thrombocytopenia, hemolysis, and disturbed liver function
- HITS heparin-induced thrombocytopenia
- DIC disseminated intravascular coagulation
- Vitamin E an antioxidant
- mFLINT is similarly useful to preserve tissues and organs. This would be particularly useful for increasing shelf-life of organs and meats for human consumption.
- mFLINT inhibits Fas/FasL interaction, thereby preventing apoptosis.
- the Fas/FasL interaction has been implicated in the process of hematopoiesis . Therefore, the present application contemplates mFLINT-based therapeutic methods for improving hematological recovery from a variety of treatments and disorders, including bone marrow transplantation, chemotherapy, radiotherapy, aplastic anemia, and myelodysplastic syndrome, pancytopenic conditions.
- the present invention also covers the mFLINT- based treatment of any clinical condition which requires expansion of bone marrow cell lineages, alone or in combination with other hematological growth factors .
- Such growth factors include, but are not limited to, erythropoietin (EPO) , FLT-3 ligand, thrombopoietin (TPO) , stem cell factor (SCF) , granulocyte colony stimulating factor (G-CSF) , and granulocyte-macrophage colony- stimulating factor (GM-CSF) .
- EPO erythropoietin
- FLT-3 ligand thrombopoietin
- TPO thrombopoietin
- SCF stem cell factor
- G-CSF granulocyte colony stimulating factor
- GM-CSF granulocyte-macrophage colony- stimulating factor
- Autologous and heterologous bone marrow transplantation are commonly used to treat a multitude of neoplastic diseases.
- autologous transplantation bone marrow cells are removed from the patient to be treated, and are cultured in vitro . Following chemotherapy and/or radiation therapy, the cells are re-introduced to the patient.
- heterologous transplantation the bone marrow cells are donated by a second individual .
- the chemotherapy or radiotherapy that is used to treat such diseases results in a dramatic myelosuppression from damage to the bone marrow compartments and intestinal epithelium, leaving the patient immunosuppressed and susceptible to invasion by microorganisms.
- Fas/FasL pathway is known to induce apoptosis in susceptible cells.
- Fas is expressed on CD34+ progenitor cells and these cells are susceptible to the apoptotic effects of Fas stimulation.
- mFLINT improves the recovery of bone marrow progenitor cells that have been exposed to irradiation.
- mice were irradiated, and bone marrow cells were removed and cultured in vitro with the cytokines IL-6 and CSF.
- the addition of mFLINT to the culture medium dramatically increased the recovery of bone marrow progenitor cells, namely progenitors of erythroid cells, granulocyte-macrophage cells, and erythroid monocyte megakaryocyte cells.
- the inventors also have shown that mFLINT improves the survival of bone marrow cells that were harvested from mice treated with 5- fluorouracil (5-FU) .
- 5- fluorouracil 5-FU
- mFLINT is useful for enhancing the in vitro expansion and maturation of bone marrow progenitor cells prior to autologous or heterologous transplantation.
- mFLINT also is useful for promoting the expansion and maturation of progenitor cells, after a patient has been treated with radiation or chemotherapy.
- administration of mFLINT to a patient is expected to promote the expansion and maturation of progenitor cells when that patient has been treated with a cancer therapy (chemo- or radio- therapy) .
- mFLINT also is expected to promote the expansion and maturation of progenitor cells in patients treated with cancer therapy, and myelosuppressive agent, which prevents cycling of progenitor cells during cancer therapy.
- cytokines are used, in vitro and in vivo, to enhance the expansion of erythroid and myeloid cell lineages in patients receiving cancer therapies.
- the present inventors have shown that mFLINT improves the expansion of cells that are treated with cytokines. Accordingly, the present invention contemplates the use of mFLINT, in combination with one or more cytokines, to expand bone marrow progenitor cells, in vitro and in vivo .
- Granulocyte-macrophage colony stimulating factor (GM-CSF) is used to improve recovery from myelosuppression that results from chemo- and radio-therapy. Accordingly, the present invention contemplates the use of a combination of mFLINT and GM-CSF to improve recovery from myelosuppression.
- anti-FasL antibody also improved the recovery of bone marrow cells from treatment with 5-FU. Accordingly, the present invention contemplates the use of anti-FasL to improve recovery of bone marrow cells, following chemo- or radio-therapy.
- Such an antibody can be used in vitro to expand bone marrow cells for heterologous or autologous transplantation.
- An anti- FasL antibody also can be administered in vivo to improve recovery from myelosuppression that results from chemotherapy, radiation therapy, and/or administration of myelosuppressive agents.
- administration of mFLINT "with" chemotherapy or irradiation encompasses all of the following modes of administration of mFLINT: (1) pretreatment with mFLINT, followed by irradiation or chemotherapy; (2) simultaneous administration of mFLINT and chemo- or radiation therapy; (3) chemotherapy or irradiation first, followed by mFLINT administration; (4) mFLINT pretreatment, followed by chemo- or radiation therapy, followed by administration with mFLINT.
- the invention encompasses the use of mFLINT in one or more of the foregoing modes of treatment .
- peripheral cytopenias Treatment of peripheral cytopenias
- the present invention also contemplates the treatment of peripheral cytopenias that are associated with hematopoietic disorders, such as aplastic anemia and myelodysplastic syndrome. Fas/FasL-mediated apoptosis has been shown to suppress lymphopoiesis. Yasutomo, et al . J. Immunol . 157: 1981 (1996) . Increased Fas expression is observed in progenitor cells from patients with aplastic anemia. Young, N.S., Eur. J. Hematol . 60 (supp) : 55(1996). Increased Fas expression also has been observed in progenitor cells from patients suffering from myelodysplastic syndrome .
- the reduction in hematopoiesis and resultant cytopenias may be a direct result of apoptosis, which may in turn be mediated through upregulation of Fas and Fas ligand.
- mFLINT inhibits Fas/FasL binding, inhibiting apoptosis, and mFLINT also enhanced the growth and maturation of hematopoietic progenitor cells. Therefore, the use of mFLINT is expected to suppress apoptosis suffering from hematopoietic disorders, leading to amelioration of one or more of the symptoms associated with these disorders.
- mFLINT administration of mFLINT to such individuals is expected to ameliorate these maturation defects, by inhibiting FasL-induced apoptosis of immature hematopoietic cells.
- Treatment of individuals suffering from hematopoietic disorders can be carried out by direct administration of mFLINT to the affected individual, or by the use of mFLINT in vitro to treat bone marrow cells that are then transplanted into the diseased individual .
- mFLINT can be augmented by administration of EPO and other compounds that promote the growth and/or maturation of hematopoietic progenitor cells.
- Cytokines are known to stimulate the growth of hematopoietic progenitor cells. Accordingly, the invention also encompasses the use of a combination of mFLINT and one or more cytokines to promote growth and differentiation of such progenitor cells in individuals suffering from diseases such as thrombocytopenia and myelodysplastic syndrome. 3.
- FLINT also can be used in conjunction with gene therapy.
- hematopoietic progenitor cells When hematopoietic progenitor cells are to be transplanted into an individual, they are transfected with a suitable transgene, and also are treated with mFLINT, optionally in combination with one or more cytokines . Following culturing of the cells, they are transplanted into an individual.
- mFLINT optionally in combination with one or more cytokines
- an “innocent bystander” tissue is a non-diseased tissue that is damaged by pharmacological, radiation or device-assisted therapies.
- These tissues include, but are not limited to, the gastric epithelium (including the epithelium lining the oral cavity, esophagus, stomach and intestinal tract) , the lung epithelium, blood cells (lymphocytes, monocytes, T cells, B cells, bone marrow cells, hematopoietic progenitor cells, neutrophils, eosinophils, mast cells, platelets) , renal epithelium, and hair follicles. Many of these tissues are characterized by rapid growth and/or turnover of their constituent cells.
- Cell damaging therapies include, but are not limited to chemotherapy (e . g. cisplatin, doxorubicin, mitomycin C, camptothecin, and fluorouracil and other nucleoside analogs) , therapeutic irradiation, laser treatment, and administration of inhaled toxins (such as bleomycin) .
- Physical manipulations that are associated with device- assisted therapies such as the physical removal of a blockage from a coronary artery, also can cause damage to innocent bystander tissue. While these cell-damaging therapies are useful because they damage and kill diseased tissue, as noted above, they have the undesirable side effect of damaging and inducing apoptosis of "innocent bystander” tissue.
- mFLINT blocks Fas/FasL interactions. It also has been demonstrated herein that mFLINT inhibits FasL-induced apoptosis in vi tro, and that mFLINT improved the survival of bone marrow cells following therapeutic irradiation and chemotherapy. Therefore, it is an object of the present invention to ameliorate damage to innocent bystander tissues that is caused by cell-damaging therapy.
- Cancer therapies such as irradiation and chemotherapy have been shown to induce apoptosis in intestinal epithelial cells. It is known that many chemotherapeutic agents work by inducing apoptosis. See, e . g. , Micheau, et al . J. Natl . Can . Inst . 89:783 (1997). This apoptosis, combined with the myelosuppression that is induced by irradiation and chemotherapy, permits massive opportunistic infection. There currently are no effective therapies for managing the disruption of intestinal function that is associated with chemotherapy and therapeutic irradiation.
- mFLINT will ameliorate damage to the intestinal epithelium that is induced by irradiation and/or chemotherapy. While not desiring to be bound to any particular theory, it is expected that mFLINT will ameliorate this damage by inhibition of apoptosis and/or inflammation of the intestinal epithelium.
- Fas/FasL interactions have been implicated in chronic gastritis. It has been shown that Fas and FasL expression are increased in gastric epithelial cells from individuals suffering from chronic gastritis. See Rudi, et al . , J. Clin . Invest . 102:1506 (1998). Rudi also reported that Helicobacter-infected gastric epithelial cells have increased levels of FasL (CD95 ligand) and Fas (CD95 receptor) , and that HelicoJacter-induced apoptosis was reduced by blocking FasL with anti-APO-1 antibody. Thus, it is expected that mFLINT may be effective in inhibiting (i) gastritis that is induced by Helicobacter and, as mentioned above, (ii) cell-damaging therapies, such as chemotherapy and irradiation.
- HD-CT high-dose chemotherapy
- Fas/FasL-induced apoptosis has been implicated in bleomycin-induced apoptosis and fibrosis in lung epithelium. Hagimoto, et al . Am. J. Respir. Cell . Mol . Biol . 16:91 (1997). That study showed that in alveolar epithelial cells treated with bleomycin, Fas mRNA was upregulated, and FasL mRNA was upregulated in infiltrating lymphocytes. Therefore, the applicants expect that mFLINT therapy may ameliorate damage in lung tissue, such as epithelium, that is induced by cell-damaging therapies.
- mFLINT administration of mFLINT to mice causes a reduction in the volume of tumors that are produced when mice are injected with melanoma cells.
- This effect of mFLINT may be mediated through mFLINT/FasL binding and the consequent inhibition of FasL- mediated T-cell apoptosis, permitting a T-cell mediated immune response to facilitate destruction of the tumor.
- FasL is expressed in melanomas, human colorectal cancers, hepatocellular cancers, astrocytomas and lung cancer. O'Connell, et al . Immunology Today insert*, Chappell, et al . Cancer Immunol . Immunother. 47:65 (1998) .
- colon cancer cell lines express FasL and can kill T cells in vitro by inducing FasL-mediated apoptosis. O'Connell. Therefore, the melanoma tumors observed in the present application may express FasL, triggering FasL-mediated death of infiltrating T-cells that express Fas.
- FasL FasL-mediated apoptosis.
- other mechanisms may also be responsible for the tumor reduction that has been demonstrated in the present application.
- cancers include, but are not limited to, astrocytoma, colon cancer, esophageal cancer, lung cancer, melanoma and hepatocellular cancer.
- Other cancers that can be treated with mFLINT include bladder cancer and ovarian cancer.
- Type I diabetes insulin-dependent and Type II diabetes are characterized by hyperglycemia .
- hyperglycemia which is well known in the art, describes a condition characterized by a blood glucose level that is higher than that found in a normal human. Normal human fasting blood glucose levels are less than 110 mg/dL.
- Type I insulin-dependent diabetes is a chronic autoimmune disorder involving destruction of pancreatic (insulin-producing) ⁇ cells via the FasL-Fas pathway. It is likely that this destructive pathway is activated by the inflammatory process. Normal ⁇ cells do not express Fas, but Fas is expressed in these cells during insulitis. It is thus likely that lymphocyte-associated FasL contributes to the local destruction of these Fas + cells via a FasL-Fas interaction. To the extent that mFLINT is useful in antagonizing this pathway, it is useful in preventing or treating IDDM.
- MS Multiple sclerosis
- Fas has be found among the oligodendrocytes located along the lesion margin and in the adjacent white matter in both acute and chronic MS, whereas normal tissue shows little or none. It is likely that this abnormal expression of Fas is induced by cytokines released during the inflammatory process. Moreover, FasL-expressing cells have been co-localized with Fas-expressing apoptotic oligodendrocytes, suggesting involvement of this pathway in the pathology of this disease. Lupus, another autoimmune disease, also can be treated with mFLINT. G.
- mFLINT Treatment of Osteoporosis with mFLINT
- Data presented below in the examples indicate that mFLINT is useful in preventing or treating disorders of bone loss, like osteoporosis.
- mFLINT also can be used to inhibit bone resorption.
- These data are consistent with data showing the naturally-occurring secreted member of the TNFR superfamily was recently reported as having a role in regulating bone resorption. Simonet et al . Cell 89:309(1997) (termed osteoprotegrin (OPG) ; Tsuda et al . Biochem . and Biophys . Res . Comm.
- Acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) represent disease entities that differ only in the severity of the hypoxemia present at diagnosis.
- a widely accepted parameter for diagnosis is the Pa02 to Fi02 ratio, according to which ARDS patients manifest a ratio of less than or equal to 200 mm Hg, whereas ALI patients exhibit values of less than or equal to 300 mm Hg.
- ARDS represents a more severe form of ALI. Numerous mediators are likely to contribute to the pathogenesis of ARDS/ALI with neutrophils playing a prominent role. While multiple precipitating factors are probable in the development of ARDS, both direct and indirect, the major cause appears to be sepsis and the systemic inflammatory response syndrome, accounting for approximately 40% of cases. Mortality in ARDS is high approximating 40%, with most deaths occurring within the first 2 to 3 weeks. There is no currently available, approved pharmacologic therapy for ARDS and treatment at present is limited to aggressive supportive care.
- FLINT by binding to FasL, could inhibit FasL-mediated apoptosis of pneumocytes and/or endothelial cells, thus inhibiting or preventing the progression from acute inflammatory insult to ALI, and from ALI to ARDS.
- the present invention relates to the use of FLINT to treat ALI and/or ARDS comprising the administration of a therapeutically effective amount of FLINT to a person in need thereof .
- the mFLINT polypeptide composition will be formulated and dosed in a fashion consistent with good medical practice, taking into account the clinical condition of the individual patient (especially the side effects of treatment with mFLINT polypeptide alone) , the site of delivery of the mFLINT polypeptide composition, the method of administration, the scheduling of administration, and other factors known to practitioners.
- an effective amount of polypeptide results in a statistically significant modulation of the biological activity of the selected TNFR family ligand, for example, FasL or LIGHT.
- the biological activity for FasL includes, but is not limited to, apoptosis.
- the biological activity for LIGHT includes, but is not limited to, cell proliferation.
- LIGHT is a 29 kDa type II transmembrane TNF superfamily member protein produced by activated T cells. Mauri d.M. , Immunity, 8:21-30, January 1998.
- an effective amount may also be determined by prevention or amelioration of adverse conditions or symptoms of diseases, injuries or disorders being treated.
- the "therapeutically effective amount" of mFLINT polypeptide for purposes herein is thus determined by such considerations.
- mFLINT is an immunomodulator and that a common observation with such substances is a bell- shaped dose-response curve. Such a phenomenon is well known in the art and it is within the skill of the clinician to take this into account in adjusting the therapeutically effective amount of mFLINT accordingly.
- the total pharmaceutically effective amount of mFLINT polypeptide administered parenterally per dose will be in the range of about 1 ⁇ g/kg/day to 10 mg/kg/day of patient body weight, more particularly 2-8mg/kg, preferably 2-4mg/kg, most preferred 2.2mg/kg to 3.3 mg/kg and finally 2.5 mg/kg.
- this dose is at least 0.01 mg/kg/day.
- the mFLINT polypeptide is typically administered at a dose rate of about 0.1 ⁇ g/kg/hour to about 50 ⁇ g/kg/hour, either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-pump.
- An intravenous bag solution may also be employed. The length of treatment needed to observe changes and the interval following treatment for responses to occur appears to vary depending on the desired effect.
- compositions containing the mFLINT of the invention may be administered using a variety of modes that include, but are not limited to, oral, rectal, intracranial, parenteral, intracistemal, intravaginal , intraperitoneal, topical, transdermal (as by powders, ointments, drops or transdermal patch) , bucally, or as an oral or nasal spray.
- pharmaceutically acceptable carrier is meant a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
- parenteral refers to modes of administration which include but are not limited to, intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion. Implants comprising mFLINT also can be used.
- the mFLINT polypeptide is also suitably administered by sustained-release systems.
- sustained-release compositions include semi-permeable polymer matrices in the form of shaped articles, e.g., films, or microcapsules .
- Sustained-release matrices include polylactides (U.S. Pat. No. 3,773.919, EP 58,481), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate
- Sustained-release mFLINT polypeptide compositions also include liposomally entrapped mFLINT polypeptides .
- Liposomes containing mFLINT polypeptides are prepared by methods known per se: DE 3,218,121; Epstein et al . , Proc. Natl. Acad. Sci. (USA) 82:3688-3692 (1985); Hwang et al . , Proc. Natl. Acad. Sci. (USA) 77:4030-4034 (1980); EP 52,322; EP 36,676; EP 88,046; EDP 143,949; EP 142,641; Japanese Pat. Appl . 83- 118008; U.S. Pat. Nos. 4,485,045 and 4,544,545; and EP 102,324. Ordinarily, the liposomes are of the small (about 200-800 Angstroms) unilamellar type in which the lipid content is greater than about 30 mol. percent cholesterol, the selected proportion being adjusted for the optimal TNFR polypeptide therapy.
- the mFLINT polypeptide is formulated generally by mixing it at the desired degree of purity, in a unit dosage injectable form (solution, suspension, or emulsion) , with a pharmaceutically acceptable carrier, i.e., one that is non- toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
- a pharmaceutically acceptable carrier i.e., one that is non- toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
- the formulation preferably does not include oxidizing agents and other compounds that are known to be deleterious to polypeptides.
- the formulations are prepared by contacting the mFLINT polypeptide uniformly and intimately with liquid carriers or finely divided solid carriers or both. Then, if necessary, the product is shaped into the desired formulation.
- the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient .
- carrier vehicles include water, saline, Ringer's solution, and dextrose solution.
- Non-aqueous vehicles such as fixed oils and ethyl oleate are also useful herein, as well as liposomes .
- the carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability.
- additives such as substances that enhance isotonicity and chemical stability.
- Such materials are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, succinate, acetic acid, and other organic acids or their salts; antioxidants such as ascorbic acid; low molecular weight (less than about ten residues) polypeptides, e.g., polyarginine or tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, manose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbi
- the mFLINT polypeptide is typically formulated in such vehicles at a concentration of about 0.1 mg/ml to 100 mg/ml, preferably 1-10 mg/ml, at a pH of about 3 to 8. It will be understood that the use of certain of the foregoing excipients, carriers, or stabilizers will result in the formation of mFLINT polypeptide salts.
- FLINT polypeptides to be used for therapeutic administration must be sterile. Sterility is readily accomplished by filtration through sterile filtration membranes (e.g., 0.2 micron membranes).
- Therapeutic mFLINT polypeptide compositions generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
- FLINT polypeptides ordinarily will be stored in unit or multi-dose containers, for example, sealed ampoules or vials, as an aqueous solution or as a lyophilized formulation for reconstitution.
- a lyophilized formulation 10-ml vials are filled with 5 ml of sterile-filtered 1% (w/v) aqueous mFLINT polypeptide solution, and the resulting mixture is lyophilized.
- the infusion solution is prepared by reconstituting the lyophilized mFLINT polypeptide using bacteriostatic Water- for-Injection.
- the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
- Associated with such container (s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
- the polypeptides of the present invention may be employed in conjunction with other therapeutic compounds.
- One embodiment of the present invention relates to the substantially purified polypeptide encoded by a mFLINT gene or a mFLINT gene .
- Skilled artisans will recognize that the polypeptides of the present invention can be synthesized by a number of different methods, such as chemical methods well known in the art, including solid phase peptide synthesis or recombinant methods. Both methods are described in U.S. Patent 4,617,149.
- polypeptides may be synthesized by solid-phase methodology utilizing an Applied Biosystems 430A peptide synthesizer (Applied Biosystems, Foster City, CA) and synthesis cycles supplied by Applied Biosystems.
- the polypeptides of the present invention can also be produced by recombinant DNA methods using the cloned FLINT gene. Recombinant methods are preferred if a high yield is desired.
- Expression of the cloned gene can be carried out in a variety of suitable host cells, well known to those skilled in the art.
- the FLINT gene is introduced into a host cell by any suitable means, well known to those skilled in the art . While chromosomal integration of the cloned gene is within the scope of the present invention, it is preferred that the gene be cloned into a suitable extra-chromosomally maintained expression vector so that the coding region of the FLINT gene is operably-linked to a constitutive or inducible promoter.
- the basic steps in the recombinant production of the FLINT polypeptide are: a) constructing a natural, synthetic or semi-synthetic DNA encoding FLINT polypeptide; b) integrating said DNA into an expression vector in a manner suitable for expressing the FLINT polypeptide, either alone or as a fusion polypeptide; c) transforming or otherwise introducing said vector into an appropriate eukaryotic or prokaryotic host cell forming a recombinant host cell; d) culturing said recombinant host cell in a manner to express the FLINT polypeptide; and e) recovering and substantially purifying the FLINT polypeptide by any suitable means well known to those skilled in the art .
- Prokaryotes may be employed in the production of recombinant FLINT polypeptide.
- Escherichia coli K12 strain 294 ATCC No. 31446
- Other strains of E. coli , bacilli such as Bacillus subtilis, enterobacteriaceae such as Salmonella typhimurium or Serratia marcescans, various Pseudomonas species and other bacteria, such as S re omyces, may also be employed as host cells in the cloning and expression of the recombinant polypeptides of this invention.
- Promoter sequences suitable for driving the expression of genes in prokaryotes include -lactamase [e . g. vector pGX2907, ATCC 39344, contains a replicon and -lactamase gene], lactose systems [Chang et al . , Nature_ (London) , 275:615 (1978); Goeddel et al . , Nature (London), 281:544 (1979)], alkaline phosphatase, and the tryptophan (trp) promoter system [vector pATHl (ATCC 37695)], which is designed to facilitate expression of an open reading frame as a trpE fusion polypeptide under the control of the trp promoter.
- trp tryptophan
- Hybrid promoters such as the tac promoter (isolatable from plasmid pDR540, ATCC-37282) are also suitable. Still other bacterial promoters, whose nucleotide sequences are generally known, may be ligated to D ⁇ A encoding the polypeptide of the instant invention, using linkers or adapters to supply any required restriction sites. Promoters for use in bacterial systems also will contain a Shine-Dalgarno sequence operably-linked to the D ⁇ A encoding the desired polypeptides. These examples are illustrative rather than limiting.
- polypeptides of this invention may be synthesized either by direct expression or as a fusion polypeptide comprising the polypeptide of interest as a translational fusion with another polypeptide or peptide that may be removed by enzymatic or chemical cleavage. It often is observed in the production of certain peptides in recombinant systems that expression as a fusion polypeptide prolongs the lifespan, increases the yield of the desired peptide, or provides a convenient means of purifying the polypeptide. This is particularly relevant when expressing mammalian polypeptides in prokaryotic hosts.
- a variety of peptidases e.g.
- enterokinase and thrombin which cleave a polypeptide at specific sites or digest the peptides from the amino or carboxy termini ( e . g. diaminopeptidase) of the peptide chain are known.
- particular chemicals e . g. cyanogen bromide
- cleave a polypeptide chain at specific sites will be cleave a polypeptide chain at specific sites.
- Exemplary mammalian host cells suitable for use in the present invention include HepG-2 (ATCC HB 8065) , CV-1 (ATCC CCL 70), LC-MK 2 (ATCC CCL 7.1), 3T3 (ATCC CCL 92), CHO-K1 (ATCC CCL 61), HeLa (ATCC CCL 2), RPMI8226 (ATCC CCL 155) , H4IIEC3 (ATCC CCL 1600) , C127I (ATCC CCL 1616) , HS- Sultan (ATCC CCL 1484) , and BHK-21 (ATCC CCL 10) , for example .
- a wide variety of vectors are suitable for transforming mammalian host cells.
- the pSV2-type vectors comprise segments of the simian virus 40 (SV40) genome required for transcription and polyadenylation.
- SV40 simian virus 40
- a large number of plasmid pSV2-type vectors have been constructed, such as pSV2-gpt, pSV2-neo, pSV2-dh.fr, pSV2-hyg, and pSV2- - globin, in which the SV40 promoter drives transcription of an inserted gene.
- These vectors are widely available from sources such as the American Type Culture Collection (ATCC) , 12301 Parklawn Drive, Rockville, Maryland, 20852, or the
- Promoters suitable for expression in mammalian cells include the SV40 late promoter, promoters from eukaryotic genes, such as, for example, the estrogen-inducible chicken ovalbumin gene, the interferon genes, the glucocorticoid- inducible tyrosine aminotransferase gene, the thymidine kinase gene promoter, and the promoters of the major early and late adenovirus genes .
- Plasmid pRSVcat (ATCC 37152) comprises portions of a long terminal repeat of the Rous Sarcoma virus, a virus known to infect chickens and other host cells. This long terminal repeat contains a promoter which is suitable for use in the vectors of this invention. H. Gorman et al .
- the plasmid pMSVi (NRRL B-15929) comprises the long terminal repeats of the Murine Sarcoma virus, a virus known to infect mouse and other host cells.
- the mouse metallothionein promoter has also been well characterized for use in eukaryotic host cells and is suitable for use in the present invention.
- This promoter is present in the plasmid pdBPV-MMTneo (ATCC 37224) which can serve as the starting material for the construction of other plasmids of the present invention.
- Transfection of mammalian cells with vectors can be performed by a plurality of well known processes including, but not limited to, protoplast fusion, calcium phosphate co- precipitation, electroporation and the like. See, e . g. , Maniatis et al . , supra .
- viruses also make appropriate vectors. Examples include the adenoviruses, the adeno-associated viruses, the vaccinia virus, the herpes viruses, the baculoviruses, and the rous sarcoma virus, as described in U.S. Patent 4,775,624, incorporated herein by reference.
- the baculovirus pFastBac-1 (GIBCO/BRL) can be used to infect a suitable host cell, such as SF9, to produce recombinant protein.
- Eukaryotic microorganisms such as yeast and other fungi are also suitable host cells.
- the yeast Saccharomyces cerevisiae is the preferred eukaryotic microorganism.
- Other yeasts such as Kluyveromyces lactis and Pichia pastoris are also suitable.
- the plasmid YRp7 (ATCC-40053) , for example, may be used. See, e . g. , L. Stinchcomb et al . , Nature, 282, 39 (1979); J. Kingsman et al . , Gene, 7, 141 (1979); S. Tschemper et al . , Gene, 10, 157 (1980) .
- Plasmid YRp7 contains the TRP1 gene which provides a selectable marker for use in a trpl auxotrophic mutant .
- An expression vector carrying the cloned FLINT gene is transformed or transfected into a suitable host cell using standard methods.
- Cells that contain the vector are propagated under conditions suitable for expression of the recombinant FLINT polypeptide. For example, if the recombinant gene has been placed under the control of an inducible promoter, suitable growth conditions would incorporate the appropriate inducer.
- the recombinantly- produced polypeptide may be purified from cellular extracts of transformed cells by any suitable means.
- the FLINT gene is modified at the 5 ' end to incorporate several histidine residues at the amino terminus of the FLINT polypeptide.
- This "histidine tag” enables a single- step polypeptide purification method referred to as “immobilized metal ion affinity chromatography” (IMAC) , essentially as described in U.S. Patent 4,569,794, which hereby is incorporated by reference.
- IMAC immobilized metal ion affinity chromatography
- nucleic acids that encode Figures 1, 2,3,4. Any of these nucleic acids may be produced by chemical synthetic methods .
- the synthesis of nucleic acids is well known in the art. See, e . g. , E.L. Brown, R. Belagaje, M.J. Ryan, and H.G. Khorana, Methods in Enzymology, 68:109-151 (1979) . Fragments of the DNA sequence corresponding to a FLINT or an mFLINT gene could be generated using a conventional DNA synthesizing apparatus, such as the Model 380A or 380B DNA synthesizers of Applied Biosystems, Inc.
- phosphotriester chemistry may be employed to synthesize nucleic acids used in this invention. See, for example, Gait, M.J., ed. OLIGONUCLEOTIDE SYNTHESIS, A PRACTICAL APPROACH (1984) .
- the DNA sequences disclosed and described herein, comprising, for example, Figure 1 can be produced from a plurality of starting materials. For example, starting with a cDNA preparation (e.g.
- cDNA library derived from tissue that expresses the FLINT gene
- suitable oligonucleotide primers complementary to Figure 1 or to any sub-region therein are prepared as described in U.S. Patent No. 4,889,818.
- Other suitable protocols for the PCR are disclosed in PCR PROTOCOLS: A GUIDE TO METHOD AND APPLICATIONS, Ed. Michael A. Innis et al., Academic Press, Inc. (1990).
- the ribonucleic acids of the present invention may be prepared via polynucleotide synthetic methodology, discussed above, or they may be prepared enzymatically, for example, by using RNA polymerase to transcribe a FLINT DNA template.
- the most preferred systems for preparing the ribonucleic acids of the present invention employ the RNA polymerase from the bacteriophage T7 or the bacteriophage SP6. These RNA polymerases are highly specific, requiring the insertion of bacteriophage-specific sequences at the 5' end of the template to be transcribed. See Maniatis et al . , supra .
- This invention also provides nucleic acids, RNA or DNA, that are complementary to Figures 1-4.
- Vectors Another aspect of the present invention relates to recombinant DNA cloning vectors and expression vectors comprising the nucleic acids of the present invention. The skilled artisan understands that choosing the most appropriate cloning vector or expression vector depends upon a number of factors including the availability of restriction enzyme sites, the type of host cell into which the vector is to be transfected or transformed, the purpose of the transfection or transformation (e.g., stable transformation as an extrachromosomal element, or integration into the host chromosome) , the presence or absence of readily assayable or selectable markers (e.g., antibiotic resistance and metabolic markers of one type and another) , and the number of copies of the gene desired in the host cell.
- readily assayable or selectable markers e.g., antibiotic resistance and metabolic markers of one type and another
- Vectors suitable to carry the nucleic acids of the present invention comprise RNA viruses, DNA viruses, lytic bacteriophages, lysogenic bacteriophages, stable bacteriophages, plasmids, viroids, and the like.
- the most preferred vectors are plasmids.
- an expression vector When preparing an expression vector the skilled artisan understands that there are many variables to be considered, for example, whether to use a constitutive or inducible promoter. The practitioner also understands that the amount of nucleic acid or polypeptide to be produced dictates, in part, the selection of the expression system. Regarding promoter sequences, inducible promoters are preferred because they enable high level, regulatable expression of an operably-linked gene. The skilled artisan will recognize a number of suitable promoters that respond to a variety of inducers, for example, carbon source, metal ions, and heat. Other relevant considerations regarding an expression vector include whether to include sequences for directing the localization of a recombinant polypeptide. For example, a sequence encoding a signal peptide preceding the coding region of a gene is useful for directing the extra- cellular export of a resulting polypeptide.
- the present invention also provides a method for constructing a recombinant host cell capable of expressing polypeptides comprising Figures 1-4.
- This method comprises transforming or otherwise introducing into a host cell a recombinant DNA vector that comprises an isolated DNA sequence as described in any of Figures 1 through 4.
- the preferred host cell is any eukaryotic cell that can accommodate high level expression of an exogenously introduced gene or polypeptide, and that will incorporate said polypeptide into its membrane structure.
- Vectors for expression are those which comprise any of the sequences of Figures 1-4.
- Transformed host cells may be cultured under conditions well known to skilled artisans such that FLINT or mFLINT is expressed, thereby producing a recombinant FLINT or mFLINT polypeptide in the recombinant host cell .
- a FLINT gene is isolated by reverse transcriptase PCR (RT-PCR) using conventional methods.
- First strand FLINT cDNA synthesis is achieved using a commercially available kit (SuperscriptTM System; Life Technologies) by PCR in conjunction with specific primers directed at any suitable region of Figures 1-4.
- Amplification is carried out by adding to the first strand cDNA (dried under vacuum) : 8 ⁇ l of 10X synthesis buffer (200 mM Tris-HCl, pH 8.4; 500 mM KCI, 25 mM MgCl 2 , 1 ug/ul BSA) ; 68 ⁇ l distilled water; 1 ⁇ l each of a 10 uM solution of each primer; and 1 ⁇ l Taq DNA polymerase (2 to 5 U/ ⁇ l) . The reaction is heated at 94° C for 5 minutes to denature the RNA/cDNA hybrid. Then, 15 to 30 cycles of PCR amplification are performed using any suitable thermal cycle apparatus. The amplified sample may be analyzed by agarose gel electrophoresis to check for an appropriately-sized fragment .
- EXAMPLE 2 Production of a Vector for Expressing FLINT in a Host Cell
- An expression vector suitable for expressing FLINT or fragment thereof in a variety of prokaryotic host cells, such as E. coli is easily made.
- the vector contains an origin of replication (Ori) , an ampicillin resistance gene (Amp) useful for selecting cells which have incorporated the vector following a transformation procedure, and further comprises the T7 promoter and T7 terminator sequences in operable linkage to a FLINT coding region.
- Plasmid pETHA Plasmid pETHA
- pETHA is linearized by restriction with endonucleases Ndel and BamHI .
- Linearized pETHA is ligated to a DNA fragment bearing Ndel and BamHI sticky ends and comprising the coding region of the FLINT gene as disclosed by Figures 1-4.
- the FLINT gene used in this construction may be slightly modified at the 5' end (amino terminus of encoded polypeptide) in order to simplify purification of the encoded polypeptide product.
- an oligonucleotide encoding 8 histidine residues is inserted after the ATG start codon. Placement of the histidine residues at the amino terminus of the encoded polypeptide serves to enable the IMAC one-step polypeptide purification procedure .
- An expression vector that carries an open reading frame (ORF) encoding FLINT or fragment thereof and which ORF is operably-linked to an expression promoter is transformed into E. coli BL21 (DE3) (hsdS gal clts857 indlSa ⁇ 7nin5lacUV5-T7gene 1) using standard methods. Transformants, selected for resistance to ampicillin, are chosen at random and tested for the presence of the vector by agarose gel electrophoresis using quick plasmid preparations .
- IMAC immobilized metal ion affinity chromatography
- the bound polypeptide is eluted in any suitable buffer at pH 4.3, or preferably with an imidizole-containing buffer at pH 7.5.
- RNA from different tissues or cultured cells was isolated by a standard guanidine chloride/phenol extraction method, and poly-A + RNA was isolated using oligo (dT) -cellulose type 7
- RNA samples were carried out in formaldehyde followed by capillary transfer to Zeta- ProbeTM nylon membranes (Bio-Rad, Hercules, Calif.).
- Figure 1 was the template for generating probes using a MultiPrimeTM random priming kit (Amersham, Arlington Heights, 111.) .
- the efficiency of the labeling reaction was approximately 4 x 10 10 cpm incorporated per ⁇ g of template.
- the hybridization buffer contained 0.5M sodium phosphate, 7% SDS (wt/vol) , 1% BSA (wt/vol) , and 1 mM EDTA.
- Prehybridization was carried out in hybridization buffer at 65° C for 2 h and 32 P-labeled probe was added and incubation continued overnight.
- the filters were washed in Buffer A (40 mM sodium phosphate pH 7.2, 5% SDS [wt/vol], 0.5% BSA [wt/vol], and 1 mM EDTA) at 65° C for 1 h, and then in Buffer B (40 mM sodium phosphate, pH 7.2, 1% SDS [wt/vol], and 1 mM EDTA) at 65° C for 20 minutes.
- Buffer A 40 mM sodium phosphate pH 7.2, 5% SDS [wt/vol], 0.5% BSA [wt/vol], and 1 mM EDTA
- Buffer B 40 mM sodium phosphate, pH 7.2, 1% SDS [wt/vol]
- the filters were air-dried and exposed to Kodak X- OMAT AR film at -80° C with an intensifying screen
- EXAMPLE 5 Production of an Antibody to a Polypeptide
- Substantially pure polypeptide or fragment thereof is isolated from transfected or transformed cells using any of the well known methods in the art, or by a method specifically disclosed herein. Concentration of polypeptide in a final preparation is adjusted, for example, by filtration through an Amicon filter device such that the level is about 1 to 5 ug/ l .
- Monoclonal or polyclonal antibody can be prepared as follows.
- Monoclonal antibody can be prepared from murine hybridomas according to the method of Kohler and Milstein (Nature, 256, 495, 1975), or a modified method thereof. Briefly, a mouse is repetitively inoculated with a few micrograms of the polypeptide or fragment thereof, or fusion peptide thereof, over a period of a few weeks. The mouse is then sacrificed and the antibody producing cells of the spleen isolated. The spleen cells are fused by means of polyethylene glycol with mouse myeloma cells. Fused cells that produce antibody are identified by any suitable immunoassay, for example, ELISA, as described in E. Engvall, Meth. Enzymol . , 70, 419, 1980.
- Polyclonal antiserum can be prepared by well known methods, as described, for example, by J. Vaitukaitis et . al . , Clin . Endocirnol . Metab. 33, 988 (1971), that involve immunizing suitable animals with the polypeptides, fragments thereof, or fusion polypeptides thereof, disclosed herein. Small doses (e.g., nanogram amounts) of antigen administered at multiple intradermal sites appears to be the most reliable method.
- pIGl-FLINTF a bicistronic expression vector
- IVS/eGFP internal ribosome entry site/enhanced green fluorescent polypeptide
- pGTD mammalian expression vector
- This new vector, designated pIGl contains the following sequence landmarks: the Ela-responsive GBMT promoter (D. T. Berg et al . , 1993 BioTechniques 14:972; D.T. Berg et al .
- the following primers were synthesized: 5'- TAGGGCTGATCAAGGATGGGCTTCTGGACTTGGGCGGCCCC TCCGCAGGCGGACCGGGG-3' ; and 5 ' -AGGGGGGCGGCCGCTGATCATCACTT GTCGTCGTCGTCCTTGTAGTCGTGCA CAGGGAGGAAGCGC - 3'.
- the latter, reverse primer contains the Flag epitope sequence (positions 24-47, double underline) (Micele, R.M. et al . , 1994 J. Immunol. Methods 167:279). These primers were then used to PCR amplify the FLINT cDNA.
- the resultant 1.3 Kb PCR product was then digested with Bell (restriction sites incorporated into primers, underlined above) and ligated into the unique Bell site of pIGl to generate the plasmid pIGl-FLINTF.
- the human FLINT cDNA orientation and nucleotide sequence were confirmed by restriction digest and double stranded sequencing of the insert .
- EXAMPLE 7 Construction of Mammalian FLINT-non-Flag Expression Vector
- pIGl-FLINT the 24-base DNA sequence encoding the eight amino acid FLAG epitope was deleted from the pIGl-FLINTF construct using the Quick Change mutagenesis kit (Stratagene) .
- a 35-base primer, and its complement, with identity to the 19-base sequences flanking the FLAG sequence was synthesized and used for PCR amplification using pIGl- FLINTF the plasmid as template.
- the PCR reaction mixture was digested with Dpnl restriction endonuclease to eliminate the parental DNA, and the PCR product was transformed into Epicurean XLI-blue E.
- EXAMPLE 8 Isolation of a high-producing FLINT clone from AV12 RGT18 transfectants
- the recombinant plasmid carrying the FLINT gene (pIGl- FLINT) encodes resistance to methotrexate .
- the construct contains a gene encoding a fluorescent polypeptide, GFP, on the same transcript and immediately 3' to the FLINT gene. Since high level expression of GFP would require a high level of expression of the FLINT-GFP mRNA, highly fluorescent clones would have a greater probability of producing high levels of FLINT.
- pIGl-FLINT and pIGl- FLINTF were used to transfect AV12 RGT18 cells.
- mFLINT Polypeptide Purification Large scale production of mFLINT was carried out by first growing stable clones stable pIGl-FLINT-containing AV12 RGT 18 cells in several 10 liter spinners. After reaching confluency, cells were further incubated for 2-3 more days to secrete maximum amount of FLINT into media. Media containing mFLINT was adjusted to 0.1% CHAPS and concentrated in an Amicon ProFlux M12 tangential filtration system to 350 ml. The concentrated media was centrifuged at 19,000 rpm (43,000 x g) for 15 minutes and passed over a SP- 5PW TSK-GEL column (21.5 mm x 15 cm; TosoHaas) at a flow rate of 8 ml/min.
- the column was washed with buffer A (20 mM MOPS, 0.1% CHAPS, pH 6.5) until the absorbency (280 nm) returned to baseline and the bound polypeptides were eluted with a linear gradient from 0.1 M-0.3 M NaCl (in buffer A) developed over 85 min.
- Fractions containing mFLINT were pooled and passed over a (7.5 mm x 7.5 cm) Heparin-5PW TSK- GEL column equilibrated in buffer B (50 mM Tris, 0.1% CHAPS, 0.3 M NaCl, pH 7.0) .
- the bound polypeptide was eluted with a linear gradient from 0.3 M-1.0 M NaCl (in buffer B) developed over 60 min.
- Fractions containing mFLINT were pooled and passed over a 1 cm x 15 cm Vydac C4 column equilibrated with 0.1% TFA/H 2 0. The bound mFLINT was eluted with a linear gradient from 0-100% CH 3 CN/0.1% TFA. Fractions containing mFLINT were analyzed by SDS-PAGE and found to be greater than 95% pure and were dialyzed against 8 mM NaP0 4 , 0.5 M NaCl, 10% glycerol, pH 7.4. The N- terminal sequence of mFLINT was confirmed on the purified polypeptide. Mass spectral analysis and Endogylcosidase-F digestion indicates that mFLINT is glycosylated.
- EXAMPLE 10 A. Construction of FLINT-Flag and FLINT Expression Vectors Flag-tagged and native versions of human FLINT were expressed in baculovirus-infected cells in order to generate enough recombinant protein for study.
- the human FLINT cDNA was engineered for expression as follows .
- a pIG3 (a derivative of pIGl; Gerlitz, B and Grinnell, B. W. , unpublished data) expression vector containing the cDNA encoding a FLAG-tagged version of FLINT was cleaved with Xbal and filled in to create blunt ends. The vector was then cleaved with Sail.
- the resulting 918-base pair fragment containing the coding region was gel-purified and ligated into the baculovirus vector pFastBac-1 (GIBCO/ BRL) that had been digested with BamHI, the ends blunted and subsequently digested with Sail generating the plasmid pBacOPG3Flag.
- This construct was designed to express a full-length molecule
- the expression was under the control of the baculovirus polyhedrin promoter.
- a 920-base pair Xbal/ Hindlll cDNA fragment encoding the full-length of the protein previously subcloned into pCDNA3.1 (+/-) [purchased from Invitrogen] was cleaved with Xbal and Hindlll.
- the fragment was gel- purified and ligated into the baculovirus vector pFastBac-1 (GIBCO/ BRL) that had been digested with Xbal and Hindlll generating the plasmid pBacOPG3.
- the two vectors, pBacOPG3Flag and pBacOPG3 were separately used to generate two recombinant baculoviruses (vBacOPG3Flag and vBacOPG3) as described by the vendor (GIBCO/ BRL) .
- Each of the viruses was separately used to infect SF-9 cells for protein production.
- the recombinant proteins were measured in supernatants collected from the infected SF-9 cells by Western-blot and Coomassie stain analyses .
- the nitrocellulose paper was subsequently mixed with the cell lysate containing FasL-Myc, and further incubated on a rotator for 1 hour at room temperature. Secondary and tertiary incubations were performed with anti-myc antibody and anti-mouse IgG-HRP for 1 hour and 30 minutes respectively.
- the polypeptide containing myc epitope was detected by chemiluminescence on X-ray film which showed that mFLINT bound to FasL specifically. No appreciable binding was detected with TNF , TNF , TRAIL, CD40L or TRANCE.
- FLINT-Fas L binding may be confirmed and specifics of binding determined (e . g. , kinetics, specificity, affinity, cooperativity, relative binding pattern, concentration) using real-time biomolecular interaction analysis.
- This technology confers the ability to study biomolecular interactions in real time, without labeling any of the interactants .
- it takes advantage of the optical phenomenon surface plasmon resonance, and detection depends on changes in the mass concentration of macromolecules at the biospecific interface. Interactions are followed in real time, so that kinetic information is readily derived. In many cases, investigations can be performed without prior purification of components.
- FasLigand binds Fas and mFLINT with different affinities.
- FLINT and Fas 100 ng of each were adsorbed on to an ELISA plate.
- hFasLigand Fra-tagged was added at different concentrations to a maximum concentration of 300 ng down to 0.1 ng on TBST plus a 0.1% solution containing 1 microgram/ml of M2 Abs.
- anti- mouse-Abs-HRP 3000 dilution, Bio-Rad was added to the wells.
- visualization enzymatic reaction using ABTS as a substrate was performed. The table below shows the data.
- Non-tissue treated 24 well plates (Decton Dickinson, Mansfield, MA) were coated with 0.5 ml of 1 ug/ml anti-CD3 (Farmingen) in PBS for 90 min at 37 °C. The plate was washed once with PBS. 1 ml of 1 X 10 6 cell/ml was seated in each well with or without following treatment: 10 ⁇ M DEVD- cmk, 1 ug OPG2-FC, 1 or 2 ug of mFLINT and 1 ug anti FasL Ab . mFLINT was made according to Examples 8 and 9.
- Jurkat cells apoptosis One milliliter of 1 x 10 6 cell/ml was added into each well of 24 well tissue culture plate and treated with following reagents: soluble Fas L (200 ng) , Fas L plus 1 ug mFLINT, Fas L plus 1 ug OPG2-FC, Trail (200 ng) , Trail plus 1 ug mFLINT. Cells were incubated overnight at 37 °C and then stained with Annexin V and PI. Cell apoptosis was analyzed by flow cytometer (FACS) . mFLINT was made according to Examples 8 and 9.
- mFLINT Measuring the effect of mFLINT in a dose-dependent manner on anti-CD3 induced Jurkat apoptosis The same steps for plate coating and cell treatment set out in Example 13 were followed except a different amount of mFLINT was added into each well . mFLINT was made according to Examples 8 and 9. The following table indicates the amounts added:
- LTT, 2, 14, 11 cells see Glasebrook, Eur . J . Immunol . 17: 1561-65 (1987), were used in this Annexin V assay.
- a 96 well plate was coated with anti-CD3 (2C11) at a serial dilutions.
- 100,000 LTT cells were added, in 50 ⁇ l of medium per well, along with 50 ⁇ l of medium to the control wells and 50 ⁇ l of medium containing:
- LIGHT Binding experiments To confirm the dot blot binding between LIGHT and mFLINT, 293 cells were transiently transfected with LIGHT expression construct overnight. On the next day, cells were detached and incubated with mFLINT-Flag on ice. The Flag epitope was subsequently detected by anti-Flag conjugated with fluorochrome and the cells population that shows specific binding with mFLINT was detected by flow cytometer. As a control we used vector transfected cells. To make sure that the binding was specific, a competition assay with 10 fold access of untagged mFLINT was performed.
- Cells were incubated on ice for 30 minutes and washed with PBS/BSA, 0.1%. Cells then were exposed either to anti- human IgG-biotin, 1 g/ml (for detection of HVEM) , or to M2- biotin, 2 ⁇ g/ml (for detection of flag conjugates) . Cells were incubated on ice for 30 minutes and washed with PBS/BSA, 0.1%. Thereafter, cells were exposed to streptavidin Alexa 488 (SIGMA) at a 1:1000 dilution. Again, cells were incubated on ice for 30 minutes and washed with PBS/BSA, 0.1%. Cells were analyzed using a FACSORT flow cytometer (Decton Dickinson) to determine binding.
- SIGMA streptavidin Alexa 488
- the cell surface binding assay using flow cytometer confirmed that peaks shifted only when LIGHT expressing cells were stained with mFLINT-Flag was used (data not shown) . There was no shift in the control cells when stained with mFLINT-Flag. The shifted peak was completely reversed to baseline peak when the cells were preincubated with 10 fold excess of non tagged mFLINT thereby preoccupying all the binding sites for mFLINT-Flag.
- the activity of the polypeptides of the present invention against acute inflammation and apoptosis was determined using the following procedure. Briefly,
- mice (Harlan) per each experimental group were given intravenous injections (the lateral tail vein) of 6 mg of D(+) -Galactosamine (Sigma, 39F-0539) in 100 ⁇ l of PBS (GIBCO-BRL) and 3 ⁇ g of Lipopolysaccharide B E. coli 026 :B6 (LPS) (Difco, 3920-25-2) in 100 ⁇ l of PBS.
- the LPS was administered, via i.v. injection, 5 minutes after the galactosamine, which was administered i.v.
- mice After LPS challenge, the animals were injected intraperitoneally with mFLINT (200 ⁇ g) , Hamster IgG (500 ⁇ g, Cappel, 30926) , mAb against murine TNF, TN3-19.12 (500 ⁇ g, Sheehan K.C.F. et al J. Immunol. 1989. 142: 3884), and Anti-mouse Fas Ligand (500 ⁇ g, PharMingen, MO24301) at 0, 2, 4, 6 hour-point respectively.
- the survival rates of the mice were determined 24 and 48 hours after LPS injection. In mice challenged with 3 ⁇ g of LPS after IP injection of 200 ⁇ g mFLINT polypeptide (FLINT) had a positive effect on animal survival .
- Figure 5 compares the effects of administering 200 ⁇ g mFLINT, i.v., and other molecules before and after challenge with LPS/GalN.
- both anti-TNF and mFLINT treatment resulted in 100% survival of mice.
- Figure 6 shows that when 400 ug of mFLINT was administered i.p. to mice, 2 hours before challenge with LPS and GalN, 100% of the animals were alive 48 hours after
- LPS/GalN dosing If 400 ug of anti-TNF was given i.p. two hours before LPS/GalN challenge, about 95% of the animals survived to 48 hours. In contrast, only 20% of those animals not treated with mFLINT survived 48 hours. Administration of IgG two hours before LPS/GalN only increased the survival rate to 30%.
- Figure 6 shows that lowering the dose of mFLINT to 50 ug still had a protective effect.
- Figure 7 shows that the effect of 100 g mFLINT on survival is the same, whether given ip or iv, 12 or 2 hours before LPS/GalN administration.
- mFLINT is given 4 hours after LPS/GalN administration, iv administration results in 100% survival, and IP administration results in 80% survival.
- This Figure also shows the dose/response relationship of the 4-hour post-LPS/GalN dose, given iv. 50 ug gave 80% survival, 10 ug gave 40% survival, 5 ug gave 20% survival and 1 ug gave only about 2% survival .
- This example demonstrates the usefulness of mFLINT in the treatment of cerebral ischemia, which is clinically relevant in stroke, head trauma and other similar disorders.
- Adult male gerbils (70 to 80 g body weight, Charles River Laboratories, Wilmington, MA) were anesthetized by i.p. injections of sodium pentobarbital (Nembutal) 40 mg/kg, and additional i.p. injections of 10 mg/kg when necessary to maintain a surgical plane of anesthesia. Animals were placed on a thermostatically controlled heating blanket to maintain body temperature at 37 °C. The ventral surface of the neck was exposed, the fur shaved, and the skin cleaned with 2% iodine solution.
- the fur on the dorsal surface of the head was shaved and the skin cleaned with 2% iodine solution.
- the gerbil ' s head was secured in a stable position by means of a stereotaxic apparatus (SA) and a midline incision was made to expose the skull.
- SA stereotaxic apparatus
- the skull was thinned by a dental drill equipped with a drill bit of 0.5 mm in diameter.
- the thinned area was punctured with a microsyringe equipped with a 27-guage blunt needle inserted 3 mm deep for a bolus injection of 5 ul (0.63 mg/ml ) of mFLINT in phosphate buffer saline (PBS).
- mFLINT was made according to Examples 8 and 9.
- the syringe needle was exchanged for an infusion cannula [3 mm in length] of a brain infusion assembly connected to an Alzet osmotic pump (Alza Corp., Palo Alto, CA) which reservior was placed under the skin on the shoulder of the gerbil .
- the infusion cannula was anchored on the surface of the skull using dental cement .
- the wound was closed by surgical suture .
- the Alzet osmotic pump containing mFLINT solution (0.63 mg/ml) or PBS delivered continuously at a rate of 1 ul/h for 3 days. Gerbils were allowed to survive for 5 days (the surgery day was taken as day zero) .
- the gerbils were sacrificed in a C02 chamber. Thoracotomy was performed for transcardiac perfusion of saline for 3 minutes and formaldehyde for 2 minutes . The brains were removed for histological processing following a standard procedure commonly adapted in the field. Coronal sections were obtained at approx. 1.7 mm posterior to the bregma. After staining with Cresyl violet, the sections were viewed under a microscope at 4Ox magnification for cell counter quantification of the intact hippocampal neurons along the dorsal CAl regions (0.5 mm in length) of both hemispheres. Data were analyzed by Student t-Test and the Wilcoxon ranking test .
- TREATMENT GROUPS Number of
- a single cell suspension of B16 melanoma cells was prepared from a brie of donor tumors.
- Tumor cells (2 x 10 6 ) were implanted subcutaneously in a hind-leg of Male C57B1 mice from Taconic Farms on day 0. Treatment was initiated on day 4.
- mFLINT or OPG2 was administered by intravenous injection into a tail vein once daily on days 4 through 13 for a total of 10 injections.
- mFLINT was made according to Examples 8 and 9. An overview of the protocol is shown above.
- Tumor response was monitored by tumor volume measurements as determined by caliper measurements of two dimensions of the tumors on days 4, 8, 11, 17, 21, 25, 30 and 34. Tumor volume was calculated as a hemi-ellipsoid. The animals were weighed on the same schedule described above .
- the control tumors reached a volume of 500 mm 3 on day 17.4 ⁇ 0.3 and 1000 mm 3 on day 21.1 ⁇ 0.3.
- the tumors of the animals treated with mFLINT reached a volume of 500 mm 3 on day 19.3 ⁇ 0.3 and reached 1000 mm 3 on day 23.0 ⁇ 0.4.
- the tumors of the animals treated with OPG2 reached a volume of 500 mm 3 on day 185. ⁇ 0.4 and reached 1000 mm 3 on day 22.2 + 0.4. Therefore, the tumor growth delay produced by mFLINT was 1.8 days and the tumor growth delay produced by OPG2 was 1.1 days .
- tumor volume after 20 days was approximately 730 mm 3 in mFLINT-treated mice, but the tumor volume of control mice was approximately 1000 mm 3 .
- mice 6 weeks of age are purchased from Jackson Laboratories (Bar Harbor, Maine) .
- the mice are housed three to a cage and given free access to food (Purina 5001) and water. After one week of acclimatization, the mice are bled by tail snip, and blood glucose and plasma insulin are measured. Blood glucose is measured by tail snip without anesthetic using a Precision G blood glucose analyzer
- mice are then arbitrarily placed into three groups, control, mFLINT- injected, and OPG2-injected. Following assigning of the mice to groups, body weight and blood glucose are determined once weekly. Beginning at the onset of overt diabetes (blood glucose >200mg%; -14 weeks of age) mice are injected once daily intraperitoneally with either mFLINT (50 ⁇ g/day) or OPG2 (50 ⁇ g/day) diluted in PBS. Control mice are injected with an equal volume of PBS.
- mice After 2 weeks of injection, mice are anesthetized by inhalation anesthesia (carbon dioxide) and blood is removed by cardiac puncture for measurement of glucose and insulin. Additionally, the pancreas is harvested by the Animal Studies Support Team and fixed in zinc-formalin for 24 hours for subsequent histochemical analysis of ⁇ cell integrity (hematoxolin and eosin) and immunohistochemical staining for insulin (George Sanduskys laboratory) .
- mFLINT is made according to Examples 8 and 9.
- mFLINT inhibits apoptosis is an in vi tro model that mimics ischemia reperfusion injury. These date indicate that mFLINT is useful in preventing and treating such injury.
- Ventricular cardiomyocytes were isolated from the hearts of 1-3 day-old neonatal rats by trypsin digestion and non-myocytes were eliminated by pre-plating. Primary cultures were plated in special-coated 96-well plates in serum-free medium. Hypoxia was induced by incubating cultures in glucose- free and oxygen-free (5% Co 2 and 95% N 2 ) for 8 hours. Reperfusion was mimicked by a 16 hour incubation in glucose- containing medium under normal oxygen conditions.
- cardiomyocyte apoptosis was measured by the cytoplasmic nucleosome-associated DNA ELISA method.
- Test samples were incubated with mFLINT (2 g/ml or 5 g/ml) and control samples with Z-YVAD-fmk (50 M) , a commercial caspase inhibitor.
- mFLINT was made according to Examples 8 and 9. To confirm these data and to query whether the observed inhibition was Fas-mediated, cardiomyocyte apoptosis was induced by incubation with soluble FasL, and apoptosis was measured as above.
- apoptosis was inhibited either by anti-Fas neutralizing antibody (1 g/ml) or mFLINT (10 g/ml) .
- mFLINT inhibits apoptosis, and indicated that it does so, at least in part, by inhibiting the FasL-Fas apoptotic pathway.
- Murine Osteoclast Differentiation Assay The co-culture method of Takahashi et al . (Endocrinology 123:2600 1988) was modified as described in Galvin et al . (Endocrinology 137:2457 1996) and used to study the effects of various agents on osteoclast differentiation. mFLINT was made according to Examples 8 and 9.
- mice Male Balb/C mice (4-8 weeks old) were euthanized with C0 2 , the femurs removed, and the marrow flushed out of the femurs with growth medium. Bone marrow cells were pelleted by centrifugation at 500 x g for 6 min. and resuspended in the growth medium (RPMI 1640 plus 5% heat inactivated fetal bovine-serum and 1% antibiotic-antimycotic solution) .
- RPMI 1640 plus 5% heat inactivated fetal bovine-serum and 1% antibiotic-antimycotic solution RPMI 1640 plus 5% heat inactivated fetal bovine-serum and 1% antibiotic-antimycotic solution
- the marrow population (5 x 10 4 cells/cm 2 ) was seeded in tissue culture dishes in which BALC cells (a stable cell line derived from neonatal mouse calvariae, 1.5 x 10 4 cells/cm 2 ) had been plated 2 h prior to addition of bone marrow.
- the cells were cultured for 7 days in a humidified incubator at 37°C with 5% C0 2 with medium changes on days 3 and 5. Cultures were treated with or without 10 "8 M l,25-(OH) 2 D 3 on days 0, 3, and 5.
- the cells were treated with or without secreted mFLINT protein purified from the conditioned medium of cells transfected with mFLINT gene ( Figure 1) .
- Neonatal pigs (aged 1-5 days) were euthanized with C0 2 , the appendages were rinsed with 70% ethanol, the soft tissues were removed, and the humeri, radii, ulnae, femora, tibiae and fibulae were excised.
- the long bones were placed in ice-cold calcium and magnesium-free Hank's balanced salt solution (CMF-HBSS, Gibco BRL) and cleaned of all soft tissues. The bones were split longitudinally and the endosteal surfaces were scraped to remove both the marrow and trabecular bone.
- CMF-HBSS Hank's balanced salt solution
- the suspension of trabecular bone particles and marrow cells was agitated by vigorous shaking and passed through a 200 mm and then 100 mm sieve.
- Cells were centrifuged at 500 x g for 10 minutes at 4°C, the pellet was resuspended in CMF-HBSS, and then separated on a Ficoll-Paque gradient (Pharmacia, Piscataway, NJ) .
- the mononuclear cell fraction from the gradient was washed twice in CMF-HBSS and passed through a 35 mm sieve.
- the cells were suspended in growth medium consisting of a-MEM (pH 7.2, which was modified to contain 8.3 mM NaHC0 3 (Gibco BRL, Grand Island, NY) ) , 10% heat-inactivated fetal bovine serum (FBS, Hyclone, Logan, UT) and 2% antibiotic/antimycotic solution (Gibco BRL, Grand Island, NY) and seeded onto tissue culture dishes at a density of 1 x 10 6 cells/cm 2 .
- a typical marrow cell yield was between 1-2 x 10 9 cells/animal, which varied with the size of the animal.
- the cells were incubated at 37°C in a humid incubator with 5% C0 2 .
- nonadherent cells were removed and seeded in either 24-well cluster dishes at a density of 7.5 x 10 5 cells/cm 2 in growth medium which did or did not contain 10 "8 M l,25-(OH) 2 D 3 (Biomol, Plymouth Meeting, PA) and mFLINT protein (obtained as in Examples 8 and 9) .
- Cells were cultured for up to 10 days with medium changes every 48-72 h with growth medium that did or did not contain l,25-(OH) 2 D 3 and mFLINT. Following 5 days of culture, the cells were fixed with formalin (3.7% for 10 min) and then stained for tartrate-resistant acid phosphatase (TRAP) as in Example 6. The number of osteoclasts (TRAP-positive cells containing 3 or more nuclei) was quantitated. Results are reported in the following table .
- CFU-E colony forming units- erythroid cells
- CFU-GM colony forming units- erythroid cells
- CFU-GEMM more primitive, granulocyte erythroid monocyte megakaryocyte cells
- Fig. 10 shows the bone marrow cell count (xlOOO) .
- the values were: control cells: 3,300; FasL- treated cells: 3,000; anti-FasL-treated cells: 4,200; mFLINT-treated cells: 4,900.
- C- CD34+ cells - This experiment is designed to determine whether mFLINT or anti-FasL antibody can improve the recovery of progenitor cells from purified human CD34+ progenitor cells.
- Purified human CD34+ cells (1 x 10 6 /ml ) are stimulated with 100 U/ml of human IL-6 and 100 ng/ml of human SCF, with or without mFLINT or anti-FasL antibody for 3 days in vitro to expand progenitor cells. Following this expansion and treatment, cells are counted and a CFU assay is conducted.
- This example demonstrates the construction of transgenic mice expressing FLINT. These animals express significant levels of FLINT, yet demonstrate no adverse effects, which indicates that FLINT has a favorable toxicity profile. These animals are also useful in further delineating useful treatment protocols for the conditions set out above .
- PCR Polymerase chain reaction
- AAGGATGGGCTTCTGGACTT-3' a Bglll restriction site and the 3' primer, 5' -GGACTAGTCCTGATCATCACTTGTCGTCGTCGTCCTT-3 ' , contained an Spel restriction enzyme site. These were used to amplify the entire FLINT and FLAG coding region. The amplified 1.1 kb fragment was ligated into the multiple cloning site of plasmid pMTmcs2 generating plasmid pMTmcs2- FLINT (6.7 kb) . See Fox et al, Eur. J. Pharmacol. 308:195 (1996) .
- the FLINT gene fragment was excised from pMTmcs2-FLINT by Bglll and Spel digestion and gel-purified. This fragment then was blunted with Klenow enzyme and ligated into the Klenow-blunted Mlul site of plasmid pLIV.7, provided by John Taylor of the J. David Gladstone Institutes. See Fan et al., Proc. Nat'l Acad. Sci. 91:8724 (1994).
- Resultant plasmid pLIV7-FLINT also contains the apo E gene promoter/5' flanking region and an hepatic enhancer sequences called the "hepatic control region" (HCR) .
- HCR hepatic control region
- a 7.0 kb DNA fragment encompassing the Apo E gene promoter-FLINT/FLAG-HCR fusion gene was excised from plasmid pLIV7-FLINT by digestion with Sail and Spel and purified by gel electrophoresis and glass bead extraction.
- Transgenic animal development Transgenic mice were generated using established techniques described, for example, by Hogan, B. et al . (1986) MANIPULATING THE MOUSE EMBRYO: A LABORATORY MANUAL, Cold Spring Harbor Laboratory (Cold Spring Harbor, NY) , as modified by Fox and Solter, Molec. Cell. Biol. 8: 5470 (1988). Briefly, the 7.0 kb DNA fragment encompassing the Apo E gene promoter-FLINT-HCR fusion gene was microinjected into the male pronuclei of newly fertilized one-cell-stage embryos (zygotes) of the FVB/N strain. The embryos were cultured in vi tro overnight to allow development to the two-cell-stage.
- Two-cell embryos were then transplanted into the oviducts of pseudopregnant CD-l strain mice to allow development to term.
- a small piece of toe was removed from each animal and digested with proteinase K to release the nucleic acids.
- a sample of the toe extract was subsequently subjected to PCR analysis using human FLINT-specific primers to identify transgene- containing mice.
- Five founder transgenic mice were identified as containing a FLINT transgene and were designated 6494, 7262, 7353, 7653 and 7659. Each of these founders was bred to produce stable lines of transgenics. Line 6494 has been extensively characterized for transgene expression and pathology.
- This bone marrow cell dose typically results in about 50% survival at 30 days for wild type animals that have been irradiated as described herein.
- Obtain 50-100 ⁇ l of blood by tail bleed on days 7, 15, 21, and 30 days post-transplant and perform hematological analysis to monitor recovery of peripheral blood (n 10 mice per group; total of 20 mice) .
- the hematological analysis will include a white blood cell count (WBC) , red blood cell count (RBC) , hematocrit, and blood smear microscopy to determine numbers of lymphocytes, neutrophils, eosinophils, platelets, mast cells and monocytes in the blood. Measure survival of mice and recovery of peripheral blood cells.
- Blood is collected by tail bleed every 7 days up to day 30 and a complete hematological analysis is conducted.
- the hematological analysis will include a white blood cell count (WBC) , red blood cell count (RBC) , hematocrit, and blood smear microscopy to determine numbers of lymphocytes, neutrophils, eosinophils, platelets, mast cells and monocytes in the blood.
- WBC white blood cell count
- RBC red blood cell count
- hematocrit hematocrit
- blood smear microscopy to determine numbers of lymphocytes, neutrophils, eosinophils, platelets, mast cells and monocytes in the blood.
- On days 12 and 20, 3 mice from each group are sacrificed. From these mice, spleen cellularity and bone marrow cellularity are analyzed. Also, the bone marrow cells are pooled and used to set up CFU assays to examine progenitor content .
- D- FLINT effects on peripheral mobilization of progenitor cells This experiment is designed to test for testing peripheral mobilization of progenitor cells.
- FLINT transgenic and control mice are treated with 3 mg of 5-FU i.p. and 4 days later, either CFU assays will be set up from isolated bone marrow cells, or lOOng of GM-CSF will be administered i.p. every day for 3 days followed by determination of bone marrow cellularity and progenitor content by CFU assays.
- the protocols for transplantation are described above in Example B.
- Applications for gene therapy would be to improve the recovery of progenitor cells following stimulation with cytokines either in vivo, or in vitro, for transduction with retrovirus, as described above.
- Ventilation measures include use of PEEP and low tidal volume .
- treatment with FLINT is initiated in the ER as an iv bolus of 2.5 mg/kg, followed by a continuous infusion of 0.1 mg/minute .
- FLINT along with aggressive supportive measures (e.g., positive ventilation, intravenous fluids, pressors, and nutritional support) are continued for four days in the ICU, at which time the FLINT is discontinued. Over the following 3 days, the patient begins to recover and is extubated on Day 8. He has an uneventful recovery and 6 months following discharge has no evidence of residual lung disease by blood gas and spirometry.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Veterinary Medicine (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Physical Education & Sports Medicine (AREA)
- Rheumatology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Vascular Medicine (AREA)
- Pulmonology (AREA)
- Heart & Thoracic Surgery (AREA)
- Cardiology (AREA)
- Urology & Nephrology (AREA)
- Cell Biology (AREA)
- Toxicology (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CA002358508A CA2358508A1 (fr) | 1998-12-22 | 1999-12-21 | Applications therapeutiques de polypeptides flint |
JP2000589204A JP2003520761A (ja) | 1998-12-22 | 1999-12-21 | Flintポリペプチドの治療用への適用 |
EP99966602A EP1140138A2 (fr) | 1998-12-22 | 1999-12-21 | Applications therapeutiques de polypeptides flint |
AU22111/00A AU2211100A (en) | 1998-12-22 | 1999-12-21 | Therapeutic applications of flint polypeptides |
Applications Claiming Priority (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US11340798P | 1998-12-22 | 1998-12-22 | |
US60/113,407 | 1998-12-22 | ||
USPCT/US99/06797 | 1999-03-30 | ||
PCT/US1999/006797 WO1999050413A2 (fr) | 1998-03-30 | 1999-03-30 | APPLICATIONS THERAPEUTIQUES DE POLYPEPTIDES mFLINT MURS, OU DE OPG3 EN TANT QUE MEMBRE DE LA SUPERFAMILLE DU RECEPTEUR DU TNF |
US17223999P | 1999-10-20 | 1999-10-20 | |
US60/172,239 | 1999-10-20 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2000037094A2 true WO2000037094A2 (fr) | 2000-06-29 |
WO2000037094A3 WO2000037094A3 (fr) | 2000-11-09 |
Family
ID=27378725
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1999/030734 WO2000037094A2 (fr) | 1998-12-22 | 1999-12-21 | Applications therapeutiques de polypeptides flint |
Country Status (5)
Country | Link |
---|---|
EP (1) | EP1140138A2 (fr) |
JP (1) | JP2003520761A (fr) |
AU (1) | AU2211100A (fr) |
CA (1) | CA2358508A1 (fr) |
WO (1) | WO2000037094A2 (fr) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2002009668A2 (fr) * | 2000-08-02 | 2002-02-07 | Eli Lilly And Company | Administration de flint (proteine inhibitrice du ligand fas) par voie pulmonaire |
US7186800B1 (en) | 1997-01-14 | 2007-03-06 | Human Genome Sciences, Inc. | Tumor necrosis factor 6α and 6β |
US7285267B2 (en) | 1997-01-14 | 2007-10-23 | Human Genome Sciences, Inc. | Tumor necrosis factor receptors 6α & 6β |
WO2022074236A3 (fr) * | 2020-10-09 | 2022-07-07 | Ucl Business Ltd | Traitement thérapeutique |
Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1998030694A2 (fr) * | 1997-01-14 | 1998-07-16 | Human Genome Sciences, Inc. | RECEPTEURS 6α ET 6β DU FACTEUR DE NECROSE TUMORALE |
EP0861850A1 (fr) * | 1997-02-04 | 1998-09-02 | Smithkline Beecham Corporation | Récepteurs TR4, liés à la nécrose tumorale |
WO1999004001A1 (fr) * | 1997-07-21 | 1999-01-28 | Zymogenetics, Inc. | Recepteur ztnfr-5 du facteur de necrose tumorale |
WO1999007738A2 (fr) * | 1997-08-06 | 1999-02-18 | Regeneron Pharmaceuticals, Inc. | Nouveau recepteur orphelin |
WO1999014330A1 (fr) * | 1997-09-18 | 1999-03-25 | Genentech, Inc. | HOMOLOGUE DU TNFR APPELE POLYPEPTIDE DcR3 |
WO1999026977A1 (fr) * | 1997-11-24 | 1999-06-03 | Biogen, Inc. | Recepteurs 'opg-2' |
WO1999050413A2 (fr) * | 1998-03-30 | 1999-10-07 | Eli Lilly And Company | APPLICATIONS THERAPEUTIQUES DE POLYPEPTIDES mFLINT MURS, OU DE OPG3 EN TANT QUE MEMBRE DE LA SUPERFAMILLE DU RECEPTEUR DU TNF |
-
1999
- 1999-12-21 EP EP99966602A patent/EP1140138A2/fr not_active Withdrawn
- 1999-12-21 CA CA002358508A patent/CA2358508A1/fr not_active Abandoned
- 1999-12-21 WO PCT/US1999/030734 patent/WO2000037094A2/fr not_active Application Discontinuation
- 1999-12-21 JP JP2000589204A patent/JP2003520761A/ja not_active Withdrawn
- 1999-12-21 AU AU22111/00A patent/AU2211100A/en not_active Abandoned
Patent Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1998030694A2 (fr) * | 1997-01-14 | 1998-07-16 | Human Genome Sciences, Inc. | RECEPTEURS 6α ET 6β DU FACTEUR DE NECROSE TUMORALE |
EP0861850A1 (fr) * | 1997-02-04 | 1998-09-02 | Smithkline Beecham Corporation | Récepteurs TR4, liés à la nécrose tumorale |
WO1999004001A1 (fr) * | 1997-07-21 | 1999-01-28 | Zymogenetics, Inc. | Recepteur ztnfr-5 du facteur de necrose tumorale |
WO1999007738A2 (fr) * | 1997-08-06 | 1999-02-18 | Regeneron Pharmaceuticals, Inc. | Nouveau recepteur orphelin |
WO1999014330A1 (fr) * | 1997-09-18 | 1999-03-25 | Genentech, Inc. | HOMOLOGUE DU TNFR APPELE POLYPEPTIDE DcR3 |
WO1999026977A1 (fr) * | 1997-11-24 | 1999-06-03 | Biogen, Inc. | Recepteurs 'opg-2' |
WO1999050413A2 (fr) * | 1998-03-30 | 1999-10-07 | Eli Lilly And Company | APPLICATIONS THERAPEUTIQUES DE POLYPEPTIDES mFLINT MURS, OU DE OPG3 EN TANT QUE MEMBRE DE LA SUPERFAMILLE DU RECEPTEUR DU TNF |
Non-Patent Citations (1)
Title |
---|
G. MATUTE-BELLO ET AL: "Soluble Fas Ligand induces epithelial cell apoptosis in humans with acute lung injury (ARDS)" JOURNAL OF IMMUNOLOGY., vol. 163, no. 4, 15 August 1999 (1999-08-15), pages 2217-2225, XP002137439 BALTIMORE US * |
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7186800B1 (en) | 1997-01-14 | 2007-03-06 | Human Genome Sciences, Inc. | Tumor necrosis factor 6α and 6β |
US7285267B2 (en) | 1997-01-14 | 2007-10-23 | Human Genome Sciences, Inc. | Tumor necrosis factor receptors 6α & 6β |
US7534428B2 (en) | 1997-01-14 | 2009-05-19 | Human Genome Sciences, Inc. | Antibodies to tumor necrosis factor receptors 6α and 6β |
US7709218B2 (en) | 1997-01-14 | 2010-05-04 | Human Genome Sciences, Inc. | Tumor necrosis factor receptors 6α and 6β |
WO2002009668A2 (fr) * | 2000-08-02 | 2002-02-07 | Eli Lilly And Company | Administration de flint (proteine inhibitrice du ligand fas) par voie pulmonaire |
WO2002009668A3 (fr) * | 2000-08-02 | 2002-05-10 | Lilly Co Eli | Administration de flint (proteine inhibitrice du ligand fas) par voie pulmonaire |
WO2022074236A3 (fr) * | 2020-10-09 | 2022-07-07 | Ucl Business Ltd | Traitement thérapeutique |
Also Published As
Publication number | Publication date |
---|---|
AU2211100A (en) | 2000-07-12 |
JP2003520761A (ja) | 2003-07-08 |
EP1140138A2 (fr) | 2001-10-10 |
CA2358508A1 (fr) | 2000-06-29 |
WO2000037094A3 (fr) | 2000-11-09 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20040167074A1 (en) | Therapeutic applications of mFLINT polypeptides | |
JP4411330B2 (ja) | 腫瘍壊死因子関連リガンド | |
US6207802B1 (en) | Stem cell factor and compositions | |
US5989537A (en) | Methods for stimulating granulocyte/macrophage lineage using thrombopoietin | |
US7067477B2 (en) | Canine erythropoietin gene and recombinant protein | |
US6248319B1 (en) | Method for increasing hematopoietic progenitor cells by stem cell factor polypeptides | |
EP1326974B1 (fr) | Procedes relatifs a l'utilisation de polypeptide lie a l'interleukine 17 (il-17) humaine pour le traitement de maladies- | |
WO1997047321A1 (fr) | Utilisation de proteines chimeres regulatrices du complement du virus vaccinal pour inhiber ledit complement | |
JP2001526532A (ja) | オステオプロテゲリン結合性蛋白および受容体 | |
JP3750819B2 (ja) | C−kit受容体に対するリガンド及びその使用法 | |
US7144731B2 (en) | SCF antibody compositions and methods of using the same | |
JPH08501314A (ja) | Hgfによる肝臓障害に対する保護 | |
US20050054567A1 (en) | Use of il-19,il-22 and il-24 to treat hematopoietic disorders | |
JP2005506287A5 (fr) | ||
EP1140138A2 (fr) | Applications therapeutiques de polypeptides flint | |
US20020069422A1 (en) | New polypeptides and peptides, nucleic acids coding for them, and their use in the field of tumor therapy, inflammation or immunology | |
US6207454B1 (en) | Method for enhancing the effciency of gene transfer with stem cell factor (SCF) polypeptide | |
ZA200005157B (en) | Therapeutic applications of mature flint (mFLINT) polypeptides or OPG3, a member of the TNF receptor superfamily. | |
US20040236088A1 (en) | Novel polypeptide analogs and fusions and their methods of use | |
MXPA00009523A (en) | THERAPEUTIC APPLICATIONS OF MATURE FLINT (mFLINT) POLYPEPTIDES OR OPG3, A MEMBER OF THE TNF RECEPTOR SUPERFAMILY | |
WO2001028582A2 (fr) | Applications therapeutiques de polypeptides de flint | |
US20040072745A1 (en) | Therapeutic methods of use for lp229 | |
WO1998055141A9 (fr) | Procedes et produits pour induire l'apoptose des cellules neuroendocrines a l'aide de proteine stimulant les macrophages | |
AU3657599A (en) | Canine erythropoietin gene and recombinant protein | |
WO2003065981A2 (fr) | Methodes d'utilisation therapeutiques de lp229 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
ENP | Entry into the national phase in: |
Ref document number: 2358508 Country of ref document: CA Ref country code: CA Ref document number: 2358508 Kind code of ref document: A Format of ref document f/p: F |
|
ENP | Entry into the national phase in: |
Ref country code: JP Ref document number: 2000 589204 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1999966602 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 1999966602 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1999966602 Country of ref document: EP |