WO1998055141A9 - Procedes et produits pour induire l'apoptose des cellules neuroendocrines a l'aide de proteine stimulant les macrophages - Google Patents

Procedes et produits pour induire l'apoptose des cellules neuroendocrines a l'aide de proteine stimulant les macrophages

Info

Publication number
WO1998055141A9
WO1998055141A9 PCT/US1998/011573 US9811573W WO9855141A9 WO 1998055141 A9 WO1998055141 A9 WO 1998055141A9 US 9811573 W US9811573 W US 9811573W WO 9855141 A9 WO9855141 A9 WO 9855141A9
Authority
WO
WIPO (PCT)
Prior art keywords
leu
gly
pro
msp
stimulating protein
Prior art date
Application number
PCT/US1998/011573
Other languages
English (en)
Other versions
WO1998055141A1 (fr
Inventor
Mary E Sunday
Christopher Willet
Original Assignee
Brigham & Womens Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Brigham & Womens Hospital filed Critical Brigham & Womens Hospital
Publication of WO1998055141A1 publication Critical patent/WO1998055141A1/fr
Publication of WO1998055141A9 publication Critical patent/WO1998055141A9/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A61K38/1833—Hepatocyte growth factor; Scatter factor; Tumor cytotoxic factor II

Definitions

  • SCLC small cell lung carcinoma
  • LCLC large cell anaplastic carcinoma
  • NSCLC non-small cell carcinomas
  • the tumors often recur a few months after chemo- or radiation-therapy, after which the patient is usually refractory to these therapeutic modalities.
  • the tumor can be initially localized to the lung, but inevitably undergoes metastasis to other organs such as the liver, lymph nodes, bone and/or brain.
  • the median survival time of SCLC patients is 1 year.
  • neuroendocrine cells were identified in the airway branch points of the lung tissue many years ago based on their similarity to the Kultchitzky cells in the gut, the relevance of these cells to lung development and to normal lung maintenance was not understood until recently. (Feyrter, F., Virchows Archiv., (1954) 325:723-732). More recent evidence demonstrated the presence of innervated clusters of silver-stained neuroendocrine cells which express the neurotransmitter, vasoactive amine serotonin (5-HT), in human infant airway epithelium, called neuroepithelial bodies (NEBs).
  • 5-HT vasoactive amine serotonin
  • Pulmonary neuroendocrine cells appear to play an important role during human embryonic development. Recent evidence has suggested that pulmonary neuroendocrine cells are derived from the endoderm (Cutz, E., "Lung Carcinomas: Current Problems in Tumor Pathology", McDowell, EM., ed., Edinburgh, Churchill Livingstone, p. 1-41 (1987) and Andrew A., J. Embryol. Exp. Morphol, (1974) 31:589-598) and that these cells are the first epithelial cells to differentiate, suggesting that pulmonary neuroendocrine cell differentiation may be functionally important for facilitating differentiation of the other non-neuroendocrine epithelial cell types.
  • Isolated pulmonary neuroendocrine cells were first observed at human gestational week 8-9 by ultrastructural, immunohistochemical, and in situ hybridization analysis. (Sunday, 1997, Supra). By weeks 9-10 of gestation, the pulmonary neuroendocrine cells begin to cluster and form NEBs. The pulmonary neuroendocrine cell clusters account for the majority of neuroendocrine cells in the lung by 20 weeks of gestation. (Sunday, 1997, Supra). After neuroendocrine clusters have formed within the developing fetal lung, the clusters become innervated by both sympathetic and sensory, non-adrenergic, non-cholinergic nerve fibers, thus forming NEBs. By the time the fetus is fully developed very few isolated neuroendocrine cells remain in the lung.
  • neuroendocrine cells in other tissues such as the trachea exist as isolated neuroendocrine cells and relatively few clusters of neuroendocrine cells are present.
  • Pulmonary neuroendocrine cells are also believed to play a role in postnatal lung. Many studies have indicated that pulmonary neuroendocrine cells function as chemosensors in regulating adaptative responses to various environmental factors, such as oxygen, nicotine, and nitrosamines in post-natal lung. For instance, it was observed that NEBs respond to acute airway hypoxia in newborn rabbits by increasing secretion of neuropeptides and amines from the dense-core vesicles.
  • NEBs may play a role in modulating airway and vascular smooth muscle tone in response to airway hypoxia by regulating the release of neuropeptides and amines which can act on other local cells.
  • DPI NADPH oxidase
  • pulmonary neuroendocrine cells Some species of animals which live under constant hypoxic conditions at high altitudes tend to demonstrate increased numbers of pulmonary neuroendocrine cells. (Gosney, J.R., Anat. Rec, (1993) 236:105-107). This phenomenon has been referred to as pulmonary neuroendocrine cell hyperplasia based on the assumption that increased numbers of immunopositive pulmonary neuroendocrine cells represent a proliferative response to the hypoxic conditions. In animal studies of short term chronic hypoxia, however, specific increases in the neuro secretory granule marker calcitonin gene-related peptide (CGRP) within pulmonary neuroendocrine cells, but not increases in the early cytoplasmic marker PGP 9.5 were demonstrated.
  • CGRP neuro secretory granule marker calcitonin gene-related peptide
  • Pulmonary neuroendocrine cell hyperplasia can occur in response to chemical stimuli as well as hypoxic conditions. Pulmonary neuroendocrine cell hyperplasia resulting from chemical stimuli is likely to be due primarily to neuroendocrine differentiation rather than proliferation. Chemicals such as nitrosamine carcinogens, nicotine, and cigarette smoke have all been demonstrated to induce pulmonary neuroendocrine cell hyperplasia. The chemical effect is believed to occur by stimulation of cholinergic-nicotinic receptors present on pulmonary neuroendocrine cells.
  • Small cell lung carcinoma appears to be derived from an undifferentiated cell which is either identical or very similar to a stem cell having a partial neuroendocrine phenotype. Although not classified as neuroendocrine tumors, many non-small cell lung carcinomas are now known to express neuroendocrine markers suggesting a common lineage for most of the major forms of lung cancer. (Berentsen, H., et al., J. Clin. Oncol, (1989) 7:1614-1620).
  • tumor suppressor genes such as the retinoblastoma gene and p53
  • the concept that the loss of genetic material or the inactivation of a gene plays an important role in human cancer is based on the original observation that somatic cell hybrids between tumor cells and normal cells were no longer tumorigenic. This indicated that normal cells contain genes coding for tumor suppressors whose function was absent in cancer cells.
  • cytogenetic and restriction fragment length polymorphism (RFLP) analyses have established an association between the loss of genetic material on specific chromosomes and the development of various human malignancies.
  • VHL 3p25von Hippel- Lindau
  • a single mutation affecting the VHL has been described in 1 of 33 small cell carcinoma cell lines but not in any cell lines derived from 33 non-small cell lung carcinomas or 2 carcinoids.
  • the role of the candidate 3pl4 tumor suppressor gene FHIT in lung cancer is also controversial.
  • the identification of genetic lesions predisposing an individual to malignancy in airway epithelial cells would represent a major advance in preventing further tissue damage, permitting early molecular diagnosis and developing therapeutics aimed at preventing overt tumorigenesis.
  • HGF hepatocyte growth factor
  • HGF is identical to scatter factor (SF or HGF/SF) a cytokine secreted from certain fibroblasts that enhances movement and causes the dissociation and scattering of mammary epithelial cells in culture (Gherardi, E., et al., Hepatocyte Growth Factor-Scatter Factor (HGF-SF) and the C-Met Receptor, ed. I.D. Goldberg and E.M. Rosen, Birkhauser Verlag, Basel Switzerland (1993)). Although HGF/SF has a protease domain this domain is believed to be inactive. HGF/SF is composed two subunits (A and B) held together in a highly folded structure by disulfide bonds.
  • a and B subunits held together in a highly folded structure by disulfide bonds.
  • the A subunit includes a preactivation peptide (PAP) domain at the N-terminal region of the subunit and a kringle domain which is a 3-disulf ⁇ de, triple-loop structure spanning approximately 80 residues.
  • the cell surface receptor for HGF is the proto-oncogene c-met, a tyrosine kinase.
  • Macrophage stimulating protein (MSP) also known as HGF-like protein and L5/3, is a protein which shares similarities with HGF-SF in terms of domain structure and predicted lack of protease activity. It has been suggested that MSP is possibly a competitive inhibitor of HGF- SF (Gherardi, et al. Supra).
  • the amino acid sequences of MSP and HGF are only 50% identical to one another, the 4 kringle domains and serine protease like domain are shared by each.
  • the MSP protein includes 3 potential N-linked cleavage sites, a potential serine protease active site including amino acids, Gin, Gin, and Tyr positioned at 522, 568, and 661 , and a putative signal sequence at the N- terminal of the protein.
  • kringle domains in MSP is unknown, kringles in general appear to be protein-binding domains and have been shown to be essential for the function of prothrombin, plasminogen and tissue plasminogen activator.
  • MSP protein is cleaved between amino acids 483 and 484 but that the two subunits remain together by disulfide bonds.
  • the two subunits of MSP have been identified as an ct-chain of 53 kDa and a ⁇ -chain of 25 kDa. (Yoshimura et al, J. Biol. Chem., (1993) 268:15461-15468).
  • the receptor for MSP is a heterodimeric transmembrane glycoprotein, known as the RON receptor or pi 85 RON .
  • the RON receptor which is expressed mainly on cells of epithelial origin and monocytes possesses intrinsic tyrosine kinase activity.
  • the RON receptor is synthesized as a single chain precursor, it is converted into a mature heterodimeric protein by proteolytic cleavage having a ⁇ (150kDa) and an ⁇ (35kDa) subunit prior to being delivered to the cell surface.
  • the RON receptor is structurally similar to the HGF receptor (c-met), binding of HGF to the RON receptor does not stimulate tyrosine kinase activity.
  • MSP binding of MSP to the c-met receptor does not activate c-met.
  • MSP has been proposed to be useful in the treatment of pathogenic infections (Leonard, et al., US Patent No. 5,219,991) and for stimulating thrombocyte production and megakaryocyte maturation (Avraham, et al, PCT International Patent Application, WO96/14082).
  • An MSP fusion protein referred to as MSP-NK2 having the N-terminal region including the first two kringle domains of MSP fused to a C-terminal region of the human IgG-gamma 1 heavy chain is also disclosed as being functionally active in the Avraham et al. patent
  • the MSP has also been proposed to be useful for stimulating cell growth and proliferation.
  • the invention encompasses methods and products for treating neuroendocrine tumors, methods for inducing apoptosis in a neuroendocrine cell expressing a RON receptor, and a method for screening a subject for susceptibility to treatment with an MSP molecule.
  • the invention is based on the unexpected finding that MSP induces apoptosis of neuroendocrine cells.
  • MSP RNA is low or undetectable in preneoplastic neuroendocrine cells and pulmonary carcinoid tumors, the MSP tyrosine kinase receptor. RON receptor is present and functional on these neuroendocrine cells. When MSP is administered to neuroendocrine cells expressing RON receptor, the result is apoptosis.
  • the invention is a method for prophylactically treating a neuroendocrine cell-derived tumor in a subject.
  • the method involves the step of administering a MSP molecule to a subject at risk of developing a neuroendocrine cell-derived tumor in an amount effective to induce apoptosis in a neuroendocrine cell expressing a RON receptor in the subject.
  • the subject is otherwise free of symptoms calling for treatment with a MSP molecule.
  • the invention is a method for treating a neuroendocrine cell-derived tumor in a subject having a neuroendocrine cell-derived tumor.
  • the method involves the step of administering a MSP molecule to a subject in need of such treatment in an amount effective to induce apoptosis in a neuroendocrine cell expressing a RON receptor in the subject.
  • the subject is otherwise free of symptoms calling for treatment with a MSP molecule.
  • the MSP molecule is a MSP- encoding nucleic acid ("MSP nucleic acid").
  • MSP nucleic acid is selected from the group consisting of (a) an intact MSP nucleic acid, and (b) a functionally equivalent fragment of a MSP nucleic acid encoding a functionally equivalent fragment of a MSP polypeptide.
  • the intact MSP nucleic acid has a nucleic acid sequence of SEQ ID NO: 1.
  • the MSP molecule is a MSP polypeptide.
  • the MSP polypeptide is selected from the group consisting of (a) an intact MSP polypeptide, and (b) a functionally equivalent fragment of a MSP polypeptide.
  • the intact MSP polypeptide has an amino acid sequence of SEQ ID NO:2.
  • the subject has or is at risk of developing a neuroendocrine cell-derived tumor which is a small cell lung carcinoma.
  • the MSP molecule is administered to the subj ect by an aerosol route of delivery.
  • the aerosol includes a surfactant vehicle.
  • the invention is a method for inducing apoptosis in a neuroendocrine cell expressing a RON receptor.
  • the method involves the step of contacting a neuroendocrine cell expressing the RON receptor with a MSP molecule in an amount effective for inducing apoptosis in the neuroendocrine cell expressing the RON receptor.
  • the neuroendocrine cell expressing the RON receptor is contacted with MSP molecule in vitro.
  • the neuroendocrine cell expressing the RON receptor is in a subject and the MSP molecule is administered to the subject in vivo.
  • the subject is otherwise free of symptoms calling for treatment with a MSP molecule.
  • the invention is a method for screening a neuroendocrine cell for susceptibility to MSP induced apoptosis.
  • the method involves the step of detecting the presence of a RON receptor molecule in a neuroendocrine cell, wherein the presence of the RON receptor molecule indicates that the cell is susceptible to MSP induced apoptosis.
  • the presence of the RON receptor is detected by contacting the RON receptor molecule with a detection reagent that selectively binds to the RON receptor molecule to detect the presence of the RON receptor molecule.
  • the RON receptor molecule is a RON receptor mRNA
  • the detection reagent is a nucleic acid that selectively hybridizes to the RON receptor mRNA and the cell is contacted with the detection reagent under conditions that permit selective hybridization of the nucleic acid to the RON receptor mRNA.
  • the RON receptor molecule is a RON receptor polypeptide
  • the detection reagent is a RON receptor binding peptide
  • the RON receptor polypeptide is contacted with the detection reagent under conditions that permit selective binding of the RON receptor binding peptide to the RON receptor polypeptide.
  • the method includes the step of isolating the RON receptor molecule from the cell and contacting the isolated RON receptor molecule with the detection reagent.
  • a method for screening a subject for susceptibility to treatment with a MSP molecule is provided. The method involves the steps of isolating a neuroendocrine cell from a subject, and detecting the presence of a RON receptor molecule in the neuroendocrine cell, wherein the presence of the RON receptor molecule indicates that the cell is susceptible to MSP induced apoptosis.
  • the presence of the RON receptor is detected by contacting the RON receptor molecule with a detection reagent that selectively binds to the RON receptor molecule to detect the presence of the RON receptor molecule.
  • the RON receptor molecule is isolated from the cell and is contacted with the detection reagent.
  • the RON receptor molecule is a RON receptor mRNA
  • the detection reagent is a nucleic acid that selectively hybridizes to the RON receptor mRNA and the cell is contacted with the detection reagent under conditions that permit selective hybridization of the nucleic acid to the RON receptor mRNA.
  • the RON receptor molecule is a RON receptor polypeptide
  • the detection reagent is a RON receptor binding peptide
  • the RON receptor polypeptide is contacted with the detection reagent under conditions that permit selective binding of the RON receptor binding peptide to the RON receptor polypeptide.
  • the invention is a pharmaceutical composition.
  • the pharmaceutical composition includes one or more doses of a MSP molecule, and a pharmaceutical preparation formulated as an aerosol for inhalation.
  • the pharmaceutical composition includes an anti-tumor agent.
  • the composition is formulated as an aerosol, preferably, in a surfactant vehicle.
  • the MSP molecule is a MSP nucleic acid.
  • the MSP nucleic acid is selected from the group consisting of (a) an intact MSP nucleic acid, and (b) a functionally equivalent fragment of a MSP nucleic acid encoding a functionally equivalent fragment of a MSP polypeptide.
  • the intact MSP nucleic acid has a nucleic acid sequence of SEQ ID NO: 1.
  • the MSP molecule is a MSP polypeptide.
  • the MSP polypeptide is selected from the group consisting of (a) an intact MSP polypeptide, and (b) a functionally equivalent fragment of a MSP polypeptide.
  • the intact MSP polypeptide has an amino acid sequence of SEQ ID NO:2.
  • a use of a MSP molecule in the manufacture of a medicament for treating a neuroendocrine cell derived tumor in a subject having a neuroendocrine cell derived tumor is provided.
  • the MSP molecule is present in the medicament in an amount effective to induce apoptosis in a neuroendocrine cell expressing a RON receptor.
  • a use of a MSP molecule in the manufacture of a medicament for prophylactically treating a neuroendocrine cell derived tumor in a subject at risk of developing a neuroendocrine cell derived tumor is provided.
  • the MSP molecule is present in the medicament in an amount effective to induce apoptosis in a neuroendocrine cell expressing a RON receptor.
  • Figure 1 is a graph depicting the effect of MSP on neuroendocrine cell adhesion in a H835 carcinoid cell line cultured in the presence or absence of MSP for 5 days.
  • Figure 2 is a bar graph depicting the kinetics of MSP induced apoptosis.
  • Figure 3 is an RNAse protection assay demonstrating MSP induced expression of apoptosis-related genes.
  • Figure 4 is an immunoprecipitation assay demonstrating JNK1 and ERK1 MAPK induction.
  • Figure 5 is a graph depicting the kinetics of MSP induced apoptosis in the presence of MEK inhibitor.
  • SEQ ID NO: 1 is the nucleotide sequence of the human MSP cDNA (GenBank Accession No. M74178).
  • SEQ ID NO:2 is the predicted amino acid sequence of the polypeptide encoded by the human MSP cDNA (GenBank Accession No. M74178).
  • SEQ ID NO:3 is the nucleotide sequence of the mouse MSP cDNA (GenBank Accession No. M74181).
  • SEQ ID NO:4 is the predicted amino acid sequence of the polypeptide encoded by the mouse MSP cDNA (GenBank Accession No. M74181).
  • SEQ ID NO:5 is the nucleotide sequence of the synthetic oligonucleotide sense primer for mouse beta actin.
  • SEQ ID NO:6 is the nucleotide sequence of the synthetic oligonucleotide antisense primer for mouse beta actin.
  • SEQ ID NO: 7 is the nucleotide sequence of the synthetic oligonucleotide probe for mouse beta actin.
  • SEQ ID NO:8 is the nucleotide sequence of the synthetic oligonucleotide sense primer for human gamma actin.
  • SEQ ID NO:9 is the nucleotide sequence of the synthetic oligonucleotide antisense primer for human gamma actin.
  • SEQ ID NO: 10 is the nucleotide sequence of the synthetic oligonucleotide probe for human gamma actin.
  • SEQ ID NO:l 1 is the nucleotide sequence of the synthetic oligonucleotide sense primer for mouse MSP.
  • SEQ ID NO: 12 is the nucleotide sequence of the synthetic oligonucleotide antisense primer for mouse MSP.
  • SEQ ID NO: 13 is the nucleotide sequence of the synthetic oligonucleotide probe for mouse MSP.
  • SEQ ID NO: 14 is the nucleotide sequence of the synthetic oligonucleotide sense primer for human MSP.
  • SEQ ID NO: 15 is the nucleotide sequence of the synthetic oligonucleotide antisense primer for human MSP.
  • SEQ ID NO: 16 is the nucleotide sequence of the synthetic oligonucleotide sense probe for human MSP.
  • SEQ ID NO: 17 is the nucleotide sequence of the synthetic oligonucleotide sense primer for human RON receptor.
  • SEQ ID NO: 18 is the nucleotide sequence of the synthetic oligonucleotide antisense primer for human RON receptor.
  • SEQ ID NO: 19 is the nucleotide sequence of the synthetic oligonucleotide sense probe for human RON receptor.
  • SEQ ID NO:20 is the nucleotide sequence of the human RON receptor cDNA (GenBank Accession No. X70040).
  • SEQ ID NO:21 is the predicted amino acid sequence of the polypeptide encoded by the human RON receptor cDNA (GenBank Accession No. X70040).
  • the present invention in based on the unexpected finding that an MSP molecule induces apoptosis in a neuroendocrine cell expressing a RON receptor.
  • MSP stimulates the growth of cells.
  • Degen, S. J. reports that MSP is useful as an in vitro growth promoter, particularly for hepatocytes. (US Patent No., 5,315,000).
  • Applicants set out to study the effects of MSP in neuroendocrine cells with the expectation that MSP would function as a growth promoter in these cells. Surprisingly, the results of these studies revealed that MSP induces apoptosis of neuroendocrine cells.
  • MSP might be useful as a therapeutic for inhibiting the growth of neuroendocrine based tumors.
  • MSP expression is inhibited in preneoplastic and neoplastic epithelial cells. This inhibition may be the result of a deletion of the entire MSP gene, a mutation or deletion in the MSP gene, inactivation of a factor(s) responsible for inducing the expression of MSP, or the presence of an inhibitory factor which inhibits the expression of MSP.
  • neuroendocrine tumors may arise as a result of the deletion of DNA sequences from the short arm of chromosome 3
  • lack of MSP expression in preneoplastic and neoplastic neuroendocrine cells does not always correlate with this genetic deletion.
  • MSP tyrosine kinase
  • RON receptor which is a tyrosine kinase can initiate a signal transduction pathway by phosphorylating a protein or group of proteins.
  • MSP is the molecule which prevents a hamster model of pulmonary neuroendocrine hyperplasia from developing neuroendocrine tumors in response to treatment with effectors which cause lung injury and may lead to the formation of neuroendocrine tumors.
  • hamsters are treated with nitrosamines and hyperoxic conditions for 10 months these animals develop non-neuroendocrine lung tumors which are similar to human non-small cell lung carcinomas but which do not develop neuroendocrine tumors.
  • the development of neuroendocrine cell hyperplasia which occurs in response to this treatment is due primarily to neuroendocrine cell differentiation and/or increased cell survival rather that neuroendocrine cell proliferation in these animals.
  • MSP and RON receptor are induced in hamsters treated with nitrosamines and hyperoxic conditions and that this induction correlated with an induction of apoptosis in the neuroendocrine cells of these animals. These results indicate that MSP and RON receptor are involved in preventing the development of neuroendocrine tumors in animals which are capable of expressing both MSP and RON receptor.
  • the invention is directed to a method for prophylactically treating a neuroendocrine tumor by administering a MSP molecule to a subject at risk of developing a neuroendocrine tumor.
  • the invention is directed to a method for treating a neuroendocrine tumor by administering a MSP molecule to subject having a neuroendocrine tumor.
  • the MSP molecule is administered to the subject having or at risk of developing a neuroendocrine tumor in an amount effective to induce apoptosis in a neuroendocrine cell expressing a RON receptor.
  • a subject at risk of developing a neuroendocrine tumor refers to any subject who has a greater probability of acquiring or developing a neuroendocrine tumor than the probability of a normal, healthy subject to acquire or develop a neuroendocrine tumor.
  • Environmental conditions which predispose a subject to a risk of developing a neuroendocrine tumor are well known to those of skill in the art. For instance, a subject exposed to chemicals such as nicotine, radon gas, ozone, tobacco smoke, nitrosamines or other carcinogens or exposed to chronic hyperoxic conditions or other conditions causing lung injury has a greater probability of acquiring or developing a neuroendocrine cell derived tumor than a subject not exposed to such conditions.
  • Subjects who have previously been diagnosed as having any lung cancer and who have had the first primary tumor treated by resection, radiation and/or chemotherapy are a particularly preferred class of subjects at risk of developing a neuroendocrine-cell-derived cancer as a second primary tumor.
  • Subjects at risk of developing a neuroendocrine tumor often will develop such a tumor after chronic exposure to environmental conditions.
  • MSP will induce apoptosis in neuroendocrine cells which are stimulated to proliferate by the environmental factors. In this manner, the MSP functions as it does in the hamster model discussed above to prevent the development of neuroendocrine tumors.
  • prevent refers to inhibiting the development of a tumor, as well as to decreasing the rate of progression of the development of a tumor.
  • a neuroendocrine tumor refers to a tumor which has originated from uncontrolled proliferation of cells having a neuroendocrine phenotype. Accordingly, the development of neuroendocrine tumors can be assessed by the histological, molecular and microscopy methods discussed below in reference to the detection of neuroendocrine cells in a tissue.
  • Exemplary neuroendocrine tumors are known to those of ordinary skill in the art and include, but are not limited to, the following types of tumors: small cell lung carcinoma, atypical and typical carcinoids, or any tumor with neuroendocrine features such as neurosecretory-type dense-core granules or containing PGP9.5- or chromogranin immunoreactivity.
  • the MSP molecules of the invention are used to treat pulmonary neuroendocrine cell derived tumors such as small cell lung carcinoma.
  • MSP molecules are capable of inducing apoptosis in neuroendocrine cells expressing a RON receptor.
  • a neuroendocrine cell is an epithelial cell which produces and secretes neuropeptides and amines.
  • Pulmonary neuroendocrine cells are a group of specific epithelial cells which are morphologically and functionally distinct from one another and which are found within the lung as either isolated neuroendocrine cells or as neuroepithelial bodies (NEB).
  • Isolated neuroendocrine cells include small granule cells, argyrophil cells, APUD cells, Kultschitzky-like cells, and enterochromaffin-like cells.
  • Neuroepithelial bodies include innervated pulmonary neuroendocrine cell clusters and intraepithelial organoids.
  • the differentiated neuroendocrine phenotype is strikingly similar in all pulmonary neuroendocrine cells.
  • All mature pulmonary neuroendocrine cells have chemical and structural properties in common such as for example, epithelial localization, dense-core neurosecretory-type granules where secretory peptides and the amine 5-HT (hydroxytryptamine) are stored, common neuropeptides and other markers, low mitotic rate, and paracrine effects on neighboring epithelial cells.
  • the presence of neuroendocrine cells in tissue can easily be measured by methods known in the art.
  • electron microscopy can be used to identify the presence of dense-core vesicles of various sizes which is a classic phenotypic marker of neuroendocrine cells.
  • Immuno- electron microscopy may also be used to identify the localization of specific peptides or other antigens at the subcellular level.
  • Silver staining e.g., Grimelius (argyrophil reaction) Fontana- Masson (argentaffin reaction) of tissue identifies amine-containing cells, which include both neuroendocrine cells and neurons.
  • pulmonary neuroendocrine cells are high in 5- HT and pulmonary nerve fibers are usually detected with argyrophilic silver staining.
  • Formaldehyde-induced fluorescence also detects the presence of amines such as catecholamines or 5-HT.
  • Granules can be identified by lead hematoxylin which binds to the granules.
  • PAS-lead hematoxylin is more sensitive than lead hematoxylin because the periodic acid Schiff (PAS) interacts with peripheral glycols or glycol amino groups on carbohydrates or glycoproteins, thus providing a stronger stain.
  • Nonspecific esterase histochemistry and immunohistochemistry are also useful for detecting neuroendocrine cells.
  • Neuroendocrine cells can also be identified by specific cellular markers. The markers can be detected at a protein or RNA level or in the intact tissue using immunohistochemistry techniques.
  • Cell surface markers of pulmonary neuroendocrine cells include but are not limited to CDlO/neutral endopeptidase 24.11 (CD10/NEP), neural cell adhesion molecule (N/CAM), and leukocyte-7/human natural killer cell antigen (LEU7).
  • Cytoplasmic markers of pulmonary neuroendocrine cells include, but are not limited to, neuron-specific enolase (NSE), protein gene product 9.5 (PGP9.5), creatine phosphokinase BB isoform, and DOPA decarboxylase (DDC).
  • NSE neuron-specific enolase
  • PGP9.5 protein gene product 9.5
  • DDC DOPA decarboxylase
  • Markers of pulmonary neuroendocrine cells found in neurosecretory granules include, but are not limited to, chromogranin A (CGA), synaptophysin, serotonin (5-HT), gastrin-releasing pepfide/bombesin-like peptide (GRP/BLP), calcitonin gene-related peptide (CGRP), calcitonin, cholecystokinin (CCK), substance P, enkephalin, ACTH, and hCG.
  • Pulmonary neuroendocrine cells in normal human fetal lung express a wide spectrum of neuro peptides including BLP, GRP, CGRP, calcitonin, CCK and endothelin, as well as 5-HT.
  • Neuropeptides which have been demonstrated to be expressed in injured postnatal lung but not in fetal lung include leu- enkelphin, human chorionic gonadotropin (hCG), and ACTH.
  • Markers can be detected by standard methods of gene and protein detection. For instance, methods for detection and/or quantitation of gene expression in the lung include methods of detecting specific mRNA either quantitatively with Northern blots, SI nuclease, RNAse protection, RT-PCR, or localization detection means such as in situ hybridization and in situ PCR. Methods for quantitation of peptide levels in a given tissue may be measured using radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISA), and immuno PCR or localized by immunohistochemistry and enzyme histochemistry. When neuroendocrine cells expressing RON receptor are contacted with MSP, the cells are induced to undergo apoptosis.
  • RIA radioimmunoassay
  • ELISA enzyme-linked immunosorbent assays
  • Apoptosis is a term of art which refers to programmed cell death. Apoptosis results in an inhibition in cell growth which is associated with several apoptosis markers. For instance, the formation of apoptotic bodies in neuroendocrine cells indicates that these cells have undergone apoptosis.
  • An exemplary assay to determine whether a cell has undergone apoptosis is provided in the Examples below. Other such assays are well known by those of skill in the art and may be used to determine whether a cell has undergone apoptosis.
  • MSP molecule embraces both "MSP nucleic acids” and “MSP polypeptides” (discussed below).
  • the MSP molecules of the invention are isolated molecules.
  • isolated as used herein in reference to a nucleic acid molecule, means a nucleic acid sequence: (i) amplified in vitro by, for example, polymerase chain reaction (PCR); (ii) synthesized by, for example, chemical synthesis; (iii) recombinately produced by cloning; or (iv) purified, as by cleavage and gel separation.
  • isolated means a polypeptide encoded by an isolated nucleic acid sequence, as well as polypeptides synthesized by, for example, chemical synthetic methods, and polypeptides separated from biological materials, and then purified using conventional protein analytical procedures.
  • MSP nucleic acid refers to a nucleic acid molecule which: (1) hybridizes under stringent conditions to a nucleic acid having the sequence of SEQ ID NO: 1 and (2) codes for a MSP polypeptide (i.e., a polypeptide which induces neuroendocrine cell apoptosis).
  • the preferred MSP nucleic acid has the nucleic acid sequence of SEQ ID NO: 1 (the nucleic acid encoding the human MSP polypeptide).
  • the MSP nucleic acids of the invention may be intact MSP nucleic acids which include the nucleic acid sequence of Sequence ID No. 1 as well as homologs and alleles of a nucleic acid having the sequence of SEQ ID NO: 1.
  • Intact MSP nucleic acids further embrace nucleic acid molecules which code for the MSP polypeptide having the sequence of SEQ ID NO:2 (the human MSP polypeptide) but which differ from the sequence of SEQ ID NO:l in codon sequence due to the degeneracy of the genetic code.
  • the MSP nucleic acids of the invention may also be functionally equivalent variants, analogs and fragments of the foregoing nucleic acids. "Functionally equivalent", in reference to a MSP nucleic acid variant, analog or fragment, refers to a nucleic acid that codes for a MSP polypeptide that is capable of inducing neuroendocrine cell apoptosis.
  • the invention further embraces complements of the foregoing nucleic acids or of unique fragments of the foregoing nucleic acids.
  • Such complements can be used, for example, as antisense nucleic acids for inhibiting the expression of MSP in a cell in order to create an experimental model of a cell in which MSP is not expressed.
  • the MSP nucleic acid molecules of the invention can be identified by conventional techniques, e.g., by identifying nucleic acid sequences which code for MSP polypeptides and which hybridize to a nucleic acid molecule having the sequence of SEQ ID NO: 1 under stringent conditions.
  • stringent conditions refers to parameters with which the art is familiar. More specifically, stringent conditions, as used herein, refer to hybridization at 65 °C in hybridization buffer (3.5 x SSC, 0.02% Ficoll, 0.02% polyvinyl pyrolidone, 0.02% bovine serum albumin, 2.5mM NaH 2 PO 4 (pH 7), 0.5% SDS, 2mM EDTA).
  • SSC 0.15M sodium chloride/0.15M sodium citrate, pH 7; SDS is sodium dodecyl sulphate; and EDTA is ethylenediaminetetraacetic acid.
  • SSC 0.15M sodium chloride/0.15M sodium citrate, pH 7; SDS is sodium dodecyl sulphate; and EDTA is ethylenediaminetetraacetic acid.
  • homologs and alleles typically will share at least 40% nucleotide identity with SEQ ID NO:l; in some instances, will share at least 50% nucleotide identity; and in still other instances, will share at least 60% nucleotide identity.
  • the preferred homologs have at least 70% sequence homoiogy to SEQ ID NO:l. More preferably the preferred homologs have at least 80%) and, most preferably, at least 90% sequence homoiogy to SEQ ID NO:l.
  • the invention also includes degenerate nucleic acids which include alternative codons to those present in the naturally occurring nucleic acid that codes for the human MSP polypeptide.
  • serine residues are encoded by the codons TCA, AGT, TCC, TCG, TCT and AGC.
  • Each of the six codons is equivalent for the purposes of encoding a serine residue.
  • any of the serine- encoding nucleotide codons may be employed to direct the protein synthesis apparatus, in vitro or in vivo, to incorporate a serine residue.
  • nucleotide sequence triplets which encode other amino acid residues include, but are not limited to, CCA, CCC, CCG and CCT (proline codons); CGA, CGC, CGG, CGT, AGA and AGG (arginine codons); ACA, ACC, ACG and ACT (threonine codons); AAC and AAT (asparagine codons); and ATA, ATC and ATT (isoleucine codons).
  • Other amino acid residues may be encoded similarly by multiple nucleotide sequences.
  • the invention embraces degenerate nucleic acids that differ from the naturally occurring nucleic acids in codon sequence due to the degeneracy of the genetic code.
  • the invention also provides complements of the foregoing MSP nucleic acids and complements of unique fragments of SEQ ID NO: l .
  • a unique fragment is one that is a 'signature' for the larger nucleic acid. It, for example, is long enough to assure that its precise sequence is not found in molecules outside of the MSP gene. As will be recognized by those skilled in the art, the size of the unique fragment will depend upon its conservancy in the genetic code. Thus, some regions of SEQ ID NO:l, will require longer segments to be unique while others will require only short segments, typically between 12 and 32 base pairs (e.g. 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 and 32 bases long).
  • the invention also embraces antisense oligonucleotides that selectively bind to a MSP nucleic acid molecule, to reduce the expression of MSP and thereby favor the development of a neuroendocrine tumor by default.
  • Antisense oligonucleotides are useful, for example, for preparing an animal model of a subject at risk of developing a neuroendocrine tumor. Such animal models can be used in screening assays for identifying therapeutic drugs other than MSP which prevent or reduce the risk of the development of a neuroendocrine tumor in a subject at risk of developing such a tumor.
  • antisense oligonucleotide or “antisense” describes an oligonucleotide which hybridizes under physiological conditions to DNA comprising a particular gene or to an RNA transcript of that gene and, thereby, inhibits the transcription of that gene and/or the translation of the mRNA.
  • the antisense molecules are designed so as to hybridize with the target gene or target gene product and thereby, interfere with transcription or translation of the target mammalian cell gene.
  • the exact length of the antisense oligonucleotide and its degree of complementarity with its target will depend upon the specific target selected, including the sequence of the target and the particular bases which comprise that sequence.
  • the antisense oligonucleotide be constructed and arranged so as to bind selectively with the target under physiological conditions, i.e., to hybridize substantially more to the target sequence than to any other sequence in the target cell under physiological conditions.
  • the antisense oligonucleotides should comprise at least 7 and, more preferably, at least 15 consecutive bases which are complementary to the target.
  • the antisense oligonucleotides comprise a complementary sequence of 20-30 bases.
  • oligonucleotides may be chosen which are antisense to any region of the gene or RNA (e.g., mRNA) transcripts
  • the antisense oligonucleotides are complementary to 5' sites, such as translation initiation, transcription initiation or promoter sites, that are upstream of the gene that is targeted for inhibition by the antisense oligonucleotides.
  • 5'-untranslated regions may be targeted.
  • 5 ' or 3' enhancers may be targeted. Targeting to mRNA splice sites has also been used in the art but may be less preferred if alternative mRNA splicing occurs.
  • the antisense is targeted, preferably, to sites in which mRNA secondary structure is not expected (see, e.g., Sainio et al., Cell Mol. NeurobioL, (1994) 14(5):439-457) and at which proteins are not expected to bind.
  • the selective binding of the antisense oligonucleotide to a mammalian target cell nucleic acid effectively decreases or eliminates the transcription or translation of the mammalian target cell nucleic acid molecule. Reduction in transcription or translation of the nucleic acid molecule is desirable in preparing an animal model for further defining the role played by the mammalian target cell nucleic acid in modulating an adverse medical condition.
  • the MSP nucleic acid in one embodiment, is operably linked to a gene expression sequence which directs the expression of the MSP nucleic acid within a eukaryotic cell.
  • the "gene expression sequence” is any regulatory nucleotide sequence, such as a promoter sequence or promoter-enhancer combination, which facilitates the efficient transcription and translation of the MSP nucleic acid to which it is operably linked.
  • the gene expression sequence may, for example, be a mammalian or viral promoter, such as a constitutive or inducible promoter.
  • Constitutive mammalian promoters include, but are not limited to, the promoters for the following genes: hypoxanthine phosphoribosyl transferase (HPTR), adenosine deaminase, pyruvate kinase, and ⁇ -actin.
  • HPTR hypoxanthine phosphoribosyl transferase
  • adenosine deaminase pyruvate kinase
  • ⁇ -actin ⁇ -actin
  • Exemplary viral promoters which function constitutively in eukaryotic cells include, for example, promoters from the simian virus, papilloma virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, cytomegalovirus, the long terminal repeats (LTR) of moloney leukemia virus and other retroviruses, and the thymidine kinase promoter of herpes simplex virus.
  • Other constitutive promoters are known to those of ordinary skill in the art.
  • the promoters useful as gene expression sequences of the invention also include inducible promoters. Inducible promoters are expressed in the presence of an inducing agent.
  • the metallothionein promoter is induced to promote transcription and translation in the presence of certain metal ions.
  • Other inducible promoters are known to those of ordinary skill in the art.
  • the gene expression sequence shall include, as necessary, 5' non-transcribing and 5' non-translating sequences involved with the initiation of transcription and translation, respectively, such as a TATA box, capping sequence, CAAT sequence, and the like.
  • 5' non-transcribing sequences will include a promoter region which includes a promoter sequence for transcriptional control of the operably joined MSP nucleic acid.
  • the gene expression sequences optionally include enhancer sequences or upstream activator sequences as desired.
  • the MSP nucleic acid of the invention is linked to a gene expression sequence which permits expression of the MSP nucleic acid in the local environment of the neuroendocrine tumor.
  • MSP is a secreted protein which has an N-terminal signal peptide. Therefore, the MSP is expressed and secreted by cells in the local environment of the tumor.
  • the MSP nucleic acid is expressed in the neuroendocrine cell. More preferably, the gene expression sequence permits expression of the MSP nucleic acid in a human pulmonary neuroendocrine cell and does not permit expression of the MSP nucleic acid in hepatocytes and other cells in which MSP normally induces proliferation.
  • a sequence which permits expression of the MSP nucleic acid in a pulmonary neuroendocrine cell is one which is selectively active in pulmonary neuroendocrine cells and thereby causes the expression of the MSP nucleic acid in these cells.
  • the following promoters can be used to express the MSP nucleic acid in human pulmonary neuroendocrine cells (GRP/calcitonin, DOPA decarboxylase, and chromogranin A.
  • GRP/calcitonin, DOPA decarboxylase, and chromogranin A Those of ordinary skill in the art will be able to easily identify alternative promoters that are capable of expressing a MSP nucleic acid in a pulmonary neuroendocrine cell.
  • the MSP nucleic acid sequence and the gene expression sequence are said to be "operably linked” when they are covalently linked in such a way as to place the transcription and/or translation of the MSP coding sequence under the influence or control of the gene expression sequence.
  • two DNA sequences are said to be operably linked if induction of a promoter in the 5' gene expression sequence results in the transcription of the MSP sequence and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame- shift mutation, (2) interfere with the ability of the promoter region to direct the transcription of the MSP sequence, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein.
  • a gene expression sequence would be operably linked to a MSP nucleic acid sequence if the gene expression sequence were capable of effecting transcription of that MSP nucleic acid sequence such that the resulting transcript might be translated into the desired protein or polypeptide.
  • the MSP nucleic acid of the invention can be delivered to the pulmonary or other neuroendocrine cell alone or in association with a vector.
  • a "vector” is any vehicle capable of facilitating: (1) delivery of a MSP molecule to a target cell or (2) uptake of a MSP molecule by a target cell.
  • the vectors transport the MSP molecule into the target cell with reduced degradation relative to the extent of degradation that would result in the absence of the vector.
  • a "targeting ligand" can be attached to the vector to selectively deliver the vector to a cell which expresses on its surface the cognate receptor for the targeting ligand.
  • the vector (containing a MSP nucleic acid or a MSP polypeptide) can be selectively delivered to a neuroendocrine cell in, e.g., the pulmonary tissue.
  • the vectors useful in the invention are divided into two classes: biological vectors and chemical/physical vectors.
  • biological vectors are useful for delivery /uptake of MSP nucleic acids to/by a target cell.
  • Chemical/physical vectors are useful for delivery/uptake of MSP nucleic acids or MSP polypeptides to/by a target cell.
  • Bio vectors include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the nucleic acid sequences of the invention, and free nucleic acid fragments which can be attached to the nucleic acid sequences of the invention.
  • Viral vectors are a preferred type of biological vector and include, but are not limited to, nucleic acid sequences from the following viruses: retroviruses, such as: Moloney murine leukemia virus; Harvey murine sarcoma virus; murine mammary tumor virus; Rous sarcoma virus; adenovirus; adeno- associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes viruses; vaccinia viruses; polio viruses; and RNA viruses such as any retrovirus.
  • retroviruses such as: Moloney murine leukemia virus; Harvey murine sarcoma virus; murine mammary tumor virus; Rous sarcoma virus; adenovirus; adeno- associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes viruses; vaccinia viruses; polio viruses; and RNA viruses such
  • Non-cytopathic viral vectors are based on non-cytopathic eukaryotic viruses in which non- essential genes have been replaced with the gene of interest.
  • Non-cytopathic viruses include retroviruses, the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA.
  • Retroviruses have been approved for human gene therapy trials. In general, the retroviruses are replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle).
  • retroviral expression vectors have general utility for the high-efficiency transduction of genes in vivo.
  • the adeno-associated virus can be engineered to be replication -deficient and is capable of infecting a wide range of cell types and species. It further has advantages, such as heat and lipid solvent stability; high transduction frequencies in cells of diverse lineages; and lack of superinfection inhibition thus allowing multiple series of transductions. Reportedly, the adeno-associated virus can integrate into human cellular DNA in a site-specific manner, thereby minimizing the possibility of insertional mutagenesis and variability of inserted gene expression.
  • adeno-associated virus infections have been followed in tissue culture for greater than 100 passages in the absence of selective pressure, implying that the adeno- associated virus genomic integration is a relatively stable event.
  • the adeno-associated virus can also function in an extrachromosomal fashion.
  • chemical/physical vectors may be used to deliver a MSP molecule to a target cell and facilitate uptake thereby.
  • a "chemical/physical vector” refers to a natural or synthetic molecule, other than those derived from bacteriological or viral sources, capable of delivering the MSP molecule to a cell.
  • a preferred chemical/physical vector of the invention is a colloidal dispersion system.
  • Colloidal dispersion systems include lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
  • a preferred colloidal system of the invention is a liposome.
  • Liposomes are artificial membrane vessels which are useful as a delivery vector in vivo or in vitro. It has been shown that large unilamellar vessels (LUV). which range in size from 0.2 - 4.0 ⁇ m can encapsulate large macromolecules. RNA, DNA, and intact virions can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form (Fraley, et al., Trends Biochem.
  • a liposome In order for a liposome to be an efficient gene transfer vector, one or more of the following characteristics should be present: (1) encapsulation of the gene of interest at high efficiency with retention of biological activity; (2) preferential and substantial binding to a target cell in comparison to non-target cells; (3) delivery of the aqueous contents of the vesicle to the target cell cytoplasm at high efficiency; and (4) accurate and effective expression of genetic information.
  • Liposomes may be targeted to a particular tissue, such as the pulmonary neuroendocrine cells, by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein.
  • Ligands which may be useful for targeting a liposome to a pulmonary neuroendocrine cell include, but are not limited to: intact or fragments of MSP which interact with the RON receptor and molecules which interact with the cell surface molecules of neuroendocrine cells such as antibodies. Examples of neuroendocrine cell surface molecules are disclosed above as cell surface markers of neuroendocrine cells. Others are known in the art. Such ligands may easily be identified by binding assays well known to those of skill in the art. Additionally, the vector may be coupled to a nuclear targeting peptide, which will direct the MSP nucleic acid to the nucleus of the host cell. Liposomes are commercially available from Gibco BRL, for example, as
  • LIPOFECTINTM and LIPOFECTACETM which are formed of cationic lipids such as N-[l-(2, 3 dioleyloxy)-propyl]-N, N, N-trimethylammonium chloride (DOTMA) and dimethyl dioctadecylammonium bromide (DDAB).
  • DOTMA N-[l-(2, 3 dioleyloxy)-propyl]-N, N, N-trimethylammonium chloride
  • DDAB dimethyl dioctadecylammonium bromide
  • the preferred vehicle is a biocompatible micro particle or implant that is suitable for implantation into the mammalian recipient.
  • bioerodible implants that are useful in accordance with this method are described in PCT International application no. PCT/US/03307 (Publication No. WO 95/24929, entitled “Polymeric Gene Delivery System", claiming priority to U.S. patent application serial no. 213,668, filed March 15, 1994).
  • PCT/US/0307 describes a biocompatible, preferably biodegradable polymeric matrix for containing an exogenous gene under the control of an appropriate promotor. The polymeric matrix is used to achieve sustained release of the exogenous gene in the patient.
  • the MSP nucleic acids described herein are encapsulated or dispersed within the biocompatible, preferably biodegradable polymeric matrix disclosed in PCT/US/03307.
  • the polymeric matrix preferably is in the form of a micro particle such as a microsphere (wherein the MSP molecule is dispersed throughout a solid polymeric matrix) or a microcapsule (wherein the MSP molecule is stored in the core of a polymeric shell).
  • Other forms of the polymeric matrix for containing the MSP molecule include films, coatings, gels, implants, and stents.
  • the size and composition of the polymeric matrix device is selected to result in favorable release kinetics in the tissue into which the matrix is introduced.
  • the size of the polymeric matrix further is selected according to the method of delivery which is to be used, typically injection into a tissue or administration of a suspension by aerosol into the nasal and/or pulmonary areas.
  • the polymeric matrix and MSP molecule are encompassed in a surfactant vehicle.
  • the polymeric matrix composition can be selected to have both favorable degradation rates and also to be formed of a material which is bioadhesive, to further increase the effectiveness of transfer when the matrix is administered to a nasal and/or pulmonary surface.
  • the matrix composition also can be selected not to degrade, but rather, to release by diffusion over an extended period of time.
  • the chemical/physical vector is a biocompatible microsphere that is suitable for oral delivery. Such microspheres are disclosed in Chickering et al., Biotech. And Bioeng., (1996) 52:96-101 and Mathiowitz et al., Nature, (1997) 386:.410-414.
  • Both non-biodegradable and biodegradable polymeric matrices can be used to deliver the MSP nucleic acids of the invention to the subject.
  • Biodegradable matrices are preferred.
  • Such polymers may be natural or synthetic polymers. Synthetic polymers are preferred.
  • the polymer is selected based on the period of time over which release is desired, generally in the order of a few hours to a year or longer. Typically, release over a period ranging from between a few hours and three to twelve months is most desirable.
  • the polymer optionally is in the form of a hydrogel that can absorb up to about 90% of its weight in water and further, optionally is cross-linked with multi-valent ions or other polymers.
  • the MSP nucleic acids and/or polypeptides of the invention are delivered using a bioerodible implant by way of diffusion, or more preferably, by degradation of the polymeric matrix.
  • exemplary synthetic polymers which can be used to form the biodegradable delivery system include: polyamides, polycarbonates, polyalkylenes, polyalkylene glycols, polyalkylene oxides, polyalkylene terepthalates, polyvinyl alcohols, polyvinyl ethers, polyvinyl esters, poly-vinyl halides, polyvinylpyrrolidone, polyglycolides, polysiloxanes, polyurethanes and co-polymers thereof, alkyl cellulose, hydroxyalkyl celluloses, cellulose ethers, cellulose esters, nitro celluloses, polymers of acrylic and methacrylic esters, methyl cellulose, ethyl cellulose, hydroxypropyl cellulose, hydroxy-propyl methyl cellulose, hydroxybutyl
  • non-biodegradable polymers examples include ethylene vinyl acetate, poly(mefh)acrylic acid, polyamides, copolymers and mixtures thereof.
  • Bioadhesive polymers of particular interest include bioerodible hydrogels described by H.S. Sawhney, C.P. Pathak and J.A. Hubell in Macromolecules, (1993) 26:581 -587, the teachings of which are incorporated herein, polyhyaluronic acids, casein, gelatin, glutin, polyanhydrides, polyacrylic acid, alginate, chitosan, poly(methyl methacrylates), poly(ethyl methacrylates), poly(butylmethacrylate), poly(isobutyl methacrylate), poly(hexylmethacrylate), poly(isodecyl methacrylate), poly ⁇ auryl methacrylate), poly(phenyl methacrylate), poly(methyl acrylate), poly ⁇ sopropyl acrylate), poly(isobutyl acrylate), and poly(octadecyl acrylate).
  • Compaction agents also can be used alone, or in combination with, a biological or chemical/physical vector of the invention.
  • a "compaction agent”, as used herein, refers to an agent, such as a histone, that neutralizes the negative charges on the nucleic acid and thereby permits compaction of the nucleic acid into a fine granule. Compaction of the nucleic acid facilitates the uptake of the nucleic acid by the target cell.
  • the compaction agents can be used alone, i.e., to deliver the MSP molecule in a form that is more efficiently taken up by the cell or, more preferably, in combination with one or more of the above-described vectors.
  • the MSP nucleic acids code for a MSP polypeptide.
  • the preferred MSP polypeptide has an amino acid sequence of SEQ ID NO:2.
  • the MSP polypeptides of the invention may be intact MSP polypeptides which include the polypeptide sequence of SEQ ID NO:2 as well as functionally equivalent variant and analogs of SEQ ID NO:2.
  • the MSP polypeptides of the invention may also be functionally equivalent fragments of the foregoing polypeptides.
  • “Functionally equivalent”, in reference to an intact MSP polypeptide variant or analog or a MSP polypeptide fragment, refers to a polypeptide that is capable of inducing neuroendocrine cell apoptosis in a neuroendocrine cell expressing a RON receptor.
  • a "functional equivalent" of an MSP polypeptide is capable of inducing apoptosis in neuroendocrine cells in vitro or in vivo.
  • Functional equivalents of the MSP polypeptide include polypeptides containing the four kringle domains of the human (or other mammalian homolog) MSP sequence (e.g., SEQ ID NOS. 2 or 4).
  • SEQ ID NOS. 2 or 4 The sequences for the human and mouse MSP nucleic acids and encoded proteins are shown in SEQ ID NOS. 1-4.
  • the positions of the kringle domains in the human and mouse MSP polypeptides are described by Han et al., in Biochemistry, (1991) 30:9768-9780; (See also U.S. Patent No.
  • one to three of the above listed kringle domains alone or conjugated to a backbone such as an Ig chain, or some other inert protein such as albumin, are functional equivalents of the MSP polypeptide, provided that these alternatives retain the ability to induce apoptosis in neuroendocrine cells in vitro or in vivo.
  • a fragment of the MSP polypeptide containing one, two, three, or four of the kringle domains is a preferred functional equivalent, provided that the fragment retains the ability to induce apoptosis in neuroendocrine cells as noted above.
  • chemically different synthetic activators of the RON receptor can be used as functional equivalents of the MSP polypeptide, provided that such RON receptor agonists compete with the MSP polypeptide for binding to the RON receptor and, further, provided that such activators also are capable of inducing apoptosis in neuroendocrine cells in vitro or in vivo.
  • RON receptor agonists compete with the MSP polypeptide for binding to the RON receptor and, further, provided that such activators also are capable of inducing apoptosis in neuroendocrine cells in vitro or in vivo.
  • RON receptor agonists include RON receptor anti-idiotypic antibodies.
  • An in vitro apoptosis assay can be used as a screening assay to measure the ability of a polypeptide to induce apoptosis in vitro and is predictive of the ability of the polypeptide to induce apoptosis of neuroendocrine cells in vivo.
  • Exemplary "functionally equivalent variants" of SEQ ID NO:2 include fragments of SEQ ID NO:2, as well as polypeptide analogs of SEQ ID NO:2 which contain conservative amino acid substitutions, provided that the polypeptide variants and analogs are capable of inducing apoptosis of neuroendocrine cells.
  • Fusion proteins in which a peptide of the invention is coupled to a solid support (such as a polymeric bead), a carrier molecule (such as keyhole limpet hemocyanin), or a reporter group (such as radiolabel or other tag), also are embraced within the invention.
  • a solid support such as a polymeric bead
  • a carrier molecule such as keyhole limpet hemocyanin
  • a reporter group such as radiolabel or other tag
  • an effective amount means a dosage of the MSP molecule sufficient to provide a medically desirable result.
  • the effective amount will vary with the particular condition being treated, the age and physical condition of the subject being treated, the severity of the condition, the duration of the treatment, the nature of the concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner.
  • an effective amount for treating neuroendocrine tumors is an amount sufficient to induce apoptosis in a neuroendocrine cell expressing a RON receptor so as to delay the onset of, inhibit the progression of, or halt altogether the development of a neuroendocrine tumor.
  • the MSP molecule of the invention can be used to treat a neuroendocrine tumor prophylactically in subjects at risk of developing a neuroendocrine tumor, by administering a MSP molecule to the subject in an amount effective to induce apoptosis in a neuroendocrine cell expressing a RON receptor in the subject.
  • doses of active compounds will be from about O.Olmg/kg per day to 1000 mg/kg per day. It is expected that doses range of 50-500 mg/kg will be suitable, in one or several administrations per day.
  • the pharmaceutical preparations of the invention are applied in pharmaceutically-acceptable amounts and in pharmaceutically-acceptably compositions.
  • Such preparations may routinely contain salt, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents.
  • the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts conveniently may be used to prepare pharmaceutically-acceptable salts thereof and are not excluded from the scope of the invention.
  • Such pharmacologically and pharmaceutically-acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic, and the like.
  • pharmaceutically-acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts.
  • MSP molecule means the compounds described above as well as salts thereof.
  • the MSP molecule may be combined, optionally, with a pharmaceutically-acceptable carrier.
  • pharmaceutically-acceptable carrier means one or more compatible solid or liquid filler, diluents or encapsulating substances which are suitable for administration into a human or other animal.
  • carrier denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application.
  • the components of the pharmaceutical compositions also are capable of being co- mingled with the molecules of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficacy.
  • the pharmaceutical compositions may contain suitable buffering agents, including: acetic acid in a salt; citric acid in a salt; boric acid in a salt; and phosphoric acid in a salt.
  • compositions also may contain, optionally, suitable preservatives, such as: benzalkonium chloride; chlorobutanol; parabens and thimerosal.
  • suitable preservatives such as: benzalkonium chloride; chlorobutanol; parabens and thimerosal.
  • compositions suitable for parenteral administration conveniently comprise a sterile aqueous preparation of the MSP molecule, which is preferably isotonic with the blood of the recipient.
  • This aqueous preparation may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents.
  • the sterile injectable preparation also may be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example, as a solution in 1,3-butane diol.
  • acceptable vehicles and solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution.
  • sterile, fixed oils arc conventionally employed as a solvent or suspending medium.
  • any bland fixed oil may be employed including synthetic mono- or di-glycerides.
  • fatty acids such as oleic acid may be used in the preparation of injectables.
  • Carrier formulation suitable for oral, subcutaneous, intravenous, intramuscular, etc. administrations can be found in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA.
  • a variety of administration routes are available. The particular mode selected will depend of course, upon the particular drug selected, the severity of the condition being treated and the dosage required for therapeutic efficacy.
  • the methods of the invention may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of the active compounds without causing clinically unacceptable adverse effects.
  • modes of administration include aerosol, oral, rectal, topical, nasal, interdermal, or parenteral routes.
  • parenteral includes subcutaneous, intravenous, intramuscular, or infusion. Intravenous or intramuscular routes are not particularly suitable for long-term therapy and prophylaxis. They could, however, be preferred in emergency situations.
  • Aerosol administration will be preferred for prophylactic treatment because of the convenience to the patient as well as the dosing schedule.
  • the pharmaceutical compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy. All methods include the step of bringing the MSP molecule into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the MSP molecule into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.
  • compositions suitable for oral administration may be presented as discrete units, such as capsules, tablets, lozenges, each containing a predetermined amount of the MSP molecule.
  • Other compositions include suspensions in aqueous liquids or non-aqueous liquids such as a syrup, elixir or an emulsion.
  • Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the MSP molecule described above, increasing convenience to the subject and the physician.
  • Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer base systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Patent 5,075,109.
  • Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono- di- and tri-glycerides; hydrogel release systems; sylastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like.
  • lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono- di- and tri-glycerides
  • hydrogel release systems such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono- di- and tri-glycerides
  • sylastic systems such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono- di- and tri-glycerides
  • peptide based systems such as fatty acids
  • wax coatings such as those described in U.S. Patent Nos.
  • Long-term sustained release implant may be particularly suitable for treatment of chronic conditions such as prophylactic treatment in subjects at risk of developing a neuroendocrine tumor.
  • Long-term release means that the implant is constructed and arranged to delivery therapeutic levels of the active ingredient for at least 30 days, and preferably 60 days.
  • Long-term sustained release implants are well-known to those of ordinary skill in the art and include some of the release systems described above.
  • the MSP molecule is administered to the subject having or at risk of developing a neuroendocrine tumor in combination with a method for treating the neuroendocrine tumor or preventing the development of a neuroendocrine tumor.
  • a neuroendocrine tumor is described above in more detail. See, e.g., Harrison 's Principles of Internal Medicine (McGraw Hill, Inc., New York) for a more detailed description of these conditions.
  • the method for treating a neuroendocrine tumor may be a surgical method or a method involving a drug therapy and/or radiation or a combination of the foregoing.
  • Surgical methods for treating a neuroendocrine tumor include procedures such as complete or partial resection of the tumor.
  • the MSP molecule may be administered with a tumoricidal agent.
  • a "tumoricidal agent” as used herein is an agent which inhibits the growth of neuroendocrine cells.
  • agents include for example traditional chemotherapeutic and radiation agents as well as therapeutic agents which are specific for inhibiting the growth of neuroendocrine tumors.
  • small cell lung carcinoma cells make and secrete endogenous growth factors, such as bombesin/gastrin releasing peptide (BN/GRP), and other biological response modifiers that regulate tumor proliferation. (Moody, T., Science, (1981) 214:1246).
  • SCLC cells use BN/GRP as an autocrine growth factor by stimulating the clonal growth of such cells.
  • BN/GRP Therapeutic agents which block these autocrine growth action of BN/GRP include but are not limited to monoclonal antibodies against BN (Cuttitta, F., et al., Nature, (1985) 316:823) and BN receptor antagonists Mahmoud, S., et al., Life Sci., (1989) 44:367).
  • the above-described drug therapies are well known to those of ordinary skill in the art and are administered by modes known to those of skill in the art.
  • the drug therapies are administered in amounts which are effective to achieve the physiological goals (to slow or halt the development or progression of a neuroendocrine tumor), in combination with the MSP molecule of the invention.
  • the drug therapies may be administered in amounts which are not capable of slowing or halting the development or progression of a neuroendocrine tumor when the drug therapies are administered alone but which are capable of slowing or halting the development or progression of a neuroendocrine tumor when administered in combination with the MSP molecules of the invention.
  • the MSP molecule may be administered alone or in combination with the above- described drug therapies as part of a pharmaceutical composition.
  • Such a pharmaceutical composition may include the MSP molecule in combination with any standard pharmaceutically acceptable carriers which are known in the art and are discussed in more detail above.
  • the compositions should be sterile and contain a therapeutical ly effective amount of the MSP molecule in a unit of weight or volume suitable for administration to a patient.
  • the MSP molecules can be administered to the subject (any mammalian recipient) using any modes of administration known in the art.
  • the MSP molecule (optionally contained in, or associated with, an appropriate vector) is administered to the mammalian recipient by aerosol in a surfactant vehicle.
  • the MSP polypeptide has been proposed as a therapeutic agent for the treatment of disorders characterized by defects in megakaryocyte maturation and thrombocyte production such as thrombocytopenia.
  • PCT Patent Application WO96/14082 claiming priority to US Patent Application 08/334,177 filed on November 3, 1994.
  • the conditions described herein, above typically are not associated with disorders characterized by defects in megakaryocyte maturation and thrombocyte production such as thrombocytopenia.
  • the preferred group of patients treatable by the methods of the present invention are subjects free of disorders characterized by defects in megakaryocyte maturation and thrombocyte production.
  • the preferred subjects also are otherwise free of any other condition calling for MSP treatment.
  • the MSP molecules described above are commercially available compounds, are derived from commercially available compounds or are synthesized de novo using routine synthetic procedures known to those of ordinary skill in the art.
  • the invention also contemplates the use of MSP molecules in experimental model systems to determine the role that induction of apoptosis in neuroendocrine cells plays in preventing the development of a neuroendocrine tumor.
  • An animal model of a subject at risk of developing a neuroendocrine tumor is created experimentally, for example, by administering a nitrosamine in combination with the induction of a hypoxic state in an animal having a defective MSP gene, as described in the Examples below.
  • An MSP molecule as described above is administered to the animal.
  • the application may be local or may be systemic.
  • a pharmaceutical composition in one aspect of the invention, includes a MSP molecule and a pharmaceutical preparation formulated as an aerosol for inhalation.
  • the MSP molecule is present in the composition in an amount effective for inducing apoptosis.
  • the MSP molecule of the pharmaceutical composition is the MSP molecule described in detail above in the description of the methods of the invention.
  • the aerosol is formulated as a surfactant vehicle.
  • a surfactant vehicle refers to liquids with surface tension-lowering capability, similar to native mammalian lung surfactant.
  • Surfactants include but are not limited to Survanta and Exosurf, or other natural or synthetic surface-active materials.
  • the pharmaceutical composition may include any of the therapeutic agents discussed above in connection with the description of the methods of the invention such as, for example, an anti-tumor agent.
  • Another aspect of the invention includes a screening assay method for determining whether a neuroendocrine or other cell is susceptible to MSP induced apoptosis or whether a subject is susceptible to treatment with MSP molecule. The method involves detecting the presence of a RON receptor molecule in a neuroendocrine cell. The presence of a RON receptor molecule in a neuroendocrine cell indicates that the cell is susceptible to treatment with an MSP molecule.
  • a neuroendocrine cell which is susceptible to treatment with MSP molecule is a cell which can be induced to undergo apoptosis once the MSP interacts with the RON receptor.
  • the presence of a RON receptor molecule may be measured in the neuroendocrine cell by contacting the cell with a detection reagent that selectively binds to the RON receptor molecule to detect or measure the presence of the RON receptor molecule in the cell.
  • the detection reagent can be a RON receptor nucleic acid that selectively hybridizes to the RON receptor mRNA.
  • the neuroendocrine cell is contacted with the detection reagent under conditions that permit selective hybridization of the RON receptor nucleic acid to the RON receptor mRNA.
  • the preferred RON receptor nucleic acid for this embodiment is a RON receptor nucleic acid sequence having SEQ ID NO:20 or a unique fragment thereof.
  • the RON receptor nucleic acid and deduced amino acid sequences are described by C. Ronson, et al., in Oncogene, (1993) 8(5):1195-1202 and are provided in the GenBank database as Accession No. X70040.
  • the RON receptor molecule that is being assayed can be a RON receptor polypeptide and the detection reagent can be an antibody or an MSP protein or fragment that selectively binds to the RON receptor polypeptide.
  • the RON receptor polypeptide can be contacted with the detection reagent under conditions that permit selective binding of the RON receptor antibody or the RON receptor binding MSP protein to the RON receptor polypeptide.
  • the RON receptor molecule may optionally be separated from the intact cell in the form of isolated nucleic acid or polypeptide fractions prior to the detection step.
  • a "RON receptor nucleic acid”, as used herein, refers to a nucleic acid molecule which hybridizes under stringent conditions to a nucleic acid having the sequence of SEQ ID NO:20.
  • the RON receptor nucleic acids of the invention also embrace unique fragments of the foregoing nucleic acids. Such unique fragments can be used, for example, as probes in hybridization assays and as primers in a polymerase chain reaction (PCR) in order to detect the presence of RON receptor mRNA.
  • a unique fragment is one that is a 'signature' for the larger nucleic acid. It, for example, is long enough to assure that its precise sequence is not found in molecules outside of the RON receptor gene. Unique fragments are described in more detail above.
  • a polypeptide encoded by the human RON receptor cDNA is provided as SEQ ID No. 21.
  • RON receptor antibody refers to an immunoglobulin which interacts with an epitope of the RON receptor.
  • the preparation of RON receptor antibodies has previously been described (Wang et al., Science, (1994) 266: 117-1 19) and an additional example of the preparation of such antibodies is set forth in the Examples below.
  • RON receptor antibodies can be prepared by any means known in the art.
  • a "RON receptor binding MSP protein”, as used herein, refers to an intact MSP polypeptide, or a fragment thereof that selectively binds to an epitope of the RON receptor.
  • MSP or fragments thereof can be chemically synthesized or recombinatly produced based on the sequences provided in SEQ ID NOS 1 and 2.
  • MSP can be isolated and purified from natural biological sources. Methods for isolating MSP in a highly pure state are provided, for example, in US Patent No. 5,527,685.
  • the patent discloses the isolation and purification of MSP from human serum (having a specific activity of about at least 6 units MSP/ mg protein) using an immunoaffinity column of anti- MSP, followed by carboxy methyl high performance liquid chromatography (CM-HPLC), in two sequential runs.
  • CM-HPLC carboxy methyl high performance liquid chromatography
  • the purity of the resultant MSP was determined by SDS-PAGE and partial amino acid sequencing of reduced and alkylated alpha and beta chains.
  • Immunoaffinity columns with an anti-MSP antibody as disclosed in the patent may be prepared by those of skill in the art. Such antibodies are available from a variety of sources.
  • the invention includes a kit for determining if a neuroendocrine cell is susceptible to MSP induced apoptosis or if a subject is susceptible to MSP treatment.
  • the kit may be in one or more containers and, preferably, includes any of the above-noted detection reagents.
  • the kit further includes a vehicle for facilitating the delivery of the detection agent into a neuroendocrine cell.
  • compositions of the invention is useful for a variety of purposes in addition to its use as a therapeutic in the methods of the invention.
  • complements of the MSP nucleic acids can be useful as antisense oligonucleotides, e.g., by delivering the antisense oligonucleotide to a cell to inhibit the expression of MSP within the cell.
  • the administration of antisense RNA probes to block gene expression is discussed in Lichtenstein, C, Nature, (1988) 333:801-802.
  • the MSP nucleic acid of the invention can be used to prepare a non-human transgenic animal.
  • a "transgenic animal” is an animal having cells that contain DNA which has been artificially inserted into a cell, which DNA becomes part of the genome of the animal which develops from that cell.
  • Preferred transgenic animals are primates, rodents, cows, pigs, horses, goats, sheep, dogs and cats. Animals suitable for transgenic experiments can be obtained from standard commercial sources such as Charles River (Wilmington, MA), Taconic (Germantown, NY), Harlan Sprague Dawley (Indianapolis, IN), etc.
  • Transgenic animals having a particular property associated with a particular disease can be used to study the affects of a variety of drugs and treatment methods on the disease, and thus serve as genetic models for the study of a number of human diseases.
  • a transgenic animal having a "knockout" phenotype where the MSP gene is deleted or altered is useful as an animal model of a subject who is susceptible to developing a neuroendocrine tumor.
  • a transgenic animal having a copy of an MSP gene which will have inserted into its genome is useful for determining whether agents such as nitrosamine which ordinarily induce neuroendocrine tumors are inhibited from doing so by the expression of the MSP gene.
  • the invention therefore, contemplates the use of MSP knockout and transgenic animals as models for the study of neuroendocrine tumors.
  • a variety of methods are available for the production of transgenic animals associated with this invention.
  • DNA can be injected into the pronucleus of a fertilized egg before fusion of the male and female pronuclei, or injected into the nucleus of an embryonic cell (e.g., the nucleus of a two-cell embryo) following the initiation of cell division. See e.g., Brinster et al., Proc. Nat. Acad. Sci.
  • An alternative method for producing transgenic animals involves the incorporation of the desired gene sequence into a virus which is capable of affecting the cells of a host animal. See e.g., Elbrecht et al., Molec. Cell. Biol, (1987) 7:1276; Lacey et al., Nature, (1986) 322:609; Leopol et al., Cell, (1987) 51 :885.
  • Embryos can be infected with viruses, especially retroviruses, modified to carry the nucleotide sequences of the invention which encode MSP polypeptides or sequences which disrupt the native MSP gene to produce a knockout animal.
  • Another method for producing transgenic animals involves the injection of pluripotent embryonic stem cells into a blastocyst of a developing embryo.
  • Pluripotent stem cells derived from the inner cell mass of the embryo and stabilized in culture can be manipulated in culture to incorporate nucleotide sequences of the invention.
  • a transgenic animal can be produced from such cells through implantation into a blastocyst that is implanted into a foster mother and allowed to come to term. See e.g., Robertson et al., Cold Spring Harbor Conference Cell Proliferation, (1983) 10:647; Bradley et al., Nature, (1984) 309:255; Wagner et al., Cold Spring Harbor Symposium Quantitative Biology, (1985) 50:691.
  • transgenic mouse female mice are induced to superovulate. Females are placed with males, and the mated females are sacrificed by CO 2 asphyxiation or cervical dislocation and embryos are recovered from excised oviducts. Surrounding cumulus cells are removed. Pronuclear embryos are then washed and stored until the time of injection. Randomly cycling adult female mice are paired with vasectomized males. Recipient females are mated at the same time as donor females. Embryos then are transferred surgically. The procedure for generating transgenic rats is similar to that of mice. See Hammer et al., Cell, (1990) 63:1099-1112.
  • a clone containing the sequence(s) of the invention is co-transfected with a gene encoding resistance.
  • the gene encoding neomycin resistance is physically linked to the sequence(s) of the invention.
  • DNA molecules introduced into ES cells can also be integrated into the chromosome through the process of homologous recombination. See Capecchi, Science, (1989) 244: 1288-1292. Methods for positive selection of the recombination event (e.g., neo resistance) and dual positive-negative selection (e.g., neo resistance and gangcyclovir resistance) and the subsequent identification of the desired clones by PCR have been described by Capecchi, supra and Joyner et al., Nature, (1989) 338:153-156. The final phase of the procedure is to inject targeted ES cells into blastocysts and to transfer the blastocysts into pseudopregnant females.
  • neo resistance e.g., neo resistance
  • dual positive-negative selection e.g., neo resistance and gangcyclovir resistance
  • the resulting chimeric animals are bred and the offspring are analyzed by Southern blotting to identify individuals that carry the transgene. Procedures for the production of non-rodent mammals and other animals have been discussed by others. See Houdebine and Chourrout, supra; Pursel et al., Science, (1989) 244: 1281-1288; and Simms et al., Bio/Technology, (1988) 6:179-183. Inactivation or replacement of the endogenous MSP gene can be achieved by a homologous recombination system using embryonic stem cells.
  • the resultant transgenic non- human mammals having a knockout MSP characteristic may be used as a model for subjects at risk of developing neuroendocrine tumors.
  • a variety of therapeutic drugs can be administered to the phenotypically altered animals to determine the affect of the therapeutic drugs on the development of neuroendocrine tumors. In this manner, therapeutic drugs which are useful for slowing or halting the development or progression of neuroendocrine tumors can be identified.
  • a normal or mutant version of MSP can be inserted into the mouse germ line to produce transgenic animals which constitutively or inducibly express the normal or mutant form of MSP. These animals are useful in studies to define the role and function of MSP in cells or for determining whether expression of the MSP molecule is sufficient to prevent the development of neuroendocrine tumors.
  • mice were given subcutaneous injections with diethylnitrosamine (20 mg/kg in 0.1 to 0.4 ml of PBS) (Sigma Chemical, St. Louis, MO) or phosphate-buffered saline (PBS) as detailed previously (Oreffo, V., et al., Carcinogenesis, (1993) 14:451-455).
  • PBS phosphate-buffered saline
  • animals were rapidly asphyxiated with carbon dioxide and lung tissues were snap-frozen in liquid nitrogen for RNA analyses.
  • the cosmid library was prepared using genomic DNA from human chromosome 3 -specific somatic cell hybrids (human-hamster) with 5500 individual colonies identified as containing human sequences ( ⁇ 5% contamination with hamster sequences), as detailed previously (Smith, D., et al., Genomics, (1989) 4:453-459).
  • Total RNA was prepared from hamster lung tissues which were harvested after 12 weeks of nitrosamine treatment and from age-matched normal controls using the guanidinium- isocyanate/cesium chloride method (Davis, L., et al., Basic Methods in Molecular Biology (1986) Elsevier, NY).
  • the 12 week time point was chosen for differential screening because this was the time of peak pulmonary neuroendocrine cell hyperplasia, when a putative gene involved in regulating neuroendocrine cell numbers might be expressed.
  • 32 P-labeled cDNAs were prepared from 1 ⁇ g of total RNA using 50 ⁇ Ci of 32 P-dCTP, Moloney Murine Leukemia Virus reverse transcriptase (2 units, Bethesda Research Laboratories, Gaithersburg, MD), RNAsin (5 units, Sigma Chemical Company #R4380, St.
  • Chromosome Mapping Human chromosome 3-specific cosmids identified in our differential screen were mapped to specific sub-regions on chromosome 3 by identifying unique sequence hybridization probes from each cosmid and hybridizing these to a somatic cell hybrid deletion mapping panel as described previously (Drabkin. H., Genomics, (1990) 8:435-446). Results The differential screening of a human chromosome 3 -specific cosmid library using hamster lung cDNAs from 12 week diethylnitrosamine/O 2 -treated animals versus normal adults yielded 186 primary colonies on duplicate 96 well-plate filters. These 186 colonies were re- screened on a new set of duplicate filters, and 39 were confirmed as being differentially expressed.
  • a 1 14 bp fragment of one of the clones was identified by DNA sequencing as highly homologous to the published nucleic acid and amino acid sequences of the human cDNA encoding MSP (HGFL) from bp 984 to 1090 (Han, S., EXS, (1993), 65:81-105).
  • HGFL is known to be identical to MSP (Yoshimura, T., et al., Biol. Chem., (1993), 268:15461-15468; Skeel, A., et al., Exp. Med, (1991), 173:1227-1234; Han, S., et al., Biochemistry, (1991), 30:9768-9780).
  • Mapping using a panel of chromosome 3 somatic cell hybrids confirmed that clone 1697 mapped to 3p21-24. This agrees with previous studies which mapped the MSP gene to 3p21.3 (Yoshimura, T., et al., Biol.
  • the goal of this example was to identify a human chromosome 3p regulatory gene with a hamster homologue induced by nitrosamines during preneoplastic lung.
  • Multiple putative tumor suppressor genes are believed to reside on the short arm of this chromosome, which demonstrates homozygous deletion or loss of heterozygosity in 100% of SCLCs (Whang-Peng, J., et al., Science, (1982) 215:181-182), which are usually neuroendocrine in phenotype (Bensch, K., Cancer, (1968), 22:1163-1172).
  • nitrosamine-treated hamsters have a spontaneous regression of pulmonary neuroendocrine cell hyperplasia but develop only non-neuroendocrine lung tumors, we speculated that these hamsters might activate gene(s) able to down-regulate neuroendocrine cell numbers during preneoplasia and such a gene might have a human homologue on chromosome 3p.
  • the MSP gene mapped to human chromosome 3p21.3 which coincides with the shortest region of deletion described in SCLC, according to both loss of heterozygosity (Whang-Peng, J., et al., Science, (1982) 215:181-182; Brauch, H., et al., N. Eng. J. Med, (1987) 317:1109- 1113) and homozygous deletion analyses (Daly, M., et al, Oncogene, (1993) 8:1721-1729; Kok, K., et al., Cancer Res,. (1994) 54:4183-4187; Johnson, B., et al., J. Clin.
  • altered expression of the MSP gene could occur in the absence of sequence abnormalities in these genes. This could occur as a part of global inactivation of multiple genes on chromosome 3p, or could be secondary to aberrant regulation of MSP and/or RON receptor gene expression. It is unlikely that global inactivation accounts for all instances of decreased MSP gene expression in SCLCs, because RON receptor maps near MSP on 3p21.3 and RON receptor is expressed in many SCLC cell lines.
  • Synthetic oligodeoxynucleotides were made by the phosphoramidite method on the Applied Biosystems 381 A DNA synthesizer, using conserved sequences for: murine beta-actin (yielding a 243 bp product) and human gamma-actin (yielding a 240 bp fragment) (Alonso, S., et al., J. Mol. Evol,. (1986) 23:1 1-22; Ng, S., et al., Mol. Cell. Biol,.
  • MSP 5' GCGAGAATTCTGTGACCTCCCC SEQ. ID No.11 (murine):
  • MSP 5': AATACCACCACTGCGGGCGT SEQ. ID No.14 (human)
  • the products of the reaction were analyzed on 2% agarose gels containing 0.5 ⁇ g/ml ethidium bromide in lx TBE buffer (10 mM Tris base, 10 mM boric acid, 40 mM EDTA pH 8.0 pH 7.6) and blotted onto nitrocellulose membranes according to standard protocols (Davis, L., et al., Basic Methods in Molecular Biology, (1986) Elsevier, NY).
  • Blots were washed in 2x SSC/0.1 % SDS at 42 °C before exposure to Kodak XAR film at 20 °C for 2-4 hours.
  • conditions were determined such that the number of cycles was approximately one- third and thus within the linear range of detection. These conditions allowed for a generally linear detection of relative amounts of specific mRNAs present in the same reverse transcription reaction mixture, which could be subsequently normalized using actin mRNA as an internal control.
  • Densitometry was carried out by 3-dimensional integration of the area of whole bands on autoradiograms using Molecular Dynamics Model # 300 A Densitometer. Results
  • RT-PCR conditions were established that allowed linear detection of MSP, its receptor, RON receptor, and beta-actin.
  • RT-PCR was carried out from reverse-transcribed total RNA isolated from H596 lung carcinoma cells.
  • PCR primers were designed to amplify the segment of the MSP gene coding region identified in clone 1697, a segment of the MSP receptor, RON receptor, and beta actin as a housekeeping gene control.
  • RNA input from a positive control cell line led to linear increases in RT-PCR signal for MSP, its receptor, RON receptor, and beta- actin, comparing different quantities (over a two log scale) of total RNA in the RT reaction.
  • MSP mRNA is strongly expressed as early as two weeks after beginning treatment with diethylnitrosamine (2 of 3 animals positive after 2 weeks, and all 3 animals positive after 4 weeks and 6 weeks). All animals are strongly positive after nine to 12 weeks of treatment. MSP mRNA levels thereafter drop off, becoming undetectable in all animals by 20 weeks after the initiation of diethylnitrosamine treatment, by which time neuroendocrine cell hyperplasia had spontaneously regressed in all animals.
  • hamsters treated with diethylnitrosamine/O 2 develop profound pulmonary neuroendocrine cell hyperplasia (Sunday, M., et al., Cancer Res., (1992) 52(suppl):2677s-2686s.) which spontaneously regresses in about half of the animals).
  • the following diethylnitrosamine/0 2 -treated hamsters expressed MSP mRNA in the lung: one of 3 after 9 weeks, 3 of 4 after 12 weeks, none of 2 after 13 weeks, one of 2 after 14 weeks, and 2 of 3 after 16 weeks of diethylnitrosamine/O 2 .
  • MSP mRNA is undetectable in lung tissues from age-matched normal hamsters.
  • RON receptor mRNA is also induced in hamsters treated with diethylnitrosamine (present in 17 of 17 animals after 2 to 16 weeks of diethylnitrosamine, and two of three animals after 20 weeks of diethylnitrosamine) or diethylnitrosamine/O 2 (present in 17 of 19 animals after 2 to 16 weeks of diethylnitrosamine/O 2 , and one of three animals after 20 weeks of treatment) but is undetectable in lung tissue from most normal adult hamsters (occurring at low levels in only one of 12 normal adult hamster controls, at age 20 weeks, corresponding to 12 weeks of diethylnitrosamine treatment).
  • MSP antisera developed for Western analyses of human tissues does not detect immunoreactive MSP in control sections of either fixed or frozen human or hamster liver.
  • level of MSP mRNAs in lung were below the limit of detection by in situ hybridization even when homologous cRNA probes were used. Therefore, a panel of lung cancer cell lines was used to determine whether MSP is expressed in specific epithelial cell types.
  • Example 3 Expression of mRNA encoding RON receptor, the Receptor Protein Tyrosine Kinase for MSP in Human neuroendocrine Tumor Cell Lines Methods
  • Hep G2 hepatocellular carcinoma cell line was obtained from Dr. Mark Goldberg at Brigham & Women's Hospital for use as a positive control for MSP.
  • Human lung carcinoma cell lines were cultured as described previously (Gebert, J., et al., Oncogene, (1991) 6:1859-1868; Carney, D., et al., Cancer Res., (1985) 45:2913-2923) and were used for RNA preparation as described above; these cell lines included the following SCLCs: H60, H82, H146, HI 87, H209, and H249; and the following carcinoids: H720, H835, and H679.
  • MSP gene expression does not appear to be a prominent feature of neuroendocrine lung tumors (SCLCs and carcinoids), it seemed reasonable that MSP could be acting as a paracrine regulatory factor for neuroendocrine cells.
  • RT-PCR To determine whether the receptor for MSP was transcribed in neuroendocrine subtypes of lung cancer, we used RT-PCR to screen a panel of tumor cell lines similar to the panel used in Example 2 above. A single band was detected in these human specimens at ⁇ 1200 bp, as expected. All samples show good actin control bands, except the negative controls.
  • RON receptor mRNA was undetectable in the tumor and non-neoplastic lung from all four primary SCLCs and adjacent non-neoplastic lung in spite of an excellent positive control in the same RT-PCR experiment.
  • the strongest expression of the RON receptor gene occurs in cell lines derived from two of six SCLCs (HI 87 >H60) and two of four carcinoids (H835 and H679).
  • Much lower levels of RON receptor mRNA are also present in the SCLC line H249, most clearly evident on longer exposures of autoradiograms.
  • RON Receptor Phosphorylation Rabbit IgG anti-synthetic C-terminal peptide (20mer) of RON receptor beta-chain were generated by immunization of rabbits with RON receptor peptide conjugated with keyhole limpet hemocyanin (Wang, M., et al., Science, (1994) 266:1 17-119). Monoclonal anti-phosphotyrosine IgG (clone 4G10) was from Upstate Biotechnology Inc, (Lake Placid, NY). Goat anti-mouse or anti-rabbit IgG conjugated with horseradish peroxidase (HRP) was from Jackson ImmunoResearch Laboratories, Inc, (West Grove, PA).
  • HRP horseradish peroxidase
  • Enhances chemiluminescence detection reagents were from Amersham, (Arlington Heights, NY). Protein G-Sepharose was from Pharmacia, (Piscataway, NJ). Diff- Qick was from American Scientific Products, (McGaw Park, IL).
  • RON gene expression is associated with specific cellular responses.
  • the control cell line MDCK-RE7 was included to demonstrate positive phosphorylation of the RON ⁇ chain at ⁇ 150 kDa (Wang, M., et al., Science, (1994) 266:117-119).
  • the highest level of RON phosphorylation in response to recombinant MSP is observed in 11835; somewhat lower levels arc present in HI 87.
  • the same cell lines demonstrate an absence of phosphorylation when MSP treatment was omitted.
  • H835 carcinoid cells Phase contrast microscopy and Polaroid photography were carried out using H835 carcinoid cells, which grow as partially adherent cell clusters, grown in 25 cm 2 flasks. Nonadherent H835 cells grown in 25 cm 2 flasks were harvested by gentle removal with a pipette and one gentle wash with media to collect remaining loose cells. 4 ml of PBS were added per flask prior to mechanical disruption of the remainder of the cells. Viable cell counts were carried out using trypan blue exclusion as described above.
  • H835 cells were grown on 0.4 ⁇ m pore size cell culture inserts (Falcon #3095, Becton Dickinson, Franklin Lakes, NJ) in 24-well plates with media above and below. Scanning EM was carried out according to routine procedures (Sanderson, M., et al., Electron Microscopy of Respiratory Tract cilia. In Electron Microscopy of the Lung, (1990) D.E. Schraufnagel, editor. Marcel Dekker, NY 47-69). In brief, cells were fixed overnight in 2.5% glutaraldehyde, 1% paraformaldehyde in PBS. The cells were then washed with PBS to remove fixative and dehydrated with graded series of ethanol solutions. The culture inserts were critical- point dried (in CO 2 ), mounted, and coated with gold-palladium before examination by scanning EM.
  • Apoptosis Assay Flow cytometric and in situ analysis for DNA fragmentation was carried out using H835, HI 87, and H720 cells grown in the presence of MSP (3 nM) or in media alone. Fluorescein isthiocyanate-digoxigenin nucleotide labeling of 3'-OH DNA ends was carried out on cell suspensions according to the manufacturer's specifications with 15 minutes of Proteinase K treatment (Apoptag, Oncor), using 4',6-diamidino-2-phenylindole (DAPI) and/or propidium iodide as nuclear counterstains.
  • DAPI 4',6-diamidino-2-phenylindole
  • each labeled specimen was deposited on a glass slide using a cytocentrifuge for viewing at 510-550 nm (green to yellow, fluorescein) and 360-370 nm (blue, DAPI). The remainder of each specimen was analyzed by flow cytometry at 530 nm (for fluorescein) and 620 nm (for propidium iodide, red). Additional samples were used for preparation of DNA and agarose gel electrophoresis, as previously described (Boudreau, N., et al., Science, (1995) 267:891-893). Results
  • H835 is a well-characterized cell line derived from a human pulmonary carcinoid tumor (Moody, T., et al., J. Cell. Biochem,. (1990) 43:139-147). In cell counting assays, the number of viable H835 cells adherent to the tissue culture plastic is found to increase significantly in the presence of MSP. However, H835 cells are only partially adherent; most of the viable cells are nonadherent, similar to classic SCLC cell lines (Carney, D., et al., Cancer Res., (1985) 45:2913- 2923).
  • the well-differentiated strongly RON- positive SCLC cell line HI 87 (which usually only floats) also demonstrates increased cell adhesion to tissue culture plastic in the presence of MSP, but the RON-negative cell line H720 (also a floating cell line) does not adhere when treated with this protein. Trypan blue staining also demonstrates an increase in the proportion of H835 cells with pyknotic nuclei detected after 5 to 14 days of culture with MSP, which is comparable to control cultures treated with high doses of the apoptosis-inducing agent, camptothecin. Similar morphological evidence of apoptotic nuclei is present on propidium iodide staining.
  • a more sensitive and specific assay for apoptosis is fluorescein isothiocyanate- digoxigenin nucleotide labeling of new 3'-OH DNA ends (Apoptag, Oncor), which are generated by DNA fragmentation and typically localized in morphologically identifiable nuclei and apoptotic bodies (Boudreau, N., et al., Science, (1995) 267:891-893).
  • Apoptag Oncor
  • the Apoptag fluorescence intensity induced by MSP is variable, frequently being very intense and concentrated in nuclear fragments, or forming peripheral rings of clumped DNA within visible nuclei.
  • Camptothecin treatment of H835 yields a fluorescence profile very similar to that of MSP, with brightly fluorescent nuclear fragments including peripheral rings of clumped DNA within nuclei and well-formed apoptotic bodies.
  • Apoptosis Assay In situ analysis for DNA fragmentation in tissue sections was carried using the same Apoptag Fluorescence protocol (see above) on hamster lung sections that had previously been immunostained for CGRP (Sunday, M., et al., Cancer Res., (1992)
  • Hamsters treated with diethylnitrosamine alone contain Apoptag-positive pulmonary neuroendocrine cells with occasional apoptotic bodies as early as 2 weeks after the start of diethylnitrosamine, before significant neuroendocrine cell hyperplasia is present. After 4 weeks of diethylnitrosamine, mild pulmonary neuroendocrine cell hyperplasia is evident, with -twice as many neuroendocrine cell clusters per cm of airway epithelium. There is prominent Apoptag fluorescence in about half of these neuroendocrine cell clusters after four weeks, including apoptotic bodies which arc easily identifiable in most ⁇ poptag-positive clusters.
  • Lungs of hamsters treated with diethylnitrosamine/O 2 are known to develop profound neuroendocrine cell hyperplasia after 9 to 12 weeks of treatment, with up to -ten-fold as many neuroendocrine cell clusters as compared to untreated controls after 12 weeks. Only rarely detectable Apoptag-positive nuclear fluorescence occur in pulmonary neuroendocrine cells from hamsters treated with diethylnitrosamine/O 2 for four weeks, during the early phase of mild CGRP-positive neuroendocrine cell hyperplasia. In contrast, all four hamsters treated with diethylnitrosamine/O 2 for 8-9 weeks demonstrate neuroendocrine cell clusters have prominent apoptotic bodies in over half of the neuroendocrine cells.
  • neuroendocrine cells in sections from two additional hamsters After 12 weeks of diethylnitrosamine/O 2 treatment, neuroendocrine cells in sections from two additional hamsters also contain abundant apoptotic bodies and Apoptag fluorescence. However, after 16 weeks of diethylnitrosamine/O 2 , Apoptag fluorescence is no longer detectable in lung sections from either of two hamsters, regardless of the size of the neuroendocrine cell clusters.
  • ELISA enzyme-linked immunoadsorbent assay
  • Fig. 2 A nucleosomal enzyme-linked immunoadsorbent assay (ELISA) (Oncogene Research Products, Cambridge, MA) was used as a quantitative assay for the screening for apoptosis in a large number of samples (Fig. 2).
  • H835 cells were cultured to half-confluency, with 10 6 cells per 25 cm 2 flask.
  • Recombinant human MSP (3 nM) obtained as a serum-free conditioned media from stably transfected Chinese Flampster Ovary (CHO) cells from Dr. Sandra Degen (Han, S., L. et al., (1991) Biochem. v. 30, p. 9768-9780.) was added at time zero.
  • the cells were harvested at selected time points over a 3 day time course: 15 minutes (min), 30 min, one hour (hr), 4 hrs, 8 hrs, 24 hrs, 48 hrs, and 72 hrs. As positive controls for apoptosis, the same time course also was ruth with H835 following the addition of TNF ⁇ (400 units/ml) or after exposure to 1000 rads of XRT.
  • the cells were harvested by gentle centrifugation at 1,000 rpm followed by resuspension in Lysis Buffer containing PMSF at a final concentration of 0.2 mM. After 30 min incubation on ice, the cell-free lysate was frozen for over 20 hrs at -20°C (this freezing step is important to the assay).
  • results of the quantitative nucleosomal ELISA assay used to demonstrate the kinetics of apoptosis induced by MSP versus Tumor Necrosis Factor (TNF) or Ionizing Radiation (XRT) are shown in Figure 2.
  • Both MSP and XRT induce apoptosis with an initial peak at the one hour time point, followed by a decline consistent with rapid nucleosomal degradation (known to occur during apoptosis due to clearance by neighboring cells (Blank, K. R., et al., (1997) Int. J. Radiat. Biol. v. 71, p. 455-466; and Wyllie, A. H. (1997) Euro. J. Cell Biol. v. 73, p.
  • H835 which has a baseline level of apoptosis in ⁇ 2% of the cells
  • cycloheximide led to a doubling of the number of apoptotic cells (defined as containing Apoptag-positive nuclear apoptotic bodies) induced by MSP treatment, from 20% to 40% of the cells after 5 days in culture.
  • HI 87 which has a high baseline level of apoptosis at -25% of the cells in the passages studied
  • cycloheximide inhibited the effect of MSP on apoptosis, which was decreased from 45% to the baseline (unstimulated) level of 25% of the cells after 5 days in culture.
  • H835 Six flasks of H835 were prepared, treated either with negative control CHO conditioned media (MSP-minus) or 3 nM MSP (serum-free conditioned media containing recombinant human MSP, MSP-plus). After 30 min, 60 min, or 4 hrs, the cell pellets were harvested and resuspended in lysis buffer.
  • MSP-minus negative control CHO conditioned media
  • 3 nM MSP serum-free conditioned media containing recombinant human MSP, MSP-plus
  • JNKl extracellular signal-regulated kinase
  • ERK 1 extracellular signal-regulated kinase
  • proteins are incubated with a kinase substrate (myelin basic protein for ERK/Mitogen Activated Protein Kinase (MAPK); and GST-jun for JNK) in the presence of ⁇ - 32 P-ATP.
  • a kinase substrate myelin basic protein for ERK/Mitogen Activated Protein Kinase (MAPK); and GST-jun for JNK
  • the lysates were used for immunoprecipitation with antibodies to JNK1 ( ⁇ 46) (Fig. 4A), MAPK/ERK 1 (p44) (Fig. 4B) or MAPK/ERK 2 (p42).
  • Example 11 Kinetics of Apoptosis Induced by MSP in the Presenece of MEK Inhibitor, compared to TNF and XRT.
  • MEK MAPK kinase
  • PD 098059 Dudley, D. T. , et. al. , (1995) N S U. S. A. v. 92, p. 7686-7689; and Pang, L. , T. et al., (1995) J. Biol. Chem. v. 270, p. 13585-13588).
  • MEK acts immediately upstream of MAPK to activate MAPK.
  • Apoptosis was induced by MSP versus T ⁇ F or XRT as positive controls. Data are expressed as percentage change in nucleosomal ELISA in the presence of PD 098059, a specific MEK inhibitor (MKI), and are given in Fig. 5.
  • the MEK inhibitor results in -50% increased apoptosis 15 minutes after treatment is begun for all 3 agents. Only MSP demonstrates a greater than 20% decrease in apoptosis at the 4 hr time point in the presence of the MEK inhibitor. MAPK inhibition also leads to over 25% increased apoptosis at the 3 day time point, suggesting that MAPK could be partly responsible for diminished sensitivity to XRT-induced apoptosis, especially at later time points.
  • XRT has been previously demonstrated to induce MAPK in mouse fibroblasts (Stevenson, M. A. , et al. , (1994) Cancer Res. v. 54, p. 12-15). In SCLC cell lines, neuropeptide growth factors lead to activation of p42 MAPK (Seufferlein, T. and E. Rozengurt (1996) Cancer Res. v. 56, p. 5758-5764).
  • ADDRESSEE Wolf, Greenfield & Sacks, P.C.
  • MOLECULE TYPE protein
  • FRAGMENT TYPE internal
  • GAG TTA AGG AAC CTG TTA CAC ACA GCG GTG CCG GGG CCA TGG CAG GAG 144 Glu Leu Arg Asn Leu Leu His Thr Ala Val Pro Gly Pro Trp Gin Glu 35 40 45
  • GAC AAT GGG GTC AGC TAC CGG GGC ACT GTG GCC AGG ACA GCT GGT GGC 384 Asp Asn Gly Val Ser Tyr Arg Gly Thr Val Ala Arg Thr Ala Gly Gly 115 120 125
  • ACG CCC ACG CCA AAG AAT GGC CTG GAA GAG AAC TTC TGT AGG AAC CCT 480 Thr Pro Thr Pro Lys Asn Gly Leu Glu Glu Asn Phe Cys Arg Asn Pro 145 150 155 160
  • GGG GGC TCC CTA GTG AAG GAG CAG TGG GTA CTG ACT GCC CGG CAA TGC 1584 Gly Gly Ser Leu Val Lys Glu Gin Trp Val Leu Thr Ala Arg Gin Cys 515 520 525
  • MOLECULE TYPE protein
  • FRAGMENT TYPE internal
  • GGCCATGCCA GGCCAGAGCA GTGGCCCTCC ACCTTCTTCC TGCCCTTTAA CTTTCAGAGG 4349
  • CTGCAACATC TATTTATCGA GTOCCTCCTC TGGACCCTCT CTTCTGGGCA CAGTCGACTC 4469
  • MOLECULE TYPE protein
  • FRAGMENT TYPE internal

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne des procédés et des produits de traitement des tumeurs neuroendocrines. Le procédé de traitement de la tumeur neuroendocrine consiste à administrer une molécule protéique stimulant les macrophages (MSP) à un sujet susceptible de développer une tumeur neuroendocrine à dérivation cellulaire ou à un sujet souffrant d'une tumeur neuroendocrine, en quantité efficace pour induire l'apoptose dans une cellule neuroendocrine exprimant le récepteur de MSP (récepteur RON). La molécule MSP peut être un acide nucléique MSP ou un polypeptide MSP. Le produit est une composition pharmaceutique comprenant une molécule MSP et une préparation pharmaceutique formulée comme un aérosol.
PCT/US1998/011573 1997-06-04 1998-06-04 Procedes et produits pour induire l'apoptose des cellules neuroendocrines a l'aide de proteine stimulant les macrophages WO1998055141A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US4859497P 1997-06-04 1997-06-04
US60/048,594 1997-06-04

Publications (2)

Publication Number Publication Date
WO1998055141A1 WO1998055141A1 (fr) 1998-12-10
WO1998055141A9 true WO1998055141A9 (fr) 1999-04-08

Family

ID=21955410

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1998/011573 WO1998055141A1 (fr) 1997-06-04 1998-06-04 Procedes et produits pour induire l'apoptose des cellules neuroendocrines a l'aide de proteine stimulant les macrophages

Country Status (1)

Country Link
WO (1) WO1998055141A1 (fr)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2002258798A1 (en) * 2001-04-13 2002-10-28 Children's Hospital Medical Center Methods for the treatment of hepatic disorders
WO2013173745A1 (fr) * 2012-05-18 2013-11-21 Galaxy Biotech, Llc Anticorps monoclonaux contre la protéine stimulant les macrophages

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5013720A (en) * 1986-05-06 1991-05-07 Abbott Laboratories SAP-6-Val proteins and methods
US5219991A (en) * 1990-09-21 1993-06-15 The United States Of America As Represented By The Department Of Health And Human Services Macrophage stimulating protein

Also Published As

Publication number Publication date
WO1998055141A1 (fr) 1998-12-10

Similar Documents

Publication Publication Date Title
AU654502B2 (en) Ligand for the c-kit receptor and methods of use thereof
CA2464542C (fr) Composition comprenant une proteine 3 angptl3 analogue a l'angiopoietine et son procede d'utilisation
EP2314694A2 (fr) Récepteur BAFF (BCMA), agent immunorégulateur
KR20020053066A (ko) Ａｐｒｉｌ 수용체(ｂｃｍａ) 및 그 용도
JP2014058551A (ja) 血管新生及び脈管形成のモジュレーターとしてのｒスポンジン
JP2001524313A (ja) 哺乳類のサイトカイン様ポリペプチド−１０
JP2005198656A (ja) 神経栄養因子
WO2006023893A2 (fr) Methodes de modulation de l'angiogenese et de l'apoptose, dans lesquelles sont utilisees des compositions a base d'apeline
US20040167074A1 (en) Therapeutic applications of mFLINT polypeptides
CA2133982C (fr) Ligand pour le recepteur c-kit et modes d'utilisation
JP2006523209A (ja) アペリン組成物によって血管新生を調節するための方法
KR20000010571A (ko) 신경교세포주-유래신경영양성인자수용체및이를코드하는핵산서열과아미노산서열_
US20080199443A1 (en) Bone Morphogenetic Variants, Compositions and Methods of Treatment
CA2264485A1 (fr) Facteur de transcription gata-6, compositions et methodes
EP1124572B1 (fr) Genes et proteines destines a la prevention et therapie de maladies renales et de troubles associes
JP2003512304A (ja) 医薬組成物および分泌フリズル化関連タンパクを用いる方法
JP2003508496A (ja) 哺乳動物ｃｃｒ６レセプターおよび関連試薬の新規使用
US20060286117A1 (en) Neuronally expressed stem cell factor modulates angiogenesis and neural stem cell migration to areas of brain injury
US5972688A (en) HTm4 methods of treatment and assays, agonists and antagonists
WO1998055141A9 (fr) Procedes et produits pour induire l'apoptose des cellules neuroendocrines a l'aide de proteine stimulant les macrophages
WO1999036103A1 (fr) Prevention et traitement de la neuropathie au moyen du facteur de croissance d'hepatocytes
US20050271651A1 (en) Inhibition of bright function as a treatment for excessive immunoglobulin production
WO1999026980A1 (fr) Reactifs et procedes d'utilisation de proteines de la famille sap, nouveaux regulateurs de transduction de signaux
US20030181380A1 (en) Modulating lymphoid commitment and survival
EP1423402A2 (fr) Nouveaux analogues de polypeptides et proteines hybrides et leurs procedes d'utilisation

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): CA JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: C2

Designated state(s): CA JP

AL Designated countries for regional patents

Kind code of ref document: C2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

COP Corrected version of pamphlet

Free format text: PAGES 1/5-5/5, DRAWINGS, REPLACED BY NEW PAGES 1/3-3/3; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase in:

Ref country code: JP

Ref document number: 1999502882

Format of ref document f/p: F

122 Ep: pct app. not ent. europ. phase
NENP Non-entry into the national phase in:

Ref country code: CA