WO1999036103A1 - Prevention et traitement de la neuropathie au moyen du facteur de croissance d'hepatocytes - Google Patents

Prevention et traitement de la neuropathie au moyen du facteur de croissance d'hepatocytes Download PDF

Info

Publication number
WO1999036103A1
WO1999036103A1 PCT/US1999/000965 US9900965W WO9936103A1 WO 1999036103 A1 WO1999036103 A1 WO 1999036103A1 US 9900965 W US9900965 W US 9900965W WO 9936103 A1 WO9936103 A1 WO 9936103A1
Authority
WO
WIPO (PCT)
Prior art keywords
neuropathy
hgf
neuron
ngf
patient
Prior art date
Application number
PCT/US1999/000965
Other languages
English (en)
Inventor
Freda D. Miller
Xiu-Ming Yang
Original Assignee
Mcgill University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Mcgill University filed Critical Mcgill University
Publication of WO1999036103A1 publication Critical patent/WO1999036103A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A61K38/1833—Hepatocyte growth factor; Scatter factor; Tumor cytotoxic factor II
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • This invention relates to the field of axonal regeneration in neurons.
  • Peripheral neuropathy resulting from degeneration or demyelination of peripheral nerve axons, may affect motor, sensory, or autonomic nerves.
  • General clinical manifestations of peripheral neuropathy include alterations in sensation, alterations in autonomic functions
  • peripheral neuropathy is a common complication of diabetes mellitus, in which dysfunction of autonomic, sensory, and/or sensorimotor nerves results in an array of disabling symptoms including diarrhea, urinary retention, postural hypotension, and male erectile impotence.
  • peripheral neuropathy At its most extreme, autonomic dysfunction caused by peripheral neuropathy leads to cardiac arrhythmias and death. Clearly, it would be desirable to prevent, retard, or reverse the disturbing and often life-threatening manifestations of peripheral neuropathy by stimulating growth or regeneration of peripheral nerve axons.
  • Neurons within the peripheral nervous system including those affected by peripheral neuropathy, have the capacity for axonal growth and regeneration. Moreover, under certain conditions peripheral neurons are capable of significant axonal growth and regeneration following axonal injury.
  • HGF hepatocyte growth factor
  • HGF localized hepatocyte growth factor
  • Localized exogenous HGF promotes the growth (but not survival) of sympathetic neurons.
  • sympathetic neurons co-express bioactive HGF and its cognate receptor, the Met receptor.
  • Antibodies that inhibit HGF activity decrease neuron growth, but have no affect on survival.
  • the administration of HGF may be used to promote axonal growth and regeneration for the prevention or treatment of neuropathies involving axonal degeneration, such as diabetic neuropathy.
  • the invention features a method for promoting axonal growth or axonal regeneration of a post-natal neuron.
  • the method includes administering an expression vector to the neuron, wherein the expression vector includes a hepatocyte growth factor gene operably linked to a promoter.
  • the invention features a method for inhibiting axonal degeneration of a post-natal neuron. The method includes administering an expression vector to the neuron, wherein the expression vector includes a hepatocyte growth factor gene operably linked to a promoter.
  • the invention features a method for treating or inhibiting neuropathy, in a patient.
  • the method includes administering a therapeutically effective dose of hepatocyte growth factor to the patient.
  • the invention features a method for treating or inhibiting neuropathy in a patient.
  • the method includes administering an expression vector including a hepatocyte growth factor gene operably linked to a promoter to the patient.
  • the patient is identified as having a neuropathy.
  • the neuropathy may be a symptomatic neuropathy or an asymptomatic neuropathy, and may be caused by axonal degeneration.
  • the neuropathy may be an autonomic neuropathy, a sensory neuropathy, a sensorimotor neuropathy, or a motor neuropathy.
  • the expression vector is expressed in a neuron, or is expressed in a non-neuronal cell in the region of the body where the neuropathy is present.
  • the hepatocyte growth factor gene further encodes a signal sequence that directs secretion of hepatocyte growth factor from a neuron or from a non- neuronal cell
  • the expression vector may be an adenoviral vector
  • the promotor may be a Ted -tubulin promoter.
  • the hepatocyte growth factor may comprise a non-cleavable sequence variant, and the hepatocyte growth factor or a hepatocyte growth factor expression vector is administered to a neuron selected from: a sympathetic neuron, a parasympathetic neuron, a sensory neuron, or a motor neuron.
  • the hepatocyte growth factor expression vector may be administered to the terminals of sympathetic neurons.
  • the patient is identified as at risk for diabetic neuropathy prior to said preventing, or the patient is identified as having diabetic neuropathy, or the patient is identified as having clinical manifestations of diabetic neuropathy prior to treatment.
  • the diabetic neuropathy may be caused by insulin-dependent diabetes or by non- insulin-dependent diabetes.
  • the diabetic neuropathy may present as distal sensory polyneuropathy, sensorimotor polyneuropathy, autonomic neuropathy, visceral autonomic neuropathy, mononeuropathy, or mononeuropathy multiplex. Patients having such diabetic neuropathies may have symptoms including, but not limited to, foot ulcerations, cardiac arrhythmias, sexual impotence, chronic pain, or abnormal vascular responses as a result of their neuropathy.
  • hepatocyte growth factor or "HGF” is meant a polypeptide that is substantially identical to an amino acid sequence set forth in Accession No. P14210 of the SWISS-PROT amino acid sequence database (http://www.expasy.ch/sprot or http://www.ebi.ac.uk/sprot). Included in the definition are HGFs from other species, such as mouse, rat, and chicken (see, e.g., SWISS-PROT Accession Nos.
  • HGF is capable of stimulating axonal growth and regeneration and inhibiting axonal degeneration of SCG neurons.
  • hepatocyte growth factor gene or "HGF gene” is meant a segment of DNA that encodes hepatocyte growth factor, as defined above.
  • neuropathy is meant a functional disturbance or pathological change in the peripheral nervous system. Motor, sensory, and autonomic functions may be equally or preferentially effected. Major clinical manifestations are muscle weakness and atrophy, alterations in sensory perception, and/or altered autonomic function. In extreme cases, neuropathy can lead to death. For example, the incidence of cardiac arrhythmia is increased in those suffering from autonomic neuropathy, and the incidence of fatal infection due to foot sores is increased in those suffering from sensory neuropathy.
  • a neuropathy may show mainly axonal degeneration, mainly segmental demyelination, or both.
  • Neuropathies may be localized to one nerve (mononeuropathy) or to several individual nerves (mononeuropathy multiplex), or may be diffuse and symmetrical (polyneuropathy).
  • the etiology of a neuropathy may be known or unknown.
  • causes of neuropathy include metabolic disease (such as diabetes), poor nutrition (such as that seen in alcoholism), infection (such as that seen in infection by Herpes Zoster or Human Immunodeficiency Virus (HIV)), ischemia, toxin exposure, radiation, and inheritance of a genetic predisposition for developing a neuropathy.
  • metabolic disease such as diabetes
  • poor nutrition such as that seen in alcoholism
  • infection such as that seen in infection by Herpes Zoster or Human Immunodeficiency Virus (HIV)
  • ischemia such as that seen in infection by Herpes Zoster or Human Immunodeficiency Virus (
  • transfection in the region of the body where said neuropathy is present is meant that vector-encoded HGF expressed by a cell within this specified region can diffuse to an affected axon and activate Met receptors on such axons within 24 hours of HGF synthesis.
  • transformation is meant any method for introducing foreign nucleic acid molecules into a cell. Lipofection, DEAE-dextran-mediated transfection, microinjection, protoplast fusion, calcium phosphate precipitation, transduction (e.g., bacteriophage, adeno viral retroviral, or other viral delivery), electroporation, and biolistic transformation are just a few of the methods known to those skilled in the art which may be used.
  • transformed cell means a cell (or a descendent of a cell) into which a DNA molecule encoding a polypeptide of the invention has been introduced, by means of recombinant DNA techniques.
  • promoter is meant a minimal sequence sufficient to direct transcription. Also included in the invention are those promoter elements which are sufficient to render promoter-dependent gene expression controllable for cell type-specific, tissue-specific, temporal-specific, or inducible by external signals or agents; such elements may be located in the 5' or 3' or intron sequence regions of the native gene.
  • operably linked is meant that a gene and one or more regulatory sequences are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the regulatory sequences.
  • expression vector is meant a genetically engineered plasmid or virus, derived from, for example, a bacteriophage, adenovirus, retrovirus, poxvirus, herpesvirus, or artificial chromosome, that is used to transfer an HGF coding sequence, operably linked to a promoter, into a host cell, such that the encoded HGF is expressed within the host cell.
  • degeneration is meant that the length of an axon or the density of axons in the peripheral nervous system (PNS) decreases as a result of neuropathy.
  • the relative level of degeneration may be assessed using methods known in the art for determining relative PNS function in a patient.
  • the degeneration is by at least 5% (compared to a normal subject not experiencing neuropathy), preferably by at least 15%, more preferably by at least 25%, more preferably by at least 35%, and most preferably by at least 45%.
  • growth or “regeneration” is meant that the length of an axon or the density of axons in the PNS, particularly in a PNS affected by neuropathy, increases as a result of a method of the invention.
  • the growth or regeneration may be measured by methods known in the art for assessing the relative function of a subject's PNS.
  • inhibiting is meant administering HGF or an HGF expression vector in order to delay the onset of neuropathy or axonal degeneration in a patient at risk therefor or to decrease the severity of the impending neuropathy or axonal degeneration in such a patient.
  • the delay is by at least one day, preferably by at least one week, more preferably by at least one month, still more preferably by at least six months, and most preferably by at least one year.
  • the decrease is by at least 10%, more preferably by at least 25%, still more preferably by at least 40%, yet more preferably by at least 60%, and most preferably by at least 70%.
  • treating is meant administering HGF or an HGF expression vector in order to delay the worsening of an already -present neuropathy or to improve the clinical status of a patient with a neuropathy.
  • the delay is by at least one month, more preferably by at least three months, still more preferably by at least six months, and most preferably by at least a year.
  • the improvement is by at least 10%, more preferably by at least 25%, still more preferably by at least 40%, yet more preferably by at least 60%, and most preferably by at least 70%.
  • the relative efficacy of the treatment may be assessed using methods known in the art for evaluating the relative function of a patient's PNS.
  • terapéuticaally effective dose is meant an amount of hepatocyte growth factor given to a patient for treating or inhibiting a neuropathy as defined above. Such a dose is typically in the range of about 1 ⁇ g/kg tol mg/kg of body weight.
  • signal sequence is meant an amino acid sequence at the amino terminus of a protein, that, when present, direct secretion of the protein from the cell.
  • One example of a signal sequence is amino acids 1-31 of amino acid sequence of the hepatocyte growth factor precursor set forth in Accession No. P14210 of the SWISS-PROT amino acid sequence database.
  • an artificial signal sequence or signal sequence from another secreted protein may be fused at the amino terminus of mature hepatocyte growth factor (e.g., amino acids 32-728 of SWISS-PROT Accession No. P14210), or biologically active (e.g., stimulating axonal growth or regeneration or inhibiting axonal degeneration) fragments thereof.
  • identity is meant that a polypeptide sequence possesses the same amino acid residue at a given position, compared to a reference polypeptide sequence to which the first sequence is aligned.
  • Sequence identity is typically measured using sequence analysis software with the default parameters specified therein, such as the introduction of gaps to achieve an optimal alignment (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705).
  • substantially identical is meant a polypeptide exhibiting at least 75%o, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% identity to a reference amino acid.
  • the length of comparison sequences is at least 16 amino acids, preferably at least 20 amino acids, more preferably at least 25 amino acids, and most preferably 35 amino acids.
  • terminal of a sympathetic neuron is meant the region of the neuronal axon that is furthest from the neuronal cell body.
  • Figs. 1 A- IB are representations of PCR assays showing that Met
  • Fig. 1 A and HGF (Fig. IB) are expressed in SCG sympathetic neurons in vitro and in vivo.
  • Fig. 1C is a representation of a Western blot showing that Met is expressed in SCG sympathetic neurons in vitro and in vivo.
  • Figs. 2A-2B are representations of in situ hybridization assays showing that Met (Fig. 2A) and HGF (Fig. 2B) are expressed in adult mouse SCG neurons.
  • Fig. 2C is a representation of an immunohistochemistry assay showing that Met is expressed in adult mouse SCG neurons.
  • Fig. 2D is a representation of an immunofluorescence assay showing that Met is expressed in cultured neonatal sympathetic neurons.
  • Figs. 2E-2F are representations of photomicrographs showing MDCK cells that were allowed to cluster, after which they were exposed to control medium (Fig. 2E) or medium conditioned by cultured neonatal SCG sympathetic neurons (Fig. 2F).
  • Figs. 3A-3D are representations of photomicrographs showing that treatment with HGF induces c-fos expression in cultured neonatal SCG sympathetic neurons.
  • Figs. 4A-4F are graphs showing that exogenous HGF promotes growth but not survival of sympathetic neurons, and that endogenous HGF in sympathetic neurons is necessary for optimal neuronal growth but not for survival.
  • Figs. 5A-5F are representations of phase contrast photomicrographs showing that endogenous HGF is necessary for optimal growth of SCG neurons.
  • Figs. 6A-6G are graphs showing growth of sympathetic neurons in compartmented cultures in the presence of HGF or anti-HGF antibody.
  • Figs. 7A-7B are representations of phase contrast photomicrographs showing that endogenous HGF is necessary for optimal growth of cultured sympathetic neurons in compartmented cultures.
  • Figs. 7C is a representation of a Western blot for detecting ⁇ -tubulin in lysates of axons in side compartments of compartmented cultures.
  • autocrine HGF provides an intrinsic local "motor” for promoting axonal growth without affecting neuronal survival.
  • the autocrine nature of this local "motor” makes it uniquely suited to drive axonal growth during periods when extrinsic sources of growth factors are few, such as during developmental axon extension and/or following axonal injury.
  • HGF neuronal growth
  • axonal HGF decreases the rate and density of axonal growth
  • neutralization of HGF in cell bodies and proximal neurites does not affect the rate of extension of distal axons.
  • HGF secreted by axons interacts locally with axonal Met receptors to increase the rate of axonal growth.
  • This novel local autocrine loop has important implications for neuronal growth both during development and following axonal injury.
  • HGF is likely to be useful in the treatment of medical conditions in which promotion of axon growth or regeneration is desirable. Such conditions include, but are not limited to, nerve damage caused by trauma or neuropathy.
  • Examples of neuropathies that are likely to be prevented or ameliorated by HGF include neuropathies caused by metabolic diseases (such as diabetes), poor nutrition (such as alcoholic neuropathy), infection, ischemia, toxins, and radiation.
  • an autocrine axonal HGF loop does not preclude additive effects with any HGF encountered in the path of the growing axons. As shown here, sympathetic axons can still respond to exogenous HGF, even in the presence of an autocrine axonal loop.
  • HGF Polypeptides and HGF Expression Vectors An HGF protein or gene may be administered within a pharmaceutically-acceptable diluent, carrier, or excipient, in unit dosage form. Conventional pharmaceutical practice may be employed to provide suitable formulations or compositions to administer HGF polypetides or genes to patients suffering from neuropathies or other injuries involving axonal degeneration. Administration may begin before the patient is symptomatic.
  • administration may be parenteral, intravenous, intra-arterial, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal, intracistemal, intraperitoneal, infranasal, aerosol, by suppositories, or oral administration.
  • Therapeutic formulations may be in the form of liquid solutions or suspensions; for oral administration, formulations may be in the form of tablets or capsules; and for infranasal formulations, in the form of powders, nasal drops, or aerosols. Methods well known in the art for making formulations are found, for example, in Remington 's Pharmaceutical Sciences, (18 th edition), ed. A.
  • Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes.
  • Biocompatible, biodegradable lactide polymer, lactide/glycolide copolymer, or polyoxyethylene-polyoxypropylene copolymers may be used to control the release of the compounds.
  • Other potentially useful parenteral delivery systems for HGF modulatory compounds include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes.
  • Formulations for inhalation may contain excipients, for example, lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel.
  • Expression vectors encoding HGF also may be introduced into cells by transfection. Lipofection, DEAE-dextran-mediated transfection, microinjection, protoplast fusion, calcium phosphate precipitation, adenoviral delivery, retroviral delivery, electroporation, and biolistic transformation are just a few of the methods known to those skilled in the art which may be used. The following examples are to illustrate the invention. They are not meant to limit the invention in any way.
  • Mass cultures of pure sympathetic neurons from the SCG of postnatal day 1 rats were prepared and cultured either in LI 5 media as previously described (Ma et al., J. Cell. Biol. 117:135-141, 1992; Belliveau et al, J. Cell Biol. 136:375-388, 1997) or in UltraCulture (BioWhittaker, Walkersville, MD), a defined medium containing 2 mM glutamine and 1% penicillin/streptomycin. No differences were observed in experimental results obtained in the two types of media.
  • Neurons were plated on rat tail collagen-coated tissue culture dishes: 6-well plates (Falcon Labware, Becton Dickinson & Co, Lincoln Park, NJ) for biochemistry, and 48-well plates for survival assays.
  • Low density SCG cultures for neurite extension assays were plated on 24 well dishes coated with rat tail collagen.
  • NGF-dependent neurons were selected by culruring sympathetic neurons for 5 days in the presence of 50 ng/ml NGF, as previously described (Ma et al, supra; Belliveau et al, supra). Neurons were washed three times for 1 hour each in neurotrophin-free media, and were then fed with media containing various concentrations of NGF plus HGF, NGF plus anti-HGF, or HGF alone. Analysis of survival was performed 48 h later by using nonradioactive cell proliferation (MTT) assays (CellTitre 96, Promega, Madison, WI; Belliveau et al, supra).
  • MTT nonradioactive cell proliferation
  • MTT reagent Fifty ⁇ l of the MTT reagent was added to 500 ⁇ l media in each well and left for 2 hours at 37 °C. After aspiration of the MTT-containing media, 100 ⁇ l of a 0.065N HCl/isopropanol mixture was added to each well to lyse the cells. Colorimetric analysis was performed using an ELISA reader. Each condition was repeated in triplicate. Zero ng/ml NGF was considered 0% survival, and 10 ng/ml was considered 100% survival. All other conditions were related to these values.
  • neurons were cultured in 10 ng/ml NGF for 1 or 4 days. Neurons were then switched into media containing 10 ng/ml NGF plus HGF, or 10 ng/ml NGF plus anti-HGF antibody. After 2 additional days in culture, neurons were photographed and the number of neurite intersections were determined as described previously (Belliveau et al, supra). Briefly, regions in sister cultures containing a similar number of neuronal cell bodies were sampled and photographed, all interceptions and bifurcations of neurites within these windows were counted, and the number of intersections were normalized to the number of cell bodies. At least four windows were analyzed for each sample. Results are expressed as the mean density plus or minus the standard error of the mean. Statistical comparison was performed using Student's T-test.
  • KCl experiments mass cultures of neonatal sympathetic neurons were cultured as described above at a density of approximately one ganglion per well of a four-well plate. Four days following plating, cultures were washed 4 times, 1 hour each, with serum- and NGF-free medium.
  • HGF human HGF cDNA
  • HPLC purified hHGF
  • rhHGF recombinant human HGF kindly provided by Genentech
  • the compartmented dishes were constructed from collagen-coated 35 mm Falcon tissue culture dishes in which 20 parallel collagen tracks had been formed on the dish by scraping the dried collagen from the dish surface with a pin rake (Tyler Research Instruments, Edmonton, AB, Canada).
  • the dishes were coated with poly-D-lysine and laminin, and the tracks were formed in the same manner.
  • the scratched region of the dish was then wetted with culture medium, and a Teflon divider (Tyler Research Instruments, Edmonton, AB, Canada) that partitioned the dish into three compartments was sealed to the dish floor with silicone grease.
  • Dissociated sympathetic neurons were plated in the center compartment at a density of about 1.5 ganglia per dish as previously described, and within 1-2 days neurites had entered the left and right compartments.
  • Culture medium was UltraCulture (BioWhittaker, Walkersville, MD) supplemented with 2 mM L-Glutamine, 1% Penicillin/Streptomycin (BioWhittaker) and 0.4% Methylcellulose (Sigma Chemical Co, St. Louis, MO). Unless otherwise indicated, 3% rat serum (Harlan, Indianapolis, IN) was added only to the center compartments which contained the cell bodies and proximal neurites. Nonneuronal cells were eliminated using 10 ⁇ M cytosine arabinoside (Sigma Chemical Co, St.
  • the left compartment of each culture received either 1, 3 or 10 ng/ml NGF with or without the addition of 5 ⁇ l/ml nonimmune sheep serum (Sigma Chemical Co.) and served as a control. Alternatively, anti-rhHGF was added to the center compartment.
  • NGF nonimmune sheep serum
  • anti-rhHGF was added to the center compartment.
  • neurites crossed the silicone grease barriers and entered the side compartments in all cultures.
  • Culture medium was routinely changed every 3-4 days. Neurite extension along each track in the right and left compartments of each culture was measured by an ocular microMeter using an inverted phase-contrast microscope (Axi overt 100, Carl Ziess). Neurite extension was measured at timepoints ranging from 2 to 7 days.
  • Results are expressed as mean neurite extension plus or minus the standard e ⁇ or of the mean, and statistical analysis was performed using Student's T-test.
  • KCl experiments compartmented cultures of neonatal sympathetic neurons were established as above, and after 4 days cultures were washed 4 times for 1 hour each, with serum- and neurotrophin-free medium. Following these washes, cell bodies and proximal neurites were switched to media containing 50 mM KCl, while the side compartments were switched to the same medium with or without 30 ng/ml HGF.
  • mice were cultured for 4 days in 10 ng/ml NGF, followed by three washes with neurotrophin-free media for 1 hour each. Neurons were then switched to the same media plus 10 ng/ml NGF, and conditioned media was collected 8 or 24 hours later.
  • MDCK cells were cultured in DMEM medium and plated at a density of 2 x 104 cells in 24 well dish, and left to settle overnight. MDCK cells were then switched to DMEM medium containing a 1 :100 dilution of the sympathetic neuron conditioned-media, or unconditioned medium (with or without 10 ng/ml of NGF), and left for 8 or 24 hours. Scatter activity was analyzed as previously described (Stoker et al. Nature 327:239-242, 1987).
  • SCG were dissected from adult CD1 mice, fixed in 4% paraformaldehyde in PBS for 30 minutes, and cryoprotected in graded sucroses (12%, 16% and 18%).
  • Ten- ⁇ m cryostat sections were cut, mounted on Superfrost slides (Fisher), briefly air-dried, fixed in 4% paraformaldehyde in PBS for 5 min at room temperature, and washed twice in PBS.
  • slides were treated with proteinase K (1 ⁇ g/ml) in 0.1M Tris-HCl pH 7.5, 50 mM EDTA, and 2 mM CaC12 at 37°C for 10 min, followed by incubation in 0.1 M Triethanolamine containing 0.25% acetic anhydride for 10 min.
  • Slides were washed in 3X PBS for 5 min, followed by three washes with 2X SSC for 5 min each, then prehybridized in a buffer containing 50% deionized formamide, 5X SSC, 5X Denhart's solution, 250 mg/ml tRNA and 200 mg/ml salmon sperm DNA at RT for at least lh.
  • Sections were hybridized in the same solution plus 5 ng/ml digoxigenin-labelled probes at 45 °C overnight. Slides were then washed once with 2X SSC for 20 min, treated with 25 ug/ml RNAse in 0.1 M Tris plus 150 mM NaCl for 30 min at 37 °C twice, followed by washing twice with 0.2X SSC and twice with 0.1X SSC at 55°C for 15 min each, and then blocked with 2% normal sheep serum and 0.3% Triton X-100 in Buffer 1 (100 M Tris-HCl. pH 7.5, 150 mM NaCl) for 1 hour.
  • Buffer 1 100 M Tris-HCl. pH 7.5, 150 mM NaCl
  • the hybrids bound to anti-digoxigenin antibody were visualized by the color reaction with 337.5 ⁇ g/ml nitrobluetetrazolium salt (NBT), 175 ⁇ g/ml 5-bromo-4-chloro-3-indolyl-phosphate and 0.24 ⁇ g/ml Levamisole in Buffer 3, and colour was allowed to develop overnight in the dark.
  • the reaction was terminated by incubation with 100 mM Tris-HCl, pH 8.0, 1 mM EDTA for 5 min. Slides were dehydrated, incubated in xylene, mounted with Permount and stored at 4°C in the dark. Slides were viewed and photographed on a light microscope.
  • HGF antisense probes were used as described in Sonnenberg et al, J. Cell Biol. 123:223-235, 1993.
  • Nonradioactive antisense and sense riboprobes were synthesized by in vitro transcription using digoxigenin-UTP following the manufacturer's instructions (Boehringer Mannheim).
  • Cryosections of adult SCG were prepared as described for in situ hybridization.
  • Sympathetic neurons were plated on poly-D-lysine plus laminin coated cover slips, maintained for 4 days in 10 ng/ml of NGF and then fixed in acetone and methanol (1:1 V/V) for 5 min at RT, and allowed to air dry.
  • Sections (on slides prepared as above) or sympathetic neurons (on coverslips) were blocked with 4% goat serum plus 4% rat serum in PBS supplemented with 0.1% Tween-20 (PBST) for 1 hour, incubated with an anti-Met peptide antibody (1 :150) (Yang and Park , Dev. Biol.
  • RNA Extraction and Reverse Transcriptase PCR Amplification Tissues (including SCGs) were dissected from adult CD1 mice, and total RNA was prepared following the protocol of Chomczynski and Sacchi, Anal. Biochem. 62: 156-159, 1987.
  • cDNA was synthesized from 5 ⁇ g of total RNA using the cDNA synthesis kit from Gibco BRL following the manufacturer's instructions.
  • two ohgonucleotide primers PI 5'-484 CCATGAATTTGACCTCTATG 503-3'
  • P2 5'-760 ACTGAGGAA-TGTCACAGACT 741-3'
  • Two specific oligoncleotide primers were also used to detect Met specific product, P3 (5' -272 AGATGAACGTGAACATGAAG 291-3'), P4 (5' -566 CTAATGAGTTGATCATCATAG 546-3').
  • the PCR reaction contained 10 mM Tris-HCl pH 8.3, 50 mM KCl, 1.5 mM MgC12, , 0.01% gelatin, 200 mM dNTP, 10 pM of 5' and 3' HGF ohgonucleotide primers, 2 ⁇ l cDNA template and 1 U Taq polymerase (BRL).
  • Amplification was performed for 45 cycles: 94 °C (1 min), 48 °C (2 min), 72 °C (2 min) in a Perkin Elmer Cetus DNA thermal cycler.
  • the PCR products were separated on a 1.5% agarose gel and transfe ⁇ ed to a Hybond N membrane (Nycomed Amersham pic, Buckinghamshire, UK).
  • An internal HGF P5, 5'-656 ACCTACAGGAAAACTACTG 675-3'
  • Met ohgonucleotide P6, 5' -487 TGGCTTTGCTGCTGCAGTC 469-3'
  • T4 polynucleotide kinase 100 ng
  • the membrane was prehybridized in 6X SSC, 1% SDS, 5X Denhardt's solution and 200 ⁇ g/ml salmon sperm DNA at 42 °C for 1 h and then hybridized in the same solution plus 50% formamide and 1 X 10° cpm/ml of labelled ohgonucleotide probe at 42 °C overnight.
  • the membrane was washed with 2X SSC and 0.1% SDS for 15 min and then exposed to X-ray film.
  • the lysates were normalized for protein concentration using a BCA Protein Assay Reagent (Pierce, Rockford, 111).
  • BCA Protein Assay Reagent Pieris, Rockford, 111.
  • 125 mg protein was immunoprecipitated with 10 ⁇ l anti-Met peptide antibody for 3 hours at 4°C (Yang and Park , Dev. Biol. 157:308-320, 1993), then incubated with Protein A-sepharose (Pharmacia and Upjohn, Kalamazoo, MI) for 1.5 hours at 4°C followed by centrifugation.
  • 1.25 mg protein was precipitated with wheat germ lectin-agarose (WGA) (Pharmacia) for 3 hours.
  • Detection was carried out using enhanced chemiluminescence (Nycomed Amersham pic, Buckinghamshire, UK) and XAR X-ray film (Kodak, Rochester, NY). Analysis of tubulin in the neurites of sympathetic neurons in compartmented cultures was performed by Western blot analysis. Compartmented cultures were established on a poly-D-lysine and laminin substratum with 10 ng/ml NGF in all compartments, and 5 ⁇ l/ml anti-HGF in one side compartment.
  • the neurites from each side compartment were lysed in cold Tris-buffered saline lysis buffer as described above except that sodium dodecyl sulphate was added to a final concentration of 0.1%.
  • 20 ⁇ g of total protein from each treatment group was separated by SDS-PAGE on a 7.5% gel, and transfe ⁇ ed to 0.2 ⁇ m nitrocellulose membrane. The transfe ⁇ ed membranes were then washed in TBS and blocked in 2% BSA, as described above.
  • the membranes were incubated at 4°C with an ⁇ -tubulin monoclonal antibody (Cedarlane Laboratories LTD, Hornby, ON, Canada) at a concentration of 0.05 ⁇ g/ml. Detection was carried out using enhanced chemiluminescence (Amersham) and XAR X-ray film (Kodak, Rochester, NY).
  • Acutely dissociated sympathetic neurons from postnatal day 1 rat SCG were plated on poly-D-lysine and laminin coated cover slips in LI 5-CO 2 medium without NGF for three hours (Wyatt and Davies, J. Cell Biol. 130: 1435-46, 1995). Neurons were then cultured with media containing various amount of HGF or NGF respectively for 3 hours. Cells were fixed in acetone and methanol (1 : 1 v/v), blocked with 2% goat serum in PBST, and then incubated with anti-fos antibody (1 :50) (Oncogene Science, Uniondale, NY) overnight at 4°C.
  • Example II HGF and its receptor, the Met tyrosine kinase. are coexpressed in sympathetic neurons in vivo and in culture
  • RT-PCR analysis revealed that HGF and Met mRNAs were expressed both in the newborn and in the adult SCG (Figs. 1 A and IB; the (-) in the last lanes indicates that no cDNA was added to the PCR reaction).
  • HGF and/or Met were expressed in neurons or in nonneuronal cells.
  • Met Fig. 2 A
  • HGF Fig. 2B
  • Met Fig. 2A
  • HGF Fig. 2B
  • both HGF and Met mRNAs were clearly localized to the same neurons (for example, see neuron denoted by a ⁇ ows in Figs. 2A and 2B; bar for Figs. 2A-2C is on Fig. 2C, and equals 75 ⁇ m for Figs. 2A-2B and 36 ⁇ m for Fig. 2C).
  • Fig. 2F shows a phase- contrast photomicrograph of MDCK cells in neuron-conditioned medium containing 10 ng/ml NGF; a ⁇ ow shows scattering
  • Example III Exogenous HGF Stimulates Immediate Early Gene Expression, but Not Survival of Sympathetic Neurons
  • HGF may function as an autocrine neurotrophic factor for these neurons.
  • HGF was able to stimulate a functional Met receptor-mediated signaling response, as monitored by the immediate early gene c-fos.
  • Previous work has demonstrated that HGF leads to an immediate activation of c-fos expression in epithelial cells and in septal neurons (Fabregat et al, Biochem. Biophys. Res. Commun. 189:684-690, 1992; Jung et al, J. Cell Biol.
  • HGF was capable of eliciting a robust induction of c-fos in approximately 80-90% of the sympathetic neurons in these acutely dissociated cultures (Fig. 3D), a response equivalent to that invoked by 10 ng/ml NGF (Fig. 3 A).
  • Figs. 4A-4C show the results of colorimetric MTT assays to measure mitochondrial function and cell survival. In the experiment represented in Fig.
  • Figs. 4D-4F show quantitative analyses of neuritic process density in sympathetic neuron cultures grown in the presence of: NGF alone, NGH + HGF (Fig. 4D), KCl + HGF (Fig. 4E), or NGF + anti-HGF antibody (Fig. 4F).
  • the left panel of Fig. 4F shows the results of (Fig. 4F, left panel) three separate experiments that were performed to determine the effect of blocking endogenous HGF on process density in sympathetic neurons.
  • Sympathetic neurons were plated at low density on collagen for 1 day in 10 ng/ml NGF, and then were switched for 2 days to 10 ng/ml NGF with or without 5 ⁇ g/ml of Sigma anti-HGF or 5 ⁇ l/ml Genentech HGF antiserum (anti-HGF).
  • anti-HGF Genentech HGF antiserum
  • neurons were also switched to NGF containing 5 ⁇ l/ml nonimmune goat serum (GS).
  • GS nonimmune goat serum
  • Fig. 5A-5F are phase contrast micrographs showing that endogenous HGF is necessary for optimal growth of cultured sympathetic neurons.
  • Figs. 5A-5C show neurons maintained in 10 ng/ml NGF for 1 day and then switched to (Fig. 5 A) 10 ng/ml NGF, (Fig. 5B) 10 ng/ml NGF plus 30 ng/ml rhHGF, or (Fig. 5C) 10 ng/ml NGF plus 5 ⁇ l/ml HGF antiserum (Genentech). Exogenous HGF enhanced and HGF antibody decreased process outgrowth.
  • Fig. 5D-5F show neurons maintained in 10 ng/ml NGF for 4 days, and then switched to (Fig.
  • Plots represent the combined results from three sister cultures showing the average length of neurites at 2.5, 4.5, and 6.5 days following establishment. E ⁇ or bars indicate standard e ⁇ or of the mean, and asterisks denote those timepoints where growth was significantly different between the experimental and control sides (**P ⁇ 0.001).
  • HGF applied to neurites was capable of modestly enhancing the forward rate of neurite outgrowth over the entire six day period (Fig. 6A); by the sixth day, there was an increase of approximately 18% in the average length of neurites that were exposed to NGF plus HGF versus NGF alone.
  • a second set of compartmented culture experiments we measured the effects of exogenous HGF on the forward rate of axonal extension in the presence of KCl.
  • Figs. 6C and 6D show that endogenous local HGF is necessary for optimal axonal extension rate.
  • compartmented cultures were established with 10 ng/ml NGF in all compartments, and 5 ⁇ l/ml HGF antiserum in one side compartment.
  • the results from measurements of neurite length in three sister cultures at 3.5, 4.5, and 5.5 days with (anti-HGF) or without (Control) anti-HGF were combined.
  • the results from measurements of neurite length in the side compartments of three sister cultures at 4, 6, and 7 days were combined.
  • e ⁇ or bars and significance are as in Fig. 6A. In some cases, the e ⁇ or bars fall within the symbols.
  • Fig. 6D compartmented cultures were initially established with 10 ng/ml NGF in the center compartment and 3 ng/ml NGF in both side compartments.
  • 3 ng/ml NGF plus 5 ⁇ l/ml anti-HGF antiserum (Genentech) was added to one side compartment and 3 ng/ml plus 5 ⁇ l/ml nonimmune sheep serum to the other, and neurite lengths were measured immediately.
  • Neurite length was again measured on days 2,4,5, and 6; at 3 days, media was replaced with new media containing the same concentrations of NGF, anti-HGF and nonimmune serum.
  • Results represent data combined from 6 different cultures from two separate experiments. E ⁇ ors and significance are as in Fig. 6A.
  • Fig. 6F 10 ng/ml NGF plus 3% rat serum in all compartments with 5 ⁇ l/ml anti-HGF in one side compartment.
  • the plot shown in Fig. 6F represents the combined data from measurements of neurite length in the compartments with and without anti-HGF in three sister cultures at 4, 6, and 7 days. E ⁇ or bars and significance are as in Fig. 6A. Note that this experiment was performed on sister cultures to those shown in panel C, Experiment 2, demonstrating that anti-HGF had similar effects whether the side compartments contained serum (Fig. 6F) or not (Fig. 6C, Experiment 2).
  • HGF was capable of promoting forward axonal growth in the absence of NGF, although this effect (Fig. 6B) was not as robust as the effect on neurite density (Fig. 4E). Together these data indicate that HGF can promote increased neuritic density and forward axonal extension in the presence or absence of NGF. Moreover, our compartmented culture data indicate that HGF can act locally through axonal Met receptors to enhance axonal growth.
  • HGF played any role in sympathetic neuron survival or growth.
  • sympathetic neurons were cultured for 5 days in 50 ng/ml of NGF, and were then switched into suboptimal concentrations of NGF with or without anti-HGF (5 ⁇ g/ml for Sigma anti-HGF and 5 ⁇ l/ml for Genentech anti-HGF).
  • Addition of either the anti-HGF IgG (Sigma) (Fig. 4B) or the anti-HGF antiserum (Genentech) (Fig. 4C) had no effect on sympathetic neuron survival as mediated by 1 ng/ml (Fig. 4B-4C) or 5 ng/ml NGF.
  • endogenous HGF is not apparently required for NGF-mediated sympathetic neuron survival.
  • compartmented cultures were established with 10 ng/ml NGF in the center compartment and one of the side compartments, and 10 ng/ml NGF plus 5 ⁇ l/ml anti-HGF (Genentech) in the other side compartment.
  • the amount of axonal growth was then measured at 3.5, 4.5 and 5.5 days (Experiment 1, Fig. 6C) or at 4, 6, and 7 days
  • Example VI Autocrine HGF Promotes Axonal Extension in a Local. Substrate-Independent Fashion
  • compartmented culture results indicated that axonally-produced HGF acted locally to promote an optimal axonal extension rate.
  • endogenous HGF could also be promoting sympathetic neuron growth by acting globally, for example, to increase the expression of genes important for neuronal growth (Ma et a ⁇ .,supra; Belliveau et al, supra).
  • compartmented cultures were established with 10 ng/ml NGF in all compartments, and then anti-HGF (Genentech) was added to the central compartments of half of the sister cultures.
  • the amount of neurite extension was then measured at 4, 5, and 6 days (3 cultures each treatment, Experiment 1, Fig. 6E) or 4, 6, and 7 days (3 cultures each treatment, Experiment 2, Fig. 6E).
  • FIGs. 7A-7B show phase contrast photomicrographs of neurites on a single track from a sympathetic neuron compartmented culture on poly-D-lysine/laminin where the left compartment (Fig. 7 A) has been maintained in 10 ng/ml NGF, while the right compartment (Fig. 7B) has been maintained in 10 ng/ml NGF plus 5 ⁇ l/ml HGF antiserum (Genentech). The photographs were taken about 4 mm away from the silicone grease ba ⁇ ier that separates the central and side compartments.
  • Cult 1 refers to one culture and (Cult 2) to the second.
  • One side compartment (Cult 1 or Cult 2) was treated with 10 ng/ml NGF alone for 6 days, while the other (Cult 1 + anti-HGF, Cult 2 + anti-HGF) was treated with 10 ng/ml NGF plus anti-HGF.
  • the tubulin band is denoted as ⁇ -Tubulin.
  • the Western analysis shown in Fig. 7C revealed a dramatic decrease in the amount of total tubulin in the side compartments treated with anti-HGF versus those without, a decrease that was presumably due both to decreased neuritic density and to decreased forward extension.
  • endogenous local HGF is essential for growth of sympathetic axons, promoting both the rate and density of axonal growth in a substrate-independent fashion.
  • HGFs or HGF genes used in the methods of the invention may be naturally occurring, or may be produced using methods for recombinant DNA technology.
  • HGFs or HGF genes may be derived from a variety of animal species, and may include naturally occurring or artificially mutated variants.
  • sequence variants may have properties that are useful in the methods of the invention, including enhanced stability or biological activity. For example, sequence variants described in the U.S.
  • adenoviral vectors may be used to express exogenous HGF genes in neurons or in non-neuronal cells. Such adenoviral vectors efficiently introduce DNA into cells such as post-mitotic neurons, as described in U.S. patent application "Post-Mitotic Neurons Containing Adenovirus Vectors That Modulate Apotosis and Growth” (USSN 60/066,761).
  • HGF genes may be limited to neurons by placing HGF gene expression under the regulation of a neuron- specific promoter.
  • a neuron-specific promoter is the promoter of the neuron-specific T ⁇ l ⁇ -tubulin gene, which is abundantly expressed in neurons during growth and target re-innervation.
  • the T ⁇ l ⁇ -tubulin gene promoter is described in U.S. patent "T ⁇ l ⁇ -Tubulin Promoter and Expression Vectors" (USPN 5,661,032), and in U.S. patent application "Neuron Promoter and Uses" (USSN 08/900,026).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne des procédés de prévention de la dégénérescence axonique et de stimulation de la croissance ou de la régénération axonique dans les neurones par l'exposition des neurones au facteur de croissance d'hépatocytes.
PCT/US1999/000965 1998-01-16 1999-01-15 Prevention et traitement de la neuropathie au moyen du facteur de croissance d'hepatocytes WO1999036103A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US7169498P 1998-01-16 1998-01-16
US60/071,694 1998-01-16

Publications (1)

Publication Number Publication Date
WO1999036103A1 true WO1999036103A1 (fr) 1999-07-22

Family

ID=22102971

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/000965 WO1999036103A1 (fr) 1998-01-16 1999-01-15 Prevention et traitement de la neuropathie au moyen du facteur de croissance d'hepatocytes

Country Status (1)

Country Link
WO (1) WO1999036103A1 (fr)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000062798A2 (fr) * 1999-04-15 2000-10-26 St. Elizabeth's Medical Center, Inc. Facteurs de croissance angiogenique destines au traitement de neuropathie peripherique
WO2001032220A1 (fr) * 1999-10-29 2001-05-10 Medgene Bioscience, Inc. Therapie genique pour traiter les maladies ischemiques diabetiques
EP1132098A1 (fr) * 1999-09-21 2001-09-12 MedGene Bioscience, Inc. Th rapie g nique pour troubles c r bro-vasculaires
EP1449542A1 (fr) * 2001-11-28 2004-08-25 Anges MG, Inc. Preparations medicinales contenant du materiel genetique destinees au traitement de maladies neurodegeneratives
US6989374B1 (en) 1999-10-08 2006-01-24 Anges Mg, Inc. Gene therapy for cardiomyopathy
US7125856B1 (en) 1999-04-15 2006-10-24 St. Elizabeth's Medical Center Of Boston, Inc. Angiogenic growth factors for treatment of peripheral neuropathy
WO2013065913A1 (fr) * 2011-11-03 2013-05-10 주식회사 바이로메드 Thérapie génique pour la neuropathie diabétique à l'aide d'une isoforme d'hgf
WO2019078586A1 (fr) * 2017-10-18 2019-04-25 Viromed Co., Ltd. Traitement de neuropathie avec une construction d'adn exprimant des isoformes de hgf avec une interférence réduite à partir de gabapentinoïdes
US10639351B2 (en) 2013-10-22 2020-05-05 Helixmith Co., Ltd. Method for treating amyotrophic lateral sclerosis with a polynucleotide encoding two or more isoforms of hepatocyte growth factor
US11510999B2 (en) 2018-07-17 2022-11-29 Helixmith Co., Ltd Treatment of neuropathy with DNA constructs expressing IGF-1 isoforms

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
GLOSTER A, ET AL.: "THE TALPHA1 ALPHA-TUBULIN PROMOTER SPECIFIES GENE EXPRESSION AS A FUNCTION OF NEURONAL GROWTH AND REGENERATION IN TRANSGENIC MICE", JOURNAL OF NEUROSCIENCE RESEARCH., WILEY-LISS., US, vol. 14, no. 12, 1 December 1994 (1994-12-01), US, pages 7319 - 7330, XP002918462, ISSN: 0360-4012 *
HAMANOUSE M, ET AL.: "NEUROTROPHIC EFFECT OF HEPATOCYTE GROWTH FACTOR ON CENTRAL NERVOUS SYSTEM NEURONS IN VITRO", JOURNAL OF NEUROSCIENCE RESEARCH., WILEY-LISS., US, vol. 43, 1 January 1996 (1996-01-01), US, pages 554 - 564, XP002918463, ISSN: 0360-4012, DOI: 10.1002/(SICI)1097-4547(19960301)43:5<554::AID-JNR5>3.0.CO;2-H *
MAINA F, ET AL.: "MET RECEPTOR SIGNALING IS REQUIRED FOR SENSORY NERVE DEVELOPMENT AND HGF PROMOTES AXONAL GROWTH AND SURVIVAL OF SENSORY NEURONS", GENES AND DEVELOPMENT., COLD SPRING HARBOR LABORATORY PRESS, PLAINVIEW, NY., US, vol. 11, no. 24, 15 December 1997 (1997-12-15), US, pages 3341 - 3350, XP002918459, ISSN: 0890-9369 *
SOCIETY FOR NEUROSCIENCE, WASHINGTON, DC.; 1 November 1995 (1995-11-01), WONG V, ET AL.: "CNTF POTENTIATES THE EFFECTS OF BDNF, GDNF, OR HGF IN CULTURED MOTOR NEURONS", XP002918461 *
WU W, GLOSTER A, MILLER F D: "TRANSCRIPTIONAL REPRESSION OF THE GROWTH-ASSOCIATED TALPHA1 ALPHA-TUBULIN GENE BY TARGET CONTACT", JOURNAL OF NEUROSCIENCE RESEARCH., WILEY-LISS., US, vol. 48, 1 January 1997 (1997-01-01), US, pages 477 - 487, XP002918639, ISSN: 0360-4012, DOI: 10.1002/(SICI)1097-4547(19970601)48:5<477::AID-JNR8>3.0.CO;2-B *
YAMAMOTO Y, ET AL.: "HEPATOCYTE GROWTH FACTOR (HGF/SF) IS A MUSCLE-DERIVED SURVIVAL FACTOR FOR A SUBPOPULATION OF EMBRYONIC MOTONEURONS", DEVELOPMENT, THE COMPANY OF BIOLOGISTS LTD., GB, vol. 24, no. 15, 1 January 1997 (1997-01-01), GB, pages 2903 - 2913, XP002918460, ISSN: 0950-1991 *

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000062798A2 (fr) * 1999-04-15 2000-10-26 St. Elizabeth's Medical Center, Inc. Facteurs de croissance angiogenique destines au traitement de neuropathie peripherique
WO2000062798A3 (fr) * 1999-04-15 2001-01-04 St Elizabeth S Medical Ct Inc Facteurs de croissance angiogenique destines au traitement de neuropathie peripherique
US7125856B1 (en) 1999-04-15 2006-10-24 St. Elizabeth's Medical Center Of Boston, Inc. Angiogenic growth factors for treatment of peripheral neuropathy
AU774990B2 (en) * 1999-09-21 2004-07-15 Anges Mg, Inc. Gene therapy for cerebrovascular disorders
EP1132098A4 (fr) * 1999-09-21 2002-07-31 Medgene Bioscience Inc Th rapie g nique pour troubles c r bro-vasculaires
EP1132098A1 (fr) * 1999-09-21 2001-09-12 MedGene Bioscience, Inc. Th rapie g nique pour troubles c r bro-vasculaires
US6936594B1 (en) 1999-09-21 2005-08-30 Ryuichi Morishita Gene therapy for cerebrovascular disorders
US6989374B1 (en) 1999-10-08 2006-01-24 Anges Mg, Inc. Gene therapy for cardiomyopathy
WO2001032220A1 (fr) * 1999-10-29 2001-05-10 Medgene Bioscience, Inc. Therapie genique pour traiter les maladies ischemiques diabetiques
EP1142590A1 (fr) * 1999-10-29 2001-10-10 MedGene Bioscience, Inc. Therapie genique pour traiter les maladies ischemiques diabetiques
AU778826B2 (en) * 1999-10-29 2004-12-23 Anges Mg, Inc. Gene therapy for diabetic ischemic disease
EP1142590A4 (fr) * 1999-10-29 2005-01-26 Anges Mg Inc Therapie genique pour traiter les maladies ischemiques diabetiques
US7763591B2 (en) 2001-11-28 2010-07-27 Anges Mg, Inc. Hepatocyte growth factor gene therapy for parkinson's disease
EP1449542A1 (fr) * 2001-11-28 2004-08-25 Anges MG, Inc. Preparations medicinales contenant du materiel genetique destinees au traitement de maladies neurodegeneratives
EP1449542A4 (fr) * 2001-11-28 2007-03-14 Anges Mg Inc Preparations medicinales contenant du materiel genetique destinees au traitement de maladies neurodegeneratives
US10759841B2 (en) 2011-11-03 2020-09-01 Helixmith Co., Ltd. Gene therapy for diabetic neuropathy using an HGF isoform
WO2013065913A1 (fr) * 2011-11-03 2013-05-10 주식회사 바이로메드 Thérapie génique pour la neuropathie diabétique à l'aide d'une isoforme d'hgf
US20140296142A1 (en) * 2011-11-03 2014-10-02 Viromed Co., Ltd Gene therapy for diabetic neuropathy using an hgf isoform
AU2012333408B2 (en) * 2011-11-03 2016-05-26 Viromed Co., Ltd. Gene therapy for diabetic neuropathy using an HGF isoform
US9963493B2 (en) 2011-11-03 2018-05-08 Viromed Co., Ltd. Gene therapy for diabetic neuropathy using an HGF isoform
US10639351B2 (en) 2013-10-22 2020-05-05 Helixmith Co., Ltd. Method for treating amyotrophic lateral sclerosis with a polynucleotide encoding two or more isoforms of hepatocyte growth factor
WO2019078586A1 (fr) * 2017-10-18 2019-04-25 Viromed Co., Ltd. Traitement de neuropathie avec une construction d'adn exprimant des isoformes de hgf avec une interférence réduite à partir de gabapentinoïdes
CN111836637A (zh) * 2017-10-18 2020-10-27 赫利世弥斯株式会社 减少加巴喷丁类似物的干扰并表达肝细胞生长因子异构体的利用脱氧核糖核酸结构的神经病的治疗
JP2020537675A (ja) * 2017-10-18 2020-12-24 ヘリックスミス カンパニー， リミテッド ガバペンチノイドからの干渉が減少し、ｈｇｆ異型体を発現するｄｎａコンストラクトを用いる神経病症の治療
EP3697431A4 (fr) * 2017-10-18 2021-09-08 Helixmith Co., Ltd Traitement de neuropathie avec une construction d'adn exprimant des isoformes de hgf avec une interférence réduite à partir de gabapentinoïdes
JP2022060514A (ja) * 2017-10-18 2022-04-14 ヘリックスミス カンパニー， リミテッド ガバペンチノイドからの干渉が減少し、ｈｇｆ異型体を発現するｄｎａコンストラクトを用いる神経病症の治療
US11510999B2 (en) 2018-07-17 2022-11-29 Helixmith Co., Ltd Treatment of neuropathy with DNA constructs expressing IGF-1 isoforms

Similar Documents

Publication Publication Date Title
CA2222509C (fr) Facteur de croissance des tissus conjonctifs
US20020150986A1 (en) Extracellular matrix signalling molecules
DE60223511T2 (de) Neurotrophe faktoren
US5932542A (en) Composition and methods using myelin-associated glycoprotein (MAG) and inhibitors thereof
US8673594B2 (en) Methods for stimulating nervous system regeneration and repair by regulating arginase I and polyamine synthesis
PT1443955E (pt) Pdgf-bb para o tratamento da doença de parkinson
JPH11507201A (ja) 筋肉の疾患および障害の治療方法
KR20010101981A (ko) 혈관 내피 성장 인자-2
US5985822A (en) Inhibition of glial cell proliferation with N-CAM homophilic peptides
US8420780B2 (en) Mutated netrin 4, fragments thereof and uses thereof as drugs
US20110262432A1 (en) mutated netrin 4 proteins, fragments thereof and their uses as drugs
WO1999036103A1 (fr) Prevention et traitement de la neuropathie au moyen du facteur de croissance d&#39;hepatocytes
US7384634B2 (en) Connective tissue growth factor
EP2382982A2 (fr) Peptides de régéneration neurale et procédés d&#39;utilisation de ces derniers dans le traitement des lesions cerebrales
CA2582224A1 (fr) Compositions et methodes de modulation de la regeneration des tissus et des reponses chimiotactique
CN110869386A (zh) 重组神经生长因子的组合物和方法
AU2001259453A1 (en) Methods for stimulating nervous system regeneration and repair by regulating arginase 1 and polyamine synthesis
US20060241284A1 (en) Transmembrane protein amigo and uses thereof
SK2694A3 (en) Pharmaceutical agent for treatment of motor neuron diseases
WO1994020125A1 (fr) Traitement des affections des neurones moteurs a l&#39;aide du facteur de croissance des fibroblastes 5 (fgf-5)
WO1996036709A1 (fr) Facteur de croissance transformant alpha hii
US20080241168A1 (en) Transmembrane protein amigo and uses thereof
WO1997040155A1 (fr) Proteines induisant des interactions neuronales/gliales, adn codant pour elles et leurs methodes d&#39;utilisation
Zhu Signaling at the neuromuscular synapse
MXPA97009294A (en) Tissue growth factor connect

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): CA JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 09600437

Country of ref document: US

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase