WO2000037089A1 - Analogues de ribose d'adenosine diphosphate cyclique utilises pour la modulation de l'activite des lymphocytes t - Google Patents

Analogues de ribose d'adenosine diphosphate cyclique utilises pour la modulation de l'activite des lymphocytes t Download PDF

Info

Publication number
WO2000037089A1
WO2000037089A1 PCT/GB1999/004295 GB9904295W WO0037089A1 WO 2000037089 A1 WO2000037089 A1 WO 2000037089A1 GB 9904295 W GB9904295 W GB 9904295W WO 0037089 A1 WO0037089 A1 WO 0037089A1
Authority
WO
WIPO (PCT)
Prior art keywords
cadpr
cell
compound
cells
substance
Prior art date
Application number
PCT/GB1999/004295
Other languages
English (en)
Inventor
Barry V. L. Potter
Andreas H. Guse
Hendrik Schulze-Koops
Ingeborg Berg
Georg W. Mayr
Original Assignee
University Of Bath
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Bath filed Critical University Of Bath
Priority to JP2000589200A priority Critical patent/JP2002532554A/ja
Priority to EP99962345A priority patent/EP1140118A1/fr
Priority to AU18717/00A priority patent/AU1871700A/en
Publication of WO2000037089A1 publication Critical patent/WO2000037089A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A61P21/04—Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00—Drugs for disorders of the endocrine system
    • A61P5/14—Drugs for disorders of the endocrine system of the thyroid hormones, e.g. T3, T4
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00—Drugs for disorders of the endocrine system
    • A61P5/48—Drugs for disorders of the endocrine system of the pancreatic hormones

Definitions

  • the present invention relates to therapeutics.
  • the present invention relates to the modulation of T cell responses using compounds capable of regulating activation of T cells via a cyclic ADP ribose mediated pathway.
  • the invention also relates to treating autoimmune disease and graft rejection using such compounds and methods for identifying such compounds.
  • lymphocytes e.g. B and T lymphocytes.
  • recognition of an antigen leads to activation of lymphocytes that specifically recognise that particular antigen.
  • the lymphocytes proliferate and differentiate into specialised effector cells. The immune response culminates in the development of mechanisms that ultimately eliminate the antigen.
  • Adaptive immune responses are critical components of host defence during protection against foreign antigens, such as infectious organisms or toxins.
  • specific immune responses are also sometimes elicited by antigens not associated with infectious agents, and this may cause serious disease.
  • one of the most remarkable properties of specific immunity is the ability to distinguish between self antigens and foreign antigens.
  • the lymphocytes in each individual are able to recognise and respond to numerous foreign antigens but are normally unresponsive to potentially antigenic substances present in the individual itself. Unresponsiveness to self antigens is an acquired process that has to be learned by the individual's lymphocytes and has to be maintained throughout life.
  • autoimmune diseases Abnormalities in the induction or maintenance of self-tolerance lead to immune responses against self antigens, and debilitating diseases that are commonly called autoimmune diseases.
  • the spectrum of autoimmune disorders ranges from organ specific diseases (such as thyroiditis, insulitis, multiple sclerosis, iridocyclitis, uveitis, orchitis, hepatitis, Addison's disease, myasthenia gravis) to systemic illnesses such as rheumatoid arthritis or lupus erythematosus.
  • TCR/CD3 T cell receptor/CD3 complex
  • Ins(l,4,5)P 3 appears to play an essential role in Ca signalling stimulated via the TCR/CD3 -complex, since expression of an anti-sense construct directed against the type 1 Ins(l,4,5)P 3 receptor in Jurkat T cells resulted in complete abolition of CD3 -mediated Ca signalling (Jayaraman et al, 1995).
  • cADPR potent Ca 2+ mobilising compound cyclic ADP-ribose
  • a cADPR antagonist 7-deaza-8-Br-cADPR, is capable of reducing immune responses in a murine antigen-induced arthritis model.
  • a compound that has an effect on the cADPR/Ca 2+ signalling pathway can inhibit immune responses in vivo.
  • the present invention provides a compound for use in modulating T cell activity which compound is capable of antagonising a sustained cADPR-mediated rise in intracellular Ca 2+ levels in a T cell, said rise being in response to stimulation of the T cell receptor/CD3 complex of the T cell.
  • Compounds of the invention may be used in treating (i) an autoimmune disease such as an autoimmune disease selected from thyroiditis, insulitis, multiple sclerosis, iridocyclitis, uveitis, orchitis, hepatitis, Addison's disease, myasthenia gravis, rheumatoid arthritis and lupus erythematosus or (ii) allograft rejection.
  • an autoimmune disease such as an autoimmune disease selected from thyroiditis, insulitis, multiple sclerosis, iridocyclitis, uveitis, orchitis, hepatitis, Addison's disease, myasthenia gravis, rheumatoid arthritis and lupus erythematosus or (ii) allograft rejection.
  • the present invention provides a method for identifying a substance capable of modulating a sustained rise in Ca + entry via a cADPR-mediated pathway which method comprises:
  • the present invention further provides a method for identifying a substance capable of modulating a sustained rise in Ca 2+ entry via a cADPR-mediated pathway which method comprises:
  • the substance inhibits cADPR synthesis, for example reduces or abolishes cADPR synthesis. In another embodiment, the substance modulates, for example inhibits, binding of endogenous cADPR to its receptor binding site.
  • a compound identified by the methods of the invention may be used in modulating the immune response of a mammal.
  • a compound identified by a method of the invention is provided for use in treating (i) an autoimmune disease, such as thyroiditis, insulitis, multiple sclerosis, iridocyclitis, uveitis, orchitis, hepatitis, Addison's disease, myasthenia gravis, rhematoid arthritis and lupus erythematosus or (ii) allograft rejection.
  • the present invention also provides a pharmaceutical composition (which term also includes a veterinary formulation) comprising a compound of the present invention, or a pharmaceutically acceptable salt thereof, or a pharmaceutically acceptable solvate of either entity, together with a pharmaceutically acceptable diluent, excipient or carrier.
  • a pharmaceutical composition which term also includes a veterinary formulation
  • the invention further provides a compound of the present invention, or a pharmaceutically acceptable salt thereof, or a pharmaceutically acceptable solvate of either entity, or a pharmaceutical composition containing any of the foregoing, for use as a human or animal medicament.
  • Compounds suitable for use in the present invention are capable of inhibiting cADPR- mediated sustained Ca 2+ signalling in T cells. Preferably, inhibition is specific for the
  • a compound for use in the present invention does
  • 94- not substantially inhibit other pathways involved in the release of Ca from intracellular stores for example Ins(l,4,5)P 3 mediated release of Ca 2+ from intracellular stores.
  • a compound suitable for use in the present invention may affect to some degree other pathways involved in the release of Ca 2+ from intracellular stores, it is preferred that the compounds preferentially inhibit cADPR-mediated sustained Ca 2+ entry into T cells.
  • a preferred compound will inhibit the cADPR pathway at least two-fold, preferably at least 5 or 10-fold more than other pathways involved in Ca 2+ signalling resulting from TCR/CD3 stimulation.
  • a compound for use in the present invention may act at a number of places in the cADPR Ca """ signalling pathway. It may affect signalling between the activated TCR/CD3 complex and ADP-ribosyl cyclase. It may affect activation of a cADPR-metabolising enzyme, for example ADP-ribosyl cyclase (such as covalent modification by an upstream effector protein, for example a kinase), or enzymatic activity of the cADPR-metabolising enzyme (such as a competitive inhibitor having a high binding affinity for the active site of the enzyme or a non-competitive inhibitor which binds a distal site resulting in a conformational change).
  • a cADPR-metabolising enzyme for example ADP-ribosyl cyclase (such as covalent modification by an upstream effector protein, for example a kinase), or enzymatic activity of the cADPR-metabolising enzyme (such as a competitive inhibitor
  • ryanodine/Ca -channel which is detectable as modulation of ryanodine binding to ryanodine receptors.
  • preferred compounds such as cADPR analogues may act to inhibit binding of cADPR to its binding site on the ryanodine
  • One particularly preferred class of compounds for use in the present invention are cADPR analogues, for example a compound comprising an adenine component to which is individually linked two ribose moieties or a derivative(s) thereof, which ribose moieties are joined via a pyrophosphate bridging group or a more hydrophobic isostere (i.e. an organic linker of similar size but less polar).
  • the ribose moieties are joined to the adenine component at the 1 and 9 positions.
  • the ribose moieties are joined to the pyrophosphate bridging group or isostere thereof at the 5' position of the ribose rings.
  • Particular compounds include compounds of formula (1):
  • Y is halo, Ci to C 20 hydrocarbyl, N(R 3 )(R 4 ), OR 5 , SR 6 nitro and carboxyl; each of R, R 1 , R 2 , R 3 , R 4 , R 5 and R 6 is independently selected from H and to C 20 hydrocarbyl; and
  • Z is independently selected from H and a group that increases the membrane permeability of the compound; or a bio-isostere; or a pharmaceutically acceptable salt thereof.
  • a 1 , A 2 , A 3 and A 4 are preferably OH or O-acyl.
  • B 1 and B 2 are preferably O.
  • X 7 is CH and X is N.
  • Y is preferably halo, i.e. chloro, fluoro, iodo (either a natural or a
  • each of R, R 1 , R 2 , R 3 , R 4 , R 5 and R 6 is independently selected from H and C, to Cio hydrocarbyl, more preferably H and Cj to C 5 hydrocarbyl.
  • hydrocarbyl group means a group comprising at least C and H and may optionally comprise one or more other suitable substituents. Examples of such substituents may include halo-, alkoxy-, nitro-, an alkyl group, a cyclic group etc. In addition to the possibility of the substituents being a cyclic group, a combination of substituents may form a cyclic group. If the hydrocarbyl group comprises more than one C then those carbons need not necessarily be linked to each other. For example, at least two of the carbons may be linked via a suitable element or group (e.g. carbonyl). Thus, the hydrocarbyl group may contain hetero atoms. Suitable hetero atoms will be apparent to those skilled in the art and include, for instance, sulphur, nitrogen and oxygen.
  • the hydrocarbyl group is any one or more of an alkyl group, an alkylene group, an alkenylene group, an alkenyl group, an alkynylene group, an acyl group or an aryl group, including combinations thereof (e.g. an arylalkyl group) - which groups may optionally contain one or more heteroatoms or groups, and may further comprise substituents on the chain or rings.
  • the hydrocarbyl group is a hydrocarbon group.
  • hydrocarbon means any one of an alkyl group, an alkenyl group, an alkynyl group, which groups may be linear, branched or cyclic, or an aryl group, or combinations thereof (e.g. an arylalkyl group).
  • the term hydrocarbon also includes those groups but wherein they have been optionally substituted. If the hydrocarbon is a branched structure having substituent(s) thereon, then the substitution may be on either the hydrocarbon backbone or on the branch; alternatively the substitutions may be on the hydrocarbon backbone and on the branch.
  • at least one of R 1 "6 is H or Cj to C alkyl.
  • Compounds of the present invention may contain one or more asymmetric carbon atoms and/or one or more non-aromatic carbon-carbon double bonds and may therefore exist in two or more stereoisomeric forms.
  • the present invention also provides individual stereoisomers of the compounds of the formula (1), as well as mixtures thereof, including compositions comprising the same. Separation or diastereoisomers or cis and trans isomers may be achieved by conventional techniques, e.g. by fractional crystallisation, chromatography or HPLC of a stereoisomeric mixture of a compound of the formula (I) or a suitable salt or derivative thereof.
  • An individual enantiomer of a compound of the formula (1) may also be prepared from a corresponding optically pure intermediate or by resolution, such as by HPLC of a racemate using a suitable chiral support or by fractional crystallisation of the diastereoisomeric salts formed by reaction of a racemate with a suitable optically active acid or base.
  • Either both Z groups represent hydrogen atoms (or negative charges) as in a conventional diphosphate system or one Z group may be a group that protects the phosphorous to which it is attached and preferably increases the membrane permeability of the compound (i.e. a h drophobic group, for example O-acyl groups such as acetoxymethyl), but which preferably is subsequently removed upon entry into the cell.
  • one Z group may be a "caging" group e.g. 1 -(o-nitrophenyl)ethyl, whereby the compound of the invention is a caged analogue adapted to be converted into an active compound in situ e.g. by light irradiation.
  • caged analogues The chemistry of such caged analogues is well known (see Aarhus et al, 1995; McCray and Trentham, 1989) and such compounds can be prepared by standard methods.
  • the term "caging group” is used in its normal sense - namely a stable group which is labile on irradiation.
  • bio-isostere is used in its normal sense - namely a similar (but not the same) or a different chemical structure and having the same biological functional effect.
  • the cADPR analogues of formula (1) are substantially non-hydrolysable (the Z group excepted wherein it is other than H).
  • a compound for use in the present invention has the formula (2):
  • X " is independently selected from CR and N; X ' is independently selected from CR 2 and N; Y is halo, d to C 20 hydrocarbyl, N(R 3 )(R 4 ), OR 5 , SR 6 nitro and carboxyl; each of R 1 , R 2 , R 3 , R 4 , R 5 and R 6 is independently selected from H and Ci to C 20 hydrocarbyl; and
  • Z is independently selected from H and a group that increases the membrane permeability of the compound; or a bio-isostere; or a pharmaceutically acceptable salt thereof.
  • Compounds of formula (2) may be prepared as described in PCT/GB98/00921. Particularly preferred compounds are 7-deaza-8-Br-cADPR and 8-Br-cADPR.
  • Z is selected from OH, OR, SH, SR 6 , NH 2 and NHR ! R 2 and for formula (4), Z is selected from O, S, NH and NHR 1 ; and wherein for either formula (3) or formula (4),
  • Y is selected from N or CH
  • X is halo, NH 2 or NHR'R 2 ;
  • Ri and R 2 are independently selected from H, to C 20 hydrocarbyl, sugar moieties and phosphate groups;
  • R 3 can be any group but is preferably selected from H and Ci to C 20 hydrocarbyl; or a bio-isostere; or a pharmaceutically acceptable salt thereof.
  • bio-isostere halo
  • R 1 ", “R 2 ", “R 6 " and “C, to C 20 hydrocarbyl” are defined above.
  • Ri and R 2 may be joined via a cylic linker group.
  • each of Rj, R 2 , R 3 ⁇ R , R and R is independently selected from H and Ci to Cio hydrocarbyl, more preferably H and Ci to C 5 hydrocarbyl.
  • a substance which affects the cADPR pathway may do so in several ways as discussed above. For example, it may disrupt an interaction between two components of the pathway. In particular, it preferably disrupts the binding of cADPR to its binding site on the ryanodine receptor/Ca 2+ channel. It may directly disrupt the binding of the two components by, for example, binding to one component and masking or altering the site of interaction with the other component.
  • Candidate substances of this type may conveniently be screened by in vitro binding assays. Examples of candidate substances include nonfunctional homologues of either of the two components as well as antibodies which recognize either of the two components.
  • a substance which can bind directly to either of the two components may also inhibit an interaction between the two components by altering their subcellular localization thus preventing the two components from coming into contact within the cell.
  • This can be tested in vivo using, for example the in vivo assays described below.
  • the term '/ « vivo' is intended to encompass experiments with cells in culture as well as experiments with intact multicellular organisms.
  • the substance may suppress or enhance the biologically available amount of one or both of the components. This may be by inhibiting expression of the component, for example at the level of transcription, transcript stability, translation or post-translational stability.
  • An example of such a substance would be antisense RNA which suppresses the amount of ADP-ribosyl cyclase mRNA translated into protein or antisense RNA which suppresses the amount of type 3 ryanodine receptor mRNA translated into protein.
  • Suitable candidate substances also include antibody products (for example, monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies and CDR-grafted antibodies) which are specific for either of the two components.
  • antibody products for example, monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies and CDR-grafted antibodies
  • combinatorial libraries, peptide and peptide mimetics, defined chemical entities, oligonucleotides, and natural product libraries may be screened for activity as inhibitors of an interaction between the two components.
  • Other candidate substances include analogues of substrates or products of the cADPR pathway, such as cADPR analogues or NAD analogues.
  • the candidate substances may be used in an initial screen in batches of, for example 10 substances per reaction, and the substances of those batches which show inhibition tested individually.
  • Candidate substances which show activity in in vitro screens such as those described below may then be tested in in vivo systems.
  • In vitro assays typically test for substances capable of affecting the interaction between particular components of the signalling pathway (see above) or the activity of a particular component, such as an enzyme.
  • one assay may involve testing candidate substances for the ability to inhibit synthesis of cADPR by an ADP-ribosyl cyclase. This may be performed by (i) contacting an ADP-ribosyl cyclase with a candidate substance under conditions that would allow the synthesis of cADPR in the absence of the candidate substance and (ii) determining if the candidate substance inhibits cADPR synthesis.
  • a suitable source of ADP-ribosyl cyclase may be, for example, purified recombinant protein or a crude preparation of T cell extracts.
  • Levels of cADPR may be measured using a combined two-step HPLC method as described in da Silva et al. (1998) which has a detection sensitivity for cADPR of about 10 pmol.
  • cADPR is extracted from cells using perchloric acid.
  • Suitable exogenous substrates for the reaction are NAD + or a fluorescent analogue (e.g. 1 , N 6 -etheno-NAD) and may be added at concentrations of about 100 ⁇ M to 1 mM.
  • endogenous substrates may be sufficient.
  • in vitro assays may include assays for identifying substances capable of disrupting ryanodine binding to ryanodine receptors.
  • membrane preparations may be obtained from T cells as described in the Examples and the kinetics of [ 3 H]ryanodine binding to the membrane preparation assessed in the absence or presence of a candidate substance.
  • a further in vitro assay may be used to identify substances that disrupt the binding of cADPR to its receptor on the ryanodine receptor/Ca 2+ channel.
  • membrane preparations may be obtained from T cells as described in the Examples and the binding of cADPR to the membrane preparation assessed in the absence or presence of a candidate substance.
  • purified or recombinant ryanodine receptor/Ca 2+ channel may be used instead of membrane preparations (the cloning of a part of the type 3 ryanodine receptor/Ca 2+ channel is described in the examples).
  • T cell lines preferably human T cell lines, or T cells obtained from animal tissues, especially human tissues.
  • T cells will be stimulated via the TCR CD3 complex using standard methods such as receptor cross-linking using antibodies that recognise the receptor complex. They may also be stimulated using superantigens or antigen presenting cells, such as dendritic cells.
  • a suitable assay method comprises stimulating a T cell via its TCR/CD3 receptor in the presence or absence of a candidate substance.
  • the Ca 2+ response is measured (for example using ratiometric Ca 2+ imaging) and compared.
  • An effect on sustained Ca 2+ entry is indicative of a substance capable of modulating T cell activity via a cADPR pathway.
  • the first rapid phase of Ca 2+ is substantially unaffected.
  • the sustained phase of Ca 2+ entry is typically taken to be from approximately 15 minutes after stimulation of the T cell.
  • T cells may be contacted with a candidate substance before, concomitant with, or after stimulation of the TCR/CD3 complex.
  • concentration of candidate substance administered to the cell will vary but is typically from 0.1 to 100 ⁇ M, more preferably from 1 to 100 ⁇ M or 10 to 100 ⁇ M.
  • further assays may comprise administering a substance capable of modulating the activity of the pathway to a T cell, or a candidate substance, and determining the effect on the cell.
  • compounds for use in the present invention are preferably capable of inhibiting or reducing the sustained rise in Ca 2+ levels following stimulation of the cell via the TCR/CD3 complex.
  • Such an affect may include inhibition of cell proliferation in response to, for example, stimulation by an antigen presenting cell such as a dendritic cell.
  • one suitable assay comprises incubating a T cell with an antigen presenting cell in the presence or absence of a candidate substance and determining whether T cell proliferation is reduced in the presence of the substance compared in the absence of the substance.
  • Another suitable assay involves activating a T cell with a mitogen in the presence and absence of a candidate substance and determining whether T cell proliferation is reduced in the presence of the substance compared in the absence of the substance.
  • suitable mitogens include monoclonal antibodies to CD3 or the TCR, phorbol 12-myristate 13-acetate. ionomycin, concanavalin A, phytohemagglutinin, superantigens and antibodies to CD2, CD3 or the T cell receptor.
  • T cell activation/proliferation may be measured using a variety of techniques, for example by measuring levels of secreted cytokines such as IL-2 in the culture medium or by _ WO ⁇ O/37089 PCT/GB99/04295
  • T cell surface markers indicative for activation such as CD69, CD30, CD25 and HLA-DR.
  • a preferred substance is capable of reducing T cell proliferation by at least 50%, more preferably at least 60, 70, 80 or 90% (for example with respect to numbers of cells expressing a cell surface marker, cytokine levels in the medium and/or numbers of cells present).
  • test compounds are typically administered to mice preimmunised with methylated bovine serum albumin (mBSA) in complete Freund's adjuvant, with the experimental arthritis being induced by injection of mBSA into the right knee joint.
  • mBSA methylated bovine serum albumin
  • Compounds are typically administered by intraperitoneal injection.
  • Compounds capable of affecting a cADPR mediated rise in Ca 2+ levels in T cells may be used in methods of therapy, for example in treating immune disorders such as autoimmune diseases or graft rejection such as allograft rejection. In particular such compounds may be used to inhibit T cell responses in vivo. Alternatively, T cells may be removed from a patient, treated and then returned to the patient (ex vivo therapy).
  • disorders that may be treated include a group commonly called autoimmune diseases.
  • the spectrum of autoimmune disorders ranges from organ specific diseases (such as thyroiditis, insulitis, multiple sclerosis, iridocyclitis, uveitis, orchitis, hepatitis, Addison's disease, myasthenia gravis) to systemic illnesses such as rheumatoid arthritis or lupus erythematosus.
  • organ specific diseases such as thyroiditis, insulitis, multiple sclerosis, iridocyclitis, uveitis, orchitis, hepatitis, Addison's disease, myasthenia gravis
  • Other disorders include immune hyperreactivity, such as allergic reactions.
  • Organ-specific autoimmune diseases include multiple sclerosis, insulin dependent diabetes mellitus, several forms of anemia (aplastic, hemolytic), autoimmune hepatitis, thyroiditis, insulitis, iridocyclitis, skleritis, uveitis, orchitis, myasthenia gravis, idiopathic thrombocytopenic pu ⁇ ura, inflammatory bowel diseases (Crohn's disease, ulcerative colitis).
  • Systemic autoimmune diseases include: rheumatoid arthritis, juvenile arthritis, scleroderma and systemic sclerosis, sjogren's syndrom, undifferentiated connective tissue syndrom, antiphospholipid syndrom, different forms of vasculitis (polyarteritis nodosa, allergic granulomatosis and angiitis, Wegner's granulomatosis, Kawasaki disease, hypersensitivity vasculitis, Henoch-Schoenlein purpura, Behcet's Syndrome, Takayasu arteritis, Giant cell arteritis, Thrombangiitis obliterans), lupus erythematosus, polymyalgia rheumatica, correspondingl (mixed) cryoglobulinemia, Psoriasis vulgaris and psoriatic arthritis, diffus fasciitis with or without eosinophilia, polymyositis and other idiopathic
  • collagen diseases and other autoimmune diseases inflammation associated with atherosclerosis, arteriosclerosis, atherosclerotic heart disease, reperfusion injury, cardiac arrest, myocardial infarction, vascular inflammatory disorders, respiratory distress syndrome or other cardiopulmonary diseases, inflammation associated with peptic ulcer, ulcerative colitis and other diseases of the gastrointestinal tract, hepatic fibrosis, liver cirrhosis or other hepatic diseases, thyroiditis or other glandular diseases, glomerulonephritis or other renal and urologic diseases, otitis or other oto-rhino-laryngological diseases, dermatitis or other dermal diseases, periodontal diseases or other dental diseases, orchitis or epididimo-orchitis, infertility, orchidal trauma or other immune-related testicular diseases, placental dysfunction, placental insufficiency, habitual abortion, eclampsia, pre-eclampsia and other immune and/or inflammatory-related gynaecological
  • retinitis or cystoid macular oedema retinitis or cystoid macular oedema, sympathetic ophthalmia, scleritis, retinitis pigmentosa, immune and inflammatory components of degenerative fondus disease, inflammatory components of ocular trauma, ocular inflammation caused by infection, proliferative vitreo-retinopathies, acute ischaemic optic neuropathy, excessive scarring, e.g.
  • pseudo-tumour cerebri Down's Syndrome, Huntington's disease, amyotrophic lateral sclerosis, inflammatory components of CNS compression or CNS trauma or infections of the CNS, inflammatory components of muscular atrophies and dystrophies, and immune and inflammatory related diseases, conditions or disorders of the central and peripheral nervous systems, post-traumatic inflammation, septic shock, infectious diseases, inflammatory complications or side effects of surgery or organ, inflammatory and/or immune complications and side effects of gene therapy, e.g. due to infection with a viral carrier, or inflammation associated with AIDS, to suppress or inhibit a humoral and/or cellular immune response, to treat or ameliorate monocyte or leukocyte proliferative diseases, e.g.
  • leukaemia by reducing the amount of monocytes or lymphocytes, for the prevention and/or treatment of graft rejection in cases of transplantation of natural or artificial cells, tissue and organs such as cornea, bone marrow, organs, lenses, pacemakers, natural or artificial skin tissue.
  • tissue and organs such as cornea, bone marrow, organs, lenses, pacemakers, natural or artificial skin tissue.
  • Compounds capable of affecting a cADPR-mediated rise in Ca + levels in T cells for use in immunotherapy are typically formulated for administration to patients with a pharmaceutically acceptable carrier or diluent to produce a pharmaceutical composition.
  • the formulation will depend upon the nature of the compound identified and the route of administration but typically they can be formulated for topical, parenteral, intramuscular, intravenous, intra-peritoneal, intranasal inhalation, lung inhalation, intradermal or intra- articular administration.
  • the compound may be used in an injectable form. It may therefore be mixed with any vehicle which is pharmaceutically acceptable for an injectable formulation, preferably for a direct injection at the site to be treated, although it may be administered systemically.
  • the pharmaceutically acceptable carrier or diluent may be, for example, sterile isotonic saline solutions, or other isotonic solutions such as phosphate-buffered saline.
  • the compounds of the present invention may be admixed with any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s). It is also preferred to formulate the compound in an orally active form.
  • a therapeutically effective daily oral or intravenous dose of the compounds of the invention is likely to range from 0.01 to 50 mg/kg body weight of the subject to be treated, preferably 0.1 to 20 mg/kg.
  • the compounds of the formula (I) and their salts may also be administered by intravenous infusion, at a dose which is likely to range from 0.001-10 mg/kg/hr.
  • Tablets or capsules of the compounds may be administered singly or two or more at a time, as appropriate. It is also possible to administer the compounds in sustained release formulations.
  • the physician will determine the actual dosage which will be most suitable for an individual patient and it will vary with the age, weight and response of the particular patient.
  • the above dosages are exemplary of the average case. There can, of course, be individual instances where higher or lower dosage ranges are merited, and such are within the scope of this invention.
  • the compounds of the invention can be administered by inhalation or in the form of a suppository or pessary, or they may be applied topically in the form of a lotion, solution, cream, ointment or dusting powder.
  • An alternative means of transdermal administration is by use of a skin patch.
  • they can be incorporated into a cream consisting of an aqueous emulsion of polyethylene glycols or liquid paraffin.
  • They can also be incorporated, at a concentration of between 1 and 10% by weight, into an ointment consisting of a white wax or white soft paraffin base together with such stabilisers and preservatives as may be required.
  • compositions are administered orally in the form of tablets containing excipients such as starch or lactose, or in capsules or ovules either alone or in admixture with excipients, or in the form of elixirs, solutions or suspensions containing flavouring or colouring agents.
  • excipients such as starch or lactose
  • capsules or ovules either alone or in admixture with excipients, or in the form of elixirs, solutions or suspensions containing flavouring or colouring agents.
  • compositions can also be injected parenterally, for example intracavernosally, intravenously, intramuscularly or subcutaneously.
  • the compositions will comprise a suitable carrier or diluent.
  • compositions are best used in the form of a sterile aqueous solution which may contain other substances, for example enough salts or monosaccharides to make the solution isotonic with blood.
  • compositions may be administered in the form of tablets or lozenges which can be formulated in a conventional manner.
  • the daily dosage level of the compounds of the present invention and their pharmaceutically acceptable salts and solvates may typically be from 10 to 500 mg (in single or divided doses).
  • tablets or capsules may contain from 5 to 100 mg of active compound for administration singly, or two or more at a time, as appropriate.
  • the physician will determine the actual dosage which will be most suitable for an individual patient and it will vary with the age, weight and response of the particular patient. It is to be noted that whilst the above-mentioned dosages are exemplary of the average case there can, of course, be individual instances where higher or lower dosage ranges are merited and such dose ranges are within the scope of this invention.
  • T cells treated ex vivo are typically administered to the patient by intramuscular, intraperitoneal or intravenous injection, or by direct injection into the lymph nodes of the patient, preferably by direct injection into the lymph nodes.
  • T cells typically from 10 to 10 treated cells, preferably from 10 to 10 cells, more preferably about 10 cells are administered to the patient.
  • FIG. 1 Endogenous cADPR, ADP-ribosyl cyclase activation and [Ca 2+ ]j in response to stimulation of the TCR/CD3 complex
  • Jurkat T-lymphocytes (10 8 /5 ml intracellular buffer) were left unstimulated for at least 10 min at 37°C. Then cells were stimulated for the times indicated using anti-CD3 OKT3 (10 mg/ml, a).
  • Extraction of cADPR by perchloric acid and subsequent neutralization as well as determination of cADPR was carried by a 2-step HPLC procedure using a PRP-X100 and a Hypersil BDS C18 column exactly as described in da Silva et al. (1998).
  • NAD + (100 ⁇ M) was incubated with cytosolic (SI 00) protein (2 mg/ml) at 37°C for 0, 1, 2, 3. 5 and 10 min.
  • the reaction was stopped by perchloric acid (3 M) and cADPR was analysed by reverse phase HPLC as described in da Silva et al. (1998).
  • SI 00 protein was obtained from unstimulated cells (basal activity) or from cells stimulated by OKT3 (10 ⁇ g/ml) for 10 min; dephostatin (100 ⁇ M) was present during preparation of SI 00 proteins where indicated. Data are presented as mean ⁇ SEM from 4 independent S 100 preparations (n as indicated in the Figure). Asterisks denote significant statistical differences to control values according to the Student's t-test (p > 0.92 ).
  • [Ca 2+ ] was determined in a suspension of fura-2-loaded Jurkat T cells.
  • [Ca ⁇ ]i was measured in fura-2-loaded Jurkat T cells using a ratiometric single cell Ca 2+ imaging system (Guse et al, 1997).
  • Cells were either untreated (a) or treated with increasing concentrations of 7-deaza-8-Br-cADPR for 20 min (b 1 ⁇ M, c 10 ⁇ M, d 100 ⁇ M) prior to stimulation with anti-CD3 OKT3 (10 ⁇ g/ml).
  • a typical experiment is displayed (cell number ranging from 20 to 35 cells for each condition)
  • e shows [Ca 2+ ]i at 1500 sec after OKT3 addition as combined data obtained in 5 independent experiments (108 to 203 individual cells investigated for each concentration of 7-deaza-8-Br-cADPR).
  • f shows the effect of 7-deaza-8-Br- cADPR on Ca 2+ signalling at 1500 sec stimulated by either OKT3 (10 ⁇ g/ml), thapsigargin (1 ⁇ M) or ionomycin (200 nM); data are presented as mean ⁇ SD (3-4 independent experiments, 91 to 104 individual cells investigated; * p > 0.95).
  • Jurkat T cells (10 9 cells) were disrupted in 5 ml 20 mM HEPES (pH 7.5), 1 10 mM NaCl and protease inhibitors (antipain 5 ⁇ g/ml, leupeptin 5 ⁇ g/ml, pepstatin 6.9 pg/ml.
  • Pefablock 5 ml 20 mM HEPES (pH 7.5), 1 10 mM NaCl and protease inhibitors (antipain 5 ⁇ g/ml, leupeptin 5 ⁇ g/ml, pepstatin 6.9 pg/ml.
  • Anti-RyR common mAb was coupled to Protein G-Sepharose and incubated with solubilized P10 membranes in lysis buffer (25 mM HEPES pH 7.2, 150 mM NaCl, 0.25 % CHAPS
  • Protein G-Sepharose beads were spun down (13000 x g. 1 min. 4°C), the supernatant was discarded, and the immunoprecipitate rinsed with lysis buffer; this procedure was then repeated 3 times. Protein was boiled at 95°C for 5 min and subjected to SDS-PAGE in a 6 % gel (3 % stacking gel) under reducing conditions. Proteins were subsequently transferred onto nitrocellulose sheets by tank blotting (18 h, 550 mA constant, 4°C). The nitrocellulose sheets were washed by a complex procedure and the blots were developed using the ECL- kit (Amersham) according to the manufacturer's instructions.
  • Binding of [ 3 H]ryanodine was measured in 20 mM HEPES, pH 7.4, 0.75 M KCI, CaCl 2 1.1 mM, EGTA 1.0 mM ([Ca 2+ ] free * 100 ⁇ M) using 200 ⁇ g protein in a 50 ml volume at 37°C and continuous shaking. Unspecif ⁇ c binding was determined in the presence of 1000-fold excess of unlabeled ryanodine. Separation of bound from free radioactivity was achieved by rapid filtration on glass fiber filters (Whatman type GF/B).
  • PCR was initially performed with cDNA from unstimulated Jurkat T cells and oligonucleotide primers corresponding to a highly conserved sequence from the C-terminal region of all known RyR isotypes.
  • an antisense primer was designed that was homologous to all 3 human RyR sequences (5' ACATCTTCCAGACATAAG 3') whereas redundant primers were used as sense oligos (5' AC(T/C)CACAATGG(C/G)AAACAG 3').
  • specific primers for type 3 RyR were used (sense: 5' CGACATGATGACGTGTTACC 3', antisense: 5' CTCGTACTTGT TCCTGCTGG 3').
  • Example 1 Stimulation of T cell Ca 2+ signalling via the TCR/CD3 complex leads to a sustained increase in intracellular cADPR.
  • Cyclic ADP-ribose has been discovered as a potent Ca -mobilizing compound in sea urchin eggs (Lee, 1997 and Galione et al, 1991). In the past decade, it has been shown that cADPR is also active in plants and in higher eukaryotes including a variety of mammalian tissues or cell types, such as cardiac and smooth muscle, pancreatic and parotid acinar cells, hepatocytes, PC 12 cells GH 4 C ⁇ cells, and T-lymphocytes (reviewed in Lee et al, 1997).
  • cADPR specifically releases Ca 2+ from a D-my ⁇ -inositol 1,4,5-trisphosphate [Ins(l,4,5)P ]- insensitive Ca 2+ pool of permeabilized cells (Guse et al, 1995 and Guse et al, 1996), (ii) that cADPR stimulates sustained Ca 2+ signalling in response to microinjection into intact cells (Guse et al, 1997), and (iii) that cADPR is an endogenous nucleotide (da Silva et al, 1998).
  • TCR/CD3 -complex involves the elevation of the free cytosolic Ca concentration ([Ca 2+ ]j) by at least two mechanisms, a rapid elevation caused by Ca 2+ release from intracellular stores mediated by Ins(l,4,5)P 3 and a prolonged elevation that is completely dependent on the influx of extracellular calcium (reviewed in Guse, 1998).
  • Example 2 The cADPR antagonist 7-deaza-8-Br-cADPR inhibits TCR/CD3- mediated Ca" + entry.
  • Figure 2c and d demonstrate that the membrane-permeant antagonist 7-deaza-8-Br- cADPR did not influence the first phase of Ca 2+ signalling, which is thought to be driven mainly by Ins(l,4,5)P 3 .
  • the novel membrane-permeant Ins(l,4,5)P 3 antagonist xestospongin C which has been shown to potently block Ins(l,4,5)P 3 -mediated Ca 2+ release, but up to an extracellular concentration of 20 ⁇ M to be without effect on RyR- mediated Ca 2+ release, inhibited TCR/CD3 -mediated Ca 2+ signalling after preincubation of the cells for 20 min at 2 ⁇ M (data not shown).
  • the membrane-permeant antagonists 7-deaza-8-Br-cADPR and xestospongin C are powerful tools, but to achieve a sufficiently high intracellular effective concentration, a substantial preincubation period must be employed. To find out whether either Ins(l ,4,5)P 3 or cADPR or both play an essential role also at a later time point after TCR/CD3
  • Example 4 Functional ryanodine receptors are expressed in Jurkat T cells and their activity modulated by cADPR.
  • RyRs have been detected in T cells by binding studies and western blot and by northern blot analysis. Sequencing of a cDNA clone obtained from Jurkat T cell poly(A) + RNA showed 95 % identity on the amino acid level to rabbit brain RyR in the C-terminal region. In contrast, transcripts for RyRs have not been detected in another Jurkat clone using RT-PCR.
  • PCR product of the expected size was obtained; the nucleotide sequence from the amplified product was identical with a sequence from type 3 RyR. A sequence identical to a type 3 RyR sequence was also obtained when specific primers for the type 3 RyR were used (data not shown).
  • Table 1 Highly purified human peripheral blood T cells (5 x 10 4 ) were pulsed with the indicated inhibitors for 30 min at 37°C in the absence of serum, and then transferred to flat bottom 96 well plates coated with anti-CD3 mAb and cultured in RPMI 1640 containing 10 % NHS. The cells were incubated for 96 h in the presence of the indicated inhibitors. [ HJThymidine was added for the last 16 h of culture. Results are given as mean cpm ⁇ SEM for quadruplicate determinations of one of three independent experiments with similar results (3 different healthy donors). Expression of CD25 and HLA-DR was determined by staining with directly labelled mAbs to CD25 and HLA-DR and analysed by flow cytometry. Histograms were gated for viable lymphocytes. Cyclosporin A (CsA) was added for comparison as an established inhibitor of T cell activation.
  • CsA Cyclosporin A
  • cADPR is formed as an essential second messenger in response to stimulation of the TCR/CD3-complex and mediates the second, sustained phase of Ca 2+ signalling via ryanodine receptor/Ca 2+ channels in T cells.
  • the exact mechanism by which cADPR regulates Ca 2+ entry is not yet clear.
  • cADPR since cADPR by releasing Ca 2+ from its target store also mediated Ca + pool depletion, it might act in a similar way as suggested for Ins(l,4,5)P 3 in the classical capacitative model.
  • Example 6 Treatment of antigen-induced arthritis (AIA) in mice by antagonists of cyclic ADP- ribose (cADPR)
  • T- lymphocytes are involved in the genesis of various autoimmune diseases, e.g. rheumatoid arthritis.
  • An established animal model for rheumatoid arthritis is the antigen-induced arthritis (AIA) in mice.
  • AIA antigen-induced arthritis
  • mice Female C57BL/6 mice were immunised at day -21 and day -14 with methylated bovine serum albumin (mBSA) in complete Freund's adjuvant. The experimental arthritis was induced at day 0 by injection of mBSA into the right knee joint.
  • mBSA methylated bovine serum albumin
  • body weight weight was determined at days 3, 5, 7, 14 and 21. Body weight was calculated as relative body weight as compared to the body weight at day 0.
  • the specific cADPR antagonist 7-deaza-8-Br-cADPR was applied at the very low dose of 0.2 ⁇ mol/kg. A reduction in joint swelling was observed at day 3, 5, 7 and 14 as compared to the vehicle alone.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Endocrinology (AREA)
  • Neurology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Rheumatology (AREA)
  • Diabetes (AREA)
  • Biomedical Technology (AREA)
  • Neurosurgery (AREA)
  • Ophthalmology & Optometry (AREA)
  • Pain & Pain Management (AREA)
  • Transplantation (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Reproductive Health (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne des composés capables de s'opposer aux effets d'une augmentation soutenue et induite par une ribose d'adénosine diphosphate cyclique, des niveaux de Ca2+ intracellulaire dans un lymphocyte T, ladite augmentation se faisant par réaction à une stimulation du complexe récepteur de lymphocyte T/CD3 du lymphocyte T. Cette invention concerne également des procédés d'identification desdits composés, ainsi que leur utilisation dans la modulation de l'activité des lymphocytes T. Les composés préférés sont des analogues de ribose d'adénosine diphosphate cyclique.
PCT/GB1999/004295 1998-12-18 1999-12-17 Analogues de ribose d'adenosine diphosphate cyclique utilises pour la modulation de l'activite des lymphocytes t WO2000037089A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP2000589200A JP2002532554A (ja) 1998-12-18 1999-12-17 Ｔ細胞活性を調節するためのサイクリックアデノシンニリン酸リボース類似体
EP99962345A EP1140118A1 (fr) 1998-12-18 1999-12-17 Analogues de ribose d'adenosine diphosphate cyclique utilises pour la modulation de l'activite des lymphocytes t
AU18717/00A AU1871700A (en) 1998-12-18 1999-12-17 Cyclic adenosine diphosphate ribose analogues for modulating t cell activity

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB9828071.2A GB9828071D0 (en) 1998-12-18 1998-12-18 Therapeutics
GB9828071.2 1998-12-18

Publications (1)

Publication Number Publication Date
WO2000037089A1 true WO2000037089A1 (fr) 2000-06-29

Family

ID=10844606

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB1999/004295 WO2000037089A1 (fr) 1998-12-18 1999-12-17 Analogues de ribose d'adenosine diphosphate cyclique utilises pour la modulation de l'activite des lymphocytes t

Country Status (5)

Country Link
EP (1) EP1140118A1 (fr)
JP (1) JP2002532554A (fr)
AU (1) AU1871700A (fr)
GB (1) GB9828071D0 (fr)
WO (1) WO2000037089A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001041756A2 (fr) * 1999-12-02 2001-06-14 University Of South Florida Methode et composition permettant le traitement des lesions neuronales induites par ischemie-reperfusion
WO2002011736A1 (fr) * 2000-08-04 2002-02-14 University Of Bath Analogues de naadp destines a moduler l'activite de lymphocytes t
WO2002098397A2 (fr) * 2001-06-07 2002-12-12 University Of Bath Agents therapeutiques
WO2017142368A3 (fr) * 2016-02-19 2018-09-07 전북대학교 산학협력단 Composition permettant de prévenir et de traiter une maladie cutanée allergique ou inflammatoire

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998043992A1 (fr) * 1997-03-27 1998-10-08 Isis Innovation Limited Analogues de l'adenosine-diphosphate-ribose cyclique
EP0953572A2 (fr) * 1998-04-28 1999-11-03 Biomolecular Engineering Research Institute Peptides de liaison d'antigene des cellules de stroma de moelle osseuse

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998043992A1 (fr) * 1997-03-27 1998-10-08 Isis Innovation Limited Analogues de l'adenosine-diphosphate-ribose cyclique
EP0953572A2 (fr) * 1998-04-28 1999-11-03 Biomolecular Engineering Research Institute Peptides de liaison d'antigene des cellules de stroma de moelle osseuse

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
GUSE A.H. ET AL: "Ca2+ Entry Induced by Cyclic ADP-ribose in Intact T-Lymphocytes", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 272, no. 13, 1997, pages 8546 - 8550, XP000872862 *
GUSE A.H. ET AL: "Regulation of Calcium Signalling in T Lymphocytes by the Second Messenger Cyclic ADP-ribose", NATURE, vol. 398, no. 6722, 4 March 1999 (1999-03-04), pages 70 - 73, XP000872858 *
GUSE A.H.: "Ca2+ Signaling in T-Lymphocytes", CRITICAL REVIEWS IN IMMUNOLOGY, vol. 18, no. 5, 1998, pages 419 - 448, XP000872445 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001041756A2 (fr) * 1999-12-02 2001-06-14 University Of South Florida Methode et composition permettant le traitement des lesions neuronales induites par ischemie-reperfusion
WO2001041756A3 (fr) * 1999-12-02 2002-07-18 Univ South Florida Methode et composition permettant le traitement des lesions neuronales induites par ischemie-reperfusion
US6462066B2 (en) 1999-12-02 2002-10-08 University Of South Florida Method and composition for treatment of ischemic neuronal reperfusion injury
WO2002011736A1 (fr) * 2000-08-04 2002-02-14 University Of Bath Analogues de naadp destines a moduler l'activite de lymphocytes t
WO2002098397A2 (fr) * 2001-06-07 2002-12-12 University Of Bath Agents therapeutiques
WO2002098397A3 (fr) * 2001-06-07 2003-03-13 Univ Bath Agents therapeutiques
GB2392095A (en) * 2001-06-07 2004-02-25 Univ Bath Therapeutic compositions for modulating the immune response in a mammal and use thereof
WO2017142368A3 (fr) * 2016-02-19 2018-09-07 전북대학교 산학협력단 Composition permettant de prévenir et de traiter une maladie cutanée allergique ou inflammatoire

Also Published As

Publication number Publication date
AU1871700A (en) 2000-07-12
EP1140118A1 (fr) 2001-10-10
GB9828071D0 (en) 1999-02-17
JP2002532554A (ja) 2002-10-02

Similar Documents

Publication Publication Date Title
EP1778224B1 (fr) Inhibiteurs de flt3 a des fins d'immunodepression
US20020142943A1 (en) Modifying the permeability of physiological barriers
JP2002526408A (ja) 疼痛および不安の処置のためのｍｇｌｕｒ５アンタゴニスト
EP0778848B1 (fr) Agents utilises pour induire une apoptose et leurs applications therapeutiques
EP3099307B1 (fr) Utilisation de cladribine pour la traitement la neromyélite optique
Tanner et al. Targeting KCa1. 1 channels with a scorpion venom peptide for the therapy of rat models of rheumatoid arthritis
KR20190019171A (ko) 섬유증 치료에서 사용하기 위한 wnt 억제제
JP2009502790A (ja) Ｃｆｔｒのｌｐａ２受容体アゴニスト阻害因子
Han et al. Fasudil prevents liver fibrosis via activating natural killer cells and suppressing hepatic stellate cells
WO2015054612A1 (fr) Traitement de maladies auto-immunes médiées par des lymphocytes t organo-spécifiques
WO2000037089A1 (fr) Analogues de ribose d'adenosine diphosphate cyclique utilises pour la modulation de l'activite des lymphocytes t
US8618113B2 (en) Treatment for demyelinating disease
US20050119197A1 (en) Naadp analogues for modulating t-cell activity
US20030215439A1 (en) Therapeutic uses of PAF-AH products in diabetes
WO2024099346A1 (fr) Utilisation d'un composé indazole dans le traitement de maladies médiées par l'activation de l'inflammasome
US20040132635A1 (en) Method for prevention and treatment of kidney diseases
KR100789780B1 (ko) 트란스글루타미나제 억제제로서 유용한 글루코사민 또는글루코사민 유도체
De Blasi et al. Effects of chronic metoprolol and sulphinpyrazone on human lymphocyte beta‐adrenoceptors.
CN117396204A (zh) 使用s-羟氯喹治疗抗磷脂综合征
JP2000336042A (ja) 眼圧下降剤
Koprivica Mechanisms of myelin regeneration inhibition
Schwarzera et al. 10th Symposium of the Austrian Pharmacological Society (APHAR)
WO1999011282A1 (fr) Compositions et procedes de contraception ou de sterilisation de mammiferes

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 09868348

Country of ref document: US

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 589200

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1999962345

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1999962345

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 1999962345

Country of ref document: EP