WO2000029577A1 - Novel members of the capsaicin/vanilloid receptor family of proteins and uses thereof - Google Patents

Novel members of the capsaicin/vanilloid receptor family of proteins and uses thereof Download PDF

Info

Publication number
WO2000029577A1
WO2000029577A1 PCT/US1999/026701 US9926701W WO0029577A1 WO 2000029577 A1 WO2000029577 A1 WO 2000029577A1 US 9926701 W US9926701 W US 9926701W WO 0029577 A1 WO0029577 A1 WO 0029577A1
Authority
WO
WIPO (PCT)
Prior art keywords
hvr
rvr
nucleic acid
ofthe
polypeptide
Prior art date
Application number
PCT/US1999/026701
Other languages
English (en)
French (fr)
Other versions
WO2000029577A9 (en
Inventor
Rory A. J. Curtis
Original Assignee
Millennium Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Millennium Pharmaceuticals, Inc. filed Critical Millennium Pharmaceuticals, Inc.
Priority to JP2000582560A priority Critical patent/JP2002531069A/ja
Priority to AU21480/00A priority patent/AU2148000A/en
Priority to CA002348479A priority patent/CA2348479A1/en
Priority to EP99965787A priority patent/EP1131433A1/de
Publication of WO2000029577A1 publication Critical patent/WO2000029577A1/en
Publication of WO2000029577A9 publication Critical patent/WO2000029577A9/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/04Centrally acting analgesics, e.g. opioids

Definitions

  • Nociceptors Pain is initiated when the peripheral terminals of a subgroup of sensory neurons are activated by noxious chemical, mechanical or thermal stimuli. These neurons, called nociceptors, transmit information regarding tissue damage to pain-processing centres in the spinal chord and brain (Fields, H.L. Pain, McGraw-Hill, New York, 1987). Nociceptors are characterized in part, by their sensitivity to capsaicin, a vanilloid- containing compound, and a natural product of capsicum peppers that is the active ingredient of many "hot” and spicy foods. In mammals, exposure of nociceptor terminals to capsaicin leads initially to excitation ofthe neuron and the consequent perception of pain and local release of inflammatory mediators.
  • nociceptor terminals With prolonged exposure, nociceptor terminals become insensitive to capsaicin, as well as to other noxious stimuli (Szolcsanyi, J. in Capsaicin in the Study of Pain (ed. Wood, J.) 1-26 (Academic, London, 1993).
  • This latter phenomenon of nociceptor desensitization underlies the seemingly paradoxical use of capsaicin as an analgesic agent in the treatment of painful disorders ranging from viral and diabetic neuropathies to rheumatoid arthritis (Campbell, E. in Capsaicin and the StudyofPain (ed. Wood, J.) 255-272 (Academic, London, 1993); Szallasi, A. et al. (1996) Pain 68, 195-208).
  • capsaicin may elicit the perception of pain by mimicking the actions of a physiological stimulus or an endogenous ligand produced during tissue injury (James, I.F., Kinkina, N.N.
  • the present invention is based, at least in part, on the discovery of novel members of the Capsaicin/Vanilloid family of receptors. Described herein is the isolation ofthe human orthologue of rat VR-1 (rVR-1), referred to herein as hVR-1, as well as another previously unknown member of the VR family of receptors, referred herein as VR-2, and specifically as human VR-2 (hVR-2, including an alternate form which contains a deletion) and rat VR-2 (rVR-2) nucleic acid and protein molecules.
  • the hVR-1, hVR-2, and rVR-2 molecules ofthe present invention are useful as targets for developing modulating agents to regulate a variety of cellular processes, e.g., cellular processes involved in pain.
  • this invention provides isolated nucleic acid molecules encoding hVR-1, hVR-2, and rVR-2 proteins and fragments thereof, as well as nucleic acid fragments suitable as primers or hybridization probes for the detection of hVR-1, hVR-2, and rVR-2-encoding nucleic acids.
  • an hVR-1, hVR-2, or rVR-2 nucleic acid molecule of the invention is at least 60%, 65%, 70%, 75%, 80%, 83%.
  • the isolated nucleic acid molecule includes the nucleotide sequence shown SEQ ID NO:l, 3, 4, 6, 7, 9, 10, or 12, or a complement thereof.
  • the nucleic acid molecule includes at least 10, 15, 20, or more contiguous nucleotides of SEQ ID NO:l, 3, 4, 6, 7, 9, 10, or 12.
  • an hVR-1, hVR-2, and rVR-2 nucleic acid molecule includes a nucleotide sequence encoding a protein having an amino acid sequence sufficiently homologous to the amino acid sequence of SEQ ID NO:2, 5, 8, or 1 1.
  • an hVR-1, hVR-2, and rVR-2 nucleic acid molecule includes a nucleotide sequence encoding a protein having an amino acid sequence at least 60%, 65%, 70%, 75%, 80%, 85%, 87%, 90%, 95%, 98% or more identical to the entire length ofthe amino acid sequence of SEQ ID NO:2, 5, 8, or 1 1.
  • nucleic acid molecules preferably hVR-1, hVR-2, and rVR-2 nucleic acid molecules, which specifically detect hVR-1, hVR-2, and rVR-2 nucleic acid molecules relative to nucleic acid molecules encoding non-hVR-1, non-hVR-2, and non-hVR-2 proteins.
  • such a nucleic acid molecule is at least 100-150, 1150-200, 200-250, 250-300, 300-350, 350-400, 400-450, 450-500, 500-550, 550-600, 600-700, 700-800, 800-900, 900-1000, 1088, or more nucleotides in length and hybridizes under stringent conditions to a nucleic acid molecule comprising the nucleotide sequence shown in SEQ ID NO: 1, 3, 4, 6, 7, 9, 10, or 12.
  • the nucleic acid molecules are at least 15 ⁇ e.g.
  • nucleic acid molecules are at least 15 (e.g.. contiguous) nucleotides in length and hybridize under stringent conditions to nucleotides 1944-2003 of SEQ ID NO:4. In other preferred embodiments, the nucleic acid molecules comprise nucleotides 1944-2003 of SEQ ID NO:4. In yet other preferred embodiments, the nucleic acid molecules consist of nucleotides 1944-2003 of SEQ ID NO:4.
  • the nucleic acid molecule encodes a naturally occurring allelic variant of a polypeptide comprising the amino acid sequence of SEQ ID NO:2, 5, 8, or 11 , wherein the nucleic acid molecule hybridizes to a nucleic acid molecule consisting of SEQ ID NO:l, 3, 4, 6, 7, 9, 10, or 12 under stringent conditions and is encoded by the same locus as hVR-1, hVR-2 or rVR-2.
  • nucleic acid molecule that encodes a naturally occurring orthologue of a polypeptide comprising the amino acid sequence of SEQ ID NO:2, 5, 8, or 1 1 , wherein the nucleic acid molecule hybridizes to a nucleic acid molecule consisting of SEQ ID NO: l, 3, 4, 6, 7, 9, 10, or 12 under stringent conditions.
  • Another embodiment ofthe invention provides an isolated nucleic acid molecule which is antisense to an hVR-1, hVR-2, and rVR-2 nucleic acid molecule, e.g., the coding strand of an hVR-1, hVR-2, and rVR-2 nucleic acid molecule.
  • hVR2 the alternate form
  • rVR2 sequences represent fragments of the entire coding regions of these genes
  • another embodiment ofthe invention provides the complete gene sequences. A skilled artisan can readily isolate such molecule using the sequences disclosed herein.
  • Another aspect of the invention provides a vector comprising an hVR-1, an hVR- 2, or a rVR-2 nucleic acid molecule.
  • the vector is a recombinant expression vector.
  • the invention provides a host cell containing a vector of the invention.
  • the invention provides a host cell containing a nucleic acid molecule ofthe invention.
  • the invention also provides a method for producing a protein, preferably an hVR-1, hVR-2, and rVR-2 protein, by culturing in a suitable medium, a host cell, e.g., a mammalian host cell such as a non-human mammalian cell, ofthe invention containing a recombinant expression vector, such that the protein is produced.
  • a host cell e.g., a mammalian host cell such as a non-human mammalian cell, ofthe invention containing a recombinant expression vector, such that the protein is produced.
  • the isolated protein preferably an hVR-1, hVR-2, or rVR-2 protein, includes at least one transmembrane domain.
  • the isolated protein preferably an hVR-1, hVR-2, or rVR-2 protein, includes at least one transmembrane domain and at least one proline rich domain.
  • the isolated protein, preferably an hVR-1, hVR-2, or rVR-2 protein includes at least one transmembrane domain, at least one proline rich domain, and at least one ankyrin repeat domain.
  • the protein preferably an hVR-1, hVR-2, or rVR-2 protein, includes at least one transmembrane domain, at least one proline rich domain, and at least one ankyrin repeat domain and has an amino acid sequence at least about 60%, 65%, 70%, 75%, 80%, 85%, 87%, 90%, 95%, 98% or more homologous to the amino acid sequence of SEQ ID NO:2, 5, 8, or 11.
  • the protein preferably an hVR-1. hVR-2, or rVR-2 protein, includes at least one transmembrane domain, at least one proline rich domain, and at least one ankyrin repeat domain and plays a role in the development and regulation of pain.
  • the protein preferably an hVR-1, hVR-2, and rVR-2 protein, includes at least one transmembrane domain, at least one proline rich domain, and at least one ankyrin repeat domain and is encoded by a nucleic acid molecule having a nucleotide sequence which hybridizes under stringent hybridization conditions to a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:l, 3, 4, 6, 7, 9, 10, or 12.
  • the invention features fragments of the protein having the amino acid sequence of SEQ ID NO:2, 5, 8, or 11, wherein the fragment comprises at least 15, 30, 40, 50, 60, 70, 80, 90, or 100 amino acids ⁇ e.g., contiguous amino acids).
  • the invention features an isolated protein, preferably an hVR-1 , hVR-2, and rVR-2 protein, which is encoded by a nucleic acid molecule consisting of a nucleotide sequence at least about 60%, 65%, 70%, 75%, 80%, 83%, 85%, 86%, 87%, 88%, 89%, 90%, 91%.
  • This invention further features an isolated protein, preferably an hVR-1, hVR-2, or rVR-2 protein, which is encoded by a nucleic acid molecule consisting of a nucleotide sequence which hybridizes under stringent hybridization conditions to a nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO:l, 3, 4, 6, 7, 9, 10, or 12, or a complement thereof.
  • the proteins of the present invention or portions thereof, e.g., biologically active portions thereof, can be operatively linked to a non-hVR-1, non-hVR-2, or non-rVR-2 polypeptide ⁇ e.g., heterologous amino acid sequences) to form fusion proteins.
  • the invention further features antibodies, such as monoclonal or polyclonal antibodies, that specifically bind proteins ofthe invention, preferably hVR-1, hVR-2, and rVR-2 proteins.
  • the hVR-1 , hVR-2, and rVR-2 proteins or biologically active portions thereof can be incorporated into pharmaceutical compositions, which optionally include pharmaceutically acceptable carriers.
  • the present invention provides a method for detecting the presence of an hVR-1, hVR-2, and rVR-2 nucleic acid molecule, protein or polypeptide in a biological sample by contacting the biological sample with an agent capable of detecting an hVR-1, hVR-2, and rVR-2 nucleic acid molecule, protein or polypeptide such that the presence of an hVR-1, hVR-2, and rVR-2 nucleic acid molecule, protein or polypeptide is detected in the biological sample.
  • the present invention provides a method for detecting the presence of hVR-1, hVR-2, and rVR-2 activity in a biological sample by contacting the biological sample with an agent capable of detecting an indicator of hVR-1, hVR-2, and rVR-2 activity such that the presence of hVR-1, hVR-2, and rVR-2 activity is detected in the biological sample.
  • the invention provides a method for modulating hVR-1, hVR- 2, and rVR-2 activity comprising contacting a cell capable of expressing hVR- 1 , hVR-2, and rVR-2 with an agent that modulates hVR-1, hVR-2, and rVR-2 activity such that hVR-1, hVR-2, and rVR-2 activity in the cell is modulated.
  • the agent inhibits hVR-1, hVR-2, and rVR-2 activity.
  • the agent stimulates hVR-1, hVR-2, and rVR-2 activity.
  • the agent is an antibody that specifically binds to an hVR-1, hVR-2, and rVR-2 protein.
  • the agent modulates expression of hVR-1, hVR-2, and rVR-2 by modulating transcription of an hVR-1, hVR-2, and rVR-2 gene or translation of an hVR- 1, hVR-2, and rVR-2 mRNA.
  • the agent is a nucleic acid molecule having a nucleotide sequence that is antisense to the coding strand of an hVR- 1 , hVR-2, and rVR-2 mRNA or an hVR- 1 , hVR-2, and rVR-2 gene.
  • the methods ofthe present invention are used to treat a subject having a disorder characterized by aberrant hVR-1, hVR-2, and rVR-2 protein or nucleic acid expression or activity by administering an agent which is an hVR-1, hVR-2, and rVR-2 modulator to the subject.
  • the hVR-1 , hVR-2, and rVR-2 modulator is an hVR-1 , hVR-2, and rVR-2 protein.
  • the hVR-1 , hVR-2, and rVR-2 modulator is an hVR-1, hVR-2, and rVR-2 nucleic acid molecule.
  • the hVR-1, hVR-2 is an agent which is an hVR-1, hVR-2, and rVR-2 modulator to the subject.
  • rVR-2 modulator is a peptide, peptidomimetic, or other small molecule.
  • the disorder characterized by aberrant hVR-1, hVR-2. and rVR-2 protein or nucleic acid expression is a pain disorder, e.g., hyperalgesia.
  • the present invention also provides a diagnostic assay for identifying the presence or absence of a genetic alteration characterized by at least one of (i) aberrant modification or mutation of a gene encoding an hVR-1, hVR-2, and rVR-2 protein; (ii) mis-regulation ofthe gene; and (iii) aberrant post-translational modification of an hVR- 1, hVR-2, and rVR-2 protein, wherein a wild-type form ofthe gene encodes a protein with an hVR-1, hVR-2, and rVR-2 activity (as described herein).
  • the invention provides a method for identifying a compound that binds to or modulates the activity of an hVR-1, hVR-2, and rVR-2 protein, by providing an indicator composition comprising an hVR-1, hVR-2, and rVR-2 protein having hVR-1, hVR-2, and rVR-2 activity, contacting the indicator composition with a test compound, and determining the effect ofthe test compound on hVR-1, hVR-2, and rVR-2 activity in the indicator composition to identify a compound that modulates the activity of an hVR-1, hVR-2, and rVR-2 protein.
  • Figure 1 depicts the full length cDNA sequence and predicted amino acid sequence of human VR-1 (hVR-1).
  • the nucleotide sequence corresponds to nucleic acids 1 to 3909 of SEQ ID NO:l.
  • the amino acid sequence corresponds to amino acids 1 to 839 of SEQ ID NO:2.
  • the coding region without the 5' and 3' untranslated regions ofthe human VR-1 (hVR-1) gene is shown in SEQ ID NO:3.
  • Figure 2 depicts the full length cDNA sequence and predicted amino acid sequence of human VR-2 (hVR-2).
  • the nucleotide sequence corresponds to nucleic acids 1 to 2809 of SEQ ID NO:4.
  • the amino acid sequence corresponds to amino acids 1 to 764 of SEQ ID NO:5.
  • the coding region without the 5' and 3' untranslated regions ofthe human VR-2 (hVR-2) gene is shown in SEQ ID NO:6.
  • Figure 3 depicts the partial cDNA sequence and partial predicted amino acid sequence of an alternate form of human VR-2 (hVR-2).
  • the nucleotide sequence corresponds to nucleic acids 1 to 1489 of SEQ ID NO:7.
  • the amino acid sequence corresponds to amino acids 1 to 436 of SEQ ID NO:8.
  • the coding region without the 5' and 3' untranslated regions ofthe alternate form of human VR-2 (hVR-2) gene is shown in SEQ ID NO:9.
  • Figure 4 depicts the partial cDNA sequence and partial predicted amino acid sequence of rat VR-2 (rVR-2).
  • the nucleotide sequence corresponds to nucleic acids 1 to 1794 of SEQ ID NO: 10.
  • the amino acid sequence corresponds to amino acids 1 to 554 of SEQ ID NO:l 1.
  • the coding region without the 5' and 3' untranslated regions of the rat VR-2 (rVR-2) gene is shown in SEQ ID NO: 12.
  • Figure 5 depicts an alignment ofthe hVR-1 protein (SEQ ID NO:2) with the human VR-2 protein (SEQ ID NO:5) using the GAP program in the GCG software package (Blosum 62 matrix) and a gap weight of 12 and a length weight of 4.
  • Figure 6 depicts an alignment of the hVR- 1 nucleotide sequence (SEQ ID NO: 1 ) with the human VR-2 nucleotide sequence (SEQ ID NO:4) using the GAP program in the GCG software package (nwsgapdna matrix) and a gap weight of 50 and a length weight of 3.
  • Figure 7 depicts an alignment of the hVR-2 protein (SEQ ID NO:5) with the rat VR-2 protein (SEQ ID NO : 1 1 ) using the CLUSTAL W ( 1.74) multiple sequence alignment program.
  • Figure 8 depicts an alignment ofthe hVR-2 protein (SEQ ID NO: 5) with the rat VR-2 protein (SEQ ID NO:l 1) using the GAP program in the GCG software package (Blosum 62 matrix) and a gap weight of 12 and a length weight of 4.
  • Figure 9 depicts an alignment ofthe hVR-1 nucleotide sequence (SEQ ID NO:l) with the rat VR-1 nucleotide sequence (Accession Number :AF 029310) using the GAP program in the GCG software package (nwsgapdna matrix) and a gap weight of 50 and a length weight of 3.
  • Figure 10 depicts an alignment ofthe hVR-1 protein (SEQ ID NO:2) with the rat VR-1 protein (Accession Number: AF029310) using the GAP program in the GCG software package (Blosum 62 matrix) and a gap weight of 12 and a length weight of 4.
  • Figure 11 depicts an alignment ofthe hVR-2 protein (SEQ ID NO:5) with the human VR-2 protein (alternate form) (SEQ ID NO:8) using the CLUSTAL W (1.74) multiple sequence alignment program.
  • Figure 12 depicts a structural, hydrophobicity, and antigenicity analysis ofthe hVR-1 protein.
  • Figure 13 depicts the results of a search using the amino acid sequence ofthe hVR-1 protein against the HMM database.
  • Figure 14 depicts a structural, hydrophobicity, and antigenicity analysis of the hVR-2 protein.
  • Figure 15 depicts the results of a search using the amino acid sequence ofthe hVR-2 protein against the HMM database.
  • Figure 16 depicts the predicted full length amino acid sequence ofthe human VR-2 protein (alternate form) (SEQ ID NO:20).
  • Figure 17 depicts an alignment ofthe hVR-2 protein (SEQ ID NO:5) with the predicted full length human VR-2 protein (alternate form) (SEQ ID NO:20) using the CLUSTAL W (1.74) multiple sequence alignment program.
  • the present invention is based, at least in part, on the discovery of nucleic acid and amino acid molecules which are novel members of the Capsaicin/Vanilloid family of receptors. Described herein is the isolation of the human orthologue of rat VR-1 (rVR-1), referred to herein as hVR-1, as well as another previously unknown member of the VR family of receptors, referred herein as VR-2, and specifically as human VR-2 (hVR-2) and rat VR-2 (rVR-2) nucleic acid and protein molecules.
  • the hVR-1, hVR-2, and rVR-2 molecules were identified based on their sequence similarity to the known rat vanilloid receptor (VR-1).
  • VR-1 is a vanilloid gated, non-selective cation channel which resembles members ofthe transient receptor potential (TRP) ion channel family (described in Montell et al. (1989) Neuron 2:1313-1323) that mediate the influx of extracellular calcium in response to depletion of intracellular calcium stores.
  • the rat VR-1 cDNA contains an open reading frame of 2514 nucleotides that encodes a protein of 838 amino acids. Hydrophilicity analysis has indicated that rat VR-1 contains six transmembrane domains (predicted to be mostly ⁇ -helices) with an additional short hydrophobic stretch between transmembrane regions 5 and 6.
  • the amino terminal hydrophilic segment contains a relatively proline rich region followed by three ankyrin repeat domains.
  • the rat VR-1 is expressed in small diameter neurons within sensory ganglia.
  • the present hVR-1 sequence is the human orthologue of rVR-1.
  • the human VR-1 is expressed in nodose, trigeminal sensory neurons, as well as in some, but not all, small dorsal root ganglion (DRG) neurons and in a few medium sized DRG neurons.
  • DRG small dorsal root ganglion
  • the hVR-1, hVR-2, and rVR-2 molecules ofthe present invention play a role in pain signaling mechanisms.
  • pain signaling mechanisms includes the cellular mechanisms involved in the development and regulation of pain, e.g., pain elicited by noxious chemical, mechanical, or thermal stimuli, in a subject, e.g., a mammal such as a human.
  • a subject e.g., a mammal such as a human.
  • the initial detection of noxious chemical, mechanical, or thermal stimuli a process referred to as "nociception” occurs predominantly at the peripheral terminals of specialized, small diameter primary afferent neurons, called polymodal nociceptors.
  • afferent neurons transmit the information to the central nervous system, evoking a perception of pain or discomfort and initiating appropriate protective reflexes.
  • Capsaicin/Vanilloid receptors e.g., the hVR-1, hVR-2, and rVR-2 molecules ofthe present invention, present on these afferent neurons, are involved in detecting these noxious chemical, mechanical, or thermal stimuli and transducing this information into membrane depolarization events.
  • the hVR-1, hVR-2, and rVR-2 molecules by participating in pain signaling mechanisms, can modulate pain elicitation and provide novel diagnostic targets and therapeutic agents to control pain.
  • the hVR-1, hVR-2, and rVR-2 molecules provide novel diagnostic targets and therapeutic agents to control pain in a variety of disorders, diseases, or conditions which are characterized by a deregulated, e.g., upregulated or downregulated, pain response.
  • the hVR-1, hVR-2, and rVR-2 molecules provide novel diagnostic targets and therapeutic agents to control the exaggerated pain response elicited during various forms of tissue injury, e.g., inflammation, infection, and ischemia, usually referred to as hyperalgesia (described in, for example, Fields, H.L. (1987) Pain, New York:McGraw- Hill).
  • the hVR-1, hVR-2, and rVR-2 molecules provide novel diagnostic targets and therapeutic agents to control pain associated with muscoloskeletal disorders, e.g., joint pain; tooth pain; headaches; pain associated with surgery, or neuropathic pain.
  • muscoloskeletal disorders e.g., joint pain; tooth pain; headaches; pain associated with surgery, or neuropathic pain.
  • the hVR-1 gene maps to a region of human chromosome 17 between WI- 5436 (7.7cR) and WI-6584 (18.9cR) (Example 6), which has been associated with myasthenia gravis, Smith-Magenis syndrome, CORD5, Cone-rod dysrtophy, and breast cancer
  • the hVR-1 molecule may provide novel diagnostic targets and therapeutic agents to treat, diagnose, or prognose these disorders or other disorders linked to this chromosomal region.
  • the hVR-2 gene maps to a region of human chromosome 17 between AFMA043ZB5 (23.3 cR) and D17S721 (29.3cR) (Example 6) which has been associated with myasthenia gravis, Smith-Magenis syndrome, CORD5, Cone-rod dysrtophy, choroidal dystrophy, central areolar, and retinal cone dystrophy
  • the hVR-2 molecule may provide novel diagnostic targets and therapeutic agents to treat, diagnose, or prognose these disorders or other disorders linked to this chromosomal region.
  • family when referring to the protein and nucleic acid molecules of the invention is intended to mean two or more proteins or nucleic acid molecules having a common structural domain or motif and having sufficient amino acid or nucleotide sequence homology as defined herein.
  • family members can be naturally or non- naturally occurring and can be from either the same or different species.
  • a family can contain a first protein of human origin, as well as other, distinct proteins of human origin or alternatively, can contain homologues of non-human origin.
  • Members of a family may also have common functional characteristics.
  • the family of hVR-1, hVR-2, and rVR-2 proteins comprise at least one, and preferably six "transmembrane domains.”
  • transmembrane domain includes an amino acid sequence of about 15 amino acid residues in length which spans the plasma membrane. More preferably, a transmembrane domain includes about at least 20, 25, 30, 35, 40, or 45 amino acid residues and spans the plasma membrane. Transmembrane domains are rich in hydrophobic residues, and typically have a helical structure. In a embodiment, at least 50%, 60%, 70%, 80%, 90%, 95% or more ofthe amino acid residues of a transmembrane domain are hydrophobic, e.g., leucines, isoleucines, tyrosines, or tryptophans. Transmembrane domains are described in, for example. Zaklaklaw.N. et al, (1996) Annual Rev.
  • Amino acid residues 434-455, 480-495, (509-531 ; based on homology to the rat VR-1) or 514-531, (543-569; based on homology to the rat VR-1) or 538-555, (577-596; based on homology to the rat VR-1) or 580-599, and (656-683; based on homology to the rat VR-1) or 658-682 of hVR-1 (SEQ ID NO:2) and amino acid residues 391-410, 431-448, 459-476, 486-508, 538-556, and 621-645 of hVR-2 (SEQ ID NO:5) comprise transmembrane domains.
  • an hVR-1, hVR-2, and rVR-2 ofthe present invention is identified based on the presence of a "proline rich domain" in the protein or corresponding nucleic acid molecule.
  • a proline rich domain includes an amino acid sequence of about 4-6 amino acid residues in length having the general sequence X-Pro-X-X-Pro-X (where X can be any amino acid).
  • Proline rich domains are usually located in a helical structure and bind through hydrophobic interactions to SH3 domains. SH3 domains recognize proline rich domains in both forward and reverse orientations. Proline rich domains are described in, for example, Sattler M. et al.
  • an hVR-1, hVR-2, and rVR-2 of the present invention is identified based on the presence of an "ankyrin repeat domain" in the protein or corresponding nucleic acid molecule.
  • the term "ankyrin repeat domain” includes a protein domain having an amino acid sequence of about 30-50 amino acid residues and having a bit score for the alignment ofthe sequence to the ankyrin repeat domain (HMM) of at least 6.
  • an ankyrin repeat domain includes at least about 30-45, more preferably about 30-40 amino acid residues, or about 30-35 amino acids and has a bit score for the alignment ofthe sequence to the ankyrin repeat domain (HMM) of at least 3-10, more preferably 10-30, more preferably 30-50, even more preferably 50-75, 75-100, 100-200 or greater.
  • HMM ankyrin repeat domain
  • the ankyrin repeat domain HMM has been assigned the PFAM Accession PF00023 (http://genome.wustl.edu/Pfam/.html).
  • Ankyrin repeats are involved in protein-protein interactions and are described in, for example, Ketchum K.A et al. (1996) FEBS Letters 378:19-26, the contents of which are inco ⁇ orated herein by reference.
  • the amino acid sequence ofthe protein is searched against a database of HMMs (e.g., the Pfam database, release 2.1) using the default parameters (http://www.sanger.ac.uk/Software/Pfam/HMM_search).
  • HMMs e.g., the Pfam database, release 2.1
  • a description of the Pfam database can be found in Sonhammer et al. (1997) Proteins 28(3)405-420 and a detailed description of HMMs can be found, for example, in Gribskov et ⁇ /.(1990) Meth. Enzymol.
  • Isolated proteins ofthe present invention preferably hVR-1, hVR-2, and rVR-2 proteins, have an amino acid sequence sufficiently identical to the amino acid sequence of SEQ ID NO:2, 5, 8, or 11 or are encoded by a nucleotide sequence sufficiently identical to SEQ ID NO:l , 3, 4, 6, 7, 9, 10, or 12.
  • the term "sufficiently identical" refers to a first amino acid or nucleotide sequence which contains a sufficient or minimum number of identical or equivalent (e.g., an amino acid residue which has a similar side chain) amino acid residues or nucleotides to a second amino acid or nucleotide sequence such that the first and second amino acid or nucleotide sequences share common structural domains or motifs and/or a common functional activity.
  • amino acid or nucleotide sequences which share common structural domains have at least 30%), 40%, or 50% identity, preferably 60% identity, more preferably 70%-80%, and even more preferably 90-95% identity across the amino acid sequences ofthe domains and contain at least one and preferably two structural domains or motifs, are defined herein as sufficiently identical.
  • amino acid or nucleotide sequences which share at least 30%, 40%, or 50%, preferably 60%, more preferably 70-80%, or 90-95% identity and share a common functional activity are defined herein as sufficiently identical.
  • an hVR-1, hVR-2, and rVR-2 activity is a direct activity, such as an association with an hVR-1, hVR-2, and rVR-2-target molecule.
  • a "target molecule” or “binding partner” is a molecule with which an hVR-1, hVR-2, and rVR-2 protein binds or interacts in nature, such that hVR-1, hVR-2, and rVR-2-mediated function is achieved.
  • An hVR-1, hVR-2, and rVR-2 target molecule can be a non-hVR-1, non-hVR-2, and non-rVR-2 molecule or an hVR-1, hVR-2, and rVR-2 protein or polypeptide ofthe present invention.
  • an hVR-1, hVR-2, and rVR-2 target molecule is an hVR-1, hVR-2, and rVR-2 ligand, e.g., capsaicin.
  • an hVR-1, hVR-2, and rVR-2 activity is an indirect activity, such as a cellular signaling activity mediated by interaction ofthe hVR-1, hVR-2, and rVR-2 protein with an hVR-1, hVR-2, and rVR-2 ligand.
  • another embodiment ofthe invention features isolated hVR-1, hVR-2, and rVR-2 proteins and polypeptides having an hVR-1, hVR-2, and rVR-2 activity.
  • Other proteins ofthe invention are hVR-1, hVR-2, and rVR-2 proteins having at least one, and preferably six, transmembrane domains and, preferably, an hVR- 1 , hVR-2, and rVR-2 activity.
  • Yet other proteins ofthe invention are hVR-1, hVR-2, and rVR-2 proteins having at least one transmembrane domain, at least one proline rich domain and, preferably, an hVR-1, hVR-2, and rVR-2 activity.
  • proteins ofthe invention are hVR-1, hVR-2, and rVR-2 proteins having at least one transmembrane domain, at least one proline rich domain, at least one ankyrin repeat domain and, preferably, an hVR-1, hVR-2, and rVR-2 activity.
  • Additional proteins ofthe invention have at least one transmembrane domain, at least one proline rich domain, at least one ankyrin repeat domain, and are, preferably, encoded by a nucleic acid molecule having a nucleotide sequence which hybridizes under stringent hybridization conditions to a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:l, 3, 4, 6, 7, 9, 10, or 12.
  • nucleotide sequence ofthe full length hVR-1 cDNA and the predicted amino acid sequence of the hVR-1 polypeptide are shown in Figure 1 and in SEQ ID NOs: 1 and 2, respectively.
  • nucleotide sequence ofthe full length hVR-2 cDNA and the predicted amino acid sequence of the hVR-2 polypeptide are shown in Figure 2 and in SEQ ID NOs:4 and 5, respectively.
  • nucleotide sequence of the partial hVR-2 (alternate form) cDNA and the predicted amino acid sequence of the hVR-2 (alternate form) polypeptide are shown in Figure 3 and in SEQ ID NOs:7 and 8, respectively.
  • One aspect of the invention pertains to isolated nucleic acid molecules that encode hVR-1, hVR-2, and rVR-2 proteins or biologically active portions thereof, as well as nucleic acid fragments sufficient for use as hybridization probes to identify hVR- 1, hVR-2, and rVR-2-encoding nucleic acid molecules (e.g., hVR-1, hVR-2, and rVR-2 mRNA) and fragments for use as PCR primers for the amplification or mutation of hVR- 1, hVR-2, and rVR-2 nucleic acid molecules.
  • nucleic acid molecules e.g., hVR-1, hVR-2, and rVR-2 mRNA
  • nucleic acid molecule is intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mRNA) and analogs ofthe DNA or RNA generated using nucleotide analogs.
  • the nucleic acid molecule can be single-stranded or double- stranded, but preferably is double-stranded DNA.
  • isolated nucleic acid molecule includes nucleic acid molecules which are separated from other nucleic acid molecules which are present in the natural source ofthe nucleic acid.
  • isolated includes nucleic acid molecules which are separated from the chromosome with which the genomic DNA is naturally associated.
  • an "isolated" nucleic acid is free of sequences which naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends ofthe nucleic acid) in the genomic DNA ofthe organism from which the nucleic acid is derived.
  • the isolated hVR-1, hVR-2, and rVR-2 nucleic acid molecule can contain less than about 5 kb, 4kb, 3kb. 2kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived.
  • an "isolated" nucleic acid molecule such as a cDNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
  • a nucleic acid molecule ofthe present invention e.g., a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: l, 3, 4, 6, 7, 9, 10, or 12.
  • hVR-1, hVR-2, and rVR-2 nucleic acid molecules can be isolated using standard hybridization and cloning techniques (e.g., as described in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989).
  • nucleic acid molecule encompassing all or a portion of SEQ ID NO:l, 3, 4, 6, 7, 9, 10, or 12, can be isolated by the polymerase chain reaction (PCR) using synthetic oligonucleotide primers designed based upon the sequence of SEQ ID NO:l, 3, 4, 6, 7, 9, 10, or 12.
  • a nucleic acid ofthe invention can be amplified using cDNA, mRNA or alternatively, genomic DNA, as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis.
  • an isolated nucleic acid molecule ofthe invention comprises the nucleotide sequence shown in SEQ ID NO: l .
  • the sequence of SEQ ID NO:l corresponds to the full length hVR-1 encoding cDNA.
  • an isolated nucleic acid molecule of the invention comprises the nucleotide sequence shown in SEQ ID NO:4.
  • the sequence of SEQ ID NO:4 corresponds to the full length hVR-2 encoding cDNA.
  • an isolated nucleic acid molecule of the invention comprises the nucleotide sequence shown in SEQ ID NO:7.
  • the sequence of SEQ ID NO:7 corresponds to a fragment ofthe hVR-2 (alternate form) encoding cDNA.
  • an isolated nucleic acid molecule ofthe invention comprises the nucleotide sequence shown in SEQ ID NO: 10.
  • the sequence of SEQ ID NO: 10 corresponds to a fragment ofthe rVR-2 cDNA.
  • an isolated nucleic acid molecule of the invention comprises a nucleic acid molecule which is a complement of the nucleotide sequence shown in SEQ ID NO: l, 3, 4, 6, 7, 9, 10, or 12, or a portion of any of these nucleotide sequences.
  • a nucleic acid molecule which is complementary to the nucleotide sequence shown in SEQ ID NO:l, 3, 4, 6, 7, 9, 10, or 12, is one which is sufficiently complementary to the nucleotide sequence shown in SEQ ID NO:l, 3, 4, 6, 7, 9, 10, or 12, such that it can hybridize to the nucleotide sequence shown in SEQ ID NO: l, 3, 4, 6, 7, 9, 10. or 12 thereby forming a stable duplex.
  • an isolated nucleic acid molecule ofthe present invention comprises a nucleotide sequence which is at least about 60%, 65%, 70%, 75%>, 80%, 83%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to the entire length ofthe nucleotide sequence shown in SEQ ID NO:l, 3, 4, 6, 7, 9, 10, or 12, or a portion of any of these nucleotide sequences.
  • the nucleic acid molecule ofthe invention can comprise only a portion ofthe nucleic acid sequence of SEQ ID NO: l, 3, 4, 6, 7, 9, 10, or 12, for example, a fragment which can be used as a probe or primer or a fragment encoding a portion of an hVR-1, hVR-2, and rVR-2 protein, e.g., a biologically active portion of an hVR-1, hVR- 2, and rVR-2 protein.
  • the nucleotide sequence determined from the cloning ofthe hVR-1. hVR-2, and rVR-2 gene allows for the generation of probes and primers designed for use in identifying and/or cloning other hVR-1, hVR-2.
  • the probe/primer typically comprises a substantially purified oligonucleotide.
  • the oligonucleotide typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 12 or 15, preferably about 20 or 25, more preferably about 30, 35, 40, 45, 50, 55, 60, 65, 75, or 100 consecutive nucleotides of a sense sequence of SEQ ID NO:l, 3, 4, 6, 7, 9, 10, or 12, of an anti-sense sequence of SEQ ID NO:l, 3, 4, 6, 7, 9, 10, or 12, or of a naturally occurring allelic variant or mutant of SEQ ID NO: l, 3, 4, 6, 7, 9, 10, or 12.
  • a nucleic acid molecule ofthe present invention comprises a nucleotide sequence which is greater than 100-150, 150-200. 200-250, 250-300, 300-350, 350-400, 400-450, 450-500, 500-550, 550-600. 600-650, 650-700, 700-750, 750-800, 800-850, 850-900, 900-950, 950-1000, 1088, or more nucleotides in length and hybridizes under stringent hybridization conditions to a nucleic acid molecule of SEQ ID NO:l, 3, 4, 6, 7, 9, 10, or 12.
  • Probes based on the hVR-1, hVR-2, and rVR-2 nucleotide sequences can be used to detect transcripts or genomic sequences encoding the same or homologous proteins.
  • the probe further comprises a label group attached thereto, e.g., the label group can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor.
  • Such probes can be used as a part of a diagnostic test kit for identifying cells or tissue which misexpress an hVR-1, hVR-2, and rVR-2 protein, such as by measuring a level of an hVR-1, hVR-2, and rVR-2-encoding nucleic acid in a sample of cells from a subject e.g., detecting hVR-1, hVR-2, and rVR-2 mRNA levels or determining whether a genomic hVR-1, hVR-2, and rVR-2 gene has been mutated or deleted.
  • a nucleic acid fragment encoding a "biologically active portion of an hVR- 1 , hVR-2, and rVR-2 protein" can be prepared by isolating a portion ofthe nucleotide sequence of SEQ ID NO:l, 3, 4, 6, 7, 9, 10, or 12, which encodes a polypeptide having an hVR-1, hVR-2, and rVR-2 biological activity (the biological activities ofthe hVR-1, hVR-2, and rVR-2 proteins are described herein), expressing the encoded portion ofthe hVR-1, hVR-2, and rVR-2 protein (e.g., by recombinant expression in vitro) and assessing the activity ofthe encoded portion ofthe hVR-1, hVR-2, and rVR-2 protein.
  • the invention further encompasses nucleic acid molecules that differ from the nucleotide sequence shown in SEQ ID NO: l, 3, 4, 6, 7, 9, 10, or 12, due to degeneracy ofthe genetic code and thus encode the same hVR-1, hVR-2, and rVR-2 proteins as those encoded by the nucleotide sequence shown in SEQ ID NO: l, 3, 4, 6, 7, 9, 10, or 12.
  • an isolated nucleic acid molecule ofthe invention has a nucleotide sequence encoding a protein having an amino acid sequence shown in SEQ ID NO:2, 5, 8, or 1 1.
  • DNA sequence polymo ⁇ hisms that lead to changes in the amino acid sequences ofthe hVR-1, hVR-2. and rVR-2 proteins may exist within a population (e.g., the human population).
  • Such genetic polymo ⁇ hism in the hVR-1, hVR-2, and rVR-2 genes may exist among individuals within a population due to natural allelic variation.
  • gene and “recombinant gene” refer to nucleic acid molecules which include an open reading frame encoding an hVR-1, hVR-2, and rVR-2 protein, preferably a mammalian hVR-1, hVR-2, and rVR-2 protein, and can further include non- coding regulatory sequences, and introns.
  • Allelic variants of hVR-1, hVR-2, and rVR-2 include both functional and nonfunctional hVR-1 , hVR-2, and rVR-2 proteins.
  • Functional allelic variants are naturally occurring amino acid sequence variants of the hVR-1. hVR-2, and rVR-2 protein that maintain the ability to bind an hVR-1, hVR-2, and rVR-2 ligand and/or modulate a pain signaling mechanism.
  • Functional allelic variants will typically contain only conservative substitution of one or more amino acids of SEQ ID NO:2, 5, 8, or 1 1, or substitution, deletion or insertion of non-critical residues in non-critical regions ofthe protein.
  • Non-functional allelic variants are naturally occurring amino acid sequence variants ofthe hVR-1, hVR-2, and rVR-2 protein that do not have the ability to either bind an hVR-1, hVR-2, and rVR-2 ligand and/or modulate a pain signaling mechanism.
  • Non-functional allelic variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation ofthe amino acid sequence of SEQ ID NO:2, 5, 8, or 1 1 , or a substitution, insertion or deletion in critical residues or critical regions.
  • the present invention further provides non-human orthologues of the hVR-2 and rVR-2 protein.
  • Orthologues of the hVR-2 and rVR-2 protein are proteins that are isolated from non-human and non-rat organisms and possess the same hVR-2 and rVR- 2 ligand binding and/or modulation of pain signaling mechanism capabilities ofthe hVR-2 and rVR-2 proteins.
  • Orthologues ofthe hVR-2 and rVR-2 proteins can readily be identified as comprising an amino acid sequence that is substantially homologous to SEQ ID NO: 4, 6, 8 or 10.
  • nucleic acid molecules encoding other hVR-1, hVR-2, and rVR-2 family members and, thus, which have a nucleotide sequence which differs from the hVR-1, hVR-2, and rVR-2 sequences of SEQ ID NO: l, 3, 4, 6, 7, 9, 10, or 12, are intended to be within the scope ofthe invention.
  • another hVR-1, hVR-2, and rVR-2 cDNA can be identified based on the nucleotide sequence of hVR-1, hVR-2, and rVR-2.
  • nucleic acid molecules encoding VR-2 proteins from different species and which, thus, have a nucleotide sequence which differs from the hVR-2 and rVR-2 sequences of SEQ ID NO: 4, 6, 8, or 10 are intended to be within the scope ofthe invention.
  • a mouse hVR-2 cDNA can be identified based on the nucleotide sequence ofthe human VR-2 (hVR-2) or the rat VR-2 (rVR-2).
  • Nucleic acid molecules corresponding to natural allelic variants and homologues ofthe hVR-1, hVR-2, and rVR-2 cDNAs ofthe invention can be isolated based on their homology to the hVR- 1 , hVR-2, and rVR-2 nucleic acids disclosed herein using the cDNAs disclosed herein, or a portion thereof, as a hybridization probe according to standard hybridization techniques under stringent hybridization conditions.
  • Nucleic acid molecules corresponding to natural allelic variants and homologues ofthe hVR-1, hVR- 2, and rVR-2 cDNAs ofthe invention can further be isolated by mapping to the same chromosome or locus as the hVR-1, hVR-2, and rVR-2 gene.
  • an isolated nucleic acid molecule ofthe invention is at least 15, 20, 25, 30 or more nucleotides in length and hybridizes under stringent conditions to the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:l, 3, 4, 6, 7, 9, 10, or 12.
  • the nucleic acid is at least 30, 50. 100, 150, 200, 250, 300, 350, 400, 450. 500, 550, 600, 650, 700, 750, 800, 850, 900, or 950 nucleotides in length.
  • hybridizes under stringent conditions is intended to describe conditions for hybridization and washing under which nucleotide sequences at least 60% identical to each other typically remain hybridized to each other.
  • the conditions are such that sequences at least about 70%), more preferably at least about 80%. even more preferably at least about 85% or 90% identical to each other typically remain hybridized to each other.
  • stringent conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
  • a preferred, non- limiting example of stringent hybridization conditions are hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45°C.
  • an isolated nucleic acid molecule of the invention that hybridizes under stringent conditions to the sequence of SEQ ID NO: l, 3, 4, 6, 7, 9, 10, or 12 corresponds to a naturally-occurring nucleic acid molecule.
  • a "naturally-occurring" nucleic acid molecule refers to an RNA or DNA molecule having a nucleotide sequence that occurs in nature (e.g., encodes a natural protein).
  • allelic variants of the hVR-1. hVR-2. and rVR-2 sequences that may exist in the population, the skilled artisan will further appreciate that changes can be introduced by mutation into the nucleotide sequences of SEQ ID NO: 1, 3, 4, 6, 7, 9, 10, or 12, thereby leading to changes in the amino acid sequence ofthe encoded hVR-1, hVR-2. and rVR-2 proteins, without altering the functional ability ofthe hVR-1, hVR-2, and rVR-2 proteins.
  • nucleotide substitutions leading to amino acid substitutions at "non-essential" amino acid residues can be made in the sequence of SEQ ID NO: 1, 3, 4, 6, 7, 9, 10, or 12.
  • non-essential amino acid residue is a residue that can be altered from the wild-type sequence of hVR-1, hVR-2, and rVR-2 (e.g., the sequence of SEQ ID NO:2, 5, 8, or 11) without altering the biological activity, whereas an "essential" amino acid residue is required for biological activity.
  • amino acid residues that are conserved among the hVR-1, hVR-2, and rVR-2 proteins ofthe present invention are predicted to be particularly unamenable to alteration.
  • additional amino acid residues that are conserved between the hVR-1, hVR-2, and rVR-2 proteins ofthe present invention and other members ofthe Capsaicin/Vanilloid receptor family are not likely to be amenable to alteration.
  • nucleic acid molecules encoding hVR-1, hVR-2, and rVR-2 proteins that contain changes in amino acid residues that are not essential for activity.
  • Such hVR-1, hVR-2, and rVR-2 proteins differ in amino acid sequence from SEQ ID NO:2, 5, 8, or 1 1, yet retain biological activity.
  • the isolated nucleic acid molecule comprises a nucleotide sequence encoding a protein, wherein the protein comprises an amino acid sequence at least about 60%, 65%, 70%, 75%, 80%, 85%, 87%, 90%, 95%, 98% or more homologous to SEQ ID NO:2, 5, 8, or 1 1.
  • An isolated nucleic acid molecule encoding an hVR-1, hVR-2, and rVR-2 protein homologous to the protein of SEQ ID NO:2, 5, 8, or 1 1 can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of SEQ ID NO: l, 3, 4, 6, 7, 9, 10, or 12. such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations can be introduced into SEQ ID NO:l, 3, 4, 6, 7, 9, 10, or 12, by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more predicted non-essential amino acid residues.
  • a “conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain.
  • Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
  • a predicted nonessential amino acid residue in an hVR-1, hVR-2, and rVR-2 protein is preferably replaced with another amino acid residue from the same side chain family.
  • mutations can be introduced randomly along all or part of an hVR- 1 , hVR- 2, and rVR-2 coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for hVR-1, hVR-2, and rVR-2 biological activity to identify mutants that retain activity. Following mutagenesis of SEQ ID NO: l , 3, 4, 6, 7, 9, 10, or 12.
  • a mutant hVR-1 , hVR-2, and rVR-2 protein can be assayed for the ability to (1) interact with a non-hVR-1, non-hVR-2, or non- rVR-2 protein molecule, e.g., a vanilloid compound such as capsaicin; (2) modulate intracellular calcium concentration; (3) activate an hVR-1, hVR-2, and rVR-2-dependent signal transduction pathway; or (4) modulate a pain signaling mechanism.
  • a non-hVR-1, non-hVR-2, or non- rVR-2 protein molecule e.g., a vanilloid compound such as capsaicin
  • an “antisense” nucleic acid comprises a nucleotide sequence which is complementary to a "sense” nucleic acid encoding a protein, e.g., complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA sequence. Accordingly, an antisense nucleic acid can hydrogen bond to a sense nucleic acid.
  • the antisense nucleic acid can be complementary to an entire hVR-1, hVR-2, and rVR-2 coding strand, or to only a portion thereof.
  • an antisense nucleic acid molecule is antisense to a "coding region" ofthe coding strand of a nucleotide sequence encoding hVR-1, hVR-2, and rVR-2.
  • the term "coding region” refers to the region of the nucleotide sequence comprising codons which are translated into amino acid residues (e.g., the coding region of hVR-1, hVR-2, and rVR-2).
  • the antisense nucleic acid molecule is antisense to a "noncoding region" of the coding strand of a nucleotide sequence encoding hVR-1, hVR- 2, and rVR-2.
  • the term “noncoding region” refers to 5' and 3' sequences which flank the coding region that are not translated into amino acids (i.e., also referred to as 5' and 3' untranslated regions).
  • antisense nucleic acids ofthe invention can be designed according to the rules of Watson and Crick base pairing.
  • the antisense nucleic acid molecule can be complementary to the entire coding region of hVR-1 , hVR-2, and rVR-2 mRNA, but more preferably is an oligonucleotide which is antisense to only a portion ofthe coding or noncoding region of hVR-1, hVR-2, and rVR-2 mRNA.
  • the antisense oligonucleotide can be complementary to the region surrounding the translation start site of hVR-1, hVR-2, and rVR-2 mRNA.
  • An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length.
  • An antisense nucleic acid ofthe invention can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art.
  • an antisense nucleic acid e.g., an antisense oligonucleotide
  • an antisense nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g. , phosphorothioate derivatives and acridine substituted nucleotides can be used.
  • modified nucleotides which can be used to generate the antisense nucleic acid include 5-fluorouracil, 5-bromouracil, 5- chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1 -methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7- methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta- D-mannosylqueosine, 5'-me
  • the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (/. e. , RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection).
  • the antisense nucleic acid molecules ofthe invention are typically administered to a subject or generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding an hVR-1, hVR-2, and rVR-2 protein to thereby inhibit expression ofthe protein, e.g., by inhibiting transcription and/or translation.
  • the hybridization can be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule which binds to DNA duplexes, through specific interactions in the major groove ofthe double helix.
  • An example of a route of administration of antisense nucleic acid molecules of the invention include direct injection at a tissue site.
  • antisense nucleic acid molecules can be modified to target selected cells and then administered systemically.
  • antisense molecules can be modified such that they specifically bind to receptors or antigens expressed on a selected cell surface, e.g. , by linking the antisense nucleic acid molecules to peptides or antibodies which bind to cell surface receptors or antigens.
  • the antisense nucleic acid molecules can also be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations ofthe antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol III promoter are preferred.
  • the antisense nucleic acid molecule of the invention is an -anomeric nucleic acid molecule.
  • An ⁇ -anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual -units, the strands run parallel to each other (Gaultier et al. (1987) Nucleic Acids. Res. 15:6625-6641).
  • the antisense nucleic acid molecule can also comprise a 2'-o- methylribonucleotide (Inoue et al. (1987) Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA analogue (Inoue et al. (1987) FEBS Lett. 215:327-330).
  • an antisense nucleic acid ofthe invention is a ribozyme.
  • Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region.
  • ribozymes e.g., hammerhead ribozymes (described in Haselhoff and Gerlach (1988) Nature 334:585-591)) can be used to catalytically cleave hVR-1, hVR-2, and rVR-2 mRNA transcripts to thereby inhibit translation of hVR-1, hVR-2, and rVR-2 mRNA.
  • a ribozyme having specificity for an hVR-1, hVR-2, and rVR-2-encoding nucleic acid can be designed based upon the nucleotide sequence of an hVR-1, hVR-2, and rVR-2 cDNA disclosed herein (i.e., SEQ ID NO:l, 3, 4, 6, 7, 9, 10, or 12).
  • a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in an hVR-1, hVR-2, and rVR- 2-encoding mRNA. See, e.g., Cech et al. U.S. Patent No.
  • hVR-1 , hVR-2, and rVR-2 mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See. for example, Bartel, D. and Szostak, J.W. (1993) Science 261 :141 1-1418.
  • hVR-1, hVR-2, and rVR-2 gene expression can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the hVR-1 , hVR-2, and rVR-2 (e.g. , the hVR- 1 , hVR-2, and rVR-2 promoter and/or enhancers) to form triple helical structures that prevent transcription of the hVR-1, hVR-2, and rVR-2 gene in target cells.
  • nucleotide sequences complementary to the regulatory region of the hVR-1 , hVR-2, and rVR-2 e.g. , the hVR- 1 , hVR-2, and rVR-2 promoter and/or enhancers
  • the hVR-1, hVR-2, and rVR-2 nucleic acid molecules of the present invention can be modified at the base moiety, sugar moiety or phosphate backbone to improve, e.g., the stability, hybridization, or solubility of the molecule.
  • the deoxyribose phosphate backbone ofthe nucleic acid molecules can be modified to generate peptide nucleic acids (see Hyrup B. et al. (1996) Bioorganic & Medicinal Chemistry 4 (1): 5-23).
  • peptide nucleic acids refer to nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained.
  • the neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength.
  • the synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols as described in Hyrup B. et al. (1996) supra; Perry-O'Keefe et al Proc. Natl. Acad. Sci. 93: 14670-675.
  • PNAs of hVR-1, hVR-2, and rVR-2 nucleic acid molecules can be used in therapeutic and diagnostic applications.
  • PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, for example, inducing transcription or translation arrest or inhibiting replication.
  • PNAs of hVR-1, hVR-2, and rVR-2 nucleic acid molecules can also be used in the analysis of single base pair mutations in a gene, (e.g., by PNA-directed PCR clamping); as 'artificial restriction enzymes' when used in combination with other enzymes, (e.g., SI nucleases (Hyrup B. (1996) supra)); or as probes or primers for DNA sequencing or hybridization (Hyrup B. et al. (1996) supra; Perry-O'Keefe supra).
  • PNAs of hVR-1, hVR-2, and rVR-2 can be modified, (e.g., to enhance their stability or cellular uptake), by attaching lipophilic or other helper groups to PNA, by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art.
  • PNA-DNA chimeras of hVR-1, hVR-2, and rVR-2 nucleic acid molecules can be generated which may combine the advantageous properties of PNA and DNA.
  • Such chimeras allow DNA recognition enzymes, (e.g., RNAse H and DNA polymerases), to interact with the DNA portion while the PNA portion would provide high binding affinity and specificity.
  • PNA-DNA chimeras can be linked using linkers of appropriate lengths selected in terms of base stacking, number of bonds between the nucleobases, and orientation (Hyrup B. (1996) supra).
  • the synthesis of PNA-DNA chimeras can be performed as described in Hyrup B. (1996) supra and Finn P.J. et al. (1996) Nucleic Acids Res. 24 (17): 3357-63.
  • a DNA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry and modified nucleoside analogs, e.g., 5'-(4- methoxytrityl)amino-5'-deoxy-thymidine phosphoramidite, can be used as a between the PNA and the 5' end of DNA (Mag, M. et al. (1989) Nucleic Acid Res. 17: 5973-88). PNA monomers are then coupled in a stepwise manner to produce a chimeric molecule with a 5' PNA segment and a 3' DNA segment (Finn P.J. et al. (1996) supra).
  • modified nucleoside analogs e.g., 5'-(4- methoxytrityl)amino-5'-deoxy-thymidine phosphoramidite
  • chimeric molecules can be synthesized with a 5' DNA segment and a 3' PNA segment (Peterser, K.H. et al. ( 1975) Bioorganic Med. Chem. Lett. 5 : 1 119- 11124).
  • the oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al. (1989) Proc. Natl Acad. Sci. USA 86:6553-6556; Lemaitre et al. (1987) Proc. Natl. Acad. Sci.
  • oligonucleotides can be modified with hybridization- triggered cleavage agents (See, e.g., Krol et al. (1988) Bio-Techniques 6:958-976) or intercalating agents. (See, e.g., Zon (1988) Pharm. Res. 5:539-549).
  • the oligonucleotide may be conjugated to another molecule, (e.g., a peptide, hybridization triggered cross-linking agent, transport agent, or hybridization-triggered cleavage agent).
  • One aspect ofthe invention pertains to isolated hVR-1 , hVR-2, and rVR-2 proteins, and biologically active portions thereof, as well as polypeptide fragments suitable for use as immunogens to raise anti-hVR-2, anti-hVR-2, and anti-rVR-2 antibodies.
  • native hVR-1, hVR-2, and rVR-2 proteins can be isolated from cells or tissue sources by an appropriate purification scheme using standard protein purification techniques.
  • hVR-1, hVR-2, and rVR-2 proteins are produced by recombinant DNA techniques.
  • an hVR-1 , hVR-2, and rVR-2 protein or polypeptide can be synthesized chemically using standard peptide synthesis techniques.
  • an “isolated” or “purified” protein or biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the hVR-1, hVR-2, and rVR-2 protein is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized.
  • the language “substantially free of cellular material” includes preparations of hVR-1, hVR-2, and rVR-2 protein in which the protein is separated from cellular components ofthe cells from which it is isolated or recombinantly produced.
  • the language "substantially free of cellular material” includes preparations of hVR-1, hVR-2, and rVR-2 protein having less than about 30% (by dry weight) of non-hVR-1, hVR-2, and rVR-2 protein (also referred to herein as a "contaminating protein"), more preferably less than about 20% of non-hVR-1, hVR-2, and rVR-2 protein, still more preferably less than about 10% of non-hVR-1, hVR-2, and rVR-2 protein, and most preferably less than about 5% non-hVR-1, non-hVR-2, and non-rVR-2 protein.
  • contaminating protein also referred to herein as a "contaminating protein”
  • hVR-1, hVR-2, and rVR-2 protein or biologically active portion thereof is recombinantly produced, it is also preferably substantially free of culture medium, i.e. , culture medium represents less than about 20%, more preferably less than about 10%, and most preferably less than about 5% of the volume of the protein preparation.
  • the language "substantially free of chemical precursors or other chemicals” includes preparations of hVR-1 , hVR-2, and rVR-2 protein in which the protein is separated from chemical precursors or other chemicals which are involved in the synthesis of the protein.
  • the language “substantially free of chemical precursors or other chemicals” includes preparations of hVR-1, hVR-2, and rVR-2 protein having less than about 30% (by dry weight) of chemical precursors or non-hVR-1, hVR-2, and rVR-2 chemicals, more preferably less than about 20% chemical precursors or non-hVR-1 , hVR-2, and rVR-2 chemicals, still more preferably less than about 10% chemical precursors or non-hVR-1, hVR-2, and rVR-2 chemicals, and most preferably less than about 5% chemical precursors or non-hVR-1, hVR-2, and rVR-2 chemicals.
  • a "biologically active portion" of an hVR-1, hVR-2, and rVR-2 protein includes a fragment of an hVR-1, hVR-2, and rVR-2 protein which participates in an interaction between an hVR-1, hVR-2, and rVR-2 molecule and a non-hVR-1, non-hVR-2, and non-rVR-2 molecule, respectively.
  • Biologically active portions of an hVR-1, hVR-2, and rVR-2 protein include peptides comprising amino acid sequences sufficiently homologous to or derived from the amino acid sequence of the hVR-1, hVR- 2, and rVR-2 protein, e.g., the amino acid sequence shown in SEQ ID NO:2, 5, 8, or 11, which include less amino acids than the full length hVR-1, hVR-2, and rVR-2 proteins, and exhibit at least one activity of an hVR-1, hVR-2, and rVR-2 protein.
  • biologically active portions comprise a domain or motif with at least one activity ofthe hVR- 1 , hVR-2, and rVR-2 protein, e.g.
  • a biologically active portion of an hVR- 1, hVR-2, and rVR-2 protein can be a polypeptide which is, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200 or more amino acids in length.
  • Biologically active portions of an hVR-1, hVR-2, and rVR-2 protein can be used as targets for developing agents which modulate an hVR-1, hVR-2, and rVR-2 mediated activity, e.g., a pain signaling mechanism.
  • a biologically active portion of an hVR-1, hVR-2, and rVR- 2 protein comprises at least one transmembrane domain, and/or at least one proline rich domain, and/or at least one ankyrin repeat domain. It is to be understood that a biologically active portion of an hVR- 1 , hVR-2, and rVR-2 protein of the present invention may contain at least one of the above-identified structural domains. A more biologically active portion of an hVR-1, hVR-2, and rVR-2 protein may contain at least two ofthe above-identified structural domains. Moreover, other biologically active portions, in which other regions ofthe protein are deleted, can be prepared by recombinant techniques and evaluated for one or more ofthe functional activities of a native hVR- 1 , hVR-2, and rVR-2 protein.
  • the hVR- 1 , hVR-2. and rVR-2 protein has an amino acid sequence shown in SEQ ID NO:2, 5, 8, or 1 1.
  • the hVR-1, hVR- 2, and rVR-2 protein is substantially homologous to SEQ ID NO:2, 5, 8, or 1 1, and retains the functional activity of the protein of SEQ ID NO:2, 5, 8, or 1 1 , yet differs in amino acid sequence due to natural allelic variation or mutagenesis, as described in detail in subsection I above.
  • the hVR-1, hVR-2, and rVR-2 protein is a protein which comprises an amino acid sequence at least about 60%, 65%, 70%, 75%, 80%, 85%, 87%, 90%, 95%, 98% or more homologous to SEQ ID NO:2, 5, 8, or 11.
  • the sequences are aligned for optimal comparison pu ⁇ oses (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison pu ⁇ oses).
  • the length of a reference sequence aligned for comparison pu ⁇ oses is at least 30%, preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, and even more preferably at least 70%, 80%, or 90%) ofthe length ofthe reference sequence (e.g., when aligning a second sequence to the hVR-1, hVR-2, and rVR-2 amino acid sequence of SEQ ID NO:2, 5, 8, or 11, having 177 amino acid residues, at least 80, preferably at least 100, more preferably at least 120, even more preferably at least 140, and even more preferably at least 150, 160 or 170 amino acid residues are aligned).
  • the length of a reference sequence aligned for comparison pu ⁇ oses is at least 30%, preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, and even more preferably at least 70%, 80%, or 90%) ofthe length ofthe reference sequence (e.g., when aligning a second sequence to the hVR-1, hVR-2,
  • amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared.
  • a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleic acid "identity” is equivalent to amino acid or nucleic acid "homology”).
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment ofthe two sequences.
  • the comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm.
  • the percent identity between two amino acid sequences is determined using the Needleman and Wunsch (J. Mol. Biol. (48):444-453 (1970)) algorithm which has been inco ⁇ orated into the GAP program in the GCG software package (available at http://www.gcg.com), using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.
  • the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (available at http://www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6.
  • the percent identity between two amino acid or nucleotide sequences is determined using the algorithm of E. Meyers and W.
  • the nucleic acid and protein sequences ofthe present invention can further be used as a "query sequence" to perform a search against public databases to, for example, identify other family members or related sequences.
  • search can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10.
  • Gapped BLAST can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25(17):3389-3402.
  • the default parameters of the respective programs e.g. , XBLAST and NBLAST
  • the invention also provides hVR-1, hVR-2, and rVR-2 chimeric or fusion proteins.
  • an hVR-1, hVR-2, and rVR-2 "chimeric protein" or “fusion protein” comprises an hVR-1, hVR-2, and rVR-2 polypeptide operatively linked to a non-hVR- 1 , hVR-2, and rVR-2 polypeptide.
  • hVR- 1 , hVR-2, and rVR-2 polypeptide refers to a polypeptide having an amino acid sequence corresponding to hVR-1, hVR-2, and rVR-2
  • a non-hVR-1, non-hVR-2, and non-rVR-2 polypeptide refers to a polypeptide having an amino acid sequence corresponding to a protein which is not substantially homologous to the hVR-1, hVR-2, and rVR-2 protein, e.g., a protein which is different from the hVR-1, hVR-2, and rVR-2 protein and which is derived from the same or a different organism.
  • an hVR-1, hVR-2, and rVR-2 fusion protein the hVR-1, hVR-2, and rVR-2 polypeptide can correspond to all or a portion of an hVR-1, hVR-2, and rVR-2 protein.
  • an hVR-1, hVR-2, and rVR-2 fusion protein comprises at least one biologically active portion of an hVR-1 , hVR-2, and rVR-2 protein.
  • an hVR- 1 , hVR-2, and rVR-2 fusion protein comprises at least two biologically active portions of an hVR-1, hVR-2, and rVR-2 protein.
  • the term "operatively linked" is intended to indicate that the hVR-1, hVR-2, and rVR-2 polypeptide and the non-hVR-1, non- hVR-2, and non-rVR-2 polypeptide are fused in-frame to each other.
  • the non-hVR-1, hVR-2, and rVR-2 polypeptide can be fused to the N-terminus or C-terminus ofthe hVR-1, hVR-2, and rVR-2 polypeptide.
  • the fusion protein is a GST-hVR-1, GST- hVR-2, and GST-rVR-2 fusion protein in which the hVR-1, hVR-2, and rVR-2 sequences are fused to the C-terminus ofthe GST sequences.
  • Such fusion proteins can facilitate the purification of recombinant hVR- 1 , hVR-2, and rVR-2.
  • the fusion protein is an hVR-1, hVR-2. and rVR-2 protein containing a heterologous signal sequence at its N-terminus.
  • hVR-1, hVR-2, and rVR-2 can be increased through use of a heterologous signal sequence.
  • the hVR-1, hVR-2, and rVR-2 fusion proteins ofthe invention can be inco ⁇ orated into pharmaceutical compositions and administered to a subject in vivo.
  • the hVR-1, hVR-2, and rVR-2 fusion proteins can be used to affect the bioavailability of an hVR-1, hVR-2, and rVR-2 substrate.
  • hVR-1, hVR-2, and rVR-2 fusion proteins may be useful therapeutically for the treatment of disorders caused by, for example, (i) aberrant modification or mutation of a gene encoding an hVR-1, hVR-2, and rVR-2 protein; (ii) mis-regulation of the hVR-1 , hVR-2, and rVR-2 gene; and (iii) aberrant post-translational modification of an hVR-1 , hVR-2, and rVR-2 protein.
  • the hVR-1, hVR-2, and rVR-2-fusion proteins ofthe invention can be used as immunogens to produce anti-hVR-1.
  • anti-hVR-2, and anti-rVR-2 antibodies in a subject, to purify hVR-1, hVR-2, and rVR-2 ligands and in screening assays to identify molecules which inhibit the interaction of hVR-1, hVR-2, and rVR-2 with an hVR-1, hVR-2, and rVR-2 substrate.
  • an hVR-1, hVR-2, and rVR-2 chimeric or fusion protein ofthe invention is produced by standard recombinant DNA techniques.
  • DNA fragments coding for the different polypeptide sequences are ligated together in-frame in accordance with conventional techniques, for example by employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation.
  • the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers.
  • PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al. John Wiley & Sons: 1992).
  • anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence
  • many expression vectors are commercially available that already encode a fusion moiety (e.g., a GST polypeptide).
  • An hVR-1, hVR-2, and rVR-2-encoding nucleic acid can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the hVR-1, hVR-2, and rVR-2 protein.
  • the present invention also pertains to variants of the hVR-1. hVR-2, and rVR-2 proteins which function as either hVR-1, hVR-2, and rVR-2 agonists (mimetics) or as hVR-1, hVR-2, and rVR-2 antagonists.
  • Variants ofthe hVR-1, hVR-2. and rVR-2 proteins can be generated by mutagenesis, e.g. , discrete point mutation or truncation of an hVR-1, hVR-2, and rVR-2 protein.
  • An agonist of the hVR-1, hVR-2, and rVR-2 proteins can retain substantially the same, or a subset, ofthe biological activities of the naturally occurring form of an hVR-1, hVR-2, and rVR-2 protein.
  • An antagonist of an hVR-1, hVR-2, and rVR-2 protein can inhibit one or more of the activities of the naturally occurring form ofthe hVR-1 , hVR-2, and rVR-2 protein by. for example, competitively modulating an hVR-1, hVR-2, and rVR-2-mediated activity of an hVR-1, hVR-2, and rVR-2 protein.
  • specific biological effects can be elicited by treatment with a variant of limited function.
  • treatment of a subject with a variant having a subset ofthe biological activities ofthe naturally occurring form ofthe protein has fewer side effects in a subject relative to treatment with the naturally occurring form ofthe hVR-1, hVR-2, and rVR-2 protein.
  • variants of an hVR-1, hVR-2, and rVR-2 protein which function as either hVR-1, hVR-2, and rVR-2 agonists (mimetics) or as hVR-1, hVR-2, and rVR-2 antagonists can be identified by screening combinatorial libraries of mutants, e.g., truncation mutants, of an hVR-1, hVR-2, and rVR-2 protein for hVR-1, hVR-2, and rVR-2 protein agonist or antagonist activity.
  • a variegated library of hVR-1, hVR-2, and rVR-2 variants is generated by combinatorial mutagenesis at the nucleic acid level and is encoded by a variegated gene library.
  • a variegated library of hVR-1, hVR-2, and rVR-2 variants can be produced by, for example, enzymatically ligating a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential hVR-1, hVR-2, and rVR-2 sequences is expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g., for phage display) containing the set of hVR-1, hVR-2, and rVR-2 sequences therein.
  • libraries of fragments of an hVR-1, hVR-2, and rVR-2 protein coding sequence can be used to generate a variegated population of hVR-1 , hVR-2, and rVR-2 fragments for screening and subsequent selection of variants of an hVR- 1 , hVR- 2, and rVR-2 protein.
  • a library of coding sequence fragments can be generated by treating a double stranded PCR fragment of an hVR-1, hVR-2, and rVR-2 coding sequence with a nuclease under conditions wherein nicking occurs only about once per molecule, denaturing the double stranded DNA, renaturing the DNA to form double stranded DNA which can include sense/anti sense pairs from different nicked products, removing single stranded portions from reformed duplexes by treatment with S 1 nuclease, and ligating the resulting fragment library into an expression vector.
  • an expression library can be derived which encodes N-terminal, C-terminal and internal fragments of various sizes of the hVR-1 , hVR-2, and rVR-2 protein.
  • Recrusive ensemble mutagenesis (REM), a new technique which enhances the frequency of functional mutants in the libraries, can be used in combination with the screening assays to identify hVR-1, hVR- 2, and rVR-2 variants (Arkin and Yourvan (1992) Proc. Natl. Acad. Sci. USA 59:781 1- 7815; Delgrave et al. (1993) Protein Engineering 6(3):327-331).
  • cell based assays can be exploited to analyze a variegated hVR-1, hVR-2, and rVR-2 library.
  • a library of expression vectors can be transfected into a cell line, e.g., a neuronal cell line, which ordinarily responds to a particular ligand in an hVR-1, hVR-2, and rVR-2-dependent manner.
  • the transfected cells are then contacted with the ligand and the effect of expression ofthe mutant on signaling by the ligand can be detected, e.g., by measuring intracellular calcium concentration, neuronal membrane depolarization, or the activity of an hVR-1, hVR-2, and rVR-2-regulated transcription factor.
  • Plasmid DNA can then be recovered from the cells which score for inhibition, or alternatively, potentiation of signaling by the ligand, and the individual clones further characterized.
  • An isolated hVR-1, hVR-2, and rVR-2 protein, or a portion or fragment thereof, can be used as an immunogen to generate antibodies that bind hVR-1, hVR-2, and rVR- 2 using standard techniques for polyclonal and monoclonal antibody preparation.
  • a full-length hVR-1, hVR-2, and rVR-2 protein can be used or, alternatively, the invention provides antigenic peptide fragments of hVR-1, hVR-2, and rVR-2 for use as immunogens.
  • the antigenic peptide of hVR-1, hVR-2, and rVR-2 comprises at least 8 amino acid residues ofthe amino acid sequence shown in SEQ ID NO:2, 5, 8, or 1 1 and encompasses an epitope of hVR-1, hVR-2, and rVR-2 such that an antibody raised against the peptide forms a specific immune complex with hVR-1, hVR-2, and rVR-2.
  • the antigenic peptide comprises at least 10 amino acid residues, more preferably at least 15 amino acid residues, even more preferably at least 20 amino acid residues, and most preferably at least 30 amino acid residues.
  • Epitopes encompassed by the antigenic peptide are regions of hVR-1, hVR-2, and rVR-2 that are located on the surface ofthe protein, e.g., hydrophilic regions, as well as regions with high antigenicity (see, for example, Figures 12 and 14).
  • An hVR-1, hVR-2, and rVR-2 immunogen typically is used to prepare antibodies by immunizing a suitable subject, (e.g., rabbit, goat, mouse or other mammal) with the immunogen.
  • An appropriate immunogenic preparation can contain, for example, recombinantly expressed hVR-1 , hVR-2, and rVR-2 protein or a chemically synthesized hVR-1, hVR-2, and rVR-2 polypeptide.
  • the preparation can further include an adjuvant, such as Freund's complete or incomplete adjuvant, or similar immunostimulatory agent.
  • an adjuvant such as Freund's complete or incomplete adjuvant, or similar immunostimulatory agent.
  • Immunization of a suitable subject with an immunogenic hVR-1, hVR-2, and rVR-2 preparation induces a polyclonal anti-hVR-1, anti-hVR-2, and anti-rVR-2 antibody response.
  • another aspect of the invention pertains to anti-hVR- 1 , anti-hVR-2, and anti-rVR-2 antibodies.
  • antibody refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site which specifically binds (immunoreacts with) an antigen, such as hVR-1, hVR-2, and rVR-2.
  • immunologically active portions of immunoglobulin molecules include F(ab) and
  • F(ab')2 fragments which can be generated by treating the antibody with an enzyme such as pepsin.
  • the invention provides polyclonal and monoclonal antibodies that bind hVR- 1, hVR-2, and rVR-2.
  • the term "monoclonal antibody” or “monoclonal antibody composition”, as used herein, refers to a population of antibody molecules that contain only one species of an antigen binding site capable of immunoreacting with a particular epitope of hVR-1, hVR-2, and rVR-2.
  • a monoclonal antibody composition thus typically displays a single binding affinity for a particular hVR-1, hVR-2, and rVR-2 protein with which it immunoreacts.
  • Polyclonal anti-hVR-1, anti-hVR-2, and anti-rVR-2 antibodies can be prepared as described above by immunizing a suitable subject with an hVR-1, hVR-2, and rVR-2 immunogen.
  • the anti-hVR-1, anti-hVR-2, and anti-rVR-2 antibody titer in the immunized subject can be monitored over time by standard techniques, such as with an enzyme linked immunosorbent assay (ELISA) using immobilized hVR-1, hVR-2, and rVR-2.
  • ELISA enzyme linked immunosorbent assay
  • the antibody molecules directed against hVR-1, hVR-2, and rVR-2 can be isolated from the mammal (e.g.
  • antibody-producing cells can be obtained from the subject and used to prepare monoclonal antibodies by standard techniques, such as the hybridoma technique originally described by Kohler and Milstein (1975) Nature 256:495-497) (see also, Brown et al. (1981) J. Immunol. 127:539-46; Brown et al. (1980) J. Biol. Chem .255:4980-83; Yeh et ⁇ /.
  • an immortal cell line (typically a myeloma) is fused to lymphocytes (typically splenocytes) from a mammal immunized with an hVR-1, hVR-2, and rVR-2 immunogen as described above, and the culture supernatants ofthe resulting hybridoma cells are screened to identify a hybridoma producing a monoclonal antibody that binds hVR-1, hVR-2, and rVR-2. Any ofthe many well known protocols used for fusing lymphocytes and immortalized cell lines can be applied for the pu ⁇ ose of generating an anti-hVR-1, anti- hVR-2.
  • the immortal cell line e.g., a myeloma cell line
  • the lymphocytes e.g., a myeloma cell line
  • murine hybridomas can be made by fusing lymphocytes from a mouse immunized with an immunogenic preparation ofthe present invention with an immortalized mouse cell line
  • immortal cell lines are mouse myeloma cell lines that are sensitive to culture medium containing hypoxanthine, aminopterin and thymidine ("HAT medium").
  • HAT medium culture medium containing hypoxanthine, aminopterin and thymidine
  • Any of a number of myeloma cell lines can be used as a fusion partner according to standard techniques, e.g., the P3-NSl/l-Ag4-l, P3-x63-Ag8.653 or Sp2/O-Agl4 myeloma lines. These myeloma lines are available from ATCC.
  • HAT-sensitive mouse myeloma cells are fused to mouse splenocytes using polyethylene glycol ("PEG").
  • Hybridoma cells resulting from the fusion are then selected using HAT medium, which kills unfused and unproductively fused myeloma cells (unfused splenocytes die after several days because they are not transformed).
  • Hybridoma cells producing a monoclonal antibody ofthe invention are detected by screening the hybridoma culture supernatants for antibodies that bind hVR-1, hVR-2, and rVR-2, e.g., using a standard ELISA assay.
  • a monoclonal anti-hVR-1, anti-hVR-2, and anti-rVR-2 antibody can be identified and isolated by screening a recombinant combinatorial immunoglobulin library (e.g., an antibody phage display library) with hVR-1, hVR-2, and rVR-2 to thereby isolate immunoglobulin library members that bind hVR-1, hVR-2, and rVR-2.
  • Kits for generating and screening phage display libraries are commercially available (e.g., the Pharmacia Recombinant Phage Antibody System, Catalog No. 27-9400-01 ; and the Stratagene SurfZAPTM Phage Display Kit, Catalog No. 240612).
  • examples of methods and reagents particularly amenable for use in generating and screening antibody display library can be found in, for example, Ladner et al. U.S. Patent No. 5,223,409; Kang et al. PCT International Publication No. WO 92/18619; Dower et al. PCT International Publication No. WO 91/17271; Winter et al. PCT International Publication WO 92/20791; Markland et al. PCT International Publication No. WO 92/15679; Breitling et al. PCT International Publication WO 93/01288; McCafferty et al. PCT International Publication No.
  • recombinant anti-hVR-1, anti-hVR-2, and anti-rVR-2 antibodies such as chimeric and humanized monoclonal antibodies, comprising both human and non-human portions, which can be made using standard recombinant DNA techniques, are within the scope ofthe invention.
  • Such chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art, for example using methods described in Robinson et al. International Application No. PCT/US86/02269; Akira, et al. European Patent Application 184,187; Taniguchi, M., European Patent Application 171 ,496; Morrison et al. European Patent Application 173,494; Neuberger et al. PCT International Publication No.
  • An anti-hVR-1, anti-hVR-2, and anti-rVR-2 antibody can be used to isolate hVR-1, hVR-2, and rVR-2 by standard techniques, such as affinity chromatography or immunoprecipitation.
  • An anti-hVR-1, anti-hVR-2, and anti-rVR-2 antibody can facilitate the purification of natural hVR-1, hVR-2, and rVR-2 from cells and of recombinantly produced hVR-1, hVR-2, and rVR-2 expressed in host cells.
  • an anti-hVR-1, anti-hVR-2, and anti-rVR-2 antibody can be used to detect hVR-1, hVR-2, and rVR-2 protein (e.g., in a cellular lysate or cell supernatant) in order to evaluate the abundance and pattern of expression ofthe hVR-1, hVR-2, and rVR-2 protein.
  • Anti-hVR-1, anti-hVR-2, and anti-rVR-2 antibodies can be used diagnostically to monitor protein levels in tissue as part of a clinical testing procedure, e.g., to, for example, determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling (i.e., physically linking) the antibody to a detectable substance.
  • detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials.
  • suitable enzymes include horseradish peroxidase, alkaline phosphatase, -galactosidase, or acetylcholinesterase;
  • suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin;
  • suitable fluorescent materials include umbelliferone, fluorescent, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin;
  • an example of a luminescent material includes luminol;
  • bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include 125 I, 13 I I, 35 S or 3 H.
  • vectors preferably expression vectors, containing a nucleic acid encoding an hVR-1, hVR-2, and rVR-2 protein (or a portion thereof).
  • vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • plasmid refers to a circular double stranded DNA loop into which additional DNA segments can be ligated.
  • viral vector is another type of vector, wherein additional DNA segments can be ligated into the viral genome.
  • vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors).
  • Other vectors e.g., non-episomal mammalian vectors
  • certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "expression vectors”.
  • expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
  • plasmid and "vector” can be used interchangeably as the plasmid is the most commonly used form of vector.
  • the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.
  • viral vectors e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses
  • the recombinant expression vectors ofthe invention comprise a nucleic acid of the invention in a form suitable for expression ofthe nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory sequences, selected on the basis ofthe host cells to be used for expression, which is operatively linked to the nucleic acid sequence to be expressed.
  • "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner which allows for expression ofthe nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).
  • regulatory sequence is intended to include promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cells and those which direct expression ofthe nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, and the like.
  • the expression vectors ofthe invention can be introduced into host cells to thereby produce proteins or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., hVR-1, hVR-2, and rVR-2 proteins, mutant forms of hVR-1, hVR-2, and rVR-2 proteins, fusion proteins, and the like).
  • the recombinant expression vectors ofthe invention can be designed for expression of hVR-1, hVR-2, and rVR-2 proteins in prokaryotic or eukaryotic cells.
  • hVR-1, hVR-2, and rVR-2 proteins can be expressed in bacterial cells such as E.
  • the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
  • Fusion vectors add a number of amino acids to a protein encoded therein, usually to the amino terminus ofthe recombinant protein.
  • Such fusion vectors typically serve three pu ⁇ oses: 1) to increase expression of recombinant protein; 2) to increase the solubility ofthe recombinant protein; and 3) to aid in the purification ofthe recombinant protein by acting as a ligand in affinity purification.
  • a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation ofthe recombinant protein from the fusion moiety subsequent to purification ofthe fusion protein.
  • enzymes, and their cognate recognition sequences include Factor Xa, thrombin and enterokinase.
  • Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith, D.B. and Johnson, K.S.
  • GST glutathione S-transferase
  • Purified fusion proteins can be utilized in hVR-1, hVR-2, and rVR-2 activity assays, (e.g., direct assays or competitive assays described in detail below), or to, for example, generate antibodies specific for hVR-1, hVR-2, and rVR-2 proteins.
  • an hVR- 1 , hVR-2, and rVR-2 fusion protein expressed in a retroviral expression vector ofthe present invention can be utilized to infect bone marrow cells which are subsequently transplanted into irradiated recipients. The pathology ofthe subject recipient is then examined after sufficient time has passed (e.g., six (6) weeks). Examples of suitable inducible non-fusion E.
  • coli expression vectors include pTrc (Amann et al, (1988) Gene 69:301-315) and pET 1 Id (Studier et al., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 60-89).
  • Target gene expression from the pTrc vector relies on host RNA polymerase transcription from a hybrid t ⁇ -lac fusion promoter.
  • Target gene expression from the pET 11 d vector relies on transcription from a T7 gnl 0-lac fusion promoter mediated by a coexpressed viral RNA polymerase (T7 gnl). This viral polymerase is supplied by host strains BL21(DE3) or HMS174(DE3) from a resident prophage harboring a T7 gnl gene under the transcriptional control ofthe lacUV 5 promoter.
  • One strategy to maximize recombinant protein expression in E. coli is to express the protein in a host bacteria with an impaired capacity to proteolytically cleave the recombinant protein (Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 1 19-128).
  • Another strategy is to alter the nucleic acid sequence ofthe nucleic acid to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized in E. coli (Wada et al, (1992) Nucleic Acids Res. 20:211 1-21 18).
  • Such alteration of nucleic acid sequences ofthe invention can be carried out by standard DNA synthesis techniques.
  • the hVR-1, hVR-2, and rVR-2 expression vector is a yeast expression vector.
  • yeast expression vectors for expression in yeast S. cerivisae include pYepSecl (Baldari, et al, (1987) Embo J. 6:229-234), pMFa (Kurjan and Herskowitz,
  • hVR-1, hVR-2, and rVR-2 proteins can be expressed in insect cells using baculovirus expression vectors.
  • Baculovirus vectors available for expression of proteins in cultured insect cells include the pAc series (Smith et al.
  • a nucleic acid ofthe invention is expressed in mammalian cells using a mammalian expression vector.
  • mammalian expression vectors include pCDM8 (Seed, B. (1987) Nature 329:840) and pMT2PC (Kaufman et al. (1987) EMBO J. 6:187-195).
  • the expression vector's control functions are often provided by viral regulatory elements.
  • commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40.
  • suitable expression systems for both prokaryotic and eukaryotic cells see chapters 16 and 17 of Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.
  • the recombinant mammalian expression vector is capable of directing expression ofthe nucleic acid preferentially in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid).
  • tissue-specific regulatory elements are known in the art.
  • suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert et al. (1987) Genes Dev. 1 :268-277), lymphoid-specific promoters (Calame and Eaton (1988) Adv. Immunol. 43:235-275), in particular promoters of T cell receptors (Winoto and Baltimore (1989) EMBO J.
  • promoters are also encompassed, for example the murine hox promoters (Kessel and Gruss (1990) Science 249:374-379) and the ⁇ -fetoprotein promoter (Campes and Tilghman (1989) Genes Dev. 3:537-546).
  • the expression characteristics of an endogenous hVR-1, hVR-2, and rVR-2 gene within a cell line or microorganism may be modified by inserting a heterologous DNA regulatory element into the genome of a stable cell line or cloned microorganism such that the inserted regulatory element is operatively linked with the endogenous hVR-1, hVR-2, and rVR-2 gene.
  • an endogenous hVR-1, hVR-2, and rVR-2 gene which is normally "trancriptionally silent”, i.e., a hVR-1, hVR-2, and rVR-2 gene which is normally not expressed, or is expressed only at very low levels in a cell line or microorganism, may be activated by inserting a regulatory element which is capable of promoting the expression of a normally expressed gene product in that cell line or microorganism.
  • a transcriptionally silent, endogenous hVR-1, hVR-2, and rVR-2 gene may be activated by insertion of a promiscuous regulatory element that works across cell types.
  • a heterologous regulatory element may be inserted into a stable cell line or cloned microorganism, such that it is operatively linked with an endogenous hVR-1, hVR-2, and rVR-2 gene, using techniques, such as targeted homologous recombination, which are well known to those of skill in the art, and described e.g., in Chappel, U.S. Patent No.: 5,272,071; PCT publication No. WO 91/06667, published May 16, 1991.
  • the invention further provides a recombinant expression vector comprising a DNA molecule ofthe invention cloned into the expression vector in an antisense orientation.
  • the DNA molecule is operatively linked to a regulatory sequence in a manner which allows for expression (by transcription ofthe DNA molecule) of an RNA molecule which is antisense to hVR-1, hVR-2, and rVR-2 mRNA.
  • Regulatory sequences operatively linked to a nucleic acid cloned in the antisense orientation can be chosen which direct the continuous expression ofthe antisense RNA molecule in a variety of cell types, for instance viral promoters and/or enhancers, or regulatory sequences can be chosen which direct constitutive, tissue specific or cell type specific expression of antisense RNA.
  • the antisense expression vector can be in the form of a recombinant plasmid, phagemid or attenuated virus in which antisense nucleic acids are produced under the control of a high efficiency regulatory region, the activity of which can be determined by the cell type into which the vector is introduced.
  • a high efficiency regulatory region the activity of which can be determined by the cell type into which the vector is introduced.
  • Another aspect ofthe invention pertains to host cells into which an hVR-1, hVR- 2, and rVR-2 nucleic acid molecule ofthe invention is introduced, e.g., an hVR-1, hVR- 2, and rVR-2 nucleic acid molecule within a recombinant expression vector or an hVR- 1, hVR-2, and rVR-2 nucleic acid molecule containing sequences which allow it to homologously recombine into a specific site ofthe host cell's genome.
  • the terms "host cell” and "recombinant host cell” are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope ofthe term as used herein.
  • a host cell can be any prokaryotic or eukaryotic cell.
  • an hVR-1, hVR-2, and rVR-2 protein can be expressed in bacterial cells such as E. coli, insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells).
  • bacterial cells such as E. coli, insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells).
  • CHO Chinese hamster ovary cells
  • COS cells Chinese hamster ovary cells
  • Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques.
  • transformation and “transfection” are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g. , DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, D ⁇ A ⁇ -dextran-mediated transfection, lipofection, or electroporation.
  • Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989), and other laboratory manuals.
  • a gene that encodes a selectable marker e.g., resistance to antibiotics
  • selectable markers include those which confer resistance to drugs, such as G418, hygromycin and methotrexate.
  • Nucleic acid encoding a selectable marker can be introduced into a host cell on the same vector as that encoding an hVR-1 , hVR-2, and rVR-2 protein or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have inco ⁇ orated the selectable marker gene will survive, while the other cells die).
  • a host cell ofthe invention such as a prokaryotic or eukaryotic host cell in culture, can be used to produce (i.e., express) an hVR-1, hVR-2, and rVR-2 protein.
  • the invention further provides methods for producing an hVR-1, hVR-2, and rVR-2 protein using the host cells ofthe invention.
  • the method comprises culturing the host cell of invention (into which a recombinant expression vector encoding an hVR-1, hVR-2, and rVR-2 protein has been introduced) in a suitable medium such that an hVR-1, hVR-2, and rVR-2 protein is produced.
  • the method further comprises isolating an hVR-1, hVR-2, and rVR-2 protein from the medium or the host cell.
  • the host cells ofthe invention can also be used to produce non- human transgenic animals.
  • a host cell ofthe invention is a fertilized oocyte or an embryonic stem cell into which hVR-1, hVR-2, and rVR-2-coding sequences have been introduced.
  • Such host cells can then be used to create non-human transgenic animals in which exogenous hVR-1, hVR-2, and rVR-2 sequences have been introduced into their genome or homologous recombinant animals in which endogenous hVR-1, hVR-2, and rVR-2 sequences have been altered.
  • transgenic animal is a non-human animal, preferably a mammal, more preferably a rodent such as a rat or mouse, in which one or more ofthe cells ofthe animal includes a transgene.
  • transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, amphibians, and the like.
  • a transgene is exogenous DNA which is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome ofthe mature animal, thereby directing the expression of an encoded gene product in one or more cell types or tissues ofthe transgenic animal.
  • a "homologous recombinant animal” is a non-human animal, preferably a mammal, more preferably a mouse, in which an endogenous hVR-1, hVR-2, and rVR- 2 gene has been altered by homologous recombination between the endogenous gene and an exogenous DNA molecule introduced into a cell ofthe animal, e.g., an embryonic cell ofthe animal, prior to development ofthe animal.
  • a transgenic animal ofthe invention can be created by introducing an hVR-1, hVR-2, and rVR-2-encoding nucleic acid into the male pronuclei of a fertilized oocyte, e.g., by microinjection, retroviral infection, and allowing the oocyte to develop in a pseudopregnant female foster animal.
  • the hVR-1, hVR-2, and rVR-2 cDNA sequence of SEQ ID NO: 1 , 3, 5, 7 or 9 can be introduced as a transgene into the genome of a non- human animal.
  • a nonhuman homologue of a hVR-2 gene such as a mouse or rat hVR-2, e.g., the rVR-2 gene
  • a transgene e.g., the rVR-2 gene
  • an hVR-1, hVR-2, and rVR-2 gene homologue such as another member of the Capsaicin/Vanilloid family, can be isolated based on hybridization to the hVR-1, hVR-2, and rVR-2 cDNA sequences of SEQ ID NO: l, 3, 4, 6, 7, 9, 10, or 12, (described further in subsection I above) and used as a transgene.
  • Intronic sequences and polyadenylation signals can also be included in the transgene to increase the efficiency of expression of the transgene.
  • a tissue-specific regulatory sequence(s) can be operably linked to an hVR-1, hVR-2, and rVR-2 transgene to direct expression of an hVR-1. hVR-2, and rVR- 2 protein to particular cells.
  • Methods for generating transgenic animals via embryo manipulation and microinjection, particularly animals such as mice, have become conventional in the art and are described, for example, in U.S. Patent Nos. 4,736,866 and 4,870,009, both by Leder et al, U.S. Patent No. 4,873,191 by Wagner et al. and in Hogan, B., Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986). Similar methods are used for production of other transgenic animals.
  • a transgenic founder animal can be identified based upon the presence of an hVR- 1 , hVR-2, and rVR-2 transgene in its genome and/or expression of hVR-1, hVR-2, and rVR-2 mRNA in tissues or cells ofthe animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene encoding an hVR- 1 , hVR-2, and rVR-2 protein can further be bred to other transgenic animals carrying other transgenes.
  • a vector is prepared which contains at least a portion of an hVR-1, hVR-2, and rVR-2 gene into which a deletion, addition or substitution has been introduced to thereby alter, e.g., functionally disrupt, the hVR-1, hVR-2, and rVR-2 gene.
  • the VR-1 or VR-2 gene can be a human gene (e.g., the cDNA of SEQ ID NO: 1 , 3, 5, 4, 6, 7, or 9), but more preferably, is a non-human homologue of a hVR-1 and hVR-2 gene (e.g., the cDNA of SEQ ID NO: 10 or 12, or a cDNA isolated by stringent hybridization with the nucleotide sequence of SEQ ID NO: 1, 3, 5, 4, 6, 7, or 9).
  • a mouse VR-2 gene can be used to construct a homologous recombination nucleic acid molecule, e.g., a vector, suitable for altering an endogenous VR-2 gene in the mouse genome.
  • the homologous recombination nucleic acid molecule is designed such that, upon homologous recombination, the endogenous hVR-1, hVR-2, and rVR-2 gene is functionally disrupted (i.e., no longer encodes a functional protein; also referred to as a "knock out" vector).
  • the homologous recombination nucleic acid molecule can be designed such that, upon homologous recombination, the endogenous hVR-1, hVR-2, and rVR-2 gene is mutated or otherwise altered but still encodes functional protein (e.g., the upstream regulatory region can be altered to thereby alter the expression ofthe endogenous hVR-1, hVR-2, and rVR-2 protein).
  • the altered portion ofthe hVR-1, hVR-2, and rVR-2 gene is flanked at its 5' and 3' ends by additional nucleic acid sequence ofthe hVR-1, hVR-2, and rVR-2 gene to allow for homologous recombination to occur between the exogenous hVR-1, hVR-2, and rVR-2 gene carried by the homologous recombination nucleic acid molecule and an endogenous hVR-1, hVR-2, and rVR-2 gene in a cell, e.g., an embryonic stem cell.
  • a cell e.g., an embryonic stem cell.
  • flanking hVR-1, hVR-2, and rVR-2 nucleic acid sequence is of sufficient length for successful homologous recombination with the endogenous gene.
  • flanking DNA both at the 5' and 3' ends
  • flanking DNA are included in the homologous recombination nucleic acid molecule (see, e.g., Thomas, K.R. and Capecchi, M. R. (1987) Cell 51 :503 for a description of homologous recombination vectors).
  • the homologous recombination nucleic acid molecule is introduced into a cell, e.g., an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced hVR-1, hVR-2, and rVR-2 gene has homologously recombined with the endogenous hVR-1, hVR-2, and rVR-2 gene are selected (see e.g., Li, E. et al. (1992) Cell 69:915).
  • the selected cells can then injected into a blastocyst of an animal (e.g., a mouse) to form aggregation chimeras (see e.g., Bradley, A.
  • a chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term.
  • Progeny harboring the homologously recombined DNA in their germ cells can be used to breed animals in which all cells ofthe animal contain the homologously recombined DNA by germline transmission ofthe transgene.
  • Methods for constructing homologous recombination nucleic acid molecules, e.g. , vectors, or homologous recombinant animals are described further in Bradley, A.
  • transgenic non-humans animals can be produced which contain selected systems which allow for regulated expression ofthe transgene.
  • a system is the cre/loxP recombinase system of bacteriophage P 1.
  • the cre/loxP recombinase system see, e.g., Lakso et al. (1992) Proc. Natl. Acad. Sci. USA 89:6232-6236.
  • Another example of a recombinase system is the FLP recombinase system of Saccharomyces cerevisiae (O'Gorman et al. (1991) Science 251 :1351-1355.
  • a cre/loxP recombinase system is used to regulate expression ofthe transgene
  • animals containing transgenes encoding both the Cre recombinase and a selected protein are required.
  • Such animals can be provided through the construction of "double" transgenic animals, e.g., by mating two transgenic animals, one containing a transgene encoding a selected protein and the other containing a transgene encoding a recombinase.
  • Clones ofthe non-human transgenic animals described herein can also be produced according to the methods described in Wilmut, I. et al. (1997) Nature 385:810- 813 and PCT International Publication Nos. WO 97/07668 and WO 97/07669.
  • a cell e.g., a somatic cell
  • the quiescent cell can then be fused, e.g., through the use of electrical pulses, to an enucleated oocyte from an animal ofthe same species from which the quiescent cell is isolated.
  • the recontructed oocyte is then cultured such that it develops to morula or blastocyte and then transferred to pseudopregnant female foster animal.
  • the offspring borne of this female foster animal will be a clone ofthe animal from which the cell, e.g., the somatic cell, is isolated.
  • compositions suitable for administration can be inco ⁇ orated into pharmaceutical compositions suitable for administration.
  • Such compositions typically comprise the nucleic acid molecule, protein, or antibody and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and abso ⁇ tion delaying agents, and the like, compatible with pharmaceutical administration.
  • a pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration.
  • routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration.
  • Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • the parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
  • compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS).
  • the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance ofthe required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition.
  • Prolonged abso ⁇ tion ofthe injectable compositions can be brought about by including in the composition an agent which delays abso ⁇ tion, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions can be prepared by inco ⁇ orating the active compound (e.g., a fragment of an hVR-1, hVR-2, and rVR-2 protein or an anti-hVR-1, anti-hVR-2, and anti-rVR-2 antibody) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • the active compound e.g., a fragment of an hVR-1, hVR-2, and rVR-2 protein or an anti-hVR-1, anti-hVR-2, and anti-rVR-2 antibody
  • dispersions are prepared by inco ⁇ orating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • the methods of preparation are vacuum drying and freeze-drying which yields a powder ofthe active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the pu ⁇ ose of oral therapeutic administration, the active compound can be inco ⁇ orated with excipients and used in the form of tablets, troches, or capsules, oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part ofthe composition.
  • the tablets, pills, capsules, troches and the like can contain any ofthe following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
  • a suitable propellant e.g., a gas such as carbon dioxide, or a nebulizer.
  • Systemic administration can also be by transmucosal or transdermal means.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.
  • Transmucosal administration can be accomplished through the use of nasal sprays or suppositories.
  • the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
  • the compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
  • suppositories e.g., with conventional suppository bases such as cocoa butter and other glycerides
  • retention enemas for rectal delivery.
  • the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • a controlled release formulation including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Co ⁇ oration and Nova
  • Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811. It is especially advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage.
  • Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% ofthe population) and the ED50 (the dose therapeutically effective in 50% ofthe population).
  • the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50.
  • Compounds which exhibit large therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
  • the data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans.
  • the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity.
  • the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
  • the therapeutically effective dose can be estimated initially from cell culture assays.
  • a dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans.
  • a therapeutically effective amount of protein or polypeptide ranges from about 0.001 to 30 mg/kg body weight, preferably about 0.01 to 25 mg/kg body weight, more preferably about 0.1 to 20 mg/kg body weight, and even more preferably about 1 to 10 mg/kg, 2 to 9 mg/kg, 3 to 8 mg/kg, 4 to 7 mg/kg, or 5 to 6 mg/kg body weight.
  • an effective dosage ranges from about 0.001 to 30 mg/kg body weight, preferably about 0.01 to 25 mg/kg body weight, more preferably about 0.1 to 20 mg/kg body weight, and even more preferably about 1 to 10 mg/kg, 2 to 9 mg/kg, 3 to 8 mg/kg, 4 to 7 mg/kg, or 5 to 6 mg/kg body weight.
  • an effective dosage ranges from about 0.001 to 30 mg/kg body weight, preferably about 0.01 to 25 mg/kg body weight, more preferably about 0.1 to 20 mg/kg body weight, and even more preferably about 1 to 10 mg/kg, 2 to 9 mg/
  • treatment of a subject with a therapeutically effective amount of a protein, polypeptide, or antibody can include a single treatment or, preferably, can include a series of treatments.
  • a subject is treated with antibody, protein, or polypeptide in the range of between about 0.1 to 20 mg/kg body weight, one time per week for between about 1 to 10 weeks, preferably between 2 to 8 weeks, more preferably between about 3 to 7 weeks, and even more preferably for about 4, 5, or 6 weeks.
  • the effective dosage of antibody, protein, or polypeptide used for treatment may increase or decrease over the course of a particular treatment. Changes in dosage may result and become apparent from the results of diagnostic assays as described herein.
  • the present invention encompasses agents which modulate expression or activity.
  • An agent may, for example, be a small molecule.
  • small molecules include, but are not limited to, peptides, peptidomimetics, amino acids, amino acid analogs, polynucleotides, polynucleotide analogs, nucleotides, nucleotide analogs, organic or inorganic compounds (i.e,.
  • heteroorganic and organometallic compounds having a molecular weight less than about 10,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 5,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 1,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 500 grams per mole, and salts, esters, and other pharmaceutically acceptable forms of such compounds.
  • doses of small molecule agents depends upon a number of factors within the ken ofthe ordinarily skilled physician, veterinarian, or researcher.
  • the dose(s) ofthe small molecule will vary, for example, depending upon the identity, size, and condition ofthe subject or sample being treated, further depending upon the route by which the composition is to be administered, if applicable, and the effect which the practitioner desires the small molecule to have upon the nucleic acid or polypeptide of the invention.
  • Exemplary doses include milligram or microgram amounts ofthe small molecule per kilogram of subject or sample weight (e.g., about 1 microgram per kilogram to about 500 milligrams per kilogram, about 100 micrograms per kilogram to about 5 milligrams per kilogram, or about 1 microgram per kilogram to about 50 micrograms per kilogram. It is furthermore understood that appropriate doses of a small molecule depend upon the potency ofthe small molecule with respect to the expression or activity to be modulated. Such appropriate doses may be determined using the assays described herein.
  • a physician, veterinarian, or researcher may, for example, prescribe a relatively low dose at first, subsequently increasing the dose until an appropriate response is obtained.
  • the specific dose level for any particular animal subject will depend upon a variety of factors including the activity ofthe specific compound employed, the age, body weight, general health, gender, and diet ofthe subject, the time of administration, the route of administration, the rate of excretion, any drug combination, and the degree of expression or activity to be modulated.
  • the nucleic acid molecules ofthe invention can be inserted into vectors and used as gene therapy vectors.
  • Gene therapy vectors can be delivered to a subject by, for example, intravenous injection, local administration (see U.S. Patent 5,328,470) or by stereotactic injection (see e.g., Chen et ⁇ l. (1994) Proc. N ⁇ tl. Ac ⁇ d. Sci. USA 91 :3054- 3057).
  • the pharmaceutical preparation ofthe gene therapy vector can include the gene therapy vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded.
  • the pharmaceutical preparation can include one or more cells which produce the gene delivery system.
  • the pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.
  • nucleic acid molecules, proteins, protein homologues, and antibodies described herein can be used in one or more ofthe following methods: a) screening assays; b) predictive medicine (e.g., diagnostic assays, prognostic assays, monitoring clinical trials, and pharmacogenetics); and c) methods of treatment (e.g., therapeutic and prophylactic).
  • a) screening assays e.g., a) screening assays; b) predictive medicine (e.g., diagnostic assays, prognostic assays, monitoring clinical trials, and pharmacogenetics); and c) methods of treatment (e.g., therapeutic and prophylactic).
  • an hVR-1, hVR-2, and rVR-2 protein ofthe invention has one or more of the following activities: ( 1 ) it interacts with a non-hVR- 1 , non-hVR-2, and non-rVR-2 protein molecule, e.g.
  • a vanilloid compound such as capsaicin; (2) it modulates intracellular calcium concentration; (3) it activates an hVR- 1, hVR-2, and rVR-2-dependent signal transduction pathway; and (4) it modulates a pain signaling mechanism, and, thus, can be used to, for example, (1) modulate the interaction with a non-hVR-1, non-hVR-2, and non-rVR-2 protein molecule; (2) modulate intracellular calcium concentration; (3) activate an hVR-1, hVR-2, and rVR- 2-dependent signal transduction pathway; and (4) modulate a pain signaling mechanism.
  • the isolated nucleic acid molecules ofthe invention can be used, for example, to express hVR-1, hVR-2, and rVR-2 protein (e.g., via a recombinant expression vector in a host cell in gene therapy applications), to detect hVR-1, hVR-2, and rVR-2 mRNA (e.g., in a biological sample) or a genetic alteration in an hVR-1, hVR-2, and rVR-2 gene, and to modulate hVR-1, hVR-2, and rVR-2 activity, as described further below.
  • hVR-1, hVR-2, and rVR-2 protein e.g., via a recombinant expression vector in a host cell in gene therapy applications
  • detect hVR-1, hVR-2, and rVR-2 mRNA e.g., in a biological sample
  • a genetic alteration in an hVR-1, hVR-2, and rVR-2 gene e.g., in a biological
  • the hVR-1, hVR-2, and rVR-2 proteins can be used to screen for naturally occurring hVR-1, hVR-2, and rVR-2 substrates, to screen for drugs or compounds which modulate hVR-1, hVR-2, and rVR-2 activity, as well as to treat disorders characterized by insufficient or excessive production of hVR-1, hVR-2, and rVR-2 protein or production of hVR-1, hVR-2, and rVR-2 protein forms which have decreased or aberrant activity compared to hVR-1, hVR-2, and rVR-2 wild type protein (e.g., pain disorders).
  • hVR-1, hVR-2, and rVR-2 proteins can be used to screen for naturally occurring hVR-1, hVR-2, and rVR-2 substrates, to screen for drugs or compounds which modulate hVR-1, hVR-2, and rVR-2 activity, as well as to treat disorders characterized by insufficient or excessive production of hVR-1, hVR-2, and
  • anti-hVR-1, anti-hVR-2, and anti-rVR-2 antibodies ofthe invention can be used to detect and isolate hVR- 1 , hVR-2, and rVR-2 proteins, regulate the bioavailability of hVR-1, hVR-2, and rVR-2 proteins, and modulate hVR-1, hVR-2, and rVR-2 activity.
  • the invention provides a method (also referred to herein as a "screening assay") for identifying modulators, i.e., candidate or test compounds or agents (e.g., peptides, peptidomimetics, small molecules or other drugs) which bind to hVR-1, hVR-2, and rVR-2 proteins, have a stimulatory or inhibitory effect on, for example, hVR-1, hVR-2, and rVR-2 expression or hVR-1, hVR-2, and rVR-2 activity, or have a stimulatory or inhibitory effect on, for example, the expression or activity of hVR-1, hVR-2, and rVR- 2 substrate.
  • modulators i.e., candidate or test compounds or agents (e.g., peptides, peptidomimetics, small molecules or other drugs) which bind to hVR-1, hVR-2, and rVR-2 proteins, have a stimulatory or inhibitory effect on, for example, hVR-1, hVR
  • the invention provides assays for screening candidate or test compounds which are substrates of an hVR-1, hVR-2, and rVR-2 protein or polypeptide or biologically active portion thereof.
  • the invention provides assays for screening candidate or test compounds which bind to or modulate the activity of an hVR-1, hVR-2, and rVR-2 protein or polypeptide or biologically active portion thereof.
  • the test compounds ofthe present invention can be obtained using any ofthe numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the 'one-bead one-compound' library method; and synthetic library methods using affinity chromatography selection.
  • the biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, K.S. (1997) Anticancer Drug Des. 12:145).
  • Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al. (1993) Proc. Natl. Acad. Sci. U.S.A. 90:6909; Erb et al. (1994) Proc. Natl. Acad. Sci. USA 91 :11422; Zuckermann et ⁇ /. (1994). J. Med. Chem. 37:2678; Cho et al.
  • an assay is a cell-based assay in which a cell, e.g., a neuronal cell, which expresses an hVR-1, hVR-2, and rVR-2 protein or biologically active portion thereof is contacted with a test compound and the ability ofthe test compound to modulate hVR- 1 , hVR-2, and rVR-2 activity is determined. Determining the ability ofthe test compound to modulate hVR-1, hVR-2, and rVR-2 activity can be accomplished by monitoring, for example, intracellular calcium concentration or membrane depolarization by, e.g. , patch-clamp recordings in whole-cell, inside-out, and outside-out configurations (as described in, for example, Tominaga M.
  • Determining the ability ofthe test compound to modulate hVR-1, hVR-2, and rVR-2 activity can further be accomplished by monitoring the activity of an hVR-1, hVR-2, and rVR-2-regulated transcription factor.
  • the cell for example, can be of mammalian origin, e.g., a neuronal cell.
  • the ability of the test compound to modulate hVR- 1 , hVR-2, and rVR-2 binding to a substrate or to bind to hVR- 1 , hVR-2, and rVR-2 can also be determined.
  • Determining the ability ofthe test compound to modulate hVR-1, hVR-2, and rVR-2 binding to a substrate can be accomplished, for example, by coupling the hVR-1, hVR- 2, and rVR-2 substrate with a radioisotope or enzymatic label such that binding ofthe hVR- 1 , hVR-2, and rVR-2 substrate to hVR- 1 , hVR-2, and rVR-2 can be determined by detecting the labeled hVR-1, hVR-2, and rVR-2 substrate in a complex.
  • Determining the ability ofthe test compound to bind hVR-1, hVR-2, and rVR-2 can be accomplished, for example, by coupling the compound with a radioisotope or enzymatic label such that binding ofthe compound to hVR-1, hVR-2, and rVR-2 can be determined by detecting the labeled hVR-l, hVR-2, and rVR-2 compound in a complex.
  • compounds e.g., hVR-1, hVR-2, and rVR-2 substrates
  • compounds can be enzymatically labeled with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determination of conversion of an appropriate substrate to product.
  • a compound e.g., an hVR-1, hVR-2, and rVR-2 substrate
  • a microphysiometer can be used to detect the interaction of a compound with hVR-1, hVR-2, and rVR-2 without the labeling of either the compound or the hVR- 1 , hVR-2, and rVR-2. McConnell, H. M. et al. (1992) Science 257:1906-1912.
  • a "microphysiometer” e.g., Cytosensor
  • LAPS light-addressable potentiometric sensor
  • an assay ofthe present invention is a cell-free assay in which an hVR-1, hVR-2, and rVR-2 protein or biologically active portion thereof is contacted with a test compound and the ability ofthe test compound to bind to the hVR- 1 , hVR-2, and rVR-2 protein or biologically active portion thereof is determined.
  • biologically active portions ofthe hVR-1, hVR-2, and rVR-2 proteins to be used in assays ofthe present invention include fragments which participate in interactions with non-hVR-1, non-hVR-2, and non-rVR-2 molecules, e.g., fragments with high surface probability scores.
  • Binding ofthe test compound to the hVR-1, hVR-2, and rVR-2 protein can be determined either directly or indirectly as described above.
  • the assay includes contacting the hVR-1 , hVR-2, and rVR-2 protein or biologically active portion thereof with a known compound which binds hVR-1, hVR-2, and rVR-2 to form an assay mixture, contacting the assay mixture with a test compound, and determining the ability ofthe test compound to interact with an hVR-1, hVR-2, and rVR-2 protein, wherein determining the ability ofthe test compound to interact with an hVR-1, hVR-2, and rVR-2 protein comprises determining the ability ofthe test compound to preferentially bind to hVR-1, hVR-2, and rVR-2 or biologically active portion thereof as compared to the known compound.
  • the assay is a cell-free assay in which an hVR-1, hVR-2, and rVR-2 protein or biologically active portion thereof is contacted with a test compound and the ability ofthe test compound to modulate (e.g., stimulate or inhibit) the activity ofthe hVR-1, hVR-2, and rVR-2 protein or biologically active portion thereof is determined.
  • Determining the ability ofthe test compound to modulate the activity of an hVR-1, hVR-2, and rVR-2 protein can be accomplished, for example, by determining the ability ofthe hVR-1, hVR-2, and rVR-2 protein to bind to an hVR-1, hVR-2, and rVR-2 target molecule, e.g.
  • a vanilloid compound such as capsaicin, by one ofthe methods described above for determining direct binding. Determining the ability ofthe hVR-1, hVR-2, and rVR-2 protein to bind to an hVR-1, hVR-2, and rVR-2 target molecule can also be accomplished using a technology such as real-time Biomolecular Interaction Analysis (BIA). Sjolander, S. and Urbaniczky, C. (1991) Anal. Chem. 63:2338-2345 and Szabo et al. (1995) Curr. Opin. Struct. Biol. 5:699-705.
  • BIOA Biomolecular Interaction Analysis
  • BIA is a technology for studying biospecific interactions in real time, without labeling any ofthe interactants (e.g., BIAcore). Changes in the optical phenomenon of surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
  • determining the ability ofthe test compound to modulate the activity of an hVR-1, hVR-2, and rVR-2 protein can be accomplished by determining the ability ofthe hVR-1, hVR-2, and rVR-2 protein to further modulate the activity of a downstream effector of an hVR-1, hVR-2, and rVR-2 target molecule. For example, the activity ofthe effector molecule on an appropriate target can be determined or the binding ofthe effector to an appropriate target can be determined as previously described.
  • the cell-free assay involves contacting an hVR-1, hVR-2, and rVR-2 protein or biologically active portion thereof with a known compound which binds the hVR-1, hVR-2, and rVR-2 protein to form an assay mixture, contacting the assay mixture with a test compound, and determining the ability ofthe test compound to interact with the hVR-1, hVR-2, and rVR-2 protein, wherein determining the ability ofthe test compound to interact with the hVR-1, hVR-2, and rVR-2 protein comprises determining the ability ofthe hVR-1, hVR-2, and rVR-2 protein to preferentially bind to or modulate the activity of an hVR-1, hVR-2, and rVR-2 target molecule.
  • the cell-free assays ofthe present invention are amenable to use of both soluble and or membrane-bound forms of isolated proteins (e.g., hVR-1, hVR-2, and rVR-2 proteins or biologically active portions thereof).
  • isolated proteins e.g., hVR-1, hVR-2, and rVR-2 proteins or biologically active portions thereof.
  • a solubilizing agent such that the membrane-bound form ofthe isolated protein is maintained in solution.
  • non-ionic detergents such as n-oc
  • binding of a test compound to an hVR-1, hVR-2, and rVR-2 protein, or interaction of an hVR-1, hVR-2, and rVR-2 protein with a target molecule in the presence and absence of a candidate compound can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtitre plates, test tubes, and micro- centrifuge tubes.
  • a fusion protein can be provided which adds a domain that allows one or both ofthe proteins to be bound to a matrix.
  • glutathione-S-transferase/ hVR-1, hVR-2, and rVR-2 fusion proteins or glutathione-S- transferase/target fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St.
  • the test compound or the test compound and either the non-adsorbed target protein or hVR-1, hVR-2, and rVR-2 protein, and the mixture incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH).
  • conditions conducive to complex formation e.g., at physiological conditions for salt and pH.
  • the beads or microtitre plate wells are washed to remove any unbound components, the matrix immobilized in the case of beads, complex determined either directly or indirectly, for example, as described above.
  • the complexes can be dissociated from the matrix, and the level of hVR-1, hVR-2, and rVR-2 binding or activity determined using standard techniques.
  • an hVR-1, hVR-2, and rVR-2 protein or an hVR-1, hVR-2, and rVR-2 target molecule can be immobilized utilizing conjugation of biotin and streptavidin.
  • Biotinylated hVR-1, hVR-2, and rVR-2 protein or target molecules can be prepared from biotin-NHS (N-hydroxy-succinimide) using techniques known in the art (e.g. , biotinylation kit, Pierce Chemicals, Rockford, IL), and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).
  • antibodies reactive with hVR-1, hVR-2, and rVR-2 protein or target molecules but which do not interfere with binding of the hVR- 1 , hVR-2, and rVR-2 protein to its target molecule can be derivatized to the wells ofthe plate, and unbound target or hVR-1, hVR-2, and rVR-2 protein trapped in the wells by antibody conjugation.
  • Methods for detecting such complexes include immunodetection of complexes using antibodies reactive with the hVR-1 , hVR-2, and rVR-2 protein or target molecule, as well as enzyme-linked assays which rely on detecting an enzymatic activity associated with the hVR-1, hVR-2, and rVR-2 protein or target molecule.
  • modulators of hVR-1, hVR-2, and rVR-2 expression are identified in a method wherein a cell is contacted with a candidate compound and the expression of hVR-1, hVR-2, and rVR-2 mRNA or protein in the cell is determined.
  • the level of expression of hVR-1, hVR-2, and rVR-2 mRNA or protein in the presence ofthe candidate compound is compared to the level of expression of hVR-1, hVR-2, and rVR-2 mRNA or protein in the absence ofthe candidate compound.
  • the candidate compound can then be identified as a modulator of hVR-1, hVR-2, and rVR-2 expression based on this comparison.
  • the candidate compound when expression of hVR-1, hVR-2, and rVR-2 mRNA or protein is greater (statistically significantly greater) in the presence of the candidate compound than in its absence, the candidate compound is identified as a stimulator of hVR-1 , hVR-2, and rVR-2 mRNA or protein expression.
  • the candidate compound when expression of hVR-1, hVR-2, and rVR-2 mRNA or protein is less (statistically significantly less) in the presence ofthe candidate compound than in its absence, the candidate compound is identified as an inhibitor of hVR-1, hVR-2, and rVR-2 mRNA or protein expression.
  • the level of hVR-1, hVR-2, and rVR-2 mRNA or protein expression in the cells can be determined by methods described herein for detecting hVR-1, hVR-2, and rVR-2 mRNA or protein.
  • the hVR-1, hVR-2, and rVR-2 proteins can be used as "bait proteins" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent No. 5,283,317; Zervos et al. (1993) Cell 72:223-232; Madura et al. (1993) J. Biol. Chem. 268:12046-12054; Bartel et ⁇ /. (1993) Biotechniques 14:920-924; Iwabuchi et al.
  • Such hVR-1, hVR-2, and rVR-2-binding proteins are also likely to be involved in the propagation of signals by the hVR-1, hVR-2, and rVR-2 proteins or hVR-1, hVR-2, and rVR-2 targets as, for example, downstream elements of an hVR-1, hVR-2, and rVR-2- mediated signaling pathway, e.g. , a pain signaling pathway.
  • hVR-1 , hVR-2, and rVR-2-binding proteins are likely to be hVR-1, hVR-2, and rVR-2 inhibitors.
  • the two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains.
  • the assay utilizes two different DNA constructs.
  • the gene that codes for an hVR-1, hVR-2, and rVR-2 protein is fused to a gene encoding the DNA binding domain of a known transcription factor (e.g., GAL-4).
  • a DNA sequence, from a library of DNA sequences, that encodes an unidentified protein (“prey" or "sample”) is fused to a gene that codes for the activation domain ofthe known transcription factor.
  • the DNA-binding and activation domains ofthe transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ) which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression ofthe reporter gene can be detected and cell colonies containing the functional transcription factor can be isolated and used to obtain the cloned gene which encodes the protein which interacts with the hVR-1, hVR-2, and rVR-2 protein.
  • a reporter gene e.g., LacZ
  • This invention further pertains to novel agents identified by the above-described screening assays. Accordingly, it is within the scope of this invention to further use an agent identified as described herein in an appropriate animal model.
  • an agent identified as described herein e.g. , an hVR- 1 , hVR-2, and rVR-2 modulating agent, an antisense hVR-1, hVR-2, and rVR-2 nucleic acid molecule, an hVR-1, hVR-2, and rVR-2-specific antibody, or an hVR-1, hVR-2, and rVR-2-binding partner
  • an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent.
  • this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein.
  • cDNA sequences identified herein can be used in numerous ways as polynucleotide reagents. For example, these sequences can be used to: (i) map their respective genes on a chromosome; and, thus, locate gene regions associated with genetic disease; (ii) identify an individual from a minute biological sample (tissue typing); and (iii) aid in forensic identification of a biological sample. These applications are described in the subsections below.
  • this sequence can be used to map the location ofthe gene on a chromosome. This process is called chromosome mapping. Accordingly, portions or fragments ofthe hVR-1 , hVR-2, and rVR-2 nucleotide sequences, described herein, can be used to map the location of the hVR-1, hVR-2, and rVR-2 genes on a chromosome. The mapping ofthe hVR-1, hVR-2, and rVR-2 sequences to chromosomes is an important first step in correlating these sequences with genes associated with disease.
  • hVR-1 , hVR-2, and rVR-2 genes can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp in length) from the hVR-1, hVR-2, and rVR-2 nucleotide sequences.
  • Computer analysis ofthe hVR-1, hVR-2, and rVR-2 sequences can be used to predict primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process.
  • These primers can then be used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the hVR-1. hVR-2, and rVR-2 sequences will yield an amplified fragment.
  • Somatic cell hybrids are prepared by fusing somatic cells from different mammals (e.g., human and mouse cells). As hybrids of human and mouse cells grow and divide, they gradually lose human chromosomes in random order, but retain the mouse chromosomes. By using media in which mouse cells cannot grow, because they lack a particular enzyme, but human cells can, the one human chromosome that contains the gene encoding the needed enzyme, will be retained. By using various media, panels of hybrid cell lines can be established. Each cell line in a panel contains either a single human chromosome or a small number of human chromosomes, and a full set of mouse chromosomes, allowing easy mapping of individual genes to specific human chromosomes. (D'Eustachio P.
  • Somatic cell hybrids containing only fragments of human chromosomes can also be produced by using human chromosomes with translocations and deletions.
  • PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular sequence to a particular chromosome. Three or more sequences can be assigned per day using a single thermal cycler.
  • hVR-1, hVR-2, and rVR-2 nucleotide sequences to design oligonucleotide primers sublocalization can be achieved with panels of fragments from specific chromosomes.
  • mapping strategies which can similarly be used to map an hVR-1 , hVR-2, and rVR-2 sequence to its chromosome include in situ hybridization (described in Fan, Y. et al. (1990) Proc. Natl. Acad. Sci. USA, 87:6223-27), pre-screening with labeled flow-sorted chromosomes, and preselection by hybridization to chromosome specific cDNA libraries.
  • Fluorescence in situ hybridization (FISH) of a DNA sequence to a metaphase chromosomal spread can further be used to provide a precise chromosomal location in one step.
  • Chromosome spreads can be made using cells whose division has been blocked in metaphase by a chemical such as colcemid that disrupts the mitotic spindle.
  • the chromosomes can be treated briefly with trypsin, and then stained with Giemsa. A pattern of light and dark bands develops on each chromosome, so that the chromosomes can be identified individually.
  • the FISH technique can be used with a DNA sequence as short as 500 or 600 bases.
  • clones larger than 1,000 bases have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection.
  • Reagents for chromosome mapping can be used individually to mark a single chromosome or a single site on that chromosome, or panels of reagents can be used for marking multiple sites and/or multiple chromosomes. Reagents corresponding to noncoding regions ofthe genes actually are for mapping pu ⁇ oses. Coding sequences are more likely to be conserved within gene families, thus increasing the chance of cross hybridizations during chromosomal mapping.
  • differences in the DNA sequences between individuals affected and unaffected with a disease associated with the hVR-1, hVR-2, and rVR-2 gene can be determined. If a mutation is observed in some or all ofthe affected individuals but not in any unaffected individuals, then the mutation is likely to be the causative agent ofthe particular disease. Comparison of affected and unaffected individuals generally involves first looking for structural alterations in the chromosomes, such as deletions or translocations that are visible from chromosome spreads or detectable using PCR based on that DNA sequence. Ultimately, complete sequencing of genes from several individuals can be performed to confirm the presence of a mutation and to distinguish mutations from polymo ⁇ hisms.
  • the hVR-1, hVR-2, and rVR-2 sequences ofthe present invention can also be used to identify individuals from minute biological samples.
  • the United States military, for example, is considering the use of restriction fragment length polymo ⁇ hism (RFLP) for identification of its personnel.
  • RFLP restriction fragment length polymo ⁇ hism
  • an individual's genomic DNA is digested with one or more restriction enzymes, and probed on a Southern blot to yield unique bands for identification. This method does not suffer from the current limitations of "Dog Tags" which can be lost, switched, or stolen, making positive identification difficult.
  • the sequences ofthe present invention are useful as additional DNA markers for RFLP (described in U.S. Patent 5,272,057).
  • sequences ofthe present invention can be used to provide an alternative technique which determines the actual base-by-base DNA sequence of selected portions of an individual's genome.
  • the hVR-1, hVR-2, and rVR-2 nucleotide sequences described herein can be used to prepare two PCR primers from the 5' and 3' ends ofthe sequences. These primers can then be used to amplify an individual's DNA and subsequently sequence it. Panels of corresponding DNA sequences from individuals, prepared in this manner, can provide unique individual identifications, as each individual will have a unique set of such DNA sequences due to allelic differences.
  • the sequences ofthe present invention can be used to obtain such identification sequences from individuals and from tissue.
  • the hVR-1 , hVR-2, and rVR-2 nucleotide sequences ofthe invention uniquely represent portions ofthe human genome. Allelic variation occurs to some degree in the coding regions of these sequences, and to a greater degree in the noncoding regions. It is estimated that allelic variation between individual humans occurs with a frequency of about once per each 500 bases.
  • Each ofthe sequences described herein can, to some degree, be used as a standard against which DNA from an individual can be compared for identification pu ⁇ oses. Because greater numbers of polymo ⁇ hisms occur in the noncoding regions, fewer sequences are necessary to differentiate individuals.
  • a panel of reagents from hVR-1, hVR-2, and rVR-2 nucleotide sequences described herein is used to generate a unique identification database for an individual, those same reagents can later be used to identify tissue from that individual.
  • Using the unique identification database positive identification ofthe individual, living or dead, can be made from extremely small tissue samples.
  • DNA-based identification techniques can also be used in forensic biology.
  • Forensic biology is a scientific field employing genetic typing of biological evidence found at a crime scene as a means for positively identifying, for example, a pe ⁇ etrator of a crime.
  • PCR technology can be used to amplify DNA sequences taken from very small biological samples such as tissues, e.g., hair or skin, or body fluids, e.g., blood, saliva, or semen found at a crime scene. The amplified sequence can then be compared to a standard, thereby allowing identification ofthe origin ofthe biological sample.
  • sequences ofthe present invention can be used to provide polynucleotide reagents, e.g., PCR primers, targeted to specific loci in the human genome, which can enhance the reliability of DNA-based forensic identifications by, for example, providing another "identification marker" (i.e. another DNA sequence that is unique to a particular individual).
  • another "identification marker” i.e. another DNA sequence that is unique to a particular individual.
  • actual base sequence information can be used for identification as an accurate alternative to patterns formed by restriction enzyme generated fragments.
  • polynucleotide reagents include the hVR-1, hVR-2, and rVR-2 nucleotide sequences or portions thereof, e.g., fragments derived from SEQ ID NO:l, 3, 4, 6, 7, 9, 10, or 11 having a length of at least 20 bases, preferably at least 30 bases.
  • the hVR-1, hVR-2, and rVR-2 nucleotide sequences described herein can further be used to provide polynucleotide reagents, e.g., labeled or labelable probes which can be used in, for example, an in situ hybridization technique, to identify a specific tissue, e.g., brain tissue. This can be very useful in cases where a forensic pathologist is presented with a tissue of unknown origin. Panels of such hVR-1, hVR-2, and rVR-2 probes can be used to identify tissue by species and/or by organ type.
  • these reagents e.g., hVR-1, hVR-2, and rVR-2 primers or probes can be used to screen tissue culture for contamination (i.e. screen for the presence of a mixture of different types of cells in a culture).
  • the present invention also pertains to the field of predictive medicine in which diagnostic assays, prognostic assays, and monitoring clinical trials are used for prognostic (predictive) pu ⁇ oses to thereby treat an individual prophylactically.
  • diagnostic assays for determining hVR-1, hVR-2, and rVR-2 protein and/or nucleic acid expression as well as hVR-1, hVR-2, and rVR-2 activity, in the context of a biological sample (e.g., blood, serum, cells, tissue) to thereby determine whether an individual is afflicted with a disease or disorder, or is at risk of developing a disorder, associated with aberrant hVR- 1 , hVR-2, and rVR-2 expression or activity.
  • a biological sample e.g., blood, serum, cells, tissue
  • the invention also provides for prognostic (or predictive) assays for determining whether an individual is at risk of developing a disorder associated with hVR-1, hVR-2, and rVR-2 protein, nucleic acid expression or activity. For example, mutations in an hVR-1, hVR-2, and rVR-2 gene can be assayed in a biological sample. Such assays can be used for prognostic or predictive pu ⁇ ose to thereby phophylactically treat an individual prior to the onset of a disorder characterized by or associated with hVR-1, hVR-2, and rVR-2 protein, nucleic acid expression or activity.
  • Another aspect ofthe invention pertains to monitoring the influence of agents (e.g., drugs, compounds) on the expression or activity of hVR-1, hVR-2, and rVR-2 in clinical trials.
  • agents e.g., drugs, compounds
  • An exemplary method for detecting the presence or absence of hVR-1, hVR-2, and rVR-2 protein or nucleic acid in a biological sample involves obtaining a biological sample from a test subject and contacting the biological sample with a compound or an agent capable of detecting hVR- 1 , hVR-2, and rVR-2 protein or nucleic acid (e.g. , mRNA, genomic DNA) that encodes hVR-1, hVR-2, and rVR-2 protein such that the presence of hVR-1, hVR-2, and rVR-2 protein or nucleic acid is detected in the biological sample.
  • a compound or an agent capable of detecting hVR- 1 , hVR-2, and rVR-2 protein or nucleic acid e.g. , mRNA, genomic DNA
  • a agent for detecting hVR-1, hVR-2, and rVR-2 mRNA or genomic DNA is a labeled nucleic acid probe capable of hybridizing to hVR-1, hVR-2, and rVR- 2 mRNA or genomic DNA.
  • the nucleic acid probe can be, for example, a full-length hVR-1 , hVR-2, and rVR-2 nucleic acid, such as the nucleic acid of SEQ ID NO: 1, 3, 4, 6, 7, 9, 10, or 12, or a portion thereof, such as an oligonucleotide of at least 15, 30, 50, 100, 250 or 500 nucleotides in length and sufficient to specifically hybridize under stringent conditions to hVR-1, hVR-2, and rVR-2 mRNA or genomic DNA.
  • Other suitable probes for use in the diagnostic assays ofthe invention are described herein.
  • An agent for detecting hVR-1, hVR-2, and rVR-2 protein is an antibody capable of binding to hVR-1, hVR-2, and rVR-2 protein, preferably an antibody with a detectable label.
  • Antibodies can be polyclonal, or more preferably, monoclonal. An intact antibody, or a fragment thereof (e.g., Fab or F(ab')2) can be used.
  • the term "labeled", with regard to the probe or antibody, is intended to encompass direct labeling ofthe probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, as well as indirect labeling ofthe probe or antibody by reactivity with another reagent that is directly labeled.
  • Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin such that it can be detected with fluorescently labeled streptavidin.
  • biological sample is intended to include tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject. That is, the detection method ofthe invention can be used to detect hVR-1, hVR-2, and rVR-2 mRNA, protein, or genomic DNA in a biological sample in vitro as well as in vivo.
  • in vitro techniques for detection of hVR-1, hVR-2, and rVR-2 mRNA include Northern hybridizations and in situ hybridizations.
  • In vitro techniques for detection of hVR-1, hVR-2, and rVR-2 protein include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations and immunofluorescence.
  • In vitro techniques for detection of hVR-1, hVR-2, and rVR-2 genomic DNA include Southern hybridizations.
  • in vivo techniques for detection of hVR- 1 , hVR-2, and rVR-2 protein include introducing into a subject a labeled anti-hVR-1, hVR-2, and rVR-2 antibody.
  • the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.
  • the biological sample contains protein molecules from the test subject.
  • the biological sample can contain mRNA molecules from the test subject or genomic DNA molecules from the test subject.
  • a biological sample is a serum sample isolated by conventional means from a subject.
  • the methods further involve obtaining a control biological sample from a control subject, contacting the control sample with a compound or agent capable of detecting hVR-1, hVR-2, and rVR-2 protein, mRNA, or genomic DNA, such that the presence of hVR-1, hVR-2, and rVR-2 protein, mRNA or genomic DNA is detected in the biological sample, and comparing the presence of hVR-
  • hVR-2 1 , hVR-2, and rVR-2 protein, mRNA or genomic DNA in the control sample with the presence of hVR-1, hVR-2, and rVR-2 protein, mRNA or genomic DNA in the test sample.
  • the invention also encompasses kits for detecting the presence of hVR-1, hVR-
  • the kit can comprise a labeled compound or agent capable of detecting hVR-1, hVR-2, and rVR-2 protein or mRNA in a biological sample; means for determining the amount of hVR-1, hVR-2, and rVR-2 in the sample; and means for comparing the amount of hVR-1, hVR-2, and rVR-2 in the sample with a standard.
  • the compound or agent can be packaged in a suitable container.
  • the kit can further comprise instructions for using the kit to detect hVR-1, hVR-2, and rVR-2 protein or nucleic acid.
  • the diagnostic methods described herein can furthermore be utilized to identify subjects having or at risk of developing a disease or disorder associated with aberrant hVR-1, hVR-2, and rVR-2 expression or activity.
  • aberrant includes an hVR-1 , hVR-2, and rVR-2 expression or activity which deviates from the wild type hVR-1, hVR-2, and rVR-2 expression or activity.
  • Aberrant expression or activity includes increased or decreased expression or activity, as well as expression or activity which does not follow the wild type developmental pattern of expression or the subcellular pattern of expression.
  • aberrant hVR-1, hVR-2, and rVR-2 expression or activity is intended to include the cases in which a mutation in the hVR-1, hVR-2, and rVR-2 gene causes the hVR-1, hVR-2, and rVR-2 gene to be under- expressed or over-expressed and situations in which such mutations result in a nonfunctional hVR-1, hVR-2, and rVR-2 protein or a protein which does not function in a wild-type fashion, e.g., a protein which does not interact with an hVR-1, hVR-2, and rVR-2 ligand or one which interacts with a non-hVR- 1 , non-hVR-2, and non-rVR-2 ligand.
  • the assays described herein can be utilized to identify a subject having or at risk of developing a disorder associated with a misregulation in hVR-1, hVR-2, and rVR-2 protein activity or nucleic acid expression, such as a pain disorder.
  • the prognostic assays can be utilized to identify a subject having or at risk for developing a disorder associated with a misregulation in hVR-1, hVR-2, and rVR-2 protein activity or nucleic acid expression, such as a pain disorder.
  • the present invention provides a method for identifying a disease or disorder associated with aberrant hVR-1, hVR-2, and rVR-2 expression or activity in which a test sample is obtained from a subject and hVR- 1 , hVR-2, and rVR-2 protein or nucleic acid (e.g., mRNA or genomic DNA) is detected, wherein the presence of hVR-1, hVR-2, and rVR-2 protein or nucleic acid is diagnostic for a subject having or at risk of developing a disease or disorder associated with aberrant hVR-1, hVR-2, and rVR-2 expression or activity.
  • a test sample refers to a biological sample obtained from a subject of interest.
  • a test sample can be a biological fluid (e.g., serum), cell sample, or tissue.
  • the prognostic assays described herein can be used to determine whether a subject can be administered an agent (e.g., an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule, or other drug candidate) to treat a disease or disorder associated with aberrant hVR- 1 , hVR-2, and rVR-2 expression or activity.
  • an agent e.g., an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule, or other drug candidate
  • such methods can be used to determine whether a subject can be effectively treated with an agent for a pain disorder.
  • the present invention provides methods for determining whether a subject can be effectively treated with an agent for a disorder associated with aberrant hVR- 1 , hVR-2, and rVR-2 expression or activity in which a test sample is obtained and hVR-1, hVR-2, and rVR-2 protein or nucleic acid expression or activity is detected (e.g. , wherein the abundance of hVR-1, hVR-2, and rVR-2 protein or nucleic acid expression or activity is diagnostic for a subject that can be administered the agent to treat a disorder associated with aberrant hVR-1, hVR-2, and rVR-2 expression or activity).
  • the methods ofthe invention can also be used to detect genetic alterations in an hVR-1, hVR-2, and rVR-2 gene, thereby determining if a subject with the altered gene is at risk for a disorder characterized by misregulation in hVR-1, hVR-2, and rVR-2 protein activity or nucleic acid expression, such as a neurodegenerative disorder.
  • the methods include detecting, in a sample of cells from the subject, the presence or absence of a genetic alteration characterized by at least one of an alteration affecting the integrity of a gene encoding an hVR-1, hVR-2, and rVR-2 -protein, or the mis-expression ofthe hVR-1, hVR-2, and rVR-2 gene.
  • such genetic alterations can be detected by ascertaining the existence of at least one of 1) a deletion of one or more nucleotides from an hVR-1, hVR-2, and rVR-2 gene; 2) an addition of one or more nucleotides to an hVR-1, hVR-2, and rVR-2 gene; 3) a substitution of one or more nucleotides of an hVR- 1 , hVR-2, and rVR-2 gene, 4) a chromosomal rearrangement of an hVR-1, hVR-2, and rVR-2 gene; 5) an alteration in the level of a messenger RNA transcript of an hVR-1, hVR-2, and rVR-2 gene, 6) aberrant modification of an hVR-1, hVR-2, and rVR-2 gene, such as ofthe methylation pattern of the genomic DNA, 7) the presence of a non- wild type splicing pattern of a messenger RNA transcript of an hVR-1, hVR-2 gene;
  • a biological sample is a tissue or serum sample isolated by conventional means from a subject.
  • detection ofthe alteration involves the use of a probe/primer in a polymerase chain reaction (PCR) (see, e.g., U.S. Patent Nos. 4,683,195 and 4,683,202), such as anchor PCR or RACE PCR, or, alternatively, in a ligation chain reaction (LCR) (see, e.g., Landegran et al.
  • PCR polymerase chain reaction
  • LCR ligation chain reaction
  • This method can include the steps of collecting a sample of cells from a subject, isolating nucleic acid (e.g., genomic, mRNA or both) from the cells ofthe sample, contacting the nucleic acid sample with one or more primers which specifically hybridize to an hVR-1, hVR-2, and rVR-2 gene under conditions such that hybridization and amplification ofthe hVR-1 , hVR-2, and rVR-2-gene (if present) occurs, and detecting the presence or absence of an amplification product, or detecting the size ofthe amplification product and comparing the length to a control sample. It is anticipated that PCR and/or LCR may be desirable to use as a preliminary amplification step in conjunction with any ofthe techniques used for detecting mutations described herein.
  • nucleic acid e.g., genomic, mRNA or both
  • Alternative amplification methods include: self sustained sequence replication (Guatelli, J.C. et al, (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh, D.Y. et al, (1989) Proc. Natl. Acad. Sci. USA 86:1173- 1177), Q-Be ⁇ a Replicase (Lizardi, P.M. et al. (1988) Bio-Technology 6: 1197), or any other nucleic acid amplification method, followed by the detection ofthe amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers.
  • mutations in an hVR-1, hVR-2, and rVR-2 gene from a sample cell can be identified by alterations in restriction enzyme cleavage patterns.
  • sample and control DNA is isolated, amplified (optionally), digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis and compared. Differences in fragment length sizes between sample and control DNA indicates mutations in the sample DNA.
  • sequence specific ribozymes see, for example, U.S. Patent No. 5,498,531 can be used to score for the presence of specific mutations by development or loss of a ribozyme cleavage site.
  • genetic mutations in hVR-1, hVR-2, and rVR-2 can be identified by hybridizing a sample and control nucleic acids, e.g., DNA or RNA, to high density arrays containing hundreds or thousands of oligonucleotides probes (Cronin, M.T. et al. (1996) Human Mutation 7: 244-255; Kozal, M.J. et al. (1996) Nature Medicine 2: 753-759).
  • genetic mutations in hVR-1, hVR-2, and rVR-2 can be identified in two dimensional arrays containing light-generated DNA probes as described in Cronin, M.T. et al. supra.
  • a first hybridization array of probes can be used to scan through long stretches of DNA in a sample and control to identify base changes between the sequences by making linear arrays of sequential overlapping probes. This step allows the identification of point mutations. This step is followed by a second hybridization array that allows the characterization of specific mutations by using smaller, specialized probe arrays complementary to all variants or mutations detected.
  • Each mutation array is composed of parallel probe sets, one complementary to the wild-type gene and the other complementary to the mutant gene.
  • any of a variety of sequencing reactions known in the art can be used to directly sequence the hVR-1, hVR-2, and rVR-2 gene and detect mutations by comparing the sequence ofthe sample hVR-1, hVR-2, and rVR-2 with the corresponding wild-type (control) sequence.
  • Examples of sequencing reactions include those based on techniques developed by Maxam and Gilbert ((1977) Proc. Natl. Acad. Sci. USA 74:560) or Sanger ((1977) Proc. Natl. Acad. Sci. USA 74:5463).
  • any of a variety of automated sequencing procedures can be utilized when performing the diagnostic assays ((1995) Biotechniques 19:448), including sequencing by mass spectrometry (see, e.g., PCT International Publication No. WO 94/16101; Cohen et al. (1996) Adv. Chromatogr. 36:127-162; and Griffin et al. (1993) Appl. Biochem. Biotechnol. 38:147-159).
  • Other methods for detecting mutations in the hVR-1, hVR-2, and rVR-2 gene include methods in which protection from cleavage agents is used to detect mismatched bases in RNA/RNA or RNA/DNA heteroduplexes (Myers et al.
  • RNA/DNA duplexes can be treated with RNase and DNA/DNA hybrids treated with S 1 nuclease to enzymatically digesting the mismatched regions.
  • either DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium tetroxide and with piperidine in order to digest mismatched regions. After digestion of the mismatched regions, the resulting material is then separated by size on denaturing polyacrylamide gels to determine the site of mutation. See, for example, Cotton et al. (1988) Proc. Natl Acad Sci USA 85:4397; Saleeba et al. (1992) Methods Enzymol. 217:286-295.
  • the control DNA or RNA can be labeled for detection.
  • the mismatch cleavage reaction employs one or more proteins that recognize mismatched base pairs in double-stranded DNA (so called "DNA mismatch repair" enzymes) in defined systems for detecting and mapping point mutations in hVR-1, hVR-2, and rVR-2 cDNAs obtained from samples of cells.
  • DNA mismatch repair enzymes
  • the mutY enzyme of E. coli cleaves A at G/A mismatches and the thymidine DNA glycosylase from HeLa cells cleaves T at G/T mismatches (Hsu et al. (1994) Carcinogenesis 15:1657-1662).
  • a probe based on an hVR- 1 , hVR-2, and rVR-2 sequence is hybridized to a cDNA or other DNA product from a test cell(s).
  • the duplex is treated with a DNA mismatch repair enzyme, and the cleavage products, if any, can be detected from electrophoresis protocols or the like. See, for example, U.S. Patent No. 5,459,039.
  • alterations in electrophoretic mobility will be used to identify mutations in hVR-1, hVR-2, and rVR-2 genes.
  • single strand conformation polymo ⁇ hism may be used to detect differences in electrophoretic mobility between mutant and wild type nucleic acids (orita et al. (1989) Proc Natl. Acad. Sci USA: 86:2766, see also Cotton (1993) Mutat. Res. 285: 125-144; and Hayashi (1992) Genet. Anal. Tech. Appl. 9:73-79).
  • Single-stranded DNA fragments of sample and control hVR-1, hVR-2, and rVR-2 nucleic acids will be denatured and allowed to renature.
  • the secondary structure of single-stranded nucleic acids varies according to sequence, the resulting alteration in electrophoretic mobility enables the detection of even a single base change.
  • the DNA fragments may be labeled or detected with labeled probes.
  • the sensitivity ofthe assay may be enhanced by using RNA (rather than DNA), in which the secondary structure is more sensitive to a change in sequence.
  • the subject method utilizes heteroduplex analysis to separate double stranded heteroduplex molecules on the basis of changes in electrophoretic mobility (Keen et al. ( 1991 ) Trends Genet 7:5).
  • the movement of mutant or wild-type fragments in polyacrylamide gels containing a gradient of denaturant is assayed using denaturing gradient gel electrophoresis (DGGE) (Myers et al. (1985) Nature 313:495).
  • DGGE denaturing gradient gel electrophoresis
  • DNA will be modified to insure that it does not completely denature, for example by adding a GC clamp of approximately 40 bp of high-melting GC-rich DNA by PCR.
  • a temperature gradient is used in place of a denaturing gradient to identify differences in the mobility of control and sample DNA (Rosenbaum and Reissner (1987) Biophys Chem 265:12753).
  • oligonucleotide primers may be prepared in which the known mutation is placed centrally and then hybridized to target DNA under conditions which permit hybridization only if a perfect match is found (Saiki et al. (1986) Nature 324:163); Saiki et al. (1989) Proc. Natl Acad. Sci USA 86:6230).
  • Such allele specific oligonucleotides are hybridized to PCR amplified target DNA or a number of different mutations when the oligonucleotides are attached to the hybridizing membrane and hybridized with labeled target DNA.
  • Oligonucleotides used as primers for specific amplification may carry the mutation of interest in the center ofthe molecule (so that amplification depends on differential hybridization) (Gibbs et al. (1989) Nucleic Acids Res. 17:2437-2448) or at the extreme 3' end of one primer where, under appropriate conditions, mismatch can prevent, or reduce polymerase extension (Prossner (1993) Tibtech 11 :238).
  • amplification may also be performed using Taq ligase for amplification (Barany (1991) Proc. Natl. Acad. Sci USA 88:189). In such cases, ligation will occur only if there is a perfect match at the 3' end ofthe 5' sequence making it possible to detect the presence of a known mutation at a specific site by looking for the presence or absence of amplification.
  • the methods described herein may be performed, for example, by utilizing prepackaged diagnostic kits comprising at least one probe nucleic acid or antibody reagent described herein, which may be conveniently used, e.g., in clinical settings to diagnose patients exhibiting symptoms or family history of a disease or illness involving an hVR- 1, hVR-2, and rVR-2 gene.
  • any cell type or tissue in which hVR-1, hVR-2, and rVR-2 is expressed may be utilized in the prognostic assays described herein.
  • Monitoring the influence of agents (e.g., drugs) on the expression or activity of an hVR-1, hVR-2, and rVR-2 protein can be applied not only in basic drug screening, but also in clinical trials.
  • agents e.g., drugs
  • the effectiveness of an agent determined by a screening assay as described herein to increase hVR-1, hVR-2, and rVR-2 gene expression, protein levels, or upregulate hVR-1, hVR-2, and rVR-2 activity can be monitored in clinical trials of subjects exhibiting decreased hVR-1, hVR-2, and rVR-2 gene expression, protein levels, or downregulated hVR-1, hVR-2, and rVR-2 activity.
  • the effectiveness of an agent determined by a screening assay to decrease hVR-1, hVR-2, and rVR-2 gene expression, protein levels, or downregulate hVR-1, hVR-2, and rVR-2 activity can be monitored in clinical trials of subjects exhibiting increased hVR- 1 , hVR-2, and rVR-2 gene expression, protein levels, or upregulated hVR-1, hVR-2, and rVR-2 activity.
  • an hVR-1, hVR-2, and rVR-2 gene and preferably, other genes that have been implicated in, for example, an hVR-1, hVR-2, and rVR-2-associated disorder can be used as a "read out" or markers ofthe phenotype of a particular cell.
  • genes, including hVR-1, hVR-2, and rVR-2, that are modulated in cells by treatment with an agent (e.g., compound, drug or small molecule) which modulates hVR-1, hVR-2, and rVR-2 activity e.g., identified in a screening assay as described herein
  • cells can be isolated and RNA prepared and analyzed for the levels of expression of hVR-1, hVR-2, and rVR-2 and other genes implicated in the hVR-1, hVR-2, and rVR-2-associated disorder, respectively.
  • the levels of gene expression e.g., a gene expression pattern
  • the present invention provides a method for monitoring the effectiveness of treatment of a subject with an agent (e.g., an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule, or other drug candidate identified by the screening assays described herein) including the steps of (i) obtaining a pre-administration sample from a subject prior to administration ofthe agent; (ii) detecting the level of expression of an hVR- 1 , hVR-2, and rVR-2 protein, mRNA, or genomic DNA in the preadministration sample; (iii) obtaining one or more post- administration samples from the subject; (iv) detecting the level of expression or activity ofthe hVR-1, hVR-2, and rVR-2 protein, mRNA, or genomic DNA in the post-
  • an agent e.g., an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule, or other drug candidate identified by the screening assays described herein
  • increased administration ofthe agent may be desirable to increase the expression or activity of h VR-1, h VR-2, and rVR-2 to higher levels than detected, i.e., to increase the effectiveness ofthe agent.
  • decreased administration ofthe agent may be desirable to decrease expression or activity of hVR-1, hVR-2, and rVR-2 to lower levels than detected, i.e. to decrease the effectiveness ofthe agent.
  • hVR-1, hVR-2, and rVR- 2 expression or activity may be used as an indicator ofthe effectiveness of an agent, even in the absence of an observable phenotypic response.
  • the present invention provides for both prophylactic and therapeutic methods of treating a subject at risk of (or susceptible to) a disorder or having a disorder associated with aberrant hVR-1, hVR-2, and rVR-2 expression or activity.
  • treatments may be specifically tailored or modified, based on knowledge obtained from the field of pharmacogenomics.
  • “Pharmacogenomics”, as used herein, refers to the application of genomics technologies such as gene sequencing, statistical genetics, and gene expression analysis to drugs in clinical development and on the market. More specifically, the term refers the study of how a patient's genes determine his or her response to a drug (e.g.
  • another aspect ofthe invention provides methods for tailoring an individual's prophylactic or therapeutic treatment with either the hVR-1, hVR-2, and rVR-2 molecules ofthe present invention or hVR-1, hVR-2, and rVR-2 modulators according to that individual's drug response genotype.
  • Pharmacogenomics allows a climcian or physician to target prophylactic or therapeutic treatments to patients who will most benefit from the treatment and to avoid treatment of patients who will experience toxic drug-related side effects.
  • the invention provides a method for preventing in a subject, a disease or condition associated with an aberrant hVR-1, hVR-2, and rVR-2 expression or activity, by administering to the subject an hVR-1, hVR-2, and rVR-2 or an agent which modulates hVR-1, hVR-2, and rVR-2 expression or at least one hVR-1, hVR-2, and rVR-2 activity.
  • Subjects at risk for a disease which is caused or contributed to by aberrant hVR- 1 , hVR-2, and rVR-2 expression or activity can be identified by, for example, any or a combination of diagnostic or prognostic assays as described herein.
  • Administration of a prophylactic agent can occur prior to the manifestation of symptoms characteristic ofthe hVR-1, hVR-2, and rVR-2 aberrancy, such that a disease or disorder is prevented or, alternatively, delayed in its progression.
  • a prophylactic agent can be used for treating the subject.
  • the appropriate agent can be determined based on screening assays described herein.
  • the modulatory method ofthe invention involves contacting a cell with an hVR-1, hVR-2, and rVR-2 or agent that modulates one or more ofthe activities of hVR-1, hVR-2, and rVR-2 protein activity associated with the cell.
  • An agent that modulates hVR-1, hVR-2, and rVR-2 protein activity can be an agent as described herein, such as a nucleic acid or a protein, a naturally-occurring target molecule of an hVR-1, hVR-2, and rVR-2 protein (e.g., an hVR-1, hVR-2, and rVR-2 substrate), an hVR-1, hVR-2, and rVR-2 antibody, an hVR-1, hVR-2, and rVR-2 agonist or antagonist, a peptidomimetic of an hVR- 1 , hVR-2, and rVR-2 agonist or antagonist, or other small molecule.
  • the agent stimulates one or more hVR-1, hVR-2, and rVR-2 activities. Examples of such stimulatory agents include active hVR-
  • the agent inhibits one or more hVR-1, hVR-2, and rVR-2 activities.
  • inhibitory agents include antisense hVR-1, hVR-2, and rVR-2 nucleic acid molecules, anti-hVR-1, hVR-
  • the present invention provides methods of treating an individual afflicted with a disease or disorder characterized by aberrant expression or activity of an hVR-1, hVR-2, and rVR-2 protein or nucleic acid molecule.
  • the method involves administering an agent (e.g., an agent identified by a screening assay described herein), or combination of agents that modulates (e.g., upregulates or downregulates) hVR-1, hVR-2, and rVR-2 expression or activity.
  • an agent e.g., an agent identified by a screening assay described herein
  • the method involves administering an hVR-1 , hVR-2, and rVR-2 protein or nucleic acid molecule as therapy to compensate for reduced or aberrant hVR-1, hVR-2, and rVR-2 expression or activity.
  • Stimulation of hVR-1, hVR-2, and rVR-2 activity is desirable in situations in which hVR-1, hVR-2, and rVR-2 is abnormally downregulated and/or in which increased hVR-1, hVR-2, and rVR-2 activity is likely to have a beneficial effect.
  • stimulation of hVR-1, hVR-2, and rVR-2 activity is desirable in situations in which an hVR-1, hVR-2, and rVR-2 is downregulated and/or in which increased hVR-1, hVR-2, and rVR-2 activity is likely to have a beneficial effect.
  • hVR-1, hVR-2, and rVR-2 activity is desirable in situations in which hVR-1, hVR-2, and rVR-2 is abnormally upregulated and/or in which decreased hVR-1, hVR-2, and rVR-2 activity is likely to have a beneficial effect.
  • hVR-1, hVR-2, and rVR-2 molecules ofthe present invention as well as agents, or modulators which have a stimulatory or inhibitory effect on hVR-1, hVR-2, and rVR-2 activity (e.g., hVR-1, hVR-2, and rVR-2 gene expression) as identified by a screening assay described herein can be administered to individuals to treat (prophylactically or therapeutically) hVR-1, hVR-2, and rVR-2-associated disorders (e.g., pain disorders) associated with aberrant hVR-1, hVR-2, and rVR-2 activity.
  • hVR-1, hVR-2, and rVR-2 activity e.g., hVR-1, hVR-2, and rVR-2 gene expression
  • hVR-1, hVR-2, and rVR-2-associated disorders e.g., pain disorders
  • pharmacogenomics i.e., the study ofthe relationship between an individual's genotype and that individual's response to a foreign compound or drug
  • Differences in metabolism of therapeutics can lead to severe toxicity or therapeutic failure by altering the relation between dose and blood concentration ofthe pharmacologically active drug.
  • a physician or clinician may consider applying knowledge obtained in relevant pharmacogenomics studies in determining whether to administer an hVR-1, hVR-2, and rVR-2 molecule or hVR-1, hVR-2, and rVR-2 modulator as well as tailoring the dosage and/or therapeutic regimen of treatment with an hVR-1, hVR-2, and rVR-2 molecule or hVR-1, hVR-2, and rVR-2 modulator.
  • Pharmacogenomics deals with clinically significant hereditary variations in the response to drugs due to altered drug disposition and abnormal action in affected persons. See, for example, Eichelbaum, M. et al. (1996) Clin. Exp. Pharmacol. Physiol. 23(10-11) :983-985 and Linder, M.W. et al. (1997) Clin. Chem. 43(2):254-266.
  • two types of pharmacogenetic conditions can be differentiated. Genetic conditions transmitted as a single factor altering the way drugs act on the body (altered drug action) or genetic conditions transmitted as single factors altering the way the body acts on drugs (altered drug metabolism). These pharmacogenetic conditions can occur either as rare genetic defects or as naturally-occurring polymo ⁇ hisms.
  • G6PD glucose-6-phosphate dehydrogenase deficiency
  • oxidant drugs anti-malarials, sulfonamides, analgesics, nitrofurans
  • a genome-wide association relies primarily on a high-resolution map ofthe human genome consisting of already known gene-related markers (e.g., a "bi- allelic” gene marker map which consists of 60,000-100,000 polymo ⁇ hic or variable sites on the human genome, each of which has two variants.)
  • gene-related markers e.g., a "bi- allelic” gene marker map which consists of 60,000-100,000 polymo ⁇ hic or variable sites on the human genome, each of which has two variants.
  • Such a high-resolution genetic map can be compared to a map ofthe genome of each of a statistically significant number of patients taking part in a Phase II/III drug trial to identify markers associated with a particular observed drug response or side effect.
  • such a high resolution map can be generated from a combination of some ten-million known single nucleotide polymo ⁇ hisms (SNPs) in the human genome.
  • SNP single nucleotide polymo ⁇ hisms
  • a "SNP" is a common alteration that occurs in a single nucleotide base in a stretch of DNA. For example, a SNP may occur once per every 1000 bases of DNA.
  • a SNP may be involved in a disease process, however, the vast majority may not be disease- associated.
  • individuals Given a genetic map based on the occurrence of such SNPs, individuals can be grouped into genetic categories depending on a particular pattern of SNPs in their individual genome. In such a manner, treatment regimens can be tailored to groups of genetically similar individuals, taking into account traits that may be common among such genetically similar individuals.
  • a method termed the "candidate gene approach” can be utilized to identify genes that predict drug response.
  • a gene that encodes a drugs target e.g., an hVR-1, hVR-2, and rVR-2 protein ofthe present invention
  • all common variants of that gene can be fairly easily identified in the population and it can be determined if having one version ofthe gene versus another is associated with a particular drug response.
  • the activity of drug metabolizing enzymes is a major determinant of both the intensity and duration of drug action.
  • drug metabolizing enzymes e.g., N-acetyltransferase 2 (NAT 2) and cytochrome P450 enzymes CYP2D6 and CYP2C19
  • NAT 2 N-acetyltransferase 2
  • CYP2D6 and CYP2C19 cytochrome P450 enzymes
  • the gene coding for CYP2D6 is highly polymo ⁇ hic and several mutations have been identified in PM, which all lead to the absence of functional CYP2D6. Poor metabolizers of CYP2D6 and CYP2C19 quite frequently experience exaggerated drug response and side effects when they receive standard doses. If a metabolite is the active therapeutic moiety, PM show no therapeutic response, as demonstrated for the analgesic effect of codeine mediated by its C YP2D6-formed metabolite mo ⁇ hine. The other extreme are the so called ultra-rapid metabolizers who do not respond to standard doses.
  • a method termed the "gene expression profiling” can be utilized to identify genes that predict drug response.
  • a drug e.g., an hVR-1, hVR-2, and rVR-2 molecule or hVR-1, hVR- 2, and rVR-2 modulator of the present invention
  • Information generated from more than one of the above pharmacogenomics approaches can be used to determine appropriate dosage and treatment regimens for prophylactic or therapeutic treatment an individual.
  • hVR-1 clone Fchrb87a6
  • hVR-2 clone flh21el 1
  • hVR-2 alternate form clone frhobl2c4
  • rVR-2 clone flrxbl47gl 1
  • the invention is based, at least in part, on the discovery of two human genes and one rat gene encoding novel members ofthe Capsaicin/Vanilloid receptor family, referred to herein as hVR-1, hVR-2, and rVR-2, respectively.
  • hVR-1 novel members ofthe Capsaicin/Vanilloid receptor family
  • rVR-2 novel members ofthe Capsaicin/Vanilloid receptor family
  • clones were identified from a human heart library and a rat dorsal root ganglion (DRG) library, based on sequence homology to the known rat VR-1 (Accession Number AF029310).
  • DRG rat dorsal root ganglion
  • nucleotide sequence ofthe full length hVR-1 cDNA and the predicted amino acid sequence of the hVR-1 polypeptide are shown in Figure 1 and in SEQ ID NOs:l and 2, respectively.
  • nucleotide sequence ofthe full length hVR-2 cDNA and the predicted amino acid sequence of the hVR-2 polypeptide are shown in Figure 2 and in SEQ ID NOs:4 and 5, respectively.
  • nucleotide sequence ofthe partial hVR-2 (alternate form) cDNA and the predicted amino acid sequence ofthe hVR-2 (alternate form) polypeptide are shown in Figure 3 and in SEQ ID NOs:7 and 8, respectively.
  • the amino acid sequence ofthe predicted full length human VR-2 protein (alternate form) is shown in Figure 16 and in SEQ ID NO:20.
  • the nucleotide sequence ofthe partial rVR-2 cDNA and the predicted amino acid sequence ofthe rVR-2 polypeptide are shown in Figure 4 and in SEQ ID NOs: 10 and 11 , respectively.
  • the hVR-1 protein (SEQ ID NO:2) was aligned with the human VR-2 protein
  • the hVR-1 nucleotide sequence (SEQ ID NO:l) was aligned with the human VR-2 nucleotide sequence (SEQ ID NO:4) using the GAP program in the GCG software package (nwsgapdna matrix) and a gap weight of 50 and a length weight of 3. The results showed a 55.316% identity and 55.316%) similarity between the two sequences (see Figure 6).
  • the hVR-2 protein (SEQ ID NO:5) was aligned with the rat VR-2 protein (SEQ ID NO:l 1) using the CLUSTAL W (1.74) multiple sequence alignment program (Figure 7), as well as using the GAP program in the GCG software package (Blosum 62 matrix) and a gap weight of 12 and a length weight of 4. The results showed a 79.167%) identity and 81.703%) similarity between the two sequences (see Figure 8).
  • the hVR-1 nucleotide sequence (SEQ ID NOT) was aligned with the rat VR-1 nucleotide sequence (Accession Number: AF029310) using the GAP program in the GCG software package (nwsgapdna matrix) and a gap weight of 50 and a length weight of 3. The results showed a 82.125% identity and 82.125% similarity between the two sequences (see Figure 9).
  • the hVR-1 protein (SEQ ID NO:2) was aligned with the rat VR-1 protein (Accession Number: AF029310) using the GAP program in the GCG software package (Blosum 62 matrix) and a gap weight of 12 and a length weight of 4. The results showed a 86.022% identity and 89.247% similarity between the two sequences (see Figure 10).
  • the hVR-2 protein (SEQ ID NO:5) was aligned with the human VR-2 protein (alternate form) (SEQ ID NO:8) using the CLUSTAL W (1.74) multiple sequence alignment program ( Figure 1 1). Finally, the hVR-2 protein (SEQ ID NO:5) was aligned with the predicted full length human VR-2 protein (alternate form) (SEQ ID NO:20) using the CLUSTAL W (1.74) multiple sequence alignment program ( Figure 17).
  • the results ofthe searches are set forth in Figures 13 and 15, respectively.
  • Hydropathy plots have identified 6 transmembrane domains in the hVR-1 and the hVR-2 proteins (see Figures 12 and 14, respectively). A series of searches have revealed that the hVR-1 protein matches the ProDom entry 141801 for the vanilloid receptor subtype and the ProDom entry 145518 for the vanilloid receptor subtype.
  • Tissue Distribution of hVR-1 and hVR-2 mRNA This Example describes the tissue distribution of hVR-1 and hVR-2 mRNA as determined by in situ hybridization.
  • tissues such as brain regions and whole brain, obtained from human and monkey were first frozen on dry ice.
  • Ten-micrometer-thick coronal sections ofthe tissues were postfixed with 4%> formaldehyde in DEPC treated IX phosphate- buffered saline at room temperature for 10 minutes before being rinsed twice in DEPC IX phosphate-buffered saline and once in 0.1 M triethanolamine-HCl (pH 8.0).
  • sections were rinsed in DEPC 2X SSC (IX SSC is 0.15M NaCl plus 0.015M sodium citrate).
  • Tissue was then dehydrated through a series of ethanol washes, incubated in 100%o chloroform for 5 minutes, and then rinsed in 100% ethanol for 1 minute and 95% ethanol for 1 minute and allowed to air dry.
  • Hybridizations were performed with 35 S-radiolabeled (5 X 10 7 cpm/ml) cRNA probes. Probes were incubated in the presence of a solution containing 600 mM NaCl, 10 mM Tris (pH 7.5), 1 mM EDTA, 0.01% sheared salmon sperm DNA, 0.01% yeast tRNA, 0.05%) yeast total RNA type XI , 1 X Denhardt's solution, 50% formamide, 10% dextran sulfate, 100 mM dithiothreitol. 0.1%) sodium dodecyl sulfate (SDS), and 0.1% sodium thiosulfate for 18 hours at 55°C.
  • SDS sodium dodecyl sulfate
  • slides were washed with 2 X SSC. Sections were then sequentially incubated at 37°C in TNE (a solution containing 10 mM Tris-HCl (pH 7.6), 500 mM NaCl, and 1 mM EDTA), for 10 minutes, in TNE with 1 O ⁇ g of RNase A per ml for 30 minutes, and finally in TNE for 10 minutes. Slides were then rinsed with 2 X SSC at room temperature, washed with 2 X SSC at 50°C for 1 hour, washed with 0.2 X SSC at 55°C for 1 hour, and 0.2 X SSC at 60°C for 1 hour.
  • TNE a solution containing 10 mM Tris-HCl (pH 7.6), 500 mM NaCl, and 1 mM EDTA
  • Sections were then dehydrated rapidly through serial ethanol-0.3 M sodium acetate concentrations before being air dried and exposed to Kodak Biomax MR scientific imaging film for 24 hours and subsequently dipped in NB-2 photoemulsion and exposed at 4°C for 7 days before being developed and counter stained.
  • the hVR-1 molecule is expressed in nodose, trigeminal sensory neurons, but is not expressed in sympathetic neurons. Within the nodose sensory neurons and trigeminal sensory neurons, expression was seen in distinct sub-populations.
  • hVRl is expressed in some, but not all, small dorsal root ganglion (DRG) neurons and in a few medium sized DRG neurons.
  • DRG small dorsal root ganglion
  • the hVR-1 molecule is partially co-expressed with the neuropeptide CGRP and with substance P which are present in nociceptive neurons.
  • the data further indicate that the VR-2 molecule is expressed in both human and monkey brain, primarily in cortical neurons.
  • the VR2 molecule is also expressed in other brain regions, for example, the thalamus, striatum, hippocampus, hypothalamus, midbrain, medula and brain stem.
  • the VR-2 molecule is expressed in parasympathetic neurons ofthe monkey heart (atrium), nodose sensory neurons, trigeminal (TRG) sensory neurons, dorsal root ganglion sensory neurons, sympathetic neurons, and motor neurons ofthe spinal cord.
  • the VR2 molecule is widely expressed in TRG and DRG neurons, being present in most small and medium sized neurons and also in a few ofthe large neurons.
  • VR2 like VR-1, partially co-localizes with CGRP and substance P. Trigeminal sensory neurons are recognized pain centers while sympathetic neurons have been shown to be involved in neuropathic pain.
  • EXAMPLE 2 EXPRESSION OF RECOMBINANT hVR-1, hVR-2, AND rVR-2 PROTEIN IN BACTERIAL CELLS
  • hVR-1, hVR-2, and rVR-2 is expressed as a recombinant glutathione-S-transferase (GST) fusion polypeptide in E. coli and the fusion polypeptide is isolated and characterized. Specifically, hVR-1, hVR-2, and rVR-2 is fused to GST and this fusion polypeptide is expressed in E. coli, e.g., strain PEB 199. Expression of the GST-hVR- 1 , GST-hVR-2, and GST-rVR-2 fusion protein in PEB 199 is induced with IPTG.
  • GST glutathione-S-transferase
  • the recombinant fusion polypeptide is purified from crude bacterial lysates of the induced PEB 199 strain by affinity chromatography on glutathione beads. Using polyacrylamide gel electrophoretic analysis ofthe polypeptide purified from the bacterial lysates, the molecular weight ofthe resultant fusion polypeptide is determined.
  • EXAMPLE 3 EXPRESSION OF RECOMBINANT hVR-1, hVR-2,
  • rVR-2 PROTEIN IN COS CELLS To express the hVR-1, hVR-2, and rVR-2 gene in COS cells, the pcDN A/Amp vector from Invitrogen Co ⁇ oration (San Diego, CA) is used. This vector contains an SV40 origin of replication, an ampicillin resistance gene, an E. coli replication origin, a CMV promoter followed by a polylinker region, and an SV40 intron and polyadenylation site. A DNA fragment encoding the entire hVR-1, hVR-2, and rVR-2 protein and an HA tag (Wilson et al.
  • the hVR-1, hVR-2, and rVR-2 DNA sequence is amplified by PCR using two primers.
  • the 5' primer contains the restriction site of interest followed by approximately twenty nucleotides ofthe hVR-1, hVR-2, and rVR-2 coding sequence starting from the initiation codon; the 3' end sequence contains complementary sequences to the other restriction site of interest, a translation stop codon, the HA tag or FLAG tag and the last 20 nucleotides ofthe hVR-1, hVR-2, and rVR-2 coding sequence.
  • the PCR amplified fragment and the pCDNA/Amp vector are digested with the appropriate restriction enzymes and the vector is dephosphorylated using the CIAP enzyme (New England Biolabs, Beverly, MA).
  • the two restriction sites chosen are different so that the hVR-1, hVR-2, and rVR-2 gene is inserted in the correct orientation.
  • the ligation mixture is transformed into E. coli cells (strains HB101, DH5a, SURE, available from Stratagene Cloning Systems, La Jolla, CA, can be used), the transformed culture is plated on ampicillin media plates, and resistant colonies are selected. Plasmid DNA is isolated from transformants and examined by restriction analysis for the presence ofthe correct fragment.
  • COS cells are subsequently transfected with the hVR-1, hVR-2, and rVR-2- pcDNA/Amp plasmid DNA using the calcium phosphate or calcium chloride co- precipitation methods, DEAE-dextran-mediated transfection, lipofection, or electroporation.
  • Other suitable methods for transfecting host cells can be found in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.
  • the expression ofthe hVR-1, hVR-2, and rVR-2 polypeptide is detected by radiolabelling ( 35 S -methionine or 35 S-cysteine available from NEN, Boston, MA, can be used) and immunoprecipitation (Harlow, E. and Lane, D. Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1988) using an HA specific monoclonal antibody. Briefly, the cells are labelled for 8 hours with 35 S-methionine (or 35 S-cysteine).
  • the culture media are then collected and the cells are lysed using detergents (RIPA buffer, 150 mM NaCl, 1% NP- 40, 0.1% SDS, 0.5% DOC, 50 mM Tris, pH 7.5). Both the cell lysate and the culture media are precipitated with an HA specific monoclonal antibody. Precipitated polypeptides are then analyzed by SDS-PAGE.
  • detergents 150 mM NaCl, 1% NP- 40, 0.1% SDS, 0.5% DOC, 50 mM Tris, pH 7.5.
  • DNA containing the hVR-1, hVR-2, and rVR-2 coding sequence is cloned directly into the polylinker ofthe pCDNA/Amp vector using the appropriate restriction sites.
  • the resulting plasmid is transfected into COS cells in the manner described above, and the expression ofthe hVR-1 , hVR-2, and rVR-2 polypeptide is detected by radiolabelling and immunoprecipitation using an hVR-1, hVR-2, and rVR-2 specific monoclonal antibody.
  • EXAMPLE 4 ELECTROPHYSIOLOGICAL STUDIES OF VR2 Human VR2 was functionally characterized in both HEK293 cells and Xenopus oocytes using electrophysiological methods.
  • VR2 in the pcDNA3.1 vector purchased by Invitrogen
  • the results indicate that heat stimulation (>50 °C) induces a rapid inactivating inward current (1-2 nA).
  • Polyclonal antisera were raised in rabbits against the following three peptides derived from the human VR2 amino acid sequence, using the techniques described in Ed Harlow and David Lane (1988) "Antibodies; A Laboratory Manual” Cold Spring harbor Laboratory Press.
  • Antibody PEPTIDE 1 AFHCKSPHRHRMVVLE (SEQ ID NO: 13)
  • Antibody PEPTIDE 2 RPEAPTGPNATESVQPMEGQEDEGN (SEQ ID NO: 14)
  • Antibody PEPTIDE 3 SVLEMENGYWWCRKKQRAG (SEQ ID NO: 15) Antisera were subsequently affinity purified using the peptide immunogen.
  • the polyclonal antisera were tested for immunostaining of both monkey and rat dorsal root ganglion sensory neurons.
  • Peptides 1 and 3 gave specific staining of subpopulations of sensory neurons that was competed with the corresponding peptide. This pattern of expression was very similar to the one observed using a VR-2 riboprobe.
  • EXAMPLE 6 CHROMOSOMAL LOCALIZATION OF hVR-1 AND hVR-2
  • primers were designed based on the sequence of hVR-1 (clone Fchrb87a6) (amplifying a 177 bp product from a human control cell line DNA and multiple faint larger products from a control Hamster cell line DNA by PCR). These primers were used to amplify 93 DNAs in duplicate from the Genebridge 4 Radiation Hybrid Panel (Research Genetics, Inc., Huntsville, AL).
  • the hVR-1 primers used in the PCR mapping studies were: forward - TAGGAGACCCCGTTGCCACG (SEQ ID NO: 16) and reverse - GATTCACTTGGGGACAGTGACG (SEQ ID NO: 17) and the PCR reactions were performed as follows: 5 ⁇ l Template DNA (lOng/ ⁇ l), 1.5 ⁇ l 10X Perkin Elmer PCR Buffer, 1.2 ⁇ l Pharmacia dNTP mix 2.5 mM, 1.15 ⁇ l Forward primer 6.6 ⁇ M, 1.15 ⁇ l Reverse primer 6.6 ⁇ M, 5 ⁇ l Gibco/BRL Platinum Taq .05U/ ⁇ l (Hot Start), using an amplification profile of: 95°C for 10 minutes followed by 35 Cycles of 94°C for 40 seconds, 55°C for 40 seconds, 72°C for 40 seconds, and 72°C for 5 minutes.
  • the PCR products were run on 2%> agarose gels, post-stainedwith SYBR Gold (1 : 10,000 dilution in IX TBE), and
  • primers were designed from 5' UTR sequence of human VR2 (clone Flh21el 1) (amplifying a 166 bp product from a human control cell line DNA and 2 much larger faint bands from a control Hamster cell line DNA by PCR). These primers were used to amplify 93 DNAs in duplicate from the Genebridge 4 Radiation Hybrid Panel (Research Genetics, Inc., Huntsville, AL).
  • the hVR-2 primers used in the PCR mapping studies were: forward - TTAAGCTCCCGTTCTCACCG (SEQ ID NO: 18) and reverse - GCTGCGGGAGGAAGTGAAGC (SEQ ID NO: 19) and the PCR reactions were performed as follows: 5 ⁇ l Template DNA (lOng/ ⁇ l), 1.5 ⁇ l 10X Perkin Elmer PCR Buffer, 1.2 ⁇ l Pharmacia dNTP mix 2.5mM, 1.15 ⁇ l Forward primer 6.6 ⁇ M, 1.15 ⁇ l Reverse primer 6.6 ⁇ M, 5 ⁇ l Gibco/BRL Platinum Taq .05U/ ⁇ l (Hot Start), using an amplification profile of 95°C for 10 minutes, followed by 35 Cycles of 94°C for 40 seconds, 55°C for 40 seconds, 72°C for 40 seconds, and 72°C for 5 minutes.
  • the PCR products were run on 2% agarose gels, post-stainedwith SYBR Gold (1 :10,000 dilution in IX TBE), and scanned on a Molecular Dynamics 595 Fluorimager.
  • the following is the vector data for the 93 Genebridge4 hybrid DNAs. These are in order 1-93. A “1" is a positive result, a "-” is a negative result, a "?” is an ambiguous result.
  • hVR2 was found to map to the p arm of human chromosome 17 , 29.3cR cR 3000 telomeric to the Whitehead Institute framework marker D17S721, and 23.3 cR 3000 centromeric ofthe Whitehead framework marker AFMA043ZB5.
  • LOD scores for linkage were 11.9 for D17S721 and 13.6 for AFMA043ZB5. This region corresponds to the cytogenetic location 17p 11-12. This region is syntenic to mouse chromosome 11.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Neurosurgery (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Neurology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biomedical Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Toxicology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Pain & Pain Management (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Cell Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
PCT/US1999/026701 1998-11-13 1999-11-12 Novel members of the capsaicin/vanilloid receptor family of proteins and uses thereof WO2000029577A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP2000582560A JP2002531069A (ja) 1998-11-13 1999-11-12 タンパク質のカプサイシン/バニロイド受容体ファミリーの新規メンバー及びそれらの使用
AU21480/00A AU2148000A (en) 1998-11-13 1999-11-12 Novel members of the capsaicin/vanilloid receptor family of proteins and uses thereof
CA002348479A CA2348479A1 (en) 1998-11-13 1999-11-12 Novel members of the capsaicin/vanilloid receptor family of proteins and uses thereof
EP99965787A EP1131433A1 (de) 1998-11-13 1999-11-12 Mitglieder der capsaicin/vanilloid rezeptor familie und ihre anwendungen

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
US10832298P 1998-11-13 1998-11-13
US60/108,322 1998-11-13
US11407898P 1998-12-28 1998-12-28
US60/114,078 1998-12-28
US25863399A 1999-02-26 1999-02-26
US09/258,633 1999-02-26
US42113499A 1999-10-19 1999-10-19
US09/421,134 1999-10-19

Publications (2)

Publication Number Publication Date
WO2000029577A1 true WO2000029577A1 (en) 2000-05-25
WO2000029577A9 WO2000029577A9 (en) 2000-09-28

Family

ID=27493638

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/026701 WO2000029577A1 (en) 1998-11-13 1999-11-12 Novel members of the capsaicin/vanilloid receptor family of proteins and uses thereof

Country Status (5)

Country Link
EP (1) EP1131433A1 (de)
JP (1) JP2002531069A (de)
AU (1) AU2148000A (de)
CA (1) CA2348479A1 (de)
WO (1) WO2000029577A1 (de)

Cited By (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1047711A1 (de) * 1998-01-22 2000-11-02 The Regents of the University of California Nukleinsäuresequenzen, welche für capsaicin-rezeptoren kodieren
WO2002018407A2 (de) * 2000-09-02 2002-03-07 Grünenthal GmbH Antisense oligonukleotide gegen vanilloid rezeptor 1
DE10043674A1 (de) * 2000-09-02 2002-03-21 Gruenenthal Gmbh Antisense Oligonukleotide
WO2002033411A1 (en) * 2000-10-16 2002-04-25 Ortho-Mcneil Pharmaceutical, Inc. Improved ligand binding assays for vanilloid receptors
US6406908B1 (en) 1999-03-26 2002-06-18 Novartis Ag Vanilloid receptor
US6482611B1 (en) 1999-09-23 2002-11-19 Neurogen Corporation Human capsaicin receptor and uses thereof
WO2004072020A1 (en) * 2003-02-12 2004-08-26 Bayer Healthcare Ag Hydroxy-tetrahydro-naphthalenylurea derivatives
US6790629B2 (en) 1997-08-20 2004-09-14 The Regents Of The University Of California Nucleic acid sequences encoding capsaicin receptor and capsaicin receptor-related polypeptides and uses thereof
WO2005044802A2 (en) 2003-11-08 2005-05-19 Bayer Healthcare Ag Tetrahydro-quinolinylurea derivatives as vrl antagonists
US6969721B2 (en) 2000-07-20 2005-11-29 Bristol-Myers Squibb Pharma Tricyclic-2-pyridone compounds useful as HIV reverse transcriptase inhibitors
US7179898B1 (en) 1998-12-08 2007-02-20 Merck & Co., Inc. Human vanilloid receptor-like receptor
EP2048132A1 (de) 2003-10-01 2009-04-15 Xention Limited Tetrahydro-Naphthalen und Harnstoffderivate
US7906508B2 (en) 2005-12-28 2011-03-15 Japan Tobacco Inc. 3,4-dihydrobenzoxazine compounds and inhibitors of vanilloid receptor subtype 1 (VRI) activity
US8008292B2 (en) 2004-07-15 2011-08-30 Japan Tobacco Inc. Condensed benzamide compounds and inhibitors of vanilloid receptor subtype 1 (VR1) activity
US8079960B2 (en) 2002-04-19 2011-12-20 Pelikan Technologies, Inc. Methods and apparatus for lancet actuation
US8197423B2 (en) 2002-04-19 2012-06-12 Pelikan Technologies, Inc. Method and apparatus for penetrating tissue
US8360992B2 (en) 2002-04-19 2013-01-29 Sanofi-Aventis Deutschland Gmbh Method and apparatus for penetrating tissue
US9034639B2 (en) 2002-12-30 2015-05-19 Sanofi-Aventis Deutschland Gmbh Method and apparatus using optical techniques to measure analyte levels
US9072842B2 (en) 2002-04-19 2015-07-07 Sanofi-Aventis Deutschland Gmbh Method and apparatus for penetrating tissue
US9089294B2 (en) 2002-04-19 2015-07-28 Sanofi-Aventis Deutschland Gmbh Analyte measurement device with a single shot actuator
US9248267B2 (en) 2002-04-19 2016-02-02 Sanofi-Aventis Deustchland Gmbh Tissue penetration device
US9261476B2 (en) 2004-05-20 2016-02-16 Sanofi Sa Printable hydrogel for biosensors
US9427532B2 (en) 2001-06-12 2016-08-30 Sanofi-Aventis Deutschland Gmbh Tissue penetration device
US9560993B2 (en) 2001-11-21 2017-02-07 Sanofi-Aventis Deutschland Gmbh Blood testing apparatus having a rotatable cartridge with multiple lancing elements and testing means
US9561000B2 (en) 2003-12-31 2017-02-07 Sanofi-Aventis Deutschland Gmbh Method and apparatus for improving fluidic flow and sample capture
US9694144B2 (en) 2001-06-12 2017-07-04 Sanofi-Aventis Deutschland Gmbh Sampling module device and method
US9724021B2 (en) 2002-04-19 2017-08-08 Sanofi-Aventis Deutschland Gmbh Method and apparatus for penetrating tissue
US9795747B2 (en) 2010-06-02 2017-10-24 Sanofi-Aventis Deutschland Gmbh Methods and apparatus for lancet actuation
US9820684B2 (en) 2004-06-03 2017-11-21 Sanofi-Aventis Deutschland Gmbh Method and apparatus for a fluid sampling device
US9839386B2 (en) 2002-04-19 2017-12-12 Sanofi-Aventis Deustschland Gmbh Body fluid sampling device with capacitive sensor
US10034628B2 (en) 2003-06-11 2018-07-31 Sanofi-Aventis Deutschland Gmbh Low pain penetrating member

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9226699B2 (en) 2002-04-19 2016-01-05 Sanofi-Aventis Deutschland Gmbh Body fluid sampling module with a continuous compression tissue interface surface
US7547287B2 (en) 2002-04-19 2009-06-16 Pelikan Technologies, Inc. Method and apparatus for penetrating tissue
US9314194B2 (en) 2002-04-19 2016-04-19 Sanofi-Aventis Deutschland Gmbh Tissue penetration device
US8282576B2 (en) 2003-09-29 2012-10-09 Sanofi-Aventis Deutschland Gmbh Method and apparatus for an improved sample capture device
WO2005037095A1 (en) 2003-10-14 2005-04-28 Pelikan Technologies, Inc. Method and apparatus for a variable user interface
US9775553B2 (en) 2004-06-03 2017-10-03 Sanofi-Aventis Deutschland Gmbh Method and apparatus for a fluid sampling device
EP2265324B1 (de) 2008-04-11 2015-01-28 Sanofi-Aventis Deutschland GmbH Integriertes System zur Messung von Analyten
US9375169B2 (en) 2009-01-30 2016-06-28 Sanofi-Aventis Deutschland Gmbh Cam drive for managing disposable penetrating member actions with a single motor and motor and control system
JP5644026B2 (ja) * 2009-08-11 2014-12-24 独立行政法人国立循環器病研究センター Trpv2の部分ペプチド
CA2786853A1 (en) * 2010-02-26 2011-09-01 Ventana Medical Systems, Inc. Cytogenic analysis of metaphase chromosomes
US8965476B2 (en) 2010-04-16 2015-02-24 Sanofi-Aventis Deutschland Gmbh Tissue penetration device

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998039448A2 (en) * 1997-03-07 1998-09-11 Human Genome Sciences, Inc. 186 human secreted proteins
WO1999009140A1 (en) * 1997-08-20 1999-02-25 The Regents Of The University Of California Nucleic acid sequences encoding capsaicin receptor and capsaicin receptor-related polypeptides and uses thereof
WO1999037765A1 (en) * 1998-01-27 1999-07-29 Smithkline Beecham Plc Human vanilloid receptor homologues
WO1999037675A1 (en) * 1998-01-22 1999-07-29 The Regents Of The University Of California Nucleic acid sequences encoding capsaicin receptors
EP0943683A1 (de) * 1998-03-10 1999-09-22 Smithkline Beecham Plc Menschliches Vanilloid Rezeptorhomolog Vanilrep1
EP0953638A1 (de) * 1998-03-11 1999-11-03 Synthelabo Dem menschlichen Vanilloid Rezeptor ähnlicher Kationenkanal

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998039448A2 (en) * 1997-03-07 1998-09-11 Human Genome Sciences, Inc. 186 human secreted proteins
WO1999009140A1 (en) * 1997-08-20 1999-02-25 The Regents Of The University Of California Nucleic acid sequences encoding capsaicin receptor and capsaicin receptor-related polypeptides and uses thereof
WO1999037675A1 (en) * 1998-01-22 1999-07-29 The Regents Of The University Of California Nucleic acid sequences encoding capsaicin receptors
WO1999037765A1 (en) * 1998-01-27 1999-07-29 Smithkline Beecham Plc Human vanilloid receptor homologues
EP0943683A1 (de) * 1998-03-10 1999-09-22 Smithkline Beecham Plc Menschliches Vanilloid Rezeptorhomolog Vanilrep1
EP0953638A1 (de) * 1998-03-11 1999-11-03 Synthelabo Dem menschlichen Vanilloid Rezeptor ähnlicher Kationenkanal

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CATERINA ET AL: "A capsaicin-receptor homologue with a high threshold for noxious heat", NATURE,GB,MACMILLAN JOURNALS LTD. LONDON, vol. 398, no. 398, 1 April 1999 (1999-04-01), pages 436 - 441-441, XP002105951, ISSN: 0028-0836 *
CATERINA M J ET AL: "THE CAPSAICIN RECEPTOR: A HEAT-ACTIVATED ION CHANNEL IN THE PAIN PATHWAY", NATURE,GB,MACMILLAN JOURNALS LTD. LONDON, vol. 389, 23 October 1997 (1997-10-23), pages 816 - 824, XP002075020, ISSN: 0028-0836 *

Cited By (48)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6790629B2 (en) 1997-08-20 2004-09-14 The Regents Of The University Of California Nucleic acid sequences encoding capsaicin receptor and capsaicin receptor-related polypeptides and uses thereof
US7097991B2 (en) 1997-08-20 2006-08-29 The Regents Of The University Of California Nucleic acid sequences encoding capsaicin receptor and capsaicin receptor-related polypeptides and uses thereof
EP1047711A4 (de) * 1998-01-22 2001-05-16 Univ California Nukleinsäuresequenzen, welche für capsaicin-rezeptoren kodieren
EP1047711A1 (de) * 1998-01-22 2000-11-02 The Regents of the University of California Nukleinsäuresequenzen, welche für capsaicin-rezeptoren kodieren
US7179898B1 (en) 1998-12-08 2007-02-20 Merck & Co., Inc. Human vanilloid receptor-like receptor
US6406908B1 (en) 1999-03-26 2002-06-18 Novartis Ag Vanilloid receptor
US6887978B2 (en) 1999-03-26 2005-05-03 Novartis Ag Vanilloid receptor
US6482611B1 (en) 1999-09-23 2002-11-19 Neurogen Corporation Human capsaicin receptor and uses thereof
US6867009B2 (en) 1999-09-23 2005-03-15 Neurogen Corporation Human capsaicin receptor and uses thereof
US6969721B2 (en) 2000-07-20 2005-11-29 Bristol-Myers Squibb Pharma Tricyclic-2-pyridone compounds useful as HIV reverse transcriptase inhibitors
JP2004507263A (ja) * 2000-09-02 2004-03-11 グリュネンタール・ゲゼルシャフト・ミト・ベシュレンクテル・ハフツング Vr1に対するアンチセンスオリゴヌクレオチド
WO2002018407A3 (de) * 2000-09-02 2002-10-03 Gruenenthal Gmbh Antisense oligonukleotide gegen vanilloid rezeptor 1
DE10043674A1 (de) * 2000-09-02 2002-03-21 Gruenenthal Gmbh Antisense Oligonukleotide
WO2002018407A2 (de) * 2000-09-02 2002-03-07 Grünenthal GmbH Antisense oligonukleotide gegen vanilloid rezeptor 1
US7662948B2 (en) 2000-09-02 2010-02-16 Gruenenthal Gmbh Antisense oligonucleotides against VR1
US6780650B2 (en) 2000-10-16 2004-08-24 Ortho-Mcneil Pharmaceutical, Inc. Ligand binding assays for vanilloid receptors
WO2002033411A1 (en) * 2000-10-16 2002-04-25 Ortho-Mcneil Pharmaceutical, Inc. Improved ligand binding assays for vanilloid receptors
US9937298B2 (en) 2001-06-12 2018-04-10 Sanofi-Aventis Deutschland Gmbh Tissue penetration device
US9802007B2 (en) 2001-06-12 2017-10-31 Sanofi-Aventis Deutschland Gmbh Methods and apparatus for lancet actuation
US9427532B2 (en) 2001-06-12 2016-08-30 Sanofi-Aventis Deutschland Gmbh Tissue penetration device
US9694144B2 (en) 2001-06-12 2017-07-04 Sanofi-Aventis Deutschland Gmbh Sampling module device and method
US9560993B2 (en) 2001-11-21 2017-02-07 Sanofi-Aventis Deutschland Gmbh Blood testing apparatus having a rotatable cartridge with multiple lancing elements and testing means
US9089678B2 (en) 2002-04-19 2015-07-28 Sanofi-Aventis Deutschland Gmbh Method and apparatus for penetrating tissue
US9498160B2 (en) 2002-04-19 2016-11-22 Sanofi-Aventis Deutschland Gmbh Method for penetrating tissue
US9186468B2 (en) 2002-04-19 2015-11-17 Sanofi-Aventis Deutschland Gmbh Method and apparatus for penetrating tissue
US9248267B2 (en) 2002-04-19 2016-02-02 Sanofi-Aventis Deustchland Gmbh Tissue penetration device
US8360992B2 (en) 2002-04-19 2013-01-29 Sanofi-Aventis Deutschland Gmbh Method and apparatus for penetrating tissue
US9795334B2 (en) 2002-04-19 2017-10-24 Sanofi-Aventis Deutschland Gmbh Method and apparatus for penetrating tissue
US9072842B2 (en) 2002-04-19 2015-07-07 Sanofi-Aventis Deutschland Gmbh Method and apparatus for penetrating tissue
US9089294B2 (en) 2002-04-19 2015-07-28 Sanofi-Aventis Deutschland Gmbh Analyte measurement device with a single shot actuator
US9724021B2 (en) 2002-04-19 2017-08-08 Sanofi-Aventis Deutschland Gmbh Method and apparatus for penetrating tissue
US8079960B2 (en) 2002-04-19 2011-12-20 Pelikan Technologies, Inc. Methods and apparatus for lancet actuation
US8197423B2 (en) 2002-04-19 2012-06-12 Pelikan Technologies, Inc. Method and apparatus for penetrating tissue
US9839386B2 (en) 2002-04-19 2017-12-12 Sanofi-Aventis Deustschland Gmbh Body fluid sampling device with capacitive sensor
US9907502B2 (en) 2002-04-19 2018-03-06 Sanofi-Aventis Deutschland Gmbh Method and apparatus for penetrating tissue
US9034639B2 (en) 2002-12-30 2015-05-19 Sanofi-Aventis Deutschland Gmbh Method and apparatus using optical techniques to measure analyte levels
WO2004072020A1 (en) * 2003-02-12 2004-08-26 Bayer Healthcare Ag Hydroxy-tetrahydro-naphthalenylurea derivatives
US7423175B2 (en) 2003-02-12 2008-09-09 Bayer Healthcare Ag Hydroxy-tetrahydro-naphthalenylurea derivatives
US10034628B2 (en) 2003-06-11 2018-07-31 Sanofi-Aventis Deutschland Gmbh Low pain penetrating member
EP2048132A1 (de) 2003-10-01 2009-04-15 Xention Limited Tetrahydro-Naphthalen und Harnstoffderivate
US7683076B2 (en) 2003-11-08 2010-03-23 Bayer Schering Pharma Aktiengesellschaft Tetrahydro-quinolinylurea derivatives
WO2005044802A2 (en) 2003-11-08 2005-05-19 Bayer Healthcare Ag Tetrahydro-quinolinylurea derivatives as vrl antagonists
US9561000B2 (en) 2003-12-31 2017-02-07 Sanofi-Aventis Deutschland Gmbh Method and apparatus for improving fluidic flow and sample capture
US9261476B2 (en) 2004-05-20 2016-02-16 Sanofi Sa Printable hydrogel for biosensors
US9820684B2 (en) 2004-06-03 2017-11-21 Sanofi-Aventis Deutschland Gmbh Method and apparatus for a fluid sampling device
US8008292B2 (en) 2004-07-15 2011-08-30 Japan Tobacco Inc. Condensed benzamide compounds and inhibitors of vanilloid receptor subtype 1 (VR1) activity
US7906508B2 (en) 2005-12-28 2011-03-15 Japan Tobacco Inc. 3,4-dihydrobenzoxazine compounds and inhibitors of vanilloid receptor subtype 1 (VRI) activity
US9795747B2 (en) 2010-06-02 2017-10-24 Sanofi-Aventis Deutschland Gmbh Methods and apparatus for lancet actuation

Also Published As

Publication number Publication date
WO2000029577A9 (en) 2000-09-28
AU2148000A (en) 2000-06-05
JP2002531069A (ja) 2002-09-24
CA2348479A1 (en) 2000-05-25
EP1131433A1 (de) 2001-09-12

Similar Documents

Publication Publication Date Title
EP1131433A1 (de) Mitglieder der capsaicin/vanilloid rezeptor familie und ihre anwendungen
US8133689B2 (en) Members of the capsaicin/vanilloid receptor family of proteins and uses thereof
US20030232378A1 (en) Novel toll molecules and uses therefor
US6197551B1 (en) Spoil-1 protein and nucleic acid molecules and uses therefor
US20020099197A1 (en) Novel potassium channel molecules and uses therefor
US20020028483A1 (en) Novel potassium channel molecules and uses therefor
WO2000042170A1 (en) Novel lrsg protein and nucleic acid molecules and uses therefor
US7517659B2 (en) Potassium channel molecules and uses therefor
US20020173636A1 (en) 66784, a novel human potassium channel and uses therefor
AU4101599A (en) Novel secreted and membrane-associated proteins and uses therefor
WO2002038767A2 (en) G protein-coupled receptor protein and nucleic acid molecules and uses therefor
US6756212B1 (en) Isolated proteins and nucleic acid molecules having homology to the NIP2 protein and uses thereof
WO2001000878A2 (en) A novel vascular endothelial growth factor family member and uses thereof
AU6677300A (en) Novel abc transporter and uses thereof
US20020055474A1 (en) Novel molecules of the tnf ligand superfamily and uses therefor
WO2000043514A9 (en) Human acid sensing ion channel and uses thereof
US20020120112A1 (en) Lymphoma associated molecules and uses therefor
US20020086982A1 (en) Novel EBI-3-ALT protein and nucleic acid molecules and uses therefor
EP1792913A1 (de) Neue sekretierte- und membranassoziierte Proteine und deren Verwendug
WO2000017236A2 (en) Apoptosis related protein and uses therefor

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: C2

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: C2

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

COP Corrected version of pamphlet

Free format text: PAGES 1/35-35/35, DRAWINGS, REPLACED BY NEW PAGES 1/37-37/37; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE

WWE Wipo information: entry into national phase

Ref document number: PA/a/2001/003923

Country of ref document: MX

ENP Entry into the national phase

Kind code of ref document: A

Ref document number: 2348479

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2000 582560

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1999965787

Country of ref document: EP

Ref document number: 21480/00

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 1999965787

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 1999965787

Country of ref document: EP