WO2000020635A1 - ANTISENSE MODULATION OF INTEGRIN α4 EXPRESSION - Google Patents
ANTISENSE MODULATION OF INTEGRIN α4 EXPRESSION Download PDFInfo
- Publication number
- WO2000020635A1 WO2000020635A1 PCT/US1999/018796 US9918796W WO0020635A1 WO 2000020635 A1 WO2000020635 A1 WO 2000020635A1 US 9918796 W US9918796 W US 9918796W WO 0020635 A1 WO0020635 A1 WO 0020635A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- antisense compound
- integrin
- antisense
- disease
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/04—Antineoplastic agents specific for metastasis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/33—Chemical structure of the base
- C12N2310/334—Modified C
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/341—Gapmers, i.e. of the type ===---===
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
Definitions
- the present invention provides compositions and methods for modulating the expression of integrin .
- this invention relates to antisense compounds, particularly oligonucleotides, specifically hybridizable with nucleic acids encoding human integrin ⁇ 4. Such oligonucleotides have been shown to modulate the expression of human integrin ⁇ 4.
- Inflammation is a localized protective response elicited by tissues in response to injury, infection, or tissue destruction resulting in the destruction of the infectious or injurious agent and isolation of the injured tissue.
- a typical inflammatory response proceeds as follows: recognition of an antigen as foreign or recognition of tissue damage, synthesis and release of soluble inflammatory mediators, recruitment of inflammatory cells to the site of infection or tissue damage, destruction and removal of the invading organism or damaged tissue, and deactivation of the system once the invading organism or damage has been resolved.
- the normal, homeostatic mechanisms which attenuate the inflammatory responses are defective, resulting in damage and destruction of normal tissue.
- Very late ant ⁇ gen-4 (also called VLA-4, 4 ⁇ l or CD49d/CD29) is a homodimeric adhesion receptor which is composed of noncovalently linked ⁇ and ⁇ subunits and serves to mediate leukocyte adhesion to vascular cell adhesion molecule-1 (VCAM-1) which is expressed on cytokme-stimulated endothelial cells.
- VCAM-1 vascular cell adhesion molecule-1
- This interaction between VCAM-1 and VLA-4 contributes to leukocyte extravasation in acute and chronic inflammatory conditions including multiple sclerosis (MS), rheumatoid arthritis, asthma, psoriasis and allergy.
- Fibronectin is also a ligand for VLA- . Fibronectm plays an important role in many processes including embryonic development, wound healing and tumor cell metastasis (Guan, J.-L. and Hynes, R.O., Cell 1990, 60, 53-61).
- VLA-4 is a heterodimer of an ⁇ 4 integrin and a ⁇ l integrin.
- the ⁇ 4 integrin can also heterodimerize with a ⁇ 7 integrin chain to form integrin ⁇ 4 ⁇ 7 which is known as a ucosal homing receptor because its primary ligand is the mucosal vascular addressing MadCAM-1.
- Integrin 4 ⁇ 7 identifies a subset of memory T cells with a tropism for the intestinal tract, whereas integrin 4 ⁇ l (VLA-4) is constitutively expressed on most mononuclear leukocytes, but not on circulating neutrophils.
- VLA-4 is a potential therapeutic target for inflammatory diseases, including atherosclerosis, allergy and asthma, arthritis, and tumor cell metastasis (Kassner, P.D., et al, Adv. Exp . Med . Biol . 1992, 323, 163-170) .
- VLA-4 has also been found to play a role in promoting adhesion ( i . e . , retention) of hemopoietic stem cells in the bone marrow (Papayannopoulou and Nakamoto, Proc . Na tl . Acad . Sci . U. S . A . 1993, 90, 9374-9378).
- Asthma is an inflammatory disease associated with eosmophil infiltration into the lung.
- VLA-4 is expressed on eos ophils.
- Metzger, W.J. (Springer Semm . Immunopa thol . 1995, 16, 467-478) used a rabbit model of asthma to demonstrate that both an ant ⁇ -VLA-4 antibody and a CS-1 peptide could reduce eosmophil infiltration into the lung and reduce the development of asthma.
- Rheumatoid arthritis is another disease associated with inflammation. Muller-Ladner, U., et al .
- VLA-4 also plays a role m ⁇ rumber of autoimmune diseases. Marazuela, M., et al . , ( E r J Immunol . 1994, 24, 2483-2490) found elevated expression of both tne VLA-4/VCAM-1 and LFA-l/ICAM-1, 3 pathways m Graves' disease and Hashimoto's thyroiditis, suggesting that both play a role in these diseases. VLA-4 may also play a role in multiple sclerosis.
- VLA-4 Antibodies to VLA-4 have been found to prevent experimental autoimmune encephalomyelitis (EAE) , an experimentally induced disease with similarities to multiple sclerosis (Yednock, T.A., et al., Na ture 1992, 356, 63-66). Elevated expression levels of VLA-4 were detected in a patient with systemic lupus erythematosus (Takeuchi, T., et al . , Cl m . Rheuma tology 1995, 14, 370-374) . VLA-4 is involved in cellular responses to two surgical procedures, transplantation and vascular reconstructive procedures. Allograft rejection is a common response to transplantation of a foreign tissue.
- EAE experimental autoimmune encephalomyelitis
- CS-1 peptides have been found to prevent both acute re ection (Coito, A.J., et al., Transplan ta tion 1998, 65, 699-706) and chronic rejection (Korom, S., et al . , Transplan ta tion 1998, 65, 854-859) by blocking VLA-4 binding to fibronectm.
- acute re ection Coito, A.J., et al., Transplan ta tion 1998, 65, 699-706
- Chronic rejection Kerrom, S., et al . , Transplan ta tion 1998, 65, 854-859
- mtimal hyperplasia which results from the accumulation of monocytes and lymphocytes.
- Lumsden, A.B., et al. (J. Vase . Surg. 1997, 26, 87-93) demonstrated that an ant ⁇ -VLA-4 antibody reduced mtimal hyperplasia.
- VLA-4 also plays a role m tumor cell metastasis. In metastasis, tumor cells must cross the extracellular matrix, enter the circulatory system and invade into new tissue. Bao, L. et al . , ( Differen tia tion 1993, 52, 239-246) detected VLA-4 expression of many human tumor cell lines, including a breast carcinoma, melanoma, and renal carcinoma, and found that the presence of VLA-4 correlated well with metastatic potential. Kawaguchi, S. et al . , ( Jpn J. Cancer Res . 1992, 83, 1304-1316) transfected a cDNA encoding the ⁇ 4 subunit of VLA-4 into a human fibrosarcoma cell line.
- VLA-4 is involved m promoting retention of hemopoietic progenitor cells m the bone marrow.
- Antibodies to mtegrm ⁇ 4 have been found to selectively mobilize progenitor/stem cells into the bloodstream (Papayannopoulou and Nakamoto, Proc . Na tl . Acad . Sci . U. S . A . 1993, 90, 9374-9378) .
- This mobilization is of clinical relevance in the field of bone marrow transplantion as it obviates the need for marrow harvesting by making hemopoietic progenitor cells available m the circulating blood.
- steroids and other antnnflammatory drugs are effective in treating inflammatory diseases and conditions, long-term usage often leads to side effects such as increased risk of infection caused by impairment of phagocytic leukocyte migration and function.
- inhibition of the function of the ⁇ l mtegrm chain may be associated with increased susceptibility to infections, as demonstrated by a ⁇ l (also called CD18) monoclonal antibody in rabbits (Foster, C.A., 1996, J. Allergy Clin . Immunol .
- VLA-4 potential therapeutic interventions targeting VLA-4 include monoclonal antibodies, and peptide antagonists.
- Leger, O.J.P., et al . Human Antibodies 1997, 8, 3-16
- CS-1 peptide antagonists have been described by Jackson, D.Y., et al . (J. Med . Chem . 1997, 40, 3359-3369) .
- Hayashi et al . Cell Struct . Funct . 1991, 16, 241-249
- Antisense oligonucleotides targeted to various integrins have been used as tools to dissect the functional interactions of integrins in complex settings.
- EP patent applicatior ⁇ l ⁇ s et al . discloses 3' derivatized oligonucleotide analogs, including one sequence targeted to the ⁇ l subunit of VLA- .
- Antisense oligonucleotides are believed to represent a useful means of modulating the expression of mtegrm ⁇ 4 and of treating diseases associated with its expression.
- the present invention is directed to antisense compounds, particularly oligonucleotides, which are targeted to a nucleic acid encoding mtegrm ⁇ 4 , and which modulate the expression of mtegrm ⁇ 4.
- Pharmaceutical and other compositions comprising the antisense compounds of the invention are also provided. Further provided are methods of modulating the expression of mtegrm ⁇ 4 in cells or tissues comprising contacting said cells or tissues with one or more of the antisense compounds or compositions of the invention.
- the present invention employs oligomeric antisense compounds, particularly oligonucleotides, for use in modulating the function of nucleic acid molecules encoding mtegrm ⁇ 4, ultimately modulating the amount of mtegrm ⁇ 4 produced. This is accomplished by providing antisense compounds which specifically hybridize with one or more nucleic acids encoding mtegrm ⁇ 4.
- target nucleic acid and “nucleic acid encoding mtegrm ⁇ 4" encompass DNA encoding mtegrm ⁇ 4 , RNA (including pre-mRNA and mRNA) transcribed from such DNA, and also cDNA derived from such RNA.
- the specific hybridization of an oligomeric compound with its target nucleic acid interferes with the normal function of the nucleic acid.
- This modulation of function of a target nucleic acid by compounds which specifically hybridize to it is generally referred to as "antisense".
- the functions of DN to be interfered with include replication and transcription.
- the functions of RNA to be interfered with include all vital functions such as, for example, translocation of the RNA tc the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in or facilitated by the RNA.
- the overall effect of such interference with target nucleic acid function is modulation of the expression of mtegrm ⁇ 4.
- modulation means either an increase (stimulation) or a decrease (inhibition) in the expression of a gene.
- inhibition is the preferred form of modulation of gene expression and mRNA is a preferred target.
- Targeting an antisense compound to a particular nucleic acid is a multistep process.
- the process usually begins with the identification of a nucleic acid sequence whose function is to be modulated. This may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent.
- the target is a nucleic acid molecule encoding mtegrm ⁇ 4.
- the targeting process also includes determination of a site or sites within this gene for the antisense interaction to occur such that the desired effect, e . g.
- a preferred mtragenic site is the region encompassing the translation initiation or termination codon of the open reading frame (ORF) of the gene. Since, as is known in the art, the translation initiation codon is typically 5'-AUG (m transcribed mRNA molecules; 5'-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the "AUG codon, " the "start codon” or the “AUG start codon” .
- translation initiation codon having the RNA sequence 5'-GUG, 5'-UUG or 5'-CUG, and 5'-AUA, 5'-ACG and 5'-CUG have been shown to function in vivo.
- translation initiation codon and “start codon” can encompass many codon sequences, even though the initiator ammo acid in each instance is typically methionine (in eukaryotes) or formylmethionme (in prokaryotes) .
- start codon and “translation initiation codon” refer to the codon or codons that are used m vivo to initiate translation of an mRNA molecule transcribed from a gene encoding mtegrm ⁇ 4 , regardless of the sequence (s) of such codons.
- a translation termination codon (or "stop codon”) of a gene may have one of three sequences, i . e . , 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences are 5'-TAA, 5'-TAG and 5'-TGA, respectively) .
- the terms "start codon region” and “translation initiation codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides m either direction ( i . e . , 5' or 3') from a translation initiation codon.
- stop codon region and “translation termination codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation termination codon .
- Other target regions include the 5' untranslated region (5'UTR) , known in the art to refer to the portion of an mRNA in the 5' direction from the translation initiation codon, and thus including nucleotides between the 5' cap site and the translation initiation codon of an mRNA or corresponding nucleotides on the gene, and the 3' untranslated region (3'UTR), known m the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA or corresponding nucleotides on the gene.
- 5'UTR 5' untranslated region
- 3'UTR known m the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon
- the 5' cap of an mRNA comprises an N7-methylated guanos e residue joined to the 5'-most residue of the mRNA via a 5'-5' triphosphate linkage.
- the 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap.
- the 5' cap region may also be a preferred target region.
- mRNA splice sites i.e., mtron- exon junctions
- mtron- exon junctions may also be preferred target regions, and are particularly useful in situations where aberrant splicing is implicated m disease, or where an overproduction of a particular mRNA splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred targets. It has also been found that mtrons can also be effective, and therefore preferred, target regions for antisense compounds targeted, for example, to DNA or pre-mRNA.
- oligonucleotides are chosen which are sufficiently complementary to the target, i . e . , hybridize sufficiently well and with sufficient specificity, to give the desired effect.
- hybridization means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases.
- adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds.
- “Complementary,” as used herein, refers to the capacity for precise pairing between two nucleotides.
- oligonucleotide and the DNA or RNA are considered to be complementary to each other at that position.
- the oligonucleotide and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other.
- “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the oligonucleotide and the DNA or RNA target.
- an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable.
- An antisense compound is specifically hybridizable when binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA to cause a loss of utility, and there is a sufficient degree of complementarity to avoid non-specific bindm ⁇ o? ""he antisense compound to non-target sequences uno in which specific binding is desired, i . e . , under pnysiological conditions in the case of in vivo assays or therapeutic treatment, or m the case of in vi tro assays, under conditions in which the assays are performed.
- Antisense compounds are commonly used as research reagents and diagnostics. For example, antisense oligonucleotides, which are able to inhibit gene expression with seventeen specificity, are often used by those of ordinary skill to elucidate the function of particular genes. Antisense compounds are also used, for example, to distinguish between functions of various members of a biological pathway. Antisense modulation has, therefore, been harnessed for research use.
- Antisense oligonucleotides have been employed as therapeutic moieties in the treatment of disease states m animals and man. Antisense oligonucleotides have been safely and effectively administered to humans and numerous clinical trials are presently underway. It is thus established that oligonucleotides can be useful therapeutic modalities that can be configured to be useful in treatment regimes for treatment of cells, tissues and animals, especially humans.
- oligonucleotide refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof.
- RNA ribonucleic acid
- DNA deoxyribonucleic acid
- oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions which function similarly.
- backbone covalent internucleoside
- modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases.
- antisense oligonucleotides are a preferred form of antisense compound
- the present invention comprehends other oligomeric antisense compounds, including but not limited to oligonucleotide mimetics such as are described below.
- the antisense compounds in accordance with this invention preferably comprise from about 8 to about 30 nucleobases.
- Particularly preferred are antisense oligonucleotides comprising from about 8 to about 30 nucleobases (i.e. from about 8 to about 30 linked nucleosides) .
- a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base.
- Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside.
- the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar.
- the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn the respective ends of this linear polymeric structure can be further joined to form a circular structure, however, open linear structures are generally preferred.
- the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide.
- the normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage .
- oligonucleotides containing modified backbones or non-natural internucleoside linkages include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.
- modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides .
- Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, ammoalkylphosphotri- esters, methyl and other alkyl phosphonates including 3'- alkylene phosphonates and chiral phosphonates, phosphmates , phosphoramidates including 3'-ammo phosphoramidate and ammoalkylphosphoramidates, thionophosphoramidates , thiono- alkylphosphonates, thionoalkylphosphotriesters, and borano- phosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'.
- Various salts, mixed salts and free acid forms are also included.
- Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
- oligonucleosides include those having morpholmo linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimmo and methylenehydrazmo backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, 0, S and CH 2 component parts .
- Representative United States patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Patents 5,034,506; 5,166,315; 5,185,444
- both the sugar and the internucleoside linkage, i . e . , the backbone, of the nucleotide units are replaced with novel groups.
- the base units are maintained for hybridization with an appropriate nucleic ac d target compound.
- an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA) .
- PNA peptide nucleic acid
- the sugar- backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an ammoethylglycme backbone.
- nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
- Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S.: 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al . , ( Science, 1991, 254, 1497-1500) .
- oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones and in particular -CH 2 -NH-0-CH 2 -, -CH 2 -N (CH 3 ) -0-CH 2 - [known as a methylene
- Modified oligonucleotides may also contain one or more substituted sugar moieties.
- Preferred oligonucleotides comprise one of the following at the 2' position: OH; F; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S- or N-alkynyl; or 0-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C ⁇ to C c alkyl or C- to C 10 alkenyl and alkynyl.
- n and m are from 1 to about 10.
- oligonucleotides comprise one of the following at the 2' position: C x to C 10 lower alkyl, substituted lower alkyl, alkaryl, araikyl, O-alkaryl or 0- aralkyl, SH, SCH ⁇ , OCN, Cl, Br, CN, CF , OCF , SOCH ⁇ , S0 2 CH , 0N0 2 , N0 2 , N 3 , NH , heterocycloalkyl, heterocycloalkaryl, a moalkylammo, polyalkylammo, substituted silyl, an RNA cleaving group, a reporter group, an mtercalator, a group for improving the pharmacokmetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
- a preferred modification includes 2'-methoxyethoxy (2 ' -0-CH 2 CH 2 OCH 3 , also known as 2'-0-(2- methoxyethyl) or 2'-MOE) (Martin et al . , Hel v. Chim . Acta , 1995, 78, 486-504) i . e . , an alkoxyalkoxy group.
- a further preferred modification includes 2 ' -dimethylammooxyethoxy, i . e .
- a 0 (CH 2 ) 2 ON (CH 3 ) 2 group also known as 2'-DMAOE, as described in United States patent application Serial Number 09/016,520, filed on January 30, 1998, which is commonly owned with the instant application and the contents of which are herein incorporated by reference.
- Oligonucleotides may also include nucleobase (often referred to m the art simply as “base”) modifications or substitutions.
- nucleobases include the purme bases adenme (A) and guanme (G), and the pyrimidme bases thymine (T) , cytosme (C) and uracil (U) .
- Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosme (5-me-C), 5- hydroxymethyl cytosme, xanthme, hypoxanthme, 2- ammoadenme, 6-methyl and other alkyl derivatives of adenme and guanme, 2-propyl and other alkyl derivatives of adenme and guanme, 2-th ⁇ ourac ⁇ l, 2-th ⁇ othymme and 2-th ⁇ ocytosme, 5-halourac ⁇ l and cytosme, 5-propynyl uracil and cytosme, 6- azo uracil, cytosme and thymine, 5 ⁇ urac ⁇ l (pseudouracil) , 4- thiouracil, 8-halo, 8-ammo, 8-th ⁇ ol, 8-th ⁇ oalkyl, 8-hydroxyl and other 8-subst ⁇ tuted adenmes and guanmes, 5-halo particularly 5-
- nucleobases include those disclosed in United States Patent No. 3,687,808, those disclosed in The Concise Encycl opedia Of Polymer Science And Engineering, , Kroschwitz, J.I., ed. John Wiley & Sons, 1990, 858-859 those disclosed by Englisch et al . , (Angewandte Chemie, IE, 1991, 30, 613), and those disclosed by Sanghvi, Y.S., ( An tisense Research and Applications, 15,289-302), and Crooke, S.T. and Lebleu, B., ed., (CRC Press, 1993) . Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention.
- 5- substituted pyrimidmes 6-azapyr ⁇ m ⁇ dmes and N-2, N-6 and 0-6 substituted purines, including 2-ammopropyladenme, 5- propynyluracil and 5-propynylcytosme .
- 5-methylcytosme substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds., Antisense Research and Applications 1993, 276-278) and are presently preferred base substitutions, even more particularly when combined with 2'-0-methoxyethyl sugar modifications .
- oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide.
- moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al . , Bioorg. Med.
- a thioether e.g., hexyi-S-trmylthioi (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al . , Nucl. Acids Res. 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al .
- a phospholipid e.g., di-hexadecyl-rac-glycerol or triethyl- ammonium 1, 2-d ⁇ -0-hexadecyl-rac-glycero-3-H-phosphonate
- the present invention also includes antisense compounds which are chimeric compounds.
- "Chimeric” antisense compounds or “chimeras,” m the context of this invention, are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i . e. , a nucleotide in the case of an oligonucleotide compound.
- oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid.
- An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA : DNA or RNA:RNA hybrids.
- RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA: DNA duplex.
- RNA target Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used, compared to phosphorothioate deoxyoligonucleotides hybridizing to the same target region.
- Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known m the art.
- Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers . Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S.
- the antisense compounds used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis.
- Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, CA) . Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives.
- the antisense compounds of the invention are synthesized in vi tro and do not include antisense compositions of biological origin, or genetic vector constructs designed to direct the in vivo synthesis of antisense molecules.
- the compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption.
- Representative United States patents that teach the preparation of such uptake distribution and/or absorption assisting formulations include but are not limited to, U.S. Patents 5,108,921; 5,354,844
- the antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents .
- prodrug indicates a therapeutic agent that is prepared m an inactive form that is converted to an active form ( i . e . , drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions.
- prodrug versions of the oligonucleotides of the invention are prepared as SATE [ (S-acetyl-2-th ⁇ oethyl) phosphate] derivatives according to the methods disclosed in WO 93/24510 to Gossel et al . , published December 9, 1993 or in WO 94/26764 to Imbach et al.
- pharmaceutically acceptable salts refers to physiologically and pharmaceutically acceptable salts of tne compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
- Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines.
- metals used as cations are sodium, potassium, magnesium, calcium, and the like.
- suitable amines are N, N'-dibenzylethylenediamme, cnloroprocame, cholme, diethanolam e , dicyclohexylamine, ethylenediamme, N-methylglucamme, and procame (see, for example, Berge et al. J. of Pharma Sci . , 1977, 66, 1-19).
- the base addition salts of said acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in the conventional manner.
- the free acid form may be regenerated by contacting the salt form with an acid and isolating the free acid in the conventional manner.
- the free acid forms differ from their respective salt forms somewhat in certain physical properties such as solubility m polar solvents, but otherwise the salts are equivalent to their respective free acid for purposes of the present invention.
- a "pharmaceutical addition salt” includes a pharmaceutically acceptable salt of an acid form of one of the components of the compositions of the invention. These include organic or inorganic acid salts of the amines.
- Preferred acid salts are the hydrochlo ⁇ des, acetates, salicylates, nitrates and phosphates.
- Other suitable pharmaceutically acceptable salts are well known to those skilled in the art and include basic salts of a variety of inorganic and organic acids, such as, for example, with inorganic acids, such as for example hydrochloric acid, hydrobromic acid, sulfuric acid or phosphoric acid; with organic carboxylic, sulfomc, sulfo or phospho acids or N-substituted sulfamic acids, for example acetic acid, propionic acid, glycolic acid, succimc acid, maleic acid, hydroxymaleic acid, methylmaleic acic, fumaric acid, malic acid, tarta ⁇ c acid, lactic acid, oxalic acid, gluconic acid, gluca ⁇ c acid, glucuronic acid, citric acid, benzoic acid, cmnamic acid, mandelic acid, salicylic acid,
- Pharmaceutically acceptable salts of compounds may also be prepared with a pharmaceutically acceptable cation.
- Suitable pharmaceutically acceptable cations are well known to those skilled in the art and include alkaline, alkaline earth, ammonium and quaternary ammonium cations. Carbonates or hydrogen carbonates are also possible.
- salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyammes such as spermine and spermid e, etc.
- acid addition salts formed with inorganic acids for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like
- salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, raaleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, poly
- the antisense compounds of the present invention can be utilized for diagnostics, therapeutics, prophylaxis and as research reagents and kits.
- an animal preferably a human, suspected of having a disease or disorder which can be treated by modulating the expression of mtegrm ⁇ 4 is treated by administering antisense compounds accordance with this invention.
- the compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of an antisense compound to a suitable pharmaceutically acceptable diluent or carrier.
- Use of the antisense compounds and methods of the invention may also be useful prophylactically, e.g., to prevent or delay infection, inflammation or tumor formation, for example.
- the antisense compounds of the invention are useful for research and diagnostics, because these compounds hybridize to nucleic acids encoding mtegrm ⁇ 4 , enabling sandwich and other assays to easily be constructed to exploit this fact.
- Hybridization of the antisense oligonucleotides of the invention with a nucleic acid encoding mtegrm ⁇ 4 can be detected by means known in the art. Such means may include conjugation of an enzyme to the oligonucleotide, radiolabelling of the oligonucleotide or any other suitable detection means. Kits using such detection means for detecting the level of mtegrm ⁇ 4 in a sample may also be prepared .
- the present invention also includes pharmaceutical compositions and formulations which include the antisense compounds of the invention.
- the pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; mtratracheal, mtranasal, epidermal and transdermal), oral or parenteral.
- Parenteral administration includes intravenous, mtraarterial , subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., mtrathecal or mtraventricular, administration.
- Oligonucleotides with at least one 2'-0- methoxyethyl modification are believed to be particularly useful for oral administration.
- compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
- Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
- Coated condoms, gloves and the like may also be useful.
- compositions and formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
- compositions and formulations for parenteral, mtrathecal or mtraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
- Pharmaceutical compositions and/or formulations comprising the oligonucleotides of the present invention may also include penetration enhancers in order to enhance the alimentary delivery of the oligonucleotides.
- Penetration enhancers may be classified as belonging to one of five broad categories, i.e., fatty acids, bile salts, chelating agents, surfactants and non-surfactants (Lee et al .
- Penetration enhancers are described in pending United States patent application 08/886,829, filed on July 1, 1997, and pending United States patent application 08/961,469, filed on October 31, 1997, both of which are commonly owned with the instant application and both of which are herein incorporated by reference.
- fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid, my ⁇ stic acid, palmitic acid, stearic acid, linoleic acid, lmolenic acid, dicaprate, tricaprate, recmleate, monoolem (a.k.a.
- bile salt includes any of the naturally occurring components of bile as well as any of their synthetic derivatives .
- bile salts are described in pending United States patent application 08/886,829, filed on July 1, 1997, which is commonly owned with the instant application and which is herein incorporated by reference.
- a presently preferred bile salt is chenodeoxycholic acid (CDCA) (Sigma Chemical Company,
- Complex formulations comprising one or more penetration enhancers may be used.
- bile salts may be used in combination with fatty acids to make complex formulations.
- Preferred combinations include CDCA combined with sodium caprate or sodium laurate (generally 0.5 to 5%) .
- Chelating agents include, but are not limited to, disodium ethylenediammetetraacetate (EDTA) , citric acid, salicylates (e.g., sodium salicylate, 5-methoxysal ⁇ cylate and homovanilate) , N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-diketones (enamines) (Lee et al., Cri tical Reviews in Therapeuti c Drug Carrier Sys tems, 1991, 8, 92-192; Muranishi, Cri ti ca l Reviews in Tnerapeutic Drug Carrier Sys tems, 1990, 7, 1-33; Buur et al., J. Con trol Rel . , 1990, 14, 43-51). Chelating agents have the added advantage of also serving as DNase inhibitors.
- EDTA disodium ethylenediammetetraacetate
- citric acid citric acid
- salicylates e.
- Surfactants include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether (Lee et al., Cri tical Reviews m Therapeutic Drug Carrier Sys tems, 1991, 8, 92-191) ; and perfluorochemical emulsions, such as FC-43 (Takahashi et al., J. Pharm . Pharmacol . , 1988, 40, 252-257).
- Non-surfactants include, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives
- non-steroidal anti-mflammatory agents such as diclofenac sodium, mdomethacm and phenylbutazone (Yamashita et al . , J. Pharm . Pharma col . , 1987, 39, 621-626) .
- carrier compound refers to a nucleic acid, or analog thereof, which is inert ( i . e . , does not possess biological activity per se) but is recognized as a nucleic acid by m vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the oiologically active nucleic acid or promoting its removal from circulation.
- the coadmmistration of a nucleic acid and a carrier compound typically with an excess of the latter substance, can result a substantial reduction of the amount of nucleic acid recovered m the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor.
- the recovery of a partially phosphorothioated oligonucleotide in hepatic tissue is reduced when it is coadmmistered with polymosmic acid, dextran sulfate, polycytidic acid or 4-acetam ⁇ do-4 '-lsothiocyano-stilbene- 2 , 2'-d ⁇ sulfon ⁇ c acid (Miyao et al . , An tisense Res . Dev. , 1995, 5, 115-121; Takakura et al . , Antisense & Nucl . Acid Drug Dev. , 1996, 6, 177-183) .
- a "pharmaceutically acceptable carrier” is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal.
- the pharmaceutically acceptable carrier may be liquid or solid and is selected with the planned manner of administration in mmd so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition.
- Typical pharmaceutically acceptable carriers include, but are not limited to, binding agents (e.g., pregelatmized maize starch, polyvmyl- pyrrolidone or hydroxypropyl methylcellulose, etc.); fillers
- lubricants e.g., lactose and other sugars, microcrystallme cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.
- lubricants e.g., lactose and other sugars, microcrystallme cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.
- compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels.
- the compositions may contain additional compatible pharmaceutically-active materials such as, e.g., antipru ⁇ tics, astringents, local anesthetics or anti-mflammatory agents, or may contain additional materials useful m physically formulating various dosage forms of the composition of present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
- additional compatible pharmaceutically-active materials such as, e.g., antipru ⁇ tics, astringents, local anesthetics or anti-mflammatory agents
- additional materials useful m physically formulating various dosage forms of the composition of present invention such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
- such materials when added, should not unduly interfere with the biological activities of the components of the compositions of the invention.
- colloidal dispersion systems may be used as delivery vehicles to enhance the m vi vo stability of the compounds and/or to target the compounds to a particular organ, tissue or cell type.
- Colloidal dispersion systems include, but are not limited to, macromolecule complexes, nanocapsules, microspheres, beads and lipid-based systems including oil-m- water emulsions, micelles, mixed micelles, liposomes and lipid: oligonucleotide complexes of uncharacte ⁇ zed structure.
- a preferred colloidal dispersion system is a plurality of liposomes.
- Liposomes are microscopic spheres having an aqueous core surrounded by one or more outer layer (s) made up of lipids arranged in a bilayer configuration (see, generally, Chonn et al . , Curren t Op . Bio tech . , 1995, 6, 698-708).
- Liposome preparation is described m pending United States patent application 08/961,469, filed on October 31, 1997, which is commonly owned with the instant application and which is herein incorporated by reference.
- Certain embodiments of the invention provide for liposomes and other compositions containing (a) one or more antisense compounds and (b) one or more other chemotherapeutic agents which function by a non-antisense mechanism.
- chemotherapeutic agents include, but are not limited to, anticancer drugs such as daunorubicm, dactmomycm, doxorubicm, bleomycm, mitomycm, nitrogen mustard, chlorambucil, melphalan, cyclophosphamide, 6-mercaptopurme, 6-th ⁇ oguanme, cytarabme (CA) , 5-fluorouracil (5-FU), floxu ⁇ dme (5-FUdR), methotrexate (MTX) , colchicme, vinc ⁇ stme, v blastme, etoposide, teniposide, cisplatm and diethylstilbestrol (DES) .
- anticancer drugs such as daunor
- Anti-mflammatory drugs including but not limited to nonsteroidal anti-mflammatory drugs and corticosteroids
- antiviral drugs including but not limited to ribivirm, vidarabme, acyclovir and ganciclovir
- Other non-antisense chemotherapeutic agents are also withm the scope of this invention. Two or more combined compounds may be used together or sequentially.
- compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target. Two or more combined compounds may be used together or sequentially.
- the formulation of therapeutic compositions and their subsequent administration is believed to be within the skill of those m the art. Dosing is dependent on severity and responsiveness of the disease state to oe treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient.
- Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on ECr, 0 s found to be effective in in vi tro and m vivo animal models. In general, dosage is from 0.01 ug to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues.
- oligonucleotide is administered in maintenance doses, ranging from 0.01 ug to 100 g per kg of body weight, once or more daily, to once every 20 years. While the present invention has been described with specificity in accordance with certain of its preferred embodiments, the following examples serve only to illustrate the invention and are not intended to limit the same.
- 2'-Deoxy and 2'-methoxy beta-cyanoethyldnsopropyl phosphoramidites are purchased from commercial sources (e.g. Chemgenes, Needham MA or Glen Research, Inc. Sterling VA) .
- Other 2'-0-alkoxy substituted nucleoside amidites are prepared as described in U.S. Patent 5,506,351, herein incorporated by reference.
- the standard cycle for unmodified oligonucleotides is utilized, except the wait step after pulse delivery of tetrazole and base is increased to 360 seconds.
- (5-Me-C) nucleotides are synthesized according to published methods (Sanghvi, et. al., Nucl eic Acids Research , 1993, 21, 3197-3203) using commercially available phosphoramidites (Glen Research, Sterling, VA or ChemGenes, Needham, MA) . 2 ' -Fluoro amidites
- 2'-fluoro oligonucleotides are synthesized as described previously (Kawasaki, et. al . , J. Med . Chem . , 1993, 36, 831- 841) and United States patent 5,670,633, herein incorporated by reference. Briefly, the protected nucleoside N6-benzoyl-2' deoxy-2'-fluoroadenosme is synthesized utilizing commercially available 9-beta-D-arabmofuranosyladenine as starting material and by modifying literature procedures whereby the 2'-alpha-fluoro atom is introduced by a S 2-d ⁇ splacement of a 2'-beta-tr ⁇ tyl group.
- N6-benzoyl-9-beta-D- arabmofuranosyladenine is selectively protected m moderate yield as the 3', 5'-d ⁇ tetrahydropyranyl (THP) intermediate.
- THP 3', 5'-d ⁇ tetrahydropyranyl
- Deprotection of the THP and N6-benzoyl groups is accomplished using standard methodologies and standard methods are used to obtain the 5'-d ⁇ methoxytntyl- ( DMT) and 5'-DMT-3'- phosphoramidite intermediates.
- TPDS tetraisopropyldisiloxanyl
- 9-beta-D-arabmofuranosylguanme as starting material, and conversion to the intermediate dnsobutyryl- arabmofuranosylguanosme .
- Deprotection of the TPDS group is followed by protection of the hydroxyl group with THP to give diisobutyryl di-THP protected arabmofuranosylguanme .
- Selective O-deacylation and t ⁇ flation is followed by treatment of the crude product with fluoride, then deprotection of the THP groups .
- Standard methodologies are used to obtain the 5'-DMT- and 5'-DMT-3'-phosphoram ⁇ d ⁇ tes .
- Synthesis of 2'-deoxy-2'-fluorouridme is accomplished by the modification of a literature procedure in which 2,2'- anhydro-1-beta-D-arab ⁇ nofuranosylurac ⁇ l is treated with 70% hydrogen fluoride-pyridme . Standard procedures are used to obtain the 5'-DMT and 5'-DMT-3'phosphoram ⁇ d ⁇ tes .
- 2'-Fluorodeoxycyt ⁇ dine 2'-deoxy-2'-fluorocytidme is synthesized via ammation of 2'-deoxy-2'-fluorouridme, followed by selective protection to give N4-benzoyl-2'-deoxy-2'-fluorocytidme . Standard procedures are used to obtain the 5'-DMT and 5'-DMT- 3'phosphoram ⁇ d ⁇ tes .
- 2'-0-Methoxyethyl-subst ⁇ tuted nucleoside amidites were prepared as follows, or alternatively, as per the methods of Martin, P., ( Hel veti ca Chimica Acta , 1995, 78, 486-504).
- P0C1 3 was added dropwise, over a 30 mmute period, to the stirred solution maintained at 0-10°C, and the resulting mixture stirred for an additional 2 hours.
- the first solution was added dropwise, over a 45 mmute period, to the latter solution.
- the resulting reaction mixture was stored overnight in a cold room. Salts were filtered from the reaction mixture and the solution was evaporated. The residue was dissolved in EtOAc
- the filtrate was washed with 1x300 mL of NaHCO, and 2x300 mL of saturated NaCl, dried over sodium sulfate and evaporated.
- N4-Benzoyl-2'-0-methoxyethyl-5'-0-d ⁇ methoxytrityl-5 ⁇ methylcytidine (74 g, 0.10 M) was dissolved in CH 2 C1 2 (1 L) .
- the thiation wait step was increased to 68 sec and was followed by the capping step.
- oligonucleotides were purified by precipitating twice with 2.5 volumes of ethanol from a 0.5 M NaCl solution. Phosphmate oligonucleotides are prepared as described m U.S. Patent 5,508,270, herein incorporated by reference.
- Alkyl phosphonate oligonucleotides are prepared as described in U.S. Patent 4,469,863, herein incorporated by reference .
- 3'-Deoxy-3'-methylene phosphonate oligonucleotides are prepared as described m U.S. Patents 5,610,289 or 5,625,050, herein incorporated by reference.
- Phosphoramidite oligonucleotides are prepared as described in U.S. Patent, 5,256,775 or U.S. Patent 5,366,878, herein incorporated by reference.
- Alkylphosphonothioate oligonucleotides are prepared as described in published PCT applications PCT/US94 /00902 and PCT/US93/06976 (published as WO 94/17093 and WO 94/02499, respectively), herein incorporated by reference.
- 3'-Deoxy-3'-am ⁇ no phosphoramidate oligonucleotides are prepared as described m U.S. Patent 5,476,925, herein incorporated by reference.
- Phosphotriester oligonucleotides are prepared as described in U.S. Patent 5,023,243, herein incorporated by reference .
- Borano phosphate oligonucleotides are prepared as described in U.S. Patents 5,130,302 and 5,177,198, both herein incorporated by reference.
- Formacetal and thioformacetal linked oligonucleosides are prepared as described m U.S. Patents 5,264,562 and 5,264,564, herein incorporated by reference.
- Ethylene oxide linked oligonucleosides are prepared as described in U.S. Patent 5,223,618, herein incorporated by reference .
- PNAs Peptide nucleic acids
- PNA Peptide nucleic acids
- Chimeric oligonucleotides, oligonucleosides or mixed oligonucleotides/oligonucleosides of the invention can be of several different types. These include a first type wherein the "gap" segment of linked nucleosides is positioned between 5' and 3' "wing" segments of linked nucleosides and a second "open end” type wherein the "gap” segment is located at either the 3' or the 5' terminus of the oligomeric compound. Oligonucleotides of the first type are also known m the art as “gapmers” or gapped oligonucleotides. Oligonucleotides of the second type are also known in tne art as “hemimers” or “wmgmers” .
- Oligonucleotides are synthesized using the automated synthesizer and 2'-deoxy-5'- d ⁇ methoxyt ⁇ tyl-3'-0-phosphoram ⁇ d ⁇ te for the DNA portion and 5'-d ⁇ methoxytr ⁇ tyl-2'-0-methyl-3'-0-phosphoram ⁇ d ⁇ te for 5' and 3' wings.
- the standard synthesis cycle is modified by increasing the wait step after the delivery of tetrazole and base to 600 s repeated four times for RNA and twice for 2'-0- methyl .
- the fully protected oligonucleotide is cleaved from the support and the phosphate group is deprotected in 3:1 Ammonia/Ethanol at room temperature overnight then lyophilized to dryness.
- chimeric oligonucleotides chimeric oligonucleosides and mixed chimeric oligonucleotides/oligonucleosides are synthesized according to United States Patent 5,623,065, herein incorporated by reference.
- oligonucleotides or oligonucleosides are purified by precipitation twice out of
- oligonucleotides were analyzed by polyacrylamide gel electrophoresis on denaturing gels and judged to be at least
- Antisense modulation of mtegrm ⁇ 4 expression can be assayed m a variety of ways known in the art.
- mtegrm ⁇ 4 mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR (RT-PCR) .
- Real-time quantitative PCR is presently preferred.
- RNA analysis can be performed on total cellular RNA or poly (A) + mRNA. Methods of RNA isolation are taught , for example, Ausubel, F . M. e t al . (Current Protocols m Mol ecular Biology , 1993., 1, 4.1.1-4.2.9 and 4.5.1-4.5.3).
- Integrin ⁇ 4 protein levels can be quantitated in a variety of ways well known m the art, such as immunoprecipitation, Western blot analysis ( lmmunoblottmg) , ELISA or fluorescence-activated cell sorting (FACS).
- Antibodies directed to mtegrm ⁇ 4 can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional antibody generation methods. Methods for preparation of polyclonal antisera are taught m, for example, Ausubel, F.M. et al . ( Curren t Protocols m Molecular Biol ogy 1997, 2, 11.12.1-11.12.9).
- oligonucleotides were designed to target different regions of the human integrin ⁇ 4 RNA, using published sequences (GenBank accession number L12002, incorporated herein as SEQ ID NO: 1) .
- the oligonucleotides are shown in Table 1. Target sites are indicated by nucleotide numbers, as given in the sequence source reference (GenBank accession no. L12002), to which the oligonucleotide binds. All compounds in Table 1 are 18 nucleotides in length, with a phosphorothioate backbone and a centered 10-base deoxynucleotide gap flanked by 2'- methoxyethoxy (2'MOE) wings.
- Human A375 melanoma cells Human A375 melanoma cells
- Results are expressed as percentage of control expression based on mean fluorescence intensity.
- oligonucleotides 24453, 24473, 24475, 24477 and 24451 gave at least about 50% inhibition of mtegrm ⁇ 4 protein expression and were subjected to further study .
- A375 cells were treated with ISIS 24473, 24475, 24477 and 24451 at concentrations of 50, 100, 200 and 400 nM for 4 hours. Cells were harvested with trypsm at 48 and 72 hours after oligonucleotide treatment and stained with 2 ug/ml CD49d-FITC as in the previous example. Results are shown in Table 2.
- oligonucleotides were tested for effects on integrin ⁇ 4 protein expression and compared to active compounds from the previous screens. These oligonucleotides are targeted to an integrin ce4 promotor sequence (Rosen et al., Proc . Na tl . Acad . Sci . 1991, 88, 4094-4098; GenBank Accession No. M62841, provided herein as SEQ ID NO: 41) . These oligonucleotides are shown in Table 3 and their effects on integrin ⁇ 4 protein expression is shown in Table .
- oligonucleotides 24475, 27104 and 27108 demonstrated 40% inhibition or greater and are preferred.
- New oligonucleotides 26640, 26641, 26642 and 26644 were synthesized and compared against previously tested oligonucleotides. Oligonucleotides are shown in Table 5 and their effect on integrin ⁇ 4 protein levels is shown in Table 6. Target sites refer to nucleotide numbers on the target sequence (GenBank Accession No. L12002) to which the oligonucleotides hybridize.
- oligonucleotides 27104, 24451, 26640, 24453, 526641, 24473, 26642, 24477 and 26644 demonstrated 40% inhibition or greater and are preferred.
- the oligonucleotide sequence (SEQ ID NO: 47) targeted to mouse integrin ⁇ 4 which has only three mismatches with the human gene target, also showed >40% inhibition at the highest dose.
- oligonucleotides targeted to integrin 5 ⁇ 4 were designed to target the murine integrin 4 using the published sequence of De Miersman et al., DNA Cell Biol . 1994, 13:743-754; GenBank Accession No:L20788, provided herein as SEQ ID NO: 48). These oligonucleotides are shown in Table 7. Nucleotide bases shown in bold are 2'- methoxyethoxy (2'MOE); remaining positions are 2' deoxy. Target site refers to the first nucleotide position on the target (GenBank Accession No. L20788) to which the oligonucleotide binds .
- Oligonucleotides were initially screened in murine P388D (IL-1) macrophage cells (American Type Culture Collection, Manassas VA) for 4 hours at an oligonucleotide concentration of 100 nM in 3 ug/ml lipofectm. Cells were harvested and RNA was purified by cellular lysis using Catr ⁇ mox-14 solution (Iowa Biotechnology Corp, Oakdale IA. Dahle, CE. and Macfarlane, D.E., BioTechniques 1993, 15, 1-4. RNA was electrophoresed on a 1% agarose/1.1% formaldehyde gel with 18 ug RNA loaded in each lane.
- the mtegrm 4 probe was a PCR- labeled 1025-base mtegrm ⁇ 4 fragment (positions 3681-4706) made by RT-PCR according to the method of Bednarczuk et al . (Biotechniques 1991 10,478) . Results of the screen are shown in Table 8.
- ISIS 15607 targeted to the 5'UTR
- ISIS 15608 and 15609 both targeted to the translation initiation codon, were most active in this assay.
- Dose response curves for ISIS 15607, 15608 and 15609 are shown in Table 9. Results are averages of duplicate samples.
- Murine IC-21 macrophage cells (American Type Culture Collection, Manassas, VA) were used for further study. Additional oligonucleotides were designed to target murine integrin ⁇ 4. These are shown in Table 10; all 2' MOE nucleotides are shown in bold and remaining positions are 2' deoxy. All 2'-MOE cytosines in these compounds are 5' methylcytosines .
- IC-21 cells were seeded at 5 x 10 4 cells/well in 24 well plates two days before assay. Cells were treated with 3 ug/ml LIPOFECTIN for 4 hours with 25 nM oligonucleotide. Wells were triplicates.
- ISIS 16430, 16431, 16433, 16434, 16434, 16435, 16436 and 16437 gave better than 50% inhibition in this assay and are preferred .
- ISIS 16433 Another dose-response experiment on ISIS 16433 was done with scramble control included. IC-21 cells were treated with 0.3, 1, 3, 10 and 30 nM oligonucleotide with 3 ug/ml LIFOFECTIN for 4 hours. Cells were incubated for 24 hours, harvested with trypsin, stained with 2 ug/ml CD49d-PE and rat IgG2B as in previous examples. The results are shown in Table 13. ISIS 16433 at 30 nM was found to inhibit protein levels to below basal levels.
- IC50 of ISIS 16433 for inhibition of integrin 4 RNA.
- IC- 21 cells were treated in duplicate with ISIS 16433 at 6.25, 12.5, 25 or 50 nM with 3 ug/ml LIPOFECTIN.
- oligonucleotides were synthesized with the ISIS 16433 sequence (SEQ ID NO: 47, targeted to the translation initiation codon) in order to optimize the backbone chemistry and 2' methoxyethoxy gap placement. These compounds were tested for ability to inhibit integrin ⁇ 4 protein expression. Compounds and results are shown m Tables 15 and 16. ISIS 17044 was found to reduce integrin ⁇ 4 expression to below starting levels and was chosen for further study in animal models of disease. TABLE 15 Optimization of oligonucleotides having SEQ ID NO: 47
- EAE Experimental autoimmune encephalomyelitis
- MBP myelm basic protein
- PLP proteolipid protein
- CSJLF-1 mice Jackson Laboratory, Bar Harbor, ME
- pl3 peptide HLGKWLGHPDKF-amide, synthesized by Research Genetics, Huntsville, AL, SEQ ID NO. 60
- Mice were immunized essentially as described m Myers et al., ( J. Neuro immunology 1992, 41, 1-8) .
- mice were injected in the hind footpads and the base of the tail with 50-100 ug of pl3 peptide, emulsified in CFA (Difco, Detroit, MI) fortified with 4 mg/ml of heat-killed H37Ra Mycoba cte ⁇ um t ubercul osis bacteria (Difco) .
- mice were also injected intravenously with 500 ng of pertussis toxm (Sigma, St. Louis, MO) .
- Mice were treated with the antisense oligonucleotide ISIS 17044 at various doses, beginning one day before pl3 immunization except where indicated otherwise.
- 17044 reduced disease severity or delayed disease onset .
- mice were treated with ISIS 17044 as described in Example 15, at daily doses ranging from 0.3 mg/kg to 3 mg/kg, injected subcutaneously, and 1 mg/kg injected intravenously for comparison. Mean peak disease severity and average number of days to disease onset were measured and these are shown in Table 18.
- 17044 reduced disease severity and delayed disease onset at all concentrations.
- mice were treated with ISIS 17044 as described in Example 15, at daily doses ranging from 0.5 mg/kg to 2.0 mg/kg, injected subcutaneously (SC) .
- SC subcutaneously
- Disease severity and time until disease onset were measured and these are shown in Table 19.
- 17044 reduced disease severity or delayed disease onset .
- ISIS 17614 was also tested at 2 mg/kg. A 1 mg/kg daily dose, given therapeutically was also tested. In this regimen, oligonucleotide treatment began on day 18, after animals had begun showing symptoms of paralysis, and continued until day 31. Disease severity and time until disease onset were measured and these are shown in Table 20.
- mice were treated with ISIS 17044 as described in Example 15, at daily doses of 0.01 /kg to 2.0 mg/kg, injected subcutaneously (SC).
- the scrambled control oligonucleotide, ISIS 17614 was also tested at 2 mg/kg. A 1 mg/kg daily dose, given therapeutically was also tested.
- oligonucleotide treatment began on day 11, after animals had begun showing symptoms of paralysis, and continued until day 27. Disease severity and time until disease onset were measured and these are shown in Table 21.
- control As shown, 17044 reduced disease severity when given therapeutically (time to disease onset is not expected to be increased because dosing begins after onset of disease).
- mice are immunized with bovine type II collagen.
- Anderson et al. J. Immunol . 1991 147, 1189-1193, citing Trentham et al., J. Exp . Med 1977, 146, 857.
- Swelling and inflammation of the joints follows in approximately 3 weeks, with joint distortion and ankylosis typical of rheumatoid arthritis.
- This model has been used to study the effects of the antisense oligonucleotide 17044, targeted to mouse integrin ⁇ 4 , on arthritis in mice.
- DBA/lLacJ mice were obtained from Jackson Laboratory, Bar Harbor, ME. Female mice aged 6 to 8 weeks were used and assigned to groups, ten mice per group. On day 0 mice were immunized at the base of the tail with 100 ug of bovine type II collagen which was emulsified in Complete Freund's Adjuvant (CFA) . On day 7, a second booster dose of collagen was administered by the same route. On day 14 the mice were injected subcutaneously with 100 ug of lipopolysaccharide (LPS). Weights were recorded weekly. Mice were inspected daily for the onset of CIA, which is characterized by erythema and edema.
- CFA Complete Freund's Adjuvant
- paw widths and rear ankle widths of affected and unaffected joints were measured three times a week using a constant tension caliper.
- the progression of all measurements was recorded to day 50. At the end of the observation period for each mouse, all paws were removed and examined histologically .
- the oligonucleotide, the positive control drug (cyclophosphamide, 5 mg/kg) , and the vehicle were administered daily to each mouse intraperitoneally (IP) starting on day -3 and continuing for the duration of the study. Each animal received 10 mg/kg as a bolus daily dose.
- ISPH 17044 was administered from the time of disease induction to the conclusion of the study 50 days later. Arthritis incidence was reduced from 70 to 30% in the ISIS 17044-treated group. A summary of clinical parameters is shown in Table 22.
- Severity total clinical score/total number of mice in group .
- # Paws/Mouse mean number of affected paws at termination/total number of mice in group.
- Peak Day of Inflammation day from onset to time of maximum swelling for each joint measured.
- the mice that developed arthritis in the various treatment groups were compared and the results are shown in Table 23.
- Mean # Paws Involved number paws at termination in the affected mice/number of affected mice in group.
- Mean Clinical Score total clinical score of affected mice/total number of affected mice in group.
- mice from EAE experiment 3 were sacrificed with C0 2 and the spinal cord was removed and cut into 0.5 cm pieces through lumbar and low thoracic regions. The pieces were embedded in O.C.T. tissue freezing medium (Ted Pella Inc., Redding, CA) on dry ice and methylbutane . Four- micron frozen sections were cut and air dried overnight.
- O.C.T. tissue freezing medium Ted Pella Inc., Redding, CA
- the sections were fixed for three minutes in ice-cold acetone and then placed on a Dako Autostainer (Dako Corporation, Carpinteria, CA) and treated in the following steps: 5 minutes in 0.03% H 2 0 2 , 5 minutes in 5% donkey serum diluted in PBS, 45 minutes in appropriately diluted primary antibody, 30 minutes in horseradish peroxidase-labeled donkey anti-rat secondary antibody (Jackson Laboratory, Bar Harbor, ME) . Sections were rinsed between treatments with PBS. All the antibodies used were rat anti-mouse from PharMingen (San Diego, CA) , except BM-8, which was from Bachem Bioscience Inc. (King of Prussia, PA) . The immunostaining was developed with DAB (Dako Corporation) and counterstained with hematoxylin.
- ISIS 17044 Treatment with 1 mg/kg ISIS 17044 was shown to reduce leukocyte trafficking into the spinal cords and brains of CSJLF1 mice directly immunized to develop EAE.
- leukocyte trafficking as measured by the ' expression of VLA-4, of which integrin ⁇ 4 is one of two subunits, CD4 (a T-cell marker), BM-8 (a macrophage marker) and CD18 (contained in the LFA-1 and MAC-1 adhesion molecules found on leukocytes) was significantly reduced.
- CD4+ T cells were virtually eliminated from the central nervous system of ISIS 17044-treated mice in one experiment. These cells have been shown to be critical for the induction of EAE.
- a mouse model for inflammatory bowel disease has recently been developed Okayasu et al . ( Gastroenterology 1990, 98, 694-702) .
- Administration of dextran sulfate to mice induces colitis that mimics human IBD in almost every detail.
- Dextran sulfate-mduced IBD and human IBD have subsequently been closely compared at the histological level and the mouse model has been found to be an extremely reproducible and reliable model. It is used here to test the effect of ISIS 17044 on inflammatory bowel disease.
- mice Female Swiss Webster mice (8 weeks of age) weighing approximately 25 to 30 grams are kept under standard conditions. Mice are allowed to acclimate for at least 5 days before initiation of experimental procedures . Mice are given 5% dextran sulfate sodium in their drinking water (available ad libitum) for 5 days. Concomitantly , ISIS 17044 oligonucleotide m pharmaceutical carrier, carrier alone (negative control) or TGF- ⁇ (known to protect against dextran sulfate-mediated colitis in mice) is administered. ISIS 17044 is given as daily subcutaneous injection of 1 mg/kg to 5 mg/kg for 5 days. TGF- ⁇ is given as 1 ⁇ g/mouse mtracolonically .
- mice are sacrificed on day 6 and colons are subjected to histopathologic evaluation. Until sacrifice, disease activity is monitored by observing mice for weight changes and by observing stools for evidence of colitis . Mice are weighed daily. Stools are observed daily for changes in consistency and for presence of occult or gross bleeding. A scoring system is used to develop a disease activity index by which weight loss, stool consistency and presence of bleeding are graded on a scale of 0 to 3 (0 being normal and 3 being most severely affected) and an index is calculated. Drug-induced changes m the disease activity index are analyzed statistically. The disease activity index has been shown to correlate extremely well with IBD in general.
- the murine integrin ⁇ 4-specific oligonucleotide ISIS 17044 is tested for activity in a murine vascularized heterotopic heart transplant model.
- Hearts from Balb/c mice are transplanted into the abdominal cavity of C3H mice as primary vascularized grafts essentially as described by Isobe et al . , ( Circula tion 1991, 84, 1246-1255) .
- Oligonucleotide is administered by continuous intravenous administration via a 7-day ALZET pump.
- the mean survival time for untreated mice is usually approximately 9-10 days. Treatment of the mice for 7 days with 1 mg/kg to 5 mg/kg ISIS 17044 is expected to increase the mean survival time.
- Leukocyte infiltration of tissues and organs is a major aspect of the inflammatory process and contributes to tissue damage resulting from inflammation.
- the effect of ISIS 17044 on leukocyte migration is examined using a mouse model in which carrageenan-soaked sponges are implanted subcutaneously. Carrageenan stimulates leukocyte migration and edema. Effect of oligonucleotide on leukocyte migration in inflammatory exudates is evaluated by quantitation of leukocytes infiltrating the implanted sponges. Following a four hour fast, 40 mice are assigned randomly to eight groups each containing five mice.
- Each mouse is anesthetized with METOFANE and a polyester sponge impregnated with 1 ml of a 20 mg/ml solution of carrageenan is implanted subcutaneously.
- Saline is administered intravenously to Group 1 at 10 ml/kg four hours prior to sponge implantation and this serves as the vehicle control.
- Indomethacm (positive control) is administered orally at 3 mg/kg at a volume of 20 ml/kg to Group 2 immediately following surgery, again 6-8 hours later and again at 21 hours post- lmplantation.
- ISIS 17044 is administered intravenously at a dose of 1 mg/kg to 5 mg/kg to Group 3 four hours prior to sponge implantation.
- ISIS 17044 is administered intravenously at a dose of 1 mg/kg to 5 mg/kg to Group 4 immediately following sponge implantation. ISIS 17044 is administered intravenously at 1 mg/kg to 5 mg/kg to Groups 5, 6, 7 and 8 at 2, 4, 8 and 18 hours following sponge implantation, respectively. Twenty- four hours after implantation, sponges are removed, immersed in EDTA and saline (5 ml) and squeezed dry. Total numbers of leukocytes in sponge exudate mixtures are determined. The oral administration of mdomethacin at 3 mg/kg generally produces a 75-80% reduction m mean leukocyte count when compared to the vehicle control group.
- C8161 is a human melanoma cell line.
- Treatment of C8161 cells with the cytokine TNF- ⁇ and mterferon ⁇ has previously been shown to result m an increased number of lung metastases when cells were injected into nude mice (Miller, D.E. and Welch, D.R., Proc . Am . Assoc . Cancer Res . 1990, 13, 353).
- Four-week- old female athymic nude mice (Harlan Sprague Dawley) are used.
- mice Animals are maintained under the guidelines of the NIH. Groups of 4-8 mice each are tested in experimental metastasis assays.
- LIPOFECTIN Gaithersburg, MD
- Cells are seeded in 60 mm tissue culture dishes at 10 6 cells/ml and incubated at 37°C for 3 days, washed with Opti-MEM (Gibco/BRL) 3 times and 100 ⁇ l of Opti-MEM medium is added to each well.
- oligonucleotide and 15 ⁇ g/ml LIPOFECTIN are mixed at room temperature for 15 minutes.
- 25 ⁇ l of the oligonucleotide-LIPOFECTIN mixture is added to the appropriate dishes and incubated at 37°C for 4 hours.
- the oligonucleotide-LIPOFECTIN mixture is removed and replaced with DME-F12 medium containing 10% fetal calf serum.
- 500 U/ml TNF- ⁇ is added to the appropriate wells and incubated for 18 hours at which time cells are removed from the plates, counted and injected into athymic nude mice.
- tumor cells (untreated with oligonucleotide) are implanted into athymic nude mice as above and tumor-bearing mice are treated every other day with antisense oligonucleotide at doses of 1 mg/kg to 5 mg/kg. After 4 weeks, mice are sacrificed, organs are fixed in Bourn's fixative and metastatic lesions on lungs are scored with the aid of a dissecting microscope.
- SJL/J and IL10-/- mice are used in a TNBS (2,4,5,- trmitrobenzene sulfonic acid) induced colitis model for Crohn's disease (Neurath, M.F., et al . , J. Exp . Med. , 1995, 182, 1281-
- mice between the ages of 6 weeks and 3 months are used to assess the activity of TNF- ⁇ antisense oligonucleotides.
- C3H/HeJ, SJL/JK and IL10-/- mice are fasted overnight prior to administration of TNBS.
- a thm, flexible polyethylene tube is slowly inserted into the colon of tne mice so that the
- ISIS 17044 is administered either at the first sign of symptoms
- mice 10 or simultaneously with induction of disease. Animals, in most cases, are dosed every day. Administration is by i.v., ⁇ .p., s.q., mmipumps or mtracolonic injection. Experimental tissues are collected at the end of the treatment regimen for histochemical evaluation.
- Concanavalm A-mduced hepatitis is used as a murine model for hepatitis (Mizuhara, H., et al . , J. Exp Med . , 1994, 179,
- mice between the ages of 6 weeks and 3 months are used to assess the activity of antisense oligonucleotide ISIS 17044.
- mice are intravenously injected with oligonucleotide.
- the pretreated mice are then intravenously injected with 0.3
- Con A concanavalm A
- the livers are removed from the animals and analyzed for cell death (apoptosis) by in vi tro methods.
- blood is collected from the retro-orbital vein.
- Airway inflammation is observed in patients with allergic asthma.
- a murine model of allergic asthma has been developed,
- Pathogen-free male BALB/c mice (6-8 wk) are obtained from Jackson Laboratories. Active sensitization is performed by seven IP injections of 10 ug of ovalbumm (Sigma Chemical Co, St. Louis, MO, grade II) m 0.5 ml of pyrogen-free saline on alternate days, one injection per day. This produces high titers of total IgE in mouse serum of which 80% is ovalbumm- specific IgE (Hessel et al . , 1998, J. Immunol . 160: 2998-3005). Four weeks after the last injection, mice are exposed either to ovalbumm aerosols (2 mg/ml) or saline aerosols, once per day for eight days.
- ovalbumm aerosols 2 mg/ml
- saline aerosols once per day for eight days.
- the aerosol is generated with a nebulizer such as Medix 8001 (Sussex, UK) .
- Animals were exposed for 5 minutes per aerosol challenge.
- Antisense oligonucleotide 17044 is given to the mice during the challenge period.
- sensitized mice were injected intravenously with a 1 mg/kg to 5 mg/kg dose of ISIS 17044 m PBS.
- Airway responsiveness to methacholme is measured in vivo 24 hours after the last aerosol exposure using the air-overflow pressure method, in which bronchial resistance to inflation is measured.
- Mice are anesthetized by IP injection of urethan 2g/kg and placed on a heated blanket.
- the trachea is cannulated and a small polyethylene catheter is placed in the jugular vein for IV administrations. Spontaneous breathing is suppressed by IV injection of tubocurarine chloride (3.3 mg/kg) . When it stopped, the tracheal cannula is attached to a respiration pump. At intervals, increasing doses of methacholine ranging from 40 to 1280 ug/kg were given. The increase in air-overflow pressure (caused by reduction of air flow in to the lungs as a result of increasing airway tone) is measured at its peak and expressed as a percentage increase. Bronchoalveolar lavage is used to measure the leukocyte infiltration of airway tissue.
- mice are anesthetized by IP injection of 0.25 ml of sodium pentobarbitone (60 mg/ml) .
- the abdomen and chest are opened, and the abdominal aorta is excised.
- a small incision is made, and a flexible polyethylene cannula is inserted into the trachea and fixed with a ligature.
- Mice are lavaged five times with 1 ml aliquots of pyrogen-free saline warmed to 37°C.
- the cells derived from each lavage were pooled, were washed with cold PBS and resuspended in 200 ul of cold PBS. Total numbers of cells were counted and categorized.
- Hemopoietic Progenitor Cells Mobilization (peripheralization) of hemopoietic progenitor cells from the bone marrow into the blood circulation is clinically useful in stem cell transplantation.
- a murine model has been established to evaluate the effects of drug compounds on this process (and its reverse, selective lodgement or homing of transplanted stem cells to the recipient's bone marrow) (Papayannopoulou et al . , Proc . Na tl . Acad. Sci . 1995, 92, 9647-9651). Briefly, pathogen-free mice 3-6 months old are used and are housed in a filtered-air-flow housing unit for the duration of the experiment. Mice used as primary or secondary recipients m the homing assay are exposed to 1150-cGy irradiation delivered from a Cs source.
- IMDM Iscove's modified Dulbecco's medium
- Splenic cell suspensions are obtained by lengthwise dissection of the spleen with a scalpel and scraping of cellular contents from the capsule, followed by vigorous pipetting. All cell suspensions are washed twice
- CFU-C Culture colony-forming unit
- CFU-S spleen colony- forming unit
- the oligonucleotide is administered by daily IV injection (at dose ranges from 1 mg/kg to 5 mg/kg) for three days. Mice are sacrificed on the four ⁇ h day. Nucleated cells
- 25 present m 0.25-0.5 ml of peripheral blood are plated m clonogenic progenitor cultures to assess CFU-C content, as described in Papayannopoulou et al., ( Proc . Na tl . Acad . Sci . 1995, 92, 9647-9651) .
- Example 32 Screening of additional oligonucleotides targeted to human integrin ⁇ 4
- oligonucleotides were synthesized as "gapmers" consisting of a 9-nucleot ⁇ de region of deoxynucleotides flanked by three 2 ' -O-methoxyethyl (2' -MOE) 5 nucleotides on the 5 ' end and eight 2 ' -MOE nucleotides on the 3' end. 2 ' -MOE nucleotides are shown m bold in the table. Oligonucleotides were synthesized with phosphorothioate backbones throughout, and all cytosmes are 5-methylcytos ⁇ nes . Oligonucleotides were screened m the presence of lipofectm
- A375 cells were treated with ISIS 107245, 107248, 107252,
- Oligonucleotide concentrations were 1, 3, 10 and 30 ⁇ M.
- Cells were harvested 24 hours after oligonucleotide treatment and 0 stained with 2 ug/ml CD49d-FITC for flow cytometry as in the previous examples. Results are shown in Table 25.
- ISIS 107248 was compared directly to ISIS 27104 for ability to inhibit integrin ⁇ 4 expression in A375 melanoma cells. The results are shown in Table 26. Oligonucleotides were electroporated into cells as in the previous example.
- ISIS 107248 was tested at doses of 1, 3, 10, 20 and 30 ⁇ M for ability to inhibit integrin ⁇ 4 expression in Jurkat T-lymphocyte cells according to the previous examples. Integrin ⁇ 4 protein expression was reduced by approximately 65-72% at oligonucleotide doses of 3-30 ⁇ M at 24 hours after oligonucleotide treatment. At 48 hours after treatment, integrin ⁇ 4 protein expression was reduced by 60% at 3 ⁇ M and by 90% at 10, 20 and 30 ⁇ M oligonucleotide concentration.
- Example 35
- Quantitation of integrin ⁇ 4 mRNA levels was performed by real-time quantitative PCR using the ABI PRISMTM 7700 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions.
- ABI PRISMTM 7700 Sequence Detection System PE-Applied Biosystems, Foster City, CA
- This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time.
- PCR polymerase chain reaction
- products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes.
- a reporter dye e.g., JOE or FAM, obtained from either Operon Technologies Inc., Alameda, CA or PE-Applied Biosystems, Foster City, CA
- a quencher dye e.g., TAMRA, obtained from either Operon Technologies Inc., Alameda, CA or PE-Applied Biosystems, Foster City, CA
- reporter dye emission is quenched by the proximity of the 3' quencher dye.
- annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5 ' -exonuclease activity of Taq polymerase.
- cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated.
- additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISMTM 7700 Sequence Detection System.
- a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples.
- PCR reagents were obtained from PE-Applied Biosystems, Foster City, CA. RT-PCR reactions were carried out by adding 20 ⁇ L PCR cocktail (lx TAQMANTM buffer A, 5.5 mM MgCl 2 , 300 ⁇ M each of dATP, dCTP and dGTP, 600 ⁇ M of dUTP, 400 nM each of forward primer and reverse primer (or 100 nM in the case of G3PDH) , 100 nM probe, 20 Units RNAse inhibitor, 1.25 Units AMPLITAQ GOLDTM, and 12.5 Units MuLV reverse transcriptase) to 5 ⁇ L (100 ng) total mRNA solution, purified using the RNEasyTM kit (Qiagen, Valencia CA) .
- PCR cocktail lx TAQMANTM buffer A, 5.5 mM MgCl 2 , 300 ⁇ M each of dATP, dCTP and dGTP, 600 ⁇ M of dUTP, 400
- the RT reaction was carried out by incubation for 30 minutes at 48°C. Following a 10 minute incubation at 95°C to activate the AMPLITAQ GOLDTM, 40 cycles of a two-step PCR protocol were carried out: 95°C for 15 seconds (denaturation) followed by 60°C for 1.5 minutes
- Integrin ⁇ 4 probes and primers were designed to hybridize to the human integrin ⁇ 4 sequence, using published sequence information (GenBank accession number L12002), incorporated herein as SEQ ID NO:l).
- the PCR primers were: forward primer: GACACGCTGCGCCTCAT (SEQ ID NO: 94, hybridizes at position 319-335 of Genbank accession no.
- probe is SEQ ID NO: 96; hybridizes at position 361-382 of Genbank accession no. L12002) where FAM (PE-Applied Biosystems, Foster City, CA) is the fluorescent reporter dye) and TAMRA (PE-Applied Biosystems, Foster City, CA) is the quencher dye.
- PCR primers were: forward primer: GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 97) reverse primer: GAAGATGGTGATGGGATTTC (SEQ ID NO: 98)and the PCR probe was: 5' JOE-CAAGCTTCCCGTTCTCAGCC- TAMRA 3' (probe is SEQ ID NO: 99) where JOE (PE-Applied Biosystems, Foster City, CA) is the fluorescent reporter dye) and TAMRA (PE-Applied Biosystems, Foster City, CA) is the quencher dye.
- Human umbilical vein endothelial cells (HUVEC) (Clonetics, San Diego CA) were cultured in EGM-UV medium (Clonetics) and treated with TNF ⁇ for 20 hours to induce VCAM expression.
- A375 melanoma cells were electroporated with ISIS 107248 as described above.
- flow cytometry was used to quantitate the inhibition of adherence of A375 melanoma cells to HUVECs .
- ISIS 107248 (10 ⁇ M) inhibited A375 melanoma cell adherence to HUVEC by approximately 85%.
- a similar adherence assay was performed using Jurkat T-cells instead of melanoma cells, again detecting adherence to HUVEC. Because Jurkat cells are smaller and less complex, they can be separated from HUVEC by gating on the basis of differences in forward light scatter and side scatter. For 5000 HUVEC events, adherent Jurkat cells were quantitated. At oligonucleotide concentrations of 1, 3, 10, and 30 ⁇ M ISIS 107248, adherence of Jurkat cells to HUVEC was 0, 12%, 32% and 63%, respectively. Antibody to integrin ⁇ 4 gave 96% inhibition, an antibody to VCAM-1 gave 67% inhibition, and a combination of ISIS 107248 and VCAM-1 antibody gave 78% inhibition.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Diabetes (AREA)
- Immunology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Biochemistry (AREA)
- Pulmonology (AREA)
- Hematology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Obesity (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Pain & Pain Management (AREA)
- Emergency Medicine (AREA)
- Oncology (AREA)
- Gastroenterology & Hepatology (AREA)
- Rheumatology (AREA)
- Endocrinology (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU55703/99A AU759938B2 (en) | 1998-10-05 | 1999-08-19 | Antisense modulation of integrin alpha4 expression |
| CA2345209A CA2345209C (en) | 1998-10-05 | 1999-08-19 | Antisense modulation of integrin .alpha.4 expression |
| DK99942290T DK1123414T3 (da) | 1998-10-05 | 1999-08-19 | Antisense-modulering af integrin alpha 4.ekspression |
| DE69934998T DE69934998T2 (de) | 1998-10-05 | 1999-08-19 | Antisense modulation der expression von integrin alpha 4 |
| JP2000574727A JP3834204B2 (ja) | 1998-10-05 | 1999-08-19 | インテグリンα4発現のアンチセンス調節 |
| EP99942290A EP1123414B1 (en) | 1998-10-05 | 1999-08-19 | Antisense modulation of integrin alpha 4 expression |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US09/166,203 US5968826A (en) | 1998-10-05 | 1998-10-05 | Antisense inhibition of integrin α4 expression |
| US09/166,203 | 1998-10-05 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2000020635A1 true WO2000020635A1 (en) | 2000-04-13 |
Family
ID=22602243
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US1999/018796 Ceased WO2000020635A1 (en) | 1998-10-05 | 1999-08-19 | ANTISENSE MODULATION OF INTEGRIN α4 EXPRESSION |
Country Status (10)
| Country | Link |
|---|---|
| US (2) | US5968826A (https=) |
| EP (1) | EP1123414B1 (https=) |
| JP (2) | JP3834204B2 (https=) |
| AT (1) | ATE352639T1 (https=) |
| AU (1) | AU759938B2 (https=) |
| CA (1) | CA2345209C (https=) |
| DE (1) | DE69934998T2 (https=) |
| DK (1) | DK1123414T3 (https=) |
| ES (1) | ES2279632T3 (https=) |
| WO (1) | WO2000020635A1 (https=) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1080225A4 (en) * | 1998-05-21 | 2004-02-04 | Isis Pharmaceuticals Inc | COMPOSITIONS AND METHODS FOR THE PULMONAL ADMINISTRATION OF NUCLEIC ACIDS |
| EP1406997A4 (en) * | 2001-06-08 | 2005-06-29 | Aventis Pharma Inc | MICE NOT EXPRESSING ALPHA-4 FUNCTIONAL INTEGRIN PROTEIN, METHODS FOR DETERMINING COMPOUNDS OR AGENTS FOR THE ACTIVITY OF ALPHA-4 INTEGRIN PROTEIN ANTAGONISTS AND GENETIC MARKER FOR EVALUATING THE EFFICACY OF MODULATORS OF ACTIVITY SIGNALING OF A VLA-4 RECEPTOR |
| EP2318424A4 (en) * | 2008-06-23 | 2012-12-26 | Teva Pharma | METHODS FOR TREATING MULTIPLE SCLEROSIS USING ANTISENSE OLIGONUCLEOTIDES |
| WO2016179634A1 (en) * | 2015-05-11 | 2016-11-17 | Murdoch University | Multiple sclerosis treatment |
| WO2017075670A1 (en) * | 2015-11-05 | 2017-05-11 | Children's Hospital Los Angeles | "mobilizing leukemia cells" |
Families Citing this family (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5968826A (en) * | 1998-10-05 | 1999-10-19 | Isis Pharmaceuticals Inc. | Antisense inhibition of integrin α4 expression |
| DE19860642A1 (de) * | 1998-12-29 | 2000-07-06 | Deutsches Krebsforsch | Antisense-Oligonukleotid zur Hemmung der Expression des Adhäsionsmoleküls very late antigen 4 (VLA-4) in menschlichen Zellen |
| GB0112617D0 (en) * | 2001-05-23 | 2001-07-18 | Hoffmann La Roche | Antiviral nucleoside derivatives |
| EP1543159A2 (en) * | 2002-08-19 | 2005-06-22 | Pharmacia Corporation | Antisense modulation of endothelial specific molecule 1 expression |
| US9403908B2 (en) * | 2003-09-29 | 2016-08-02 | The Regents Of The University Of California | Method for altering hematopoietic progenitor cell adhesion, differentiation, and migration |
| US7419666B1 (en) | 2004-02-23 | 2008-09-02 | Massachusetts Eye And Ear Infirmary | Treatment of ocular disorders |
| AU2005327506B2 (en) * | 2004-10-20 | 2010-07-08 | Antisense Therapeutics Ltd | Antisense modulation of integrin alpha4 expression |
| EA016838B1 (ru) * | 2005-06-07 | 2012-07-30 | Йельский Университет | Способы лечения рака и других заболеваний или патологических состояний с применением клевудина (lfmau) и телбивудина (ldt) |
| ES2600919T3 (es) * | 2007-10-05 | 2017-02-13 | Index Pharmaceuticals Ab | Oligonucleótidos para el tratamiento o alivio de edema |
| WO2012034194A1 (en) * | 2010-09-17 | 2012-03-22 | Antisense Therapeutics Ltd | Method for mobilizing stem and/or progenitor cells |
| WO2014193625A1 (en) * | 2013-05-30 | 2014-12-04 | R-Pharm Overseas, Inc. | Fully human antibodies against human receptor integrin alpha-4 |
| US20200038428A1 (en) * | 2017-03-23 | 2020-02-06 | Napajen Pharma, Inc. | Cancer cell adhesion activity inhibitor |
| WO2023039643A1 (en) * | 2021-09-20 | 2023-03-23 | Antisense Therapeutics Ltd | Methods and kits therefor |
| EP4230196A1 (en) | 2022-02-21 | 2023-08-23 | Som Innovation Biotech, S.A. | Compounds for use in the treatment of dystrophinopathies |
| CN114887034B (zh) * | 2022-07-14 | 2022-10-28 | 中山莱博瑞辰生物医药有限公司 | LLP2A-Ale在制备用于治疗和/或预防外周血淋巴细胞减少症的药物中的用途 |
| JP2025528873A (ja) * | 2022-08-16 | 2025-09-02 | ペルシュロン・セラピューティクス・リミテッド | Covid19の神経学的急性後後遺症(npasc)の診断及び治療におけるバイオマーカー及びその使用 |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5696248A (en) * | 1994-06-15 | 1997-12-09 | Hoechst Aktiengesellschaft | 3'-modified oligonucleotide derivatives |
| US5968826A (en) * | 1998-10-05 | 1999-10-19 | Isis Pharmaceuticals Inc. | Antisense inhibition of integrin α4 expression |
-
1998
- 1998-10-05 US US09/166,203 patent/US5968826A/en not_active Expired - Lifetime
-
1999
- 1999-08-19 AU AU55703/99A patent/AU759938B2/en not_active Ceased
- 1999-08-19 US US09/377,309 patent/US6258790B1/en not_active Expired - Lifetime
- 1999-08-19 AT AT99942290T patent/ATE352639T1/de not_active IP Right Cessation
- 1999-08-19 JP JP2000574727A patent/JP3834204B2/ja not_active Expired - Fee Related
- 1999-08-19 DE DE69934998T patent/DE69934998T2/de not_active Expired - Lifetime
- 1999-08-19 DK DK99942290T patent/DK1123414T3/da active
- 1999-08-19 WO PCT/US1999/018796 patent/WO2000020635A1/en not_active Ceased
- 1999-08-19 EP EP99942290A patent/EP1123414B1/en not_active Expired - Lifetime
- 1999-08-19 ES ES99942290T patent/ES2279632T3/es not_active Expired - Lifetime
- 1999-08-19 CA CA2345209A patent/CA2345209C/en not_active Expired - Fee Related
-
2006
- 2006-01-04 JP JP2006000258A patent/JP4168285B2/ja not_active Expired - Fee Related
Non-Patent Citations (1)
| Title |
|---|
| BRANCH A. D.: "A good antisense molecule is hard to find", TIBS, vol. 23, 1 February 1998 (1998-02-01), pages 45 - 50, XP002910401 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1080225A4 (en) * | 1998-05-21 | 2004-02-04 | Isis Pharmaceuticals Inc | COMPOSITIONS AND METHODS FOR THE PULMONAL ADMINISTRATION OF NUCLEIC ACIDS |
| EP1406997A4 (en) * | 2001-06-08 | 2005-06-29 | Aventis Pharma Inc | MICE NOT EXPRESSING ALPHA-4 FUNCTIONAL INTEGRIN PROTEIN, METHODS FOR DETERMINING COMPOUNDS OR AGENTS FOR THE ACTIVITY OF ALPHA-4 INTEGRIN PROTEIN ANTAGONISTS AND GENETIC MARKER FOR EVALUATING THE EFFICACY OF MODULATORS OF ACTIVITY SIGNALING OF A VLA-4 RECEPTOR |
| EP2318424A4 (en) * | 2008-06-23 | 2012-12-26 | Teva Pharma | METHODS FOR TREATING MULTIPLE SCLEROSIS USING ANTISENSE OLIGONUCLEOTIDES |
| US8759314B2 (en) | 2008-06-23 | 2014-06-24 | Antisense Therapeutics Limited | Methods for treating multiple sclerosis using antisense oligonucleotides |
| EP2937358A1 (en) * | 2008-06-23 | 2015-10-28 | Antisense Therapeutics Ltd | Methods for treating multiple sclerosis using antisense oligonucleotides |
| WO2016179634A1 (en) * | 2015-05-11 | 2016-11-17 | Murdoch University | Multiple sclerosis treatment |
| US10376536B2 (en) | 2015-05-11 | 2019-08-13 | Murdoch University | Multiple sclerosis treatment |
| WO2017075670A1 (en) * | 2015-11-05 | 2017-05-11 | Children's Hospital Los Angeles | "mobilizing leukemia cells" |
| US11041156B2 (en) | 2015-11-05 | 2021-06-22 | Antisense Therapeutics Ltd | Mobilizing leukemia cells |
| AU2016349954B2 (en) * | 2015-11-05 | 2022-08-25 | Antisense Therapeutics Ltd | Mobilizing leukemia cells |
Also Published As
| Publication number | Publication date |
|---|---|
| US5968826A (en) | 1999-10-19 |
| EP1123414B1 (en) | 2007-01-24 |
| JP3834204B2 (ja) | 2006-10-18 |
| JP4168285B2 (ja) | 2008-10-22 |
| DE69934998D1 (de) | 2007-03-15 |
| US6258790B1 (en) | 2001-07-10 |
| CA2345209A1 (en) | 2000-04-13 |
| EP1123414A4 (en) | 2003-10-01 |
| JP2002526555A (ja) | 2002-08-20 |
| ATE352639T1 (de) | 2007-02-15 |
| JP2006141402A (ja) | 2006-06-08 |
| DE69934998T2 (de) | 2007-12-06 |
| AU5570399A (en) | 2000-04-26 |
| ES2279632T3 (es) | 2007-08-16 |
| CA2345209C (en) | 2014-04-22 |
| AU759938B2 (en) | 2003-05-01 |
| EP1123414A1 (en) | 2001-08-16 |
| DK1123414T3 (da) | 2007-04-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU765168B2 (en) | Antisense oligonucleotide modulation of tumor necrosis factor-alpha (TNF-alpha) expression | |
| AU755515C (en) | Antisense modulation of BCL-X expression | |
| US6080580A (en) | Antisense oligonucleotide modulation of tumor necrosis factor-α (TNF-α) expression | |
| US6136603A (en) | Antisense modulation of interleukin-5 signal transduction | |
| EP1569695B1 (en) | Antisense modulation of apolipoprotein b expression | |
| US5985663A (en) | Antisense inhibition of interleukin-15 expression | |
| CA2345209C (en) | Antisense modulation of integrin .alpha.4 expression | |
| JP2002541784A (ja) | Stat3発現のアンチセンスオリゴヌクレオチド調節 | |
| EP1082456A1 (en) | Antisense modulation of cd40 expression | |
| US6204055B1 (en) | Antisense inhibition of Fas mediated signaling | |
| AU765928B2 (en) | Antisense modulation of transforming growth factor-beta expression | |
| JP2003520042A (ja) | 誘導性一酸化窒素シンターゼ発現のアンチセンスモジュレーション | |
| WO2000074687A9 (en) | Antisense modulation of b7 protein expression | |
| JP2003518928A (ja) | Akt−3発現のアンチセンスモジュレーション | |
| WO2000032818A1 (en) | Antisense modulation of cellular inhibitor of apoptosis-2 expression | |
| US20020004490A1 (en) | Antisense modulation of Fas mediated signaling | |
| US20040023908A1 (en) | Antisense modulation of a20 expression | |
| ZA200503690B (en) | Antisense modulation of apolipoprotein B expression | |
| US20030144225A1 (en) | Antisense modulation of macrophage inflammatory protein 3-alpha expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| ENP | Entry into the national phase |
Ref document number: 2345209 Country of ref document: CA Ref country code: CA Ref document number: 2345209 Kind code of ref document: A Format of ref document f/p: F |
|
| ENP | Entry into the national phase |
Ref country code: JP Ref document number: 2000 574727 Kind code of ref document: A Format of ref document f/p: F |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1999942290 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 55703/99 Country of ref document: AU |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWP | Wipo information: published in national office |
Ref document number: 1999942290 Country of ref document: EP |
|
| WWG | Wipo information: grant in national office |
Ref document number: 55703/99 Country of ref document: AU |
|
| WWG | Wipo information: grant in national office |
Ref document number: 1999942290 Country of ref document: EP |