WO2000015772A2 - Production de proteines recombinantes dans l'urine - Google Patents

Production de proteines recombinantes dans l'urine Download PDF

Info

Publication number
WO2000015772A2
WO2000015772A2 PCT/IB1999/001609 IB9901609W WO0015772A2 WO 2000015772 A2 WO2000015772 A2 WO 2000015772A2 IB 9901609 W IB9901609 W IB 9901609W WO 0015772 A2 WO0015772 A2 WO 0015772A2
Authority
WO
WIPO (PCT)
Prior art keywords
animal
polypeptide
promoter
urine
nucleic acid
Prior art date
Application number
PCT/IB1999/001609
Other languages
English (en)
Other versions
WO2000015772A3 (fr
WO2000015772A9 (fr
Inventor
Costas N. Karatzas
Original Assignee
Nexia Biotechnologies, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nexia Biotechnologies, Inc. filed Critical Nexia Biotechnologies, Inc.
Priority to CA002343104A priority Critical patent/CA2343104A1/fr
Priority to AU57553/99A priority patent/AU5755399A/en
Priority to EP99944741A priority patent/EP1112353A2/fr
Priority to JP2000570299A priority patent/JP2002525047A/ja
Publication of WO2000015772A2 publication Critical patent/WO2000015772A2/fr
Publication of WO2000015772A3 publication Critical patent/WO2000015772A3/fr
Publication of WO2000015772A9 publication Critical patent/WO2000015772A9/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2839—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the integrin superfamily
    • C07K16/2842—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the integrin superfamily against integrin beta1-subunit-containing molecules, e.g. CD29, CD49
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
    • C07K14/723—G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH receptor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/108—Plasmid DNA episomal vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/40—Vector systems having a special element relevant for transcription being an insulator
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/80—Vector systems having a special element relevant for transcription from vertebrates
    • C12N2830/85—Vector systems having a special element relevant for transcription from vertebrates mammalian
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
    • C12N2840/203—Vectors comprising a special translation-regulating system translation of more than one cistron having an IRES
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/44—Vectors comprising a special translation-regulating system being a specific part of the splice mechanism, e.g. donor, acceptor

Definitions

  • the invention relates to transgenic animals capable of secreting recombinant polypeptides in their urine.
  • recombinant proteins utilizing an animal as a bioreactor has the advantage of producing a recombinant protein that is likely properly folded. In addition, since animals can reproduce, they provide an almost inexhaustible source of the recombinant protein. Production of recombinant proteins in animal fluids has been used widely. Examples include the secretions of recombinant proteins in milk using milk specific promoters.
  • Urine presents an advantage over the milk specific expression of recombinant polypeptides for the following reasons: (1) the process of recombinant polypeptide production from urine is initiated immediately after birth (or even prior to birth); (2) unlike the lactation process, urine-specific recombinant polypeptide production doesn't depend on a hormonal or reproductive status of the transgenic animal; and (3) both female and male animals can be used for recombinant polypeptide production from urine.
  • urine naturally contains very small amounts of proteins as compared to milk, thus facilitating the isolation of recombinant polypeptides from the urine of transgenic animals.
  • re hGH recombinant human growth hormone
  • the present invention provides a transgene that includes a desired polypeptide whose expression is driven by the uromodulin gene promoter, or another promoter from a gene whose product is specifically expressed in the kidney, thus allowing the expression and secretion of the polypeptide from the kidney into the urine, from which it can be isolated.
  • the invention provides transgenic non- human urine secreting animals which are capable of producing recombinant polypeptide that are secreted extracellularly into the urine by the kidney tissue of the animal.
  • the animals may be mammals, and may be ruminants, or non- ruminants.
  • Representatives of non-human urine-secreting mammals useful in the invention include, without limitation, rodents, rabbits, pigs, goats, sheep, horses, and cows.
  • the recombinant polypeptide is an enzyme that is able to degrade or catalyze a degradation reaction of undesirable components of urine (e.g., ammonia).
  • the invention provides a method for obtaining urine of a transgenic animal that includes the steps of: (a) generating a transgenic construct composed of the controlling elements of a kidney specific gene (including the 5'-end promoter sequences and 3'-end elements) operably linked to the nucleic acid sequence of interest to be expressed; (b) screening the construct before a transgenic animal is generated; this construct screening could be done in kidney epithelial lines; (c) inserting into the genome of a non human animal the transgenic construct; (d) collecting the urine from this non-human animal; and (e) isolating the product from the animal's urine.
  • the kidney specific gene is the uromodulin gene.
  • the invention features a transgene useful for the generation of a transgenic animal, where transgene includes: (a) a promoter from a kidney specific gene that is functional in the kidney secretory cells of the transgenic animal of interest, (b) a leader sequence that is functional in the kidney secretory cells of said transgenic species and (c) a nucleic acid sequence encoding a recombinant endogenous or exogenous product.
  • the kidney specific gene is a uromodulin gene.
  • the leader sequence is operably linked to the nucleic acid sequence to form a functional transgene that is capable of directing the expression of the secreted recombinant polypeptide (encoded by the nucleic acid sequence) in kidney secretory cells of the transgenic animal.
  • the kidney specific gene promoter is from the same species of animal as the of the transgenic animal (e.g., a promoter from a goat uromodulin gene is used to generate a transgenic goat).
  • the transgene also contains in the 5 ' or 3' region at least one copy of insulator element sequence or a matrix attachment region.
  • the transgene includes four functional regions: (i) the insulator element sequence; (ii) a kidney specific expression regulation portion (e.g., the uromodulin gene promoter); (iii) a leader sequence; and (iv) a nucleic acid molecule encoding a polypeptide of interest.
  • the nucleic acid sequence encoding the polypeptide of interest may be cDNA or genomic DNA, or may encode more than one polypeptide, or a hybrid of two different proteins with domains including two different activities (e.g., hybrid polypeptide containing the Fc portion of an immunoglobulin fused to insulin).
  • the invention provides urine from a transgenic non- human mammal, where the urine is characterized by containing an endogenous or exogenous recombinant polypeptide, and is secreted by a transgenic animal.
  • the transgenic animal is produced by introducing into its genome a transgene containing a nucleic acid sequence encoding the recombinant polypeptide of interest, where the nucleic acid sequence is operably linked to controlling elements from a kidney specific gene (e.g., the uromodulin gene).
  • the controlling elements are a gene promoter.
  • the invention provides a nucleic acid molecule including (i) a nucleic acid sequence encoding a polypeptide, (ii) a promoter from a kidney specific gene (e.g., the uromodulin gene), where the promoter is operably linked to the sequence, and where the promoter is not naturally associated with the nucleic acid sequence, and (iii) a leader sequence that enables secretion of the polypeptide by the urine-producing cells into urine of an animal.
  • a kidney specific gene e.g., the uromodulin gene
  • the kidney- specific gene is selected from the group consisting of a cow, a human, and a rodent
  • the animal is a mammal or is selected from the group consisting of a rodent and a ruminant (e.g., a cow, sheep, or goat).
  • the polypeptide may have biological activity or may be soluble.
  • the invention provides an animal in which the genome of cells that contribute to urine production in the animal includes a nucleic acid molecule including (i) a nucleic acid sequence encoding a polypeptide, (ii) a promoter from a kidney specific gene (e.g., a uromodulin gene), where the promoter is operably linked to the sequence, and where the promoter is not naturally associated with the nucleic acid sequence, and (iii) a leader sequence that enables secretion of the polypeptide by the urine-producing cells into urine of an animal.
  • the cells are kidney secretory cells
  • the animal is a selected from the group consisting of a rodent and a ruminant (e.g., a cow, sheep, or goat), and the animal is a mammal.
  • the invention features a method for producing a polypeptide that is secreted in the urine of an animal, the method including the steps of: (a) providing an embryonal cell transfected with a polypeptide- encoding nucleic acid molecule operably linked to a kidney specific gene promoter (e.g., a uromodulin gene promoter) that expresses and causes secretion of the polypeptide from a kidney cell derived from the transfected embryonal cell, where the promoter is not naturally associated with the nucleic acid sequence; (b) growing the embryonal cell to produce an animal including polypeptide expressing and secreting cells; and (c) isolating the protein from the polypeptide expressing and secreting cells of the animal.
  • the animal is a mammal.
  • the invention features a method for producing a polypeptide, the method including the steps of: (a) providing a cell of an animal, the cell transfected with a nucleic acid molecule that contains (i) a nucleic acid sequence encoding a polypeptide, (ii) a kidney specific gene promoter (e.g., a uromodulin gene promoter) that directs expression of the polypeptide in the cell, where the promoter is not naturally associated with the nucleic acid sequence, and (iii) a leader sequence that causes secretion of the polypeptide by the cell; (b) culturing the transfected cell; and (c) isolating the polypeptide from the culture medium of the cultured transfected cell.
  • the cell is a kidney secretory cell or is an immortalized cell.
  • the animal is a mammal.
  • the invention features a method for producing, in the urine of a vertebrate, a recombinant protein that contains two or more subunits linked to each other by disulfide bonds; the method includes the step of: (a) providing a transgenic vertebrate exhibiting urine-specific production of the recombinant protein; (b) collecting urine from the vertebrate; and (c) isolating the protein from the urine.
  • a related aspect of the invention is the vertebrate animal used in this method. The method can employ a uroplakin I, uroplakin II, or uromodulin promoter.
  • the protein when it is excreted into the urine for the animal, is folded such that it is rendered biologically active (i.e., exhibits at least some of the biological activty of the native form of the protein).
  • the protein in order to protect the animal from possible dilaterious effects of the active protein, can be intentionally engineered to render it partially or wholly inactive at the time of secretion, but activatable by simple means following collection of the urine from the animal.
  • Such methods are known and are described e.g., in U.S. Serial No. 08/775,842, commonly assigned with the present application.
  • Examples of multimeric proteins that can be produced according to this ninth aspect of the invention are monoclonal antibodies, of any isotype; and heterodimeric fertility hormones.
  • the main hormones in this category are follicle stimulating hormone (FSH), lutenizing hormone (LH), and human chorionic gonadotrophin (hCG).
  • FSH follicle stimulating hormone
  • LH lutenizing hormone
  • hCG human chorionic gonadotrophin
  • Each of these hormones is a glycoprotein containing an alpha and a beta subunit; the alpha subunit of all three is identical, while the beta-subunits differ and confer specificity of biological action on each hormone.
  • FSH and LH are important commercial products which have been purified from human urine. These hormones currently are made in recombinant form in cultured mammalian cells. The sequences of all of these hormones are known. For example, PCT Application WO 90/02757 gives the sequences of LH and FSH.
  • the process of the ninth aspect of the invention can also be used to produce another important commercial hormone product, pregnant mare serum gonadotrophin (PMSG), which is a heterodimeric glycoprotein containing an alpha and a beta subunit.
  • PMSG pregnant mare serum gonadotrophin
  • the method can also be used to make inhibins and activins, which are also heterodimeric glycoproteins that are produced in the gonads.
  • Mature inhibin consists of an ⁇ C-subunit with either a ⁇ A-or a ⁇ B- subunit.
  • Members of this family of dimers include inhibin A, inhibin B, activin A, activin AB, and activin B (which is a homodimer, a class of multimeric proteins also included in the invention).
  • the process of the ninth aspect of the invention can also be used to make any of the multiple forms of collagen, including homotrimeric and heterotrimeric forms; the sequences of collagen chains are known, and disclosed, e.g., in PCT Application WO 96/03051.
  • the method for the ninth aspect of the invention can also be used to produce fibrinogen, which is a heterotrimeric protein whose sequences are known, e.g., PCT Application WO 95/22249.
  • the invention also provides multiple transgenes encoding various polypeptides or versions of the same polypeptide (e.g., a polypeptide containing conservative amino acid substitutions, or amino acid substitutions that would enhance the stability of the polypeptide). These multiple transgenes may be coinjected (i.e., co-microinjected) simultaneously, or sequentially. Thus, two or more recombinant polypeptides are secreted in the transgenic animal's urine.
  • protein or “polypeptide” is meant any chain of amino acids, regardless of length or post- translational modification (e.g., glycosylation or phosphorylation) .
  • naturally associated is meant that two sequences (e.g., a promoter and a polypeptide-encoding sequence) are operably linked in the naturally occurring genome of the organism from which the two sequences are derived.
  • the bovine uromodulin gene promoter is naturally associated with the bovine uromodulin-encoding sequence .
  • not naturally associated is meant that two sequences (e.g., a promoter and a polypeptide-encoding sequence) are not operably linked in the naturally occurring genome of the organism from which one or both of the two sequences are derived.
  • the goat uromodulin gene promoter is not naturally associated with the bovine uromodulin-encoding sequence.
  • the goat uromodulin gene promoter is not naturally associated with the human tPA-encoding sequence.
  • kidney specific gene is meant a gene whose product is expressed only in kidney cells.
  • uromodulin gene is a gene whose product is expressed only in kidney cells.
  • uroplakin genes are a gene whose products are expressed in the bladder.
  • an “insulator element sequence” is meant a nucleic acid sequence which, when operably linked to a regulatory element (e.g., a promoter) directing the expression of a nucleic acid molecule of interest on a transgene, allows for the expression of the nucleic acid molecule, regardless of the position of the genome in which the transgene has integrated. Typically, an insulator sequence is located immediately 5' to a promoter sequence.
  • a leader sequence or a “signal sequence” is meant a nucleic acid sequence which, when operably linked to a nucleic acid molecule of interest, allows for the secretion of the product of the nucleic acid molecule.
  • the leader sequence is preferably located 5' to the nucleic acid molecule.
  • the leader sequence is obtained either from same gene as the promoter that is used to direct the transcription of the nucleic acid molecule, or is obtained from the gene from which the nucleic acid molecule of interest is derived.
  • a transfected cell or a “transformed cell” is meant a cell into which (or into an ancestor of which) has been introduced, by means of recombinant molecular biology techniques, a nucleic acid molecule encoding a polypeptide of the invention.
  • the cell is a eukaryotic cell from a multicellular animal (e.g., a mammal).
  • embryonal cell By an “embryonal cell” is meant a cell that is capable of being a progenitor to all the somatic and germ-line cells of an organism.
  • exemplary embryonal cells are embryonic stem cells (ES cells) and fertilized oocytes.
  • ES cells embryonic stem cells
  • fertilized oocytes Preferably, the embryonal cells of the invention are mammalian embryonal cells.
  • germ-line cell is meant a eukaryotic cell, progenitor, or progeny thereof, which is a product of a meiotic cell division.
  • operably linked is meant that a nucleic acid sequence and one or more regulatory sequences (e.g., a promoter) are connected in such a way as to permit expression and/or secretion of the product (i.e., a polypeptide) encoded by the nucleic acid sequence when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the regulatory sequences.
  • endogenous as used herein in reference to a gene or a polypeptide, is meant a gene or polypeptide that is normally present in an animal.
  • exogenous as used herein in reference to a gene or a polypeptide, is meant a gene or polypeptide that is not normally present in an animal.
  • human growth hormone is exogenous to a transgenic goat.
  • transgene any piece of nucleic acid that is inserted by artifice into a cell, or an ancestor thereof, and becomes part of the genome of the animal which develops from that cell.
  • a transgene may include a gene which is partly or entirely exogenous (i.e., foreign) to the transgenic animal, or may represent a gene having identity to an endogenous gene of the animal.
  • transgenic any cell which includes a nucleic acid sequence that has been inserted by artifice into a cell, or an ancestor thereof, and becomes part of the genome of the animal which develops from that cell.
  • the transgenic animals are transgenic mammals (e.g., rodents or ruminants).
  • the nucleic acid (transgene) is inserted by artifice into the nuclear genome.
  • reporter gene any gene or nucleic acid molecule which encodes a product whose expression is detectable.
  • a reporter gene product may have one of the following attributes, without restriction: fluorescence (e.g., green fluorescent protein), enzymatic activity (e.g., luciferase or chloramphenicol acetyl transferase), toxicity (e.g., ricin), an ability to confer resistance to a reagent (e.g., resistance to neomycin by the neo gene or resistance to copper by the metallothionein-encoding gene), an ability to confer susceptibility to a reagent (e.g., susceptibility to gancyclovir by the Herpes Simplex Virus thymidine kinase-encodmg gene), or an ability to be specifically bound by a second molecule, such as biotin or a detectably labelled antibody (e.g., binding by biotin by the avidin-encoding gene or binding
  • Fig. 1 shows the partial DNA sequence of the human uromodulin gene promoter (GenBank Accession No. S75968; Yu et al., Gene Expr. 4: 63-75, 1994).
  • Fig. 2 shows the partial DNA sequence of the bovine uromodulin gene promoter (GenBank Accession No. S75961; Yu et al., supra).
  • Fig. 3 shows the partial DNA sequence of the rat uromodulin gene promoter (GenBank Accession No. S75965; Yu et al., supra).
  • Fig. 4 is a schematic diagram illustrating an example of a method to generate a uromodulin promoter transgenic construct.
  • the nucleic acid sequence (flanked by BamHI and Spel sites) in this figure may encode human tPA (see Fig. 5), or may encode a reporter gene, such as luciferase.
  • Fig. 5 is a schematic diagram of a PCR reaction to generate a human tPA-encoding cDNA fragment flanked by a BamHI recognition sequence on the 5' end and a Spel recognition sequence on the 3' end.
  • Fig. 6 is a schematic diagram of a transgenic construct that includes a goat uromodulin gene promoter directing the expression of a human tPA- encoding sequence.
  • the backbone plasmid has a hygromycin resistance gene for eukaryotic cell selection, an ampicillin resistance gene for prokaryotic cell selection, and a ColEl origin of replication for amplification in bacteria.
  • Figs. 7-9 are schematic representations of the construction of expression vectors of the invention.
  • Fig. 10 is the sequence of the goat UM promoter.
  • the present invention relates to a process for excreting recombinant proteins in the urine of non-human animals.
  • This process uses expression vectors containing promoter sequences based on the regulatory elements of uromodulins (also called the Tamm-Horsfall glyoprotein (THS) / uromucoid), or the promoter sequencess from other kidney-specific genes to express recombinant proteins in the kidney, thus allowing their secretion into urine.
  • Uromodulin is synthesized by the kidney and localizes in the early distal tubule and the renal ascending limb.
  • Uromodulin is the most abundant protein in human (30-45 mg/24 hours) and rat urine (0.5-2.9 mg/24 hours) (Gokhale et al., Urol. Res. 25: 347-354, 1997). No uromodulin protein has been detecting in normal tissues other than the kidney (Howie, A.J., J. Pathol. 153: 399-404, 1987), however cross-reacting proteins with antibodies against uromodulin have been identified in human and rat sera at low-levels (Lynn and Marshall, Biochem. J. 194: 561-568, 1981; Wirdnam and Milner, Nephron 40: 362- 367,1985).
  • Antibodies raised against uromodulin crossreact with the loop of Henle in the kidney of mammals, superficial layers of the skin of several amphibians and fish, superficial layers of the oral mucosa and gills of fish, and the distal tubules of the kidney of amphibians. No cross reaction is observed in avian and reptile species (Howie et al., Cell Tissue Res. 274: 15-19, 1993).
  • Uromodulin is a 616-amino acid, 85 kDA glycoprotein with in vitro immuno-suppressive properties.
  • the partial bovine and rodent uromodulin promoters have been cloned and shown to contain the typical controlling transcriptional elements in the proximal promoter (Yu et al., Gene Expr. 4: 63- 75, 1994).
  • Using the uromodulin promoter is useful for generating urine- secreted proteins because, since the level of uromodulin can be increased by increasing the urine volume, a means is thus provided for increasing the total output of the recombinant product, whose expression is directed by the uromodulin gene promoter.
  • amniotic fluid sampling may allow early detection of a transgenic fetus expressing a recombinant (re) polypeptide whose expression is directed by the uromodulin gene promoter (see the procedure of Phimister and Marshall, Clin. Chim. Acta 128: 261-269, 1983).
  • re recombinant
  • any appropriate backbone may be used.
  • the backbone plasmid may be derived from a cosmid (e.g., SuperCos or pWE15, both commercially available from Stratagene, La Jolla, CA).
  • the backbone has a prokaryotic origin of replication, as well as a gene encoding a selectable marker that may be used for prokaryotic cells (e.g., ampicillin, tetracycline, and chloramphenicol), for easy propagation and amplification in transformed bacteria.
  • the complete transgenic construct may be linearized by removing all the bacterial sequences (i.e., the bacterial origin of replication and the bacterial selectable marker gene).
  • the backbone plasmid should have a selectable marker gene that may be used for selection in a eukaryotic cell (for example, hygromycin, neomycin, puromycin, and zeomycin).
  • a selectable marker gene may be under the expression of its endogenous promoter (e.g., the puromycin-resistance gene promoter directing the expression of the puromycin-resistance gene).
  • a relatively weak promoter e.g., the SV40 early promoter
  • polypeptides encoded by nucleic acid sequences to be expressed and secreted in the urine include, without limitation, erythropoietin (EPO), human tissue plasminogen activator (htPA), insulin, antibodies (e.g., monoclonal or humanized), and hormones (e.g., human growth hormone).
  • EPO erythropoietin
  • htPA human tissue plasminogen activator
  • insulin e.g., monoclonal or humanized
  • hormones e.g., human growth hormone
  • the basic transgenic construct contemplated includes the following elements: the plasmid backbone; a kidney specific gene promoter (e.g., the uromodulin gene promoter) operably linked to a leader sequence and a nucleic acid sequence encoding a polypeptide of interest; and a polyadenylation signal located 3' to the stop codon of the nucleic acid sequence.
  • the leader sequence may be derived either from the gene whose promoter is being employed, from the nucleic acid sequence, or from an alternate secreted protein-encoding sequence (e.g., the Ig ⁇ gene).
  • the 3' UTR which includes the polyadenylation signal, may be from the gene from which the promoter is derived, from the nucleic acid sequence of interest, or from an alternate source (e.g., the SV40 virus).
  • a 5' UTR may be located between the promoter sequence and the leader sequence, and may be from the gene whose promoter is being employed, the nucleic acid sequence of interest, or from an alternate source.
  • the transgenic construct may be generated in a three part ligation of the linearized backbone plasmid, the kidney specific gene promoter sequence (flanked by appropriate linkers), and the following fragment, likewise flanked by appropriate linkers: 5' UTR, leader sequence, nucleic acid sequence encoding the polypeptide of interest, and 3' UTR.
  • GenBank sequence database provides a number of uromodulin sequences from a variety of mammals, including human (Accession Nos. Ml 5881 and M17778).
  • sequence of the uromodulin promoter from a particular animal e.g., a goat
  • genomic DNA from that animal using standard library screening techniques.
  • the remainder of the promoter may be derived using standard primer extension protocols or a PCR-based "gene walking” technique (using, for example, the Genome WalkerTM kits commercially available from Clontech Laboratories, Inc., Palo Alto, CA).
  • the uromodulin gene promoter can be operably linked to a reporter sequence, such as a sequence encoding luciferase.
  • This reporter construct may be used to test the ability of the cloned promoter to express and secrete luciferase from transformed cells. For example, following transformation of kidney cells (e.g., COS cells) with a construct of the uromodulin gene promoter operably linked to the luciferase encoding sequence, the culture media of the cells may be quickly assayed for the presence of luciferase (using, for example, the luciferase detection assay kit commercially available from Promega Corp., Madison, WI).
  • the recombinant protein is expressed in the urine, it can be purified using standard protein purification techniques, such as affinity chromatography (see, e.g., Ausubel et al., Current. Protocols in Molecular Biology, John Wiley & Sons, New York, NY, 1994).
  • the recombinant protein is human epidermal growth factor (EGF)
  • the urine may be added to an affinity column to which are immobilized anti-human EGF antibodies (commercially available from, for example, Upstate Biotech. Inc., Lake Placid, NY).
  • the recombinant protein can, if desired, be further purified by e.g. , by high performance liquid chromatography (HPLC; e.g., see Fisher, Laboratory Techniques Tn Biochemistry And Molecular Biology, eds. Work and Burdon, Elsevier, 1980).
  • HPLC high performance liquid chromatography
  • Transgenic constructs are usually introduced into cells by microinjection (Ogata et al, U.S.P.N. 4,873,292). A microinjected zygote is then transferred to an appropriate female resulting in the birth of a transgenic or chimeric animal, depending upon the stage of development of the zygote when the transgene integrated. Chimeric animals can be bred to form true germline transgenic animals.
  • transgenes are introduced into the pronuclei of fertilized oocytes.
  • fertilized ova are surgically removed.
  • the ova can be removed from live, or from newly-dead (e.g., slaughterhouse) animals and fertilized in vitro.
  • transgenes can be introduced into embryonic stem cells (ES cells).
  • Transgenes can be introduced into such cells by electroporations, microinjection, or any other techniques used for the transfection of cells which are known to the skilled artisan.
  • Transformed cells are combined with blastocysts from the animal from which they originate. The cells colonize the embryo, and in some embryos these cells form the germline of the resulting chimeric animal (Jaenisch, R., Science 240: 1468-1474, 1988).
  • ES cells can be used as a source of nuclei for transplantation into an enucleated fertilized oocyte, thus giving rise to a transgenic animal.
  • nucleic acid encoding each of the two subunits can be cloned into the same expression cassette with the insertion of an intervening ribosomal entry site (IRES) (Jang et al, J. Virol. 62: 2636-2643, 1988; Gurtu et al., Biochem. Biophys. Res. Comm. 229: 295-298, 1996).
  • IRS intervening ribosomal entry site
  • the construct Prior to the microinjection of a transgenic construct encoding a desired polypeptide, the construct may be screened in cultured kidney cells in vitro for an ability to encode a polypeptide that is expressed and secreted by the transfected cultured cells.
  • Cultured kidney epithelial cells such as COS cells or MDCK cells (both commercially available from the American Type Culture Collection (ATCC, Rockville, MD), may be transformed with the transgenic construct using any standard transformation protocol (e.g., CaPO 4 precipitation, DEAE-dextran, electroporation; see Ausubel et al., supra).
  • kidney specific gene promoter e.g., the uromodulin promoter
  • the desired polypeptide encoded by the transgenic construct will be expressed and secreted by the transformed cells if the transgenic construct is functional.
  • the conditioned culture media of the transformed cells may then be assayed for the presence of the secreted recombinant polypeptide.
  • Smaller mammals e.g., rodents
  • rodents have a reasonably short gestation period, thus allowing a rapid determination of whether or not the transgenic animal is truly transgenic and able to produce the recombinant protein in its urine.
  • larger animals e.g., cattle
  • Fetal renal function starts early during gestation and uromodulin is detectable in the amniotic fluid, implying, of course, that the uromodulin promoter is active.
  • amniotic fluid may be removed and tested for the presence of the recombinant polypeptide whose expression is directed by a uromodulin promoter.
  • Such testing may be by any standard immmunological assay (e.g., ELISA, Western blotting analysis), or, if no specific antibodies are available, by purification of the recombinant polypeptide and N-terminal sequencing.
  • immmunological assay e.g., ELISA, Western blotting analysis
  • the uromodulin gene promoter from the goat, it will be understood that a uromodulin gene promoter from another species is also contemplated by the invention.
  • other kidney specific gene promoters whether they direct the expression of an intracellular or secreted protein, are also within the invention.
  • the leader sequence may be from the uromodulin gene, the nucleic acid sequence encoding the desired polypeptide, or any other secreted polypeptide.
  • the uromodulin promoter sequence may be cloned using standard techniques (e.g., hybridization under non-stringent conditions) to isolate a uromodulin promoter sequence using as a probe one of the known partial uromodulin promoter sequences (i.e., the rat, human, or bovine sequence).
  • a uromodulin promoter sequence i.e., the rat, human, or bovine sequence.
  • the animal desired to be made transgenic will affect which of the known partial sequences will be used as a probe.
  • the partial sequence of the bovine uromodulin promoter may be cloned using standard techniques (e.g., hybridization under non-stringent conditions) to isolate a uromodulin promoter sequence using as a probe one of the known partial uromodulin promoter sequences (i.e., the rat, human, or bovine sequence).
  • the animal desired to be made transgenic will affect which of the known partial sequences will be used as a probe.
  • the full length promoter may be isolated by extending the isolated fragment using primer extension.
  • the full length promoter may be obtained using the commercially available gene walked kit commercially available from Clontech.
  • linkers may be attached to the ends of the promoter sequence and ligated into a bacterial plasmid containing a bacterial origin of replication (e.g., the pucl9 vector) for rapid amplification of the promoter in vector-transformed E. coli.
  • the promoter may be freed from the pucl9 vector by digestion with the restriction endonuclease which specifically cleaves at the linker sequence, and be subcloned into the transgenic construct.
  • the digested fragment can be combined with digested fragments corresponding to the leader sequence and the nucleic acid encoding the desired polypeptide (e.g., tPA), and used in a four-part ligation with a EcoRI/Spel linearized eukaryotic expression vector, a fragment containing the nucleic acid sequence of interest, and a fragment containing the 5' UTR and leader sequence (see Fig. 4).
  • a four part ligation need be used only if the 5' UTR and leader sequence are not from the uromodulin gene or the human tPA gene.
  • the backbone plasmid in Fig. 4 already contains a 3' UTR and polyadenylation signal 3' to the stop codon of the inserted human tPA-encoding nucleic acid sequence.
  • the coding sequence of the tPA gene may be generated using the known human tPA cDNA sequence (GenBank Accession No. E02027). As depicted in Fig. 5, a forward primer containing a BamHI restriction enzyme recognition site at its 5' end and a reverse primer containing a Spel restriction enzyme recognition site at its 5' end may be used to PCR amplify a human tPA- encoding cDNA sequence from a human cDNA library (commercially available from, for example, Clontech, Palo Alto, CA).
  • the PCR product may be digested with BamHI and Spel and, as above, ligated with the fragments corresponding to the uromodulin promoter and the leader sequence with the EcoRI and Spel linearized vector (see Fig. 4).
  • Example III
  • the ability of the construct to enable a transformed cell to express and secrete a polypeptide encoded by the construction may first be determined using transformed cultured kidney epithelial cells.
  • green monkey kidney cells COS cells
  • the construct may first be linearized using a unique restriction endonuclease recognition site located within the bacterial origin of replication or the prokaryotic selectable marker gene. Twenty- four hours following transformation, the cells' spent conditioned media is exchanged with fresh media, and the cells are returned to culture.
  • the construct may be used, as is, to microinject goat zygotes. In the alternative, where tPA is produced by the transformed cells, but in a quantity that is less than desirable, the construct may be modified, and retested in COS cells.
  • Example IV After repeated screening in COS cells, a transgenic construct, such as that shown schematically in Fig. 6, may be generated.
  • the construct shown has an insulator element sequence located upstream of the goat uromodulin promoter sequence to allow expression of the construct regardless of the site of integration.
  • the SV40 3' UTR (which includes the SV40 poly A signal) of Fig. 4 is replaced with the 3' UTR of th ⁇ goat uromodulin gene.
  • the construct may now be linearized, if desired, by digesting the construct with Xhol and Xbal to remove the ampicillin resistance gene and the ColEl origin of replication (i.e., the digestion fragment that includes the ColEl origin and the ampicillin resistance gene is discarded).
  • the remaining fragment i.e., the transgene
  • restriction endonucleases any suitable restriction endonuclease may be employed.
  • the linkers used to flank the sequence may be recognition sites of rare-cutting enzymes (e.g., Ssel or Notl).
  • the construct depicted in Fig. 6 can be used to generate transgenic mice capable of secreting human tPA into their urine.
  • the generation of transgenic mice prior to the generation of transgenic goats is preferable not only because of the greater time expenditure (i.e., longer gestation period) required to generate a transgenic goat as opposed to a transgenic mouse, but also because of the higher expense in maintaining and housing the animals.
  • mice are superovulated and mated with males to produce fertilized eggs.
  • the eggs are harvested for pronuclear microinjection.
  • a Leitz micro-manipulator and a Nikon inverted microscope may be employed for the microinjections. Pseudopregnant female mice are then implanted with microinjected two-cell embryos. Once the pups are born, their urine is screened for the presence of human tPA.
  • K20 is a mouse monoclonal antibody ("mAb") that recognizes a particular epitope on human CD29.
  • mAb mouse monoclonal antibody
  • a soluble form of K20 was shown to block peripheral T cell activation and proliferation induced by an anti-CD3 antibody. This negative effect might be mediated by an increase in cAMP levels or an inhibition of diacylglycerol and PA formation.
  • the in vitro functional effects of K20 make it a good candidate for therapeutic immunosuppression.
  • a humanized K20 mAb (Hu-K20) has been produced with potentially reduced immunogenicity and functional properties identical with the murine mAb K20 (Paul, M.A. et al., Mol. Immunol. 32: 101-116, 1995).
  • a group of membrane proteins known as uroplakins produced on the apical surface of the bladder urothelium, can form thick protein particles makeing two-dimensional crystals (the "urothelial plaques") that cover over 80% of the apical surface of urothelium (Yu, J. et al.: J. Cell Biol. 125: 171- 182, 1994; Sun T. T. et al.: Mol. Bio. Rep. 23: 3-11, 1996).
  • mice that express human growth hormone (hGH) in their bladder epithelium were generated, resulting in the secretion of the recombinant hGH into the urine at 100-500 mg/1 (Kerr, D.E. et al.: Nat. Biotechnol. 16: 75-79, 1998).
  • hGH human growth hormone
  • Hu-K20 expression cassettes using a eukaryotic expression vector, pcDNA4/HisMax (Invitrogen). Standard methods are used for plasmid purification, restriction enzyme digestion, DNA litigation, and DNA fragment isolation.
  • construction of the Hu-K20 light chain expression cassette PCR is performed using DNA of the 483 wkmM16 expression vector (Dr. Zhou, Nexia) as the template with a 5' sense primer (S'GCGCAGCAAXrGGCGGCCGCTCTAGACTCGS') containing a Muni site (underlined) and a 3' antisense primer
  • a pcDNA4/HisMax expression vector (Invitrogen) is digested with Muni and BamHI, and the CMV promoter-less vector is ligated with the Munl-BamHI fragments from pcDNA4/HisMax as the template with a 5' sense primer
  • the amplified SP 163 fragment which serves as a translational enhancer (Gorman, C. M. et al.: Proc. Natl. Acad. Sci. 79: 6777- 6781, 1982) is digested with BamHI and Bswl.
  • a 320 bp fragment of the variable region of the mAb Hu-K20 light chain module is obtained by PCR amplification of pSVhyg-HuVKK20-HuCK plasmid DNA (Paul, M.A. et al, Mol. Immunol.
  • Another PCR is performed in pSVhyg-HuVKK20-HuCK with a 5' sense primer (S'CGCTATGXTAACGAGTAGACTTAAACACCATCCTGTTTCGS') containing a Hpal site (underlined) a splice donor signal (bold) for the 3' end of the variable region of the light chain, and partial 5' sequence of the human genomic Ig kappa constant region, and a 3' antisense primer (5'C ⁇ CGTATGTTTAAACGAGTAGTTGGTAAACAACAG3') containing a Pmel site (underlined) and partial sequence of the human genomic Ig kappa constant region.
  • the PCR product is digested with Hpal and Pmel.
  • the amplified PCR products are ligated together through Bswil and Hpal sites, respectively.
  • the pcDNA4/HisMax/Insulator/UPII is digested with BamHI and Pmel and ligated with the ligated PCR product with overhangs of BamHI site at 5* and Pmel site at 3' to form pcDNA4/Max/UPII-K20L (Fig. 7).
  • the expression cassette pcDNA4/Mas/UPIIK20L can be used as a versatile system for the cloning and expression of immunoglobulins consisting of heavy and light chains.
  • V-genes and the C-genes may be exchanged as cassettes in the vectors, given the low frequency restriction enzyme sites in the Ig genes that have been chosen.
  • the V-genes can be kept intact, and transient and stable expression of antibodies can be done either from two separate vectors, or from one tandem vector. (Norderhaug, L. et al.: J. Immunol. Methods 204: 11 -ell, 1997).
  • a 360 bp fragment of the variable region of the Hu-K20 heavy chain module is obtained by PCR amplification of pSVgpt-VHK20- HuCyl DNA (Paul, M.A. et al, Mol. Immunol. 32: 101-116, 1995) with a 5' sense primer
  • the PCR product is digested with Clal and Pmel.
  • the two amplified PCR products are joined through the Clal site.
  • the pcDNA4/Max/UPII-K20L vector is digested with Bswil and Pmel and ligated with the ligated PCR product with overhangs of Bswil site and 5' and Pmel site at 3" to form pcDNA4/Max/UPII-K20H (Fig. 9).
  • a co-expression vector containing both light chain and heavy chain modules is generated as follows.
  • the pcDNA4/Max/UPII-K20H is digested with Xhol and Pmel.
  • the digested Xhol-Pmel fragment is gel-purified, the Xhol sticky end is filled with Klenow, and blunt-end ligated tot he pcDNA4/Max/UpH-K20L already digested with Pmel, to form pcDNA4/Max/UPII-K20LH.
  • the orientation of the pcDNA4/Max/UPII- K20LH is verified by the digestion of the vector with Hpal and Clal.
  • a human urothelium cell line (hu609) (Stacey, S.D. et al.: Mol.
  • Carcinog 3: 216-225, 1990 is to be used to assess the established expression cassettes.
  • the DNA of the L chain and the H chain constructs is purified by a Maxi-preparation (SOP#008) and is introduced simultaneously at equal molar concentration into the Hu609 cell line by standard transfection techniques.
  • Culture supernatant is precipitated and applied to an anti-human IgG (H chain specific)- Agarose column (Sigma).
  • Protein concentration of eluted fractions is assayed by Bradford microassay (Bio-Rad) and fraction containing proteins are checked on a 10% SDS-PAGE.
  • the expressed proteins are also detected by Western blot with anti-IgG (H chain) antibody (Sigma).
  • Transgenic animals expressing this construct are generated as follows. Munl-Pmel digestion of the expression vectors pcDNA4/Max-UPII-K20L, and PCDNA4/Max-UPII-K20H, respectively, releases the L chain and the H chain fragments for microinjection.
  • Hu-K20 transgenic mice are generated either by 1) co-injecting the L chain and the H chain fragments in a 1:1 molar ratio, or 2) injecting the Munl-Pmel fragment of the co-expression vector pcDNA4/Max- UPII-K20LH. DNA is purified and injected by standard techniques. Hu-K20 transgenic goats will be generated by injecting the same transgenes.
  • PCR was performed using goat genomic DNA as template, with two sets of primers designated from conserved regions of human and cattle UM gene promoters.
  • a 600 bp fragment was obtained and sequenced. It shared 94% and 67% identity with the known sequences of bovine and human UM gene promoters, respectively.
  • Several specific genomic libraries were constructed with the Universal Genome Walker Kit (Clonetech) and PCR was performed using the libraries as templates with several gene-specific primers designated from the 600 bp fragement of the goat UM gene promoter and specific adaptor primers.
  • a 1.5 kb fragment, which includes the 600 bp piece, was obtained both from one of the libraries ad the goat genomic DNA. This 1.5 kb fragment was subcloned into a promoter-less pEGFP to form pGUEGFP3, and sequenced to its entirety (Fig. 10).
  • the genomic uromodulin gene including the promoter and 3'-elements is cloned by standard techniques and the gene of the interest is fused just before uromodulin' s signal peptide or using uromodulin' s signal sequences.
  • the 3' end elements of the uromodulin structural gene including introns can be fused to the 3' end of the gene of the interest.
  • the goat UM gene promoter was used in the construction of Hu-K20 light chain and heavy chain expression. PCR was performed using as a template the 483 wkmM16 expression vector DNA (courtesty of Dr.
  • the pcDNA4/HisMax expression vector (invitrogen) was digested with Muni and BamHI, and this CMV promoter-less vector was ligated with the Munl-BamHI combined fragment of the insulator and the goat UM promoter.
  • PCR was performed using the excised Munl-BamHI fragment containing the SP163 sequences (Gorman, C. M. et al.: Proc. Natl. Acad. Sci. 79: 61111-61 '81, 1982) from ⁇ cDNA4/HisMax as the template with a 5* sense primer (5'GCGTATGGATCCAGCGCAGAGGCTTG3') containing a BamHI site and a 3' antisense primer
  • the PCR product was digest with BamHI and Bswil.
  • the amplified SP163 fratment is derived from the 5' untranslated region (UTR) of the vascular endothelial growth factor (VEGF) gene and it has been shown to increase expression levels two-to-five fold above those seen with promoter along (gorman, C. M. et al.: Proc. Natl. Acad. Sci. 79: 6777-6781, 1982).
  • UTR 5' untranslated region
  • VEGF vascular endothelial growth factor
  • a 320 bp fragment of the variable region of the mAb Hu-K20 light chain module was obtained by PCR amplification of pS Vhyg-HuVKK20-HuCK plasmid DNA (Paul, M.A. et al.: Mol. Immunol. 32: 101-116, 1995) with a 5' sense primer (5'GCGTATTfiCL XrCC4CCATGGGATGGAGCTGTATCATC3') containing a Bswl site (underlined, the Kozak sequence (italic) and the start codon (bold) followed by a partial mouse V47 Ig heavy chain signal sequence, and a 3' antisense primer
  • the PCR product was digested with Hpal and Pmel.
  • the three amplified PCR products were ligated together through Bswl and Hpal sites with the resulting fragment having BamHI and Pmel ends.
  • This joined PCR product with overhangs of BamHi site at 5' and Pmel site at 3' was ligated to pcDNA4/HisMa/Insulator-UM which was digested with BamHI and Pmel, yielding pcDNA4/Max/UM-K20L (Fig. 8).
  • a 360 bp fragment of the variable region of the Hu-K20 heavy chaing module can be obtained by PCR amplification of PSVgpt-VHK20-HuC ⁇ 1 DNA (Paul, M.A. et al: Mol. Immunol.
  • Another PCR is peformed in pSVgpt-VHK20-HuC ⁇ I with a 5' sense primer (5 , CGCTATATCII ⁇ TAGGTGAGTAGCTTTCTGGGGCAG3 , ) containing a Clal site (underlined), a splice donor signal (bold) for the 3' end of the variable region of the heavy chain, and partial 5' sequence of the human genomic Ig gamma- 1 constant region, and a 3' antisense primer (5'GCGTATGTTTAAACGACCCGCTCTGCCTCCCTC3' ⁇ containing a Pmel site (underlined) and partial 3' sequence of the human genomic Ig gamma constant region.
  • the PCR product is digested with Clal and Pmel.
  • the two amplified PCR products are joined through the Clal site.
  • This joined PCR product with overhangs of Bswl site at 5' and Pmel site at 3' is ligated to pcDNA4/Max/UM-K20L which is digested with Bswil and Pmel to form PCDNA4/Max/UM-K20H (Fig. 8).
  • a single vector containing both light chain and heavy chain modules for co-expression can be generated by inserting the Xhol-Pmel digested and 5' end blunt-ended UM promoter plus H chain module of pcDNA4/Max/Um-K20H into the Pmel-digested ⁇ cDNa4/Max/UM-K20L to form pcDNA4/Max/UM- K20LH (see Fig. 9).
  • a bicistronic expression vector can be constructed. In this case a single goat UM promoter is driving expression of both the light and heavy chains.
  • the second UM promoter fragment in pcDNA4/Max/UM-K20LH can be replaced by a fragment of an internal ribosomal entry site (IRES) sequence (Staal, F.J. et al.: Cancer Gene Ther 3: 345-351, 1996).
  • IRS internal ribosomal entry site
  • transgenic animals Prior to the generation of transgenic animals using the transgenic constructs, their functionality can be determined upon transfection in kidney epithelial cells and media testing for the presence of the antibody.
  • the rabbit renal cell line, PAP-HT25 Green, N. et al: Am J Physiol 249:C97-104. 1985
  • the dog kidney cell line MDCK ATCC #CCL-314
  • the cells can be transfected with the L chain and H chain constructs simultaneously at equal molar concentration by standard transfection technique.
  • the co- expression vector can also be transfected into the same cell lines. Twenty- four hours following transfection, the cells conditioned media can be exchanged with fresh media, and the cells returned to culture.
  • the conditioned media of the cells can be removed and applied on an anti -human IgG (H chain specific)- Agarose column (Sigma) for antibody purification or tested directly for the presence of the antibody by Western blotting analysis. Protein concentration of eluted fractions is assayed by Bradford microassay (Bio-Rad) and fractions containing proteins can be checked on a 10% SDS- PAGE. Other functional assays for the recombinant mAb Hu-K20, for example, binding measurement, T cell proliferation, measurement of phosphatidic acid synthesis, complement-dependent cytotoxicity assay and measurement of Clq binding can also be performed.
  • Transgenic animals with the Hu-K20 transgenes under the control of the goat UM gene promoter
  • Generation of transgenic animals can be performed using standard techniques including pronuclear microinjection (Wright, G. et al.: Bio/Technology 9:830- 83, 1991; Pursel, V.G. et al.: J Anim Sci 71 Suppl 3:1-9, 1993; Wall, RJ. et al.: Theriogenology 5:57-968, 1996) or nuclear transfer (NT) methodologies (Campbell, K.H. et al.: Nature 380:64-66, 1996; Wilmut, I. et al.: Nature 385:810-813, 1997; Cibelli, J.B.
  • NT derived offspring cell lines such as fetal fibroblasts can be transfected in vitro (Cibelli, J.B. et al.: Science 280: 1256-1258, 1998) with the UM-K20H and UM-K20L expression cassettes selected using for example Zeocin selection marker. Lines are screened for copy number and integration of both cassettes prior to using them in NT experiments. Reconstructed NT embryos can be cultured or transferred immediately to further recipient animals. Urine of transgenic animals can be collected daily starting at birth and assayed to determine the quantity as well as the quality of the secreted monoclonal antibodies.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Toxicology (AREA)
  • General Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Endocrinology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Cette invention concerne des procédés qui permettent de générer un polypeptide sécrété dans l'urine en utilisant le promoteur du gène d'uromoduline, ou d'autres promoteurs issus de gènes dont les produits sont spécifiquement exprimés dans le rein, ceci afin de diriger l'expression du polypeptide sécrété. Cette invention concerne également un animal transgénique sécrétant un polypeptide recombinant dans son urine, ainsi qu'un procédé permettant de déceler un tel animal lorsque ce dernier est in utero. Cette invention concerne en outre des procédés permettant de générer un polypeptide qui est sécrété dans le milieu conditionné de cellules du rein cultivées qui sont transformées par une séquence d'acides nucléiques codant ledit polypeptide, ladite séquence étant liée fonctionnellement à un promoteur du gène d'uromoduline ou à un autre promoteur du gène spécifique au rein.
PCT/IB1999/001609 1998-09-16 1999-09-16 Production de proteines recombinantes dans l'urine WO2000015772A2 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
CA002343104A CA2343104A1 (fr) 1998-09-16 1999-09-16 Production de proteines recombinantes dans l'urine
AU57553/99A AU5755399A (en) 1998-09-16 1999-09-16 Recombinant protein production in urine
EP99944741A EP1112353A2 (fr) 1998-09-16 1999-09-16 Production de proteines recombinantes dans l'urine
JP2000570299A JP2002525047A (ja) 1998-09-16 1999-09-16 尿における組換え蛋白質の産生

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US10054098P 1998-09-16 1998-09-16
US60/100,540 1998-09-16

Publications (3)

Publication Number Publication Date
WO2000015772A2 true WO2000015772A2 (fr) 2000-03-23
WO2000015772A3 WO2000015772A3 (fr) 2000-07-20
WO2000015772A9 WO2000015772A9 (fr) 2000-08-24

Family

ID=22280279

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB1999/001609 WO2000015772A2 (fr) 1998-09-16 1999-09-16 Production de proteines recombinantes dans l'urine

Country Status (5)

Country Link
EP (1) EP1112353A2 (fr)
JP (1) JP2002525047A (fr)
AU (1) AU5755399A (fr)
CA (1) CA2343104A1 (fr)
WO (1) WO2000015772A2 (fr)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1135518A1 (fr) * 1998-11-13 2001-09-26 New York University Animaux transgeniques servant de bioreacteurs urinaires pour la production de proteines dans l'urine, constructions d'adn recombine pour l'expression specifique du rein, et procedes d'utilisation de ces dernieres
KR100458792B1 (ko) * 2002-04-10 2004-12-03 주식회사 인투젠 탬-홀스팔 유로모둘린 단백질의 프로모터를 이용한 인간 이외의 형질전환 포유동물의 신장조직에서의 비상동 폴리펩타이드의 발현
WO2005001067A1 (fr) * 2003-05-27 2005-01-06 Frederick Blattner Bioreacteurs animaux
US6888047B1 (en) 1998-11-13 2005-05-03 New York University Transgenic animals as urinary bioreactors for the production of polypeptide in the urine, recombinant DNA construct for kidney-specific expression, and method of using same
US8729245B2 (en) 2009-12-21 2014-05-20 Pharmathene, Inc. Recombinant butyrylcholinesterases and truncates thereof
US9963511B2 (en) 2011-12-22 2018-05-08 Hoffmann-La Roche Inc. Expression vector organization, novel production cell generation methods and their use for the recombinant production of polypeptides
WO2018158267A1 (fr) * 2017-02-28 2018-09-07 Charité Universitätsmedizin Berlin Uromoduline destinée à être utilisée dans la prévention et le traitement de la cristallisation pathologique
US11117942B2 (en) * 2015-08-31 2021-09-14 The Trustees Of The University Of Pennsylvania AAV-EPO for treating companion animals

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1958503A3 (fr) * 1999-01-06 2008-11-26 Merrimack Pharmaceuticals, Inc. Expression d'alpha féto-protéines humaines secrétées dans des animaux transgéniques
WO2019045049A1 (fr) * 2017-09-01 2019-03-07 学校法人帝京大学 Vecteur d'expression spécifique à une cellule de tubule rénal

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995022249A1 (fr) * 1994-02-18 1995-08-24 American National Red Cross Fibrinogene transgenique
FR2717500A1 (fr) * 1994-03-17 1995-09-22 Pasteur Institut Procédé d'infection de cellules rénales par un un vecteur recombinant.
WO1996026268A1 (fr) * 1995-02-21 1996-08-29 Genzyme Transgenics Corporation Antithrombine iii produite par voie transgenique
WO1996039494A1 (fr) * 1995-06-05 1996-12-12 New York University Procede d'expression et d'isolation de molecules biologiquement actives dans l'urine
WO1997019589A1 (fr) * 1995-11-30 1997-06-05 Nexia Biotechnologies, Inc. Procede de production de chevres transgeniques
WO1999047661A2 (fr) * 1998-03-17 1999-09-23 Nexia Biotechnologies, Inc. Production de biofilaments chez des animaux transgeniques

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995022249A1 (fr) * 1994-02-18 1995-08-24 American National Red Cross Fibrinogene transgenique
FR2717500A1 (fr) * 1994-03-17 1995-09-22 Pasteur Institut Procédé d'infection de cellules rénales par un un vecteur recombinant.
WO1996026268A1 (fr) * 1995-02-21 1996-08-29 Genzyme Transgenics Corporation Antithrombine iii produite par voie transgenique
WO1996039494A1 (fr) * 1995-06-05 1996-12-12 New York University Procede d'expression et d'isolation de molecules biologiquement actives dans l'urine
WO1997019589A1 (fr) * 1995-11-30 1997-06-05 Nexia Biotechnologies, Inc. Procede de production de chevres transgeniques
WO1999047661A2 (fr) * 1998-03-17 1999-09-23 Nexia Biotechnologies, Inc. Production de biofilaments chez des animaux transgeniques

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
GORDON K ET AL: "EXPRESSIOON OF HUMAN TPA IN THE MILK OF TRANSGENIC ANIMALS" GENE TRANSFER AND GENE THERAPY,US,NEW YORK, NY,6 February 1988 (1988-02-06), pages 57-66, XP000350867 *
KERR D ET AL., : "The bladder as a bioreactor: Urothelium production and secretion of growth hormone into urine." NATURE BIOTECHNOLOGY , vol. 16, January 1998 (1998-01), page 75-79 XP002120418 cited in the application *
POUL M A ET AL., : "Inhibition of T cell activation with a humanized anti-beta-1 integrin chain mAb" MOLECULAR IMMUNOLOGY , vol. 32, no. 2, 1995, page 101-116 XP000901077 cited in the application *
QUIGG R J ET AL., : "Transgenic mice overexpressing the complement inhibitor Crry as a soluble protein are protected from antibody-induced glomerular injury." JOURNAL OF EXPERIMENTAL MEDICINE, vol. 88, 5 October 1998 (1998-10-05), page 1321-1331 XP000893030 *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1135518A1 (fr) * 1998-11-13 2001-09-26 New York University Animaux transgeniques servant de bioreacteurs urinaires pour la production de proteines dans l'urine, constructions d'adn recombine pour l'expression specifique du rein, et procedes d'utilisation de ces dernieres
EP1135518A4 (fr) * 1998-11-13 2002-11-06 Univ New York Animaux transgeniques servant de bioreacteurs urinaires pour la production de proteines dans l'urine, constructions d'adn recombine pour l'expression specifique du rein, et procedes d'utilisation de ces dernieres
US6888047B1 (en) 1998-11-13 2005-05-03 New York University Transgenic animals as urinary bioreactors for the production of polypeptide in the urine, recombinant DNA construct for kidney-specific expression, and method of using same
KR100458792B1 (ko) * 2002-04-10 2004-12-03 주식회사 인투젠 탬-홀스팔 유로모둘린 단백질의 프로모터를 이용한 인간 이외의 형질전환 포유동물의 신장조직에서의 비상동 폴리펩타이드의 발현
WO2005001067A1 (fr) * 2003-05-27 2005-01-06 Frederick Blattner Bioreacteurs animaux
US8729245B2 (en) 2009-12-21 2014-05-20 Pharmathene, Inc. Recombinant butyrylcholinesterases and truncates thereof
US8952143B2 (en) 2009-12-21 2015-02-10 Pharmathene, Inc. Recombinant butyrylcholinesterases and truncates thereof
US9963511B2 (en) 2011-12-22 2018-05-08 Hoffmann-La Roche Inc. Expression vector organization, novel production cell generation methods and their use for the recombinant production of polypeptides
US10882910B2 (en) 2011-12-22 2021-01-05 Hoffmann-La Roche Inc. Expression vector organization, novel production cell generation methods and their use for the recombinant production of polypeptides
US11117942B2 (en) * 2015-08-31 2021-09-14 The Trustees Of The University Of Pennsylvania AAV-EPO for treating companion animals
WO2018158267A1 (fr) * 2017-02-28 2018-09-07 Charité Universitätsmedizin Berlin Uromoduline destinée à être utilisée dans la prévention et le traitement de la cristallisation pathologique
US11161887B2 (en) 2017-02-28 2021-11-02 Charité Universitätsmedizin Berlin Uromodulin for use in prevention and therapy of pathological crystallization

Also Published As

Publication number Publication date
JP2002525047A (ja) 2002-08-13
CA2343104A1 (fr) 2000-03-23
AU5755399A (en) 2000-04-03
EP1112353A2 (fr) 2001-07-04
WO2000015772A3 (fr) 2000-07-20
WO2000015772A9 (fr) 2000-08-24

Similar Documents

Publication Publication Date Title
US20240023527A1 (en) Antibody producing non-human animals
RU2731084C2 (ru) Продуцирующие антитела млекопитающие, не являющиеся человеком
US5304489A (en) DNA sequences to target proteins to the mammary gland for efficient secretion
KR100882030B1 (ko) 클로닝된 트랜스제닉 유제류에서 이종 (사람)면역글로블린의 발현
WO2004076618A9 (fr) Mammiferes non humains et cellules non humaines genetiquement modifies
JP2003501103A (ja) 非同種スイッチ領域を介して、ヒト抗体の特定のアイソタイプを産生するためのトランスジェニック動物
KR20110020860A (ko) 유전자 삽입동물에서 단일 ｖｌ 도메인 항체를 생산하는 방법
EP1112353A2 (fr) Production de proteines recombinantes dans l'urine
JPH04505710A (ja) ポリペプチドの改良された発現
US20080009058A1 (en) Chimeric IgE Polypeptides and Host Cells
US6888047B1 (en) Transgenic animals as urinary bioreactors for the production of polypeptide in the urine, recombinant DNA construct for kidney-specific expression, and method of using same
US20040266711A1 (en) DNA sequences to target proteins to the mammary gland for efficient secretion

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AU BR CA HU JP NZ

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AU BR CA HU JP NZ

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

AK Designated states

Kind code of ref document: C2

Designated state(s): AU BR CA HU JP NZ

AL Designated countries for regional patents

Kind code of ref document: C2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

COP Corrected version of pamphlet

Free format text: PAGES 1-3, 5-8, 11, 15-18 AND 20-31, DESCRIPTION, REPLACED BY NEW PAGES 1-3, 5-8, 11, 15-18 AND 20-31; AFTER RECTIFICATION OF OBVIOUS ERRORS AS AUTHORIZED BY THE INTERNATIONAL SEARCHING AUTHORITY; PAGES 9, 10, 12-14, 19 AND 32, DESCRIPTION, REPLACED BY NEW PAGES 9, 10, 12-14, 19 AND 32; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE

WWE Wipo information: entry into national phase

Ref document number: 509900

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 57553/99

Country of ref document: AU

ENP Entry into the national phase in:

Ref country code: JP

Ref document number: 2000 570299

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase in:

Ref country code: CA

Ref document number: 2343104

Kind code of ref document: A

Format of ref document f/p: F

Ref document number: 2343104

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1999944741

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1999944741

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1999944741

Country of ref document: EP