WO2000005371A1 - Keratinocyte derived interferon - Google Patents

Keratinocyte derived interferon Download PDF

Info

Publication number
WO2000005371A1
WO2000005371A1 PCT/US1999/016424 US9916424W WO0005371A1 WO 2000005371 A1 WO2000005371 A1 WO 2000005371A1 US 9916424 W US9916424 W US 9916424W WO 0005371 A1 WO0005371 A1 WO 0005371A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
seq
amino acid
kdi
residues
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1999/016424
Other languages
English (en)
French (fr)
Inventor
Steven M. Ruben
Paul A. Moore
David W. Lafleur
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Human Genome Sciences Inc
Original Assignee
Human Genome Sciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences Inc filed Critical Human Genome Sciences Inc
Priority to EP99935752A priority Critical patent/EP1100902A4/en
Priority to CA002335655A priority patent/CA2335655A1/en
Priority to JP2000561317A priority patent/JP2002522021A/ja
Priority to AU51161/99A priority patent/AU765890B2/en
Priority to NZ509402A priority patent/NZ509402A/en
Priority to US09/487,792 priority patent/US6433145B1/en
Priority to PCT/US2000/001239 priority patent/WO2001007608A1/en
Priority to AU25099/00A priority patent/AU2509900A/en
Publication of WO2000005371A1 publication Critical patent/WO2000005371A1/en
Anticipated expiration legal-status Critical
Priority to US09/908,594 priority patent/US6472512B1/en
Priority to US10/197,816 priority patent/US7390637B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/555Interferons [IFN]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00Antiparasitic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/08Antiallergic agents
    • CCHEMISTRY; METALLURGY
    • C10PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
    • C10MLUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
    • C10M145/00Lubricating compositions characterised by the additive being a macromolecular compound containing oxygen
    • C10M145/18Macromolecular compounds obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds
    • C10M145/24Polyethers
    • C10M145/26Polyoxyalkylenes
    • C10M145/36Polyoxyalkylenes etherified
    • CCHEMISTRY; METALLURGY
    • C10PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
    • C10MLUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
    • C10M145/00Lubricating compositions characterised by the additive being a macromolecular compound containing oxygen
    • C10M145/18Macromolecular compounds obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds
    • C10M145/24Polyethers
    • C10M145/26Polyoxyalkylenes
    • C10M145/38Polyoxyalkylenes esterified
    • CCHEMISTRY; METALLURGY
    • C10PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
    • C10MLUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
    • C10M173/00Lubricating compositions containing more than 10% water
    • C10M173/02Lubricating compositions containing more than 10% water not containing mineral or fatty oils
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C10PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
    • C10MLUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
    • C10M2209/00Organic macromolecular compounds containing oxygen as ingredients in lubricant compositions
    • C10M2209/10Macromolecular compoundss obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds
    • C10M2209/103Polyethers, i.e. containing di- or higher polyoxyalkylene groups
    • C10M2209/108Polyethers, i.e. containing di- or higher polyoxyalkylene groups etherified
    • CCHEMISTRY; METALLURGY
    • C10PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
    • C10MLUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
    • C10M2209/00Organic macromolecular compounds containing oxygen as ingredients in lubricant compositions
    • C10M2209/10Macromolecular compoundss obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds
    • C10M2209/103Polyethers, i.e. containing di- or higher polyoxyalkylene groups
    • C10M2209/109Polyethers, i.e. containing di- or higher polyoxyalkylene groups esterified

Definitions

  • the present invention relates to a novel human gene encoding a polypeptide which is a member of the interferon family. More specifically, isolated nucleic acid molecules are provided encoding a human polypeptide named "Keratinocyte Derived Interferon" or "KDI". KDI polypeptides are also provided, as are vectors, host cells and recombinant methods for producing the same. Also provided are diagnostic methods for detecting disorders related to the immune system, and therapeutic methods for treating disorders of the immune system. The invention further relates to screening methods for identifying agonists and antagonists of KDI.
  • Interferons are a well known family of cytokines secreted by a large variety of eukaryotic cells upon exposure to various stimuli. The interferons have been classified by their chemical and biological characteristics into four groups: IFN-alpha (leukocytes), IFN-beta (fibroblasts), IFN-gamma (lymphocytes), and IFN-omega (leukocytes). IFN-alpha and beta are known as Type I interferons; IFN-gamma is known as a Type-II or immune interferon.
  • IFN-omega interferon omega
  • LFN-beta a monomeric glycoprotein distantly related in structure to IFN-alpha and LFN-beta, but unrelated to IFN-gamma.
  • IFN-omega is secreted by virus-infected leukocytes as a major component of human leukocyte interferon.
  • the IFNs exhibit anti-viral, immunoregulatory, and antiproliferative activity.
  • the clinical potential of interferons has been recognized, and will be summarized below.
  • IFNs have been used clinically for anti-viral therapy, for example, in the treatment of AIDS (Lane, Semin. Oncol. 18:46-52 (Oct. 1991)), viral hepatitis including chronic hepatitis B, hepatitis C (Woo, M.H. and Brunakis, T.G., Ann. Parmacother, 31:330- 337 (March 1997); Gibas, A.L., Gastroenlerologist, 1: 129-142 (June 1993)), hepatitis D, papilloma viruses (Levine, L.A. et al., Urology 47:553-557 (April 1996)), herpes (Ho, M.,
  • IFNs have been suggested for anti-parasite therapy, for example, IFN- gamma for treating Cryptosporidium parvum infection (Rehg, J.E., J. Infect. Des. 174:229- 232 (July 1996)).
  • IFNs have been used clinically for anti-bacterial therapy. For example, IFNs have been used clinically for anti-bacterial therapy. For example, IFNs have been used clinically for anti-bacterial therapy. For example, IFNs have been used clinically for anti-bacterial therapy. For example, IFNs have been used clinically for anti-bacterial therapy. For example, IFNs have been used clinically for anti-bacterial therapy. For example, IFNs have been used clinically for anti-bacterial therapy. For example, IFNs have been used clinically for anti-bacterial therapy. For example, IFNs have been used clinically for anti-bacterial therapy. For example, IFNs have been used clinically for anti-bacterial therapy. For example, IFNs have been used clinically for anti-bacterial therapy. For example, IFNs have been used clinically for anti-bacterial therapy. For example, IFNs have been used clinically for anti-bacterial therapy. For example, IFNs have been used clinically for anti-bacterial therapy. For example, IFNs have been used clinically for anti-bacterial therapy.
  • IFN-gamma has been used in the treatment of multidrug-resistant pulmonary tuberculosis (Condos, R. et ai., Lancet 549: 1513-1515 (1997)).
  • Anti-cancer Interferon therapy has been used in the treatment of numerous cancers (e.g., hairy cell leukemia (Hofmann et al, Cancer Treat. Rev. 12 (Suppl. S):33-37 (Dec.
  • IFNs have been used clinically for immunotherapy or more particularly, (1) for example, to prevent graft vs. host rejection, or to curtail the progressive receion of autoimmune diseases, such as arthritis, multiple sclerosis, (2) or diabetes (3).
  • IFN-beta is approved of sale in the United States for the treatment (i.e., as an imrnunosuppressant) of multiple sclerosis.
  • immunotherapy with recombinant IFN-alpha has been used successfully in lymphoma patients following autologous bone marrow or blood stem cell transplantation, that may intensify remission following translation (Nagler, A. et al, Blood 89: 3951-3959 (June 1997)).
  • Anti-allergy The administration of IFN-gamma has been used in the treatment of allergies in mammals (See, Patent Publication WO 8701288 to Parkin, J.M. and Pinching, A.J.). It has also recently been demonstrated that there is a reduced production of IL-12 and IL-12-dependent IFN-gamma release in patients with allergic asthma (van der Pouw Kraan,
  • IFN may be useful in the treatment of allergy by inhibiting the humoral response.
  • Vaccine adjuvantation Interferons may be used as an adjuvant or coadjuvant to enhance or simulate the immune response in cases of prophylactic or therapeutic vaccination (Heath, A.W. and Playfair, J.H.L., Vaccine 10:417-434 ( 1992)).
  • the present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding at least a portion of the KDI polypeptide having the complete amino acid sequence shown in SEQ ID NO:2 or the complete amino acid sequence encoded by the cDNA clone deposited as plasmid DNA as ATCC Deposit Number 203500 on December 1, 1998.
  • the nucleotide sequence determined by sequencing the deposited KDI clone (HKAPI15) which is shown in Figure 1 (SEQ ID NO: 1) contains an open reading frame encoding a complete polypeptide of 207 amino acid residues, including an initiation codon encoding an N-terminal methionine at nucleotide positions 35-37.
  • Nucleic acid molecules of the invention include those encoding the complete amino acid sequence excepting the N-terminal methionine shown in SEQ ID NO:2, which molecules also can encode additional amino acids fused to the N-terminus of the KDI amino acid sequence.
  • the encoded polypeptide has a predicted leader sequence of 27 amino acids underlined in Figure 1 ; and the amino acid sequence of the predicted mature KDI protein is also shown in Figure 1 as amino acid residues 28-207 and as residues 1-207 in SEQ ID NO:2.
  • Residues 165 to 183 of Figure 1 comprise the signature sequence for interferon polypeptides, and the KDI polypeptide in particular.
  • preferred are polypeptides comprising residues 165 to 183 of Figure 1 as are polynucleotides encoding such polypeptides.
  • one aspect of the invention provides an isolated nucleic acid molecule comprising a polynucleotide comprising a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence encoding the KDI polypeptide having the complete amino acid sequence in
  • SEQ ID NO:2 (b) a nucleotide sequence encoding the KDI polypeptide having the complete amino acid sequence in SEQ ID NO:2 excepting the N-terminal methionine (i.e., residues 2-207 of SEQ ID NO:2); (c) a nucleotide sequence encoding the mature KDI polypeptide shown as residues 28-207 in SEQ ID NO:2; (d) a nucleotide sequence encoding residues 165-183 of SEQ ID NO:2; (e) a nucleotide sequence encoding the complete polypeptide encoded by the human cDNA contained in clone HKAPI15; (f) a nucleotide sequence encoding the complete polypeptide encoded by the human cDNA contained in clone HKAPI15 excepting the N- terminal methionine; (g) a nucleotide sequence encoding the mature polypeptide encoded by the human cDNA contained in clone H
  • nucleic acid molecules that comprise a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical, to any of the nucleotide sequences in (a), (b), (c), (d), (e), (f), (g) or (h), above, or a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide in (a), (b), (c), (d), (e), (f), (g) or (h), above.
  • This polynucleotide which hybridizes does not hybridize under stringent hybridization conditions to a polynucleotide having a nucleotide sequence consisting of only A residues or of only T residues.
  • An additional nucleic acid embodiment of the invention relates to an isolated nucleic acid molecule comprising a polynucleotide which encodes the amino acid sequence of an epitope-bearing portion of a KDI polypeptide having an amino acid sequence in (a), (b), (c), (d), (e), (f) or (g), above.
  • the present invention also relates to recombinant vectors, which include the isolated nucleic acid molecules of the present invention, and to host cells containing the recombinant vectors, as well as to methods of making such vectors and host cells and for using them for production of KDI polypeptides or peptides by recombinant techniques.
  • the invention further provides an isolated KDI polypeptide comprising an amino acid sequence selected from the group consisting of: (a) the amino acid sequence of the full-length
  • KDI polypeptide having the complete amino acid sequence shown in SEQ ID NO:2 (b) the amino acid sequence of the full-length KDI polypeptide having the complete amino acid sequence shown in SEQ ID NO:2 excepting the N-terminal methionine (i.e., residues 2 to 207 of SEQ ID NO:2); the amino acid sequence of the mature KDI polypeptide shown as residues 28-207 in SEQ ID NO:2; (d) the amino acid sequence shown as residues 165 to 183 of SEQ ID NO:
  • polypeptides of the present invention also include polypeptides having an amino acid sequence at least 80% identical, more preferably at least 90% identical, and still more preferably 95%, 96%, 97%, 98% or 99% identical to those described in (a), (b), (c), (d), (e), (f) or (g) above, as well as polypeptides having an amino acid sequence with at least 90% similarity, and more preferably at least 95% similarity, to those above.
  • An additional embodiment of this aspect of the invention relates to a peptide or polypeptide which comprises the amino acid sequence of an epitope-bearing portion of a KDI polypeptide having an amino acid sequence described in (a), (b), (c), (d), (e), (f), or (g), above.
  • Peptides or polypeptides having the amino acid sequence of an epitope-bearing portion of a KDI polypeptide of the invention include portions of such polypeptides with at least six or seven, preferably at least nine, and more preferably at least about 30 amino acids to about 50 amino acids, although epitope-bearing polypeptides of any length up to and including the entire amino acid sequence of a polypeptide of the invention described above also are included in the invention.
  • the invention provides an isolated antibody that binds specifically to a KDI polypeptide having an amino acid sequence described in (a), (b), (c), (d), (e), (f) or (g) above.
  • the invention further provides methods for isolating antibodies that bind specifically to a KDI polypeptide having an amino acid sequence as described herein. Such antibodies are useful therapeutically as described below.
  • the invention also provides for pharmaceutical compositions comprising KDI polypeptides which may be employed, for instance, to treat immune system-related disorders such as viral infection, parasitic infection, bacterial infection, cancer, autoimmune disease, multiple sclerosis, lymphoma and allergy. Methods of treating individuals in need of interferon polypeptides are also provided.
  • compositions comprising a KDI polynucleotide or a KDI polypeptide for administration to cells in vitro, to cells ex vivo and to cells in vivo, or to a multicellular organism.
  • the compositions comprise a KDI polynucleotide for expression of a KDI polypeptide in a host organism for treatment of disease.
  • Particularly preferred in this regard is expression in a human patient for treatment of a dysfunction associated with aberrant endogenous activity of an interferon.
  • the present invention also provides a screening method for identifying compounds capable of enhancing or inhibiting a biological activity of the KDI polypeptide, which involves contacting a receptor which is enhanced by the KDI polypeptide with the candidate compound in the presence of a KDI polypeptide, assaying, for example, anti-viral activity in the presence of the candidate compound and the KDI polypeptide, and comparing the activity to a standard level of activity, the standard being assayed when contact is made between the receptor and KDI in the absence of the candidate compound.
  • an increase in activity over the standard indicates that the candidate compound is an agonist of KDI activity and a decrease in activity compared to the standard indicates that the compound is an antagonist of KDI activity.
  • nucleic acids of the invention are useful as hybridization probes for differential identification of the tissue(s) or cell type(s) present in a biological sample.
  • polypeptides and antibodies directed to those polypeptides are useful to provide immunological probes for differential identification of the tissue(s) or cell type(s).
  • the invention provides a diagnostic method useful during diagnosis of such a disorder, which involves: (a) assaying KDI gene expression level in cells or body fluid of an individual; (b) comparing the
  • KDI gene expression level with a standard KDI gene expression level, whereby an increase or decrease in the assayed KDI gene expression level compared to the standard expression level is indicative of disorder in the immune system.
  • An additional aspect of the invention is related to a method for treating an individual in need of an increased level of interferon activity in the body comprising administering to such an individual a composition comprising a therapeutically effective amount of an isolated KDI polypeptide of the invention or an agonist thereof.
  • a still further aspect of the invention is related to a method for treating an individual in need of a decreased level of interferon activity in the body comprising, administering to such an individual a composition comprising a therapeutically effective amount of a KDI antagonist.
  • Preferred antagonists for use in the present invention are KDI-specific antibodies.
  • Figure 1 shows the nucleotide sequence (SEQ ID NO:l) and amino acid sequence (SEQ ID NO:2) of KDI.
  • Figure 2 shows the regions of identity between the amino acid sequences of the KDI protein and translation product of the human mRNA for Interferon Omega (SEQ ID NO:3), determined by the computer program Bestfit (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711).
  • Figure 3 shows an analysis of the KDI amino acid sequence. Alpha, beta, turn and coil regions; hydrophilicity and hydrophobicity; amphipathic regions; flexible regions; antigenic index and surface probability are shown.
  • the positive peaks indicate locations of the highly antigenic regions of the KDI protein, i.e., regions from which epitope-bearing peptides of the invention can be obtained.
  • Figure 4 shows an alignment of the KDI polypeptide of the present invention with several other members of the interferon polypeptide family.
  • human interferon beta-1 SEQ ID NO:4
  • human placental interferon SEQ ID NO:5
  • human interferon omega SEQ ID NO:6
  • human interferon alpha-c SEQ ID NO:7
  • human interferon alpha-F SEQ ID NO:8
  • human interferon II- 1 SEQ ID NO:9
  • human alpha interferon-N SEQ ID NO: 10
  • bovine TP- 1 SEQ ID NO:l 1
  • ovi TP-1 SEQ ID NO: 12
  • pig TP SEQ ID NO: 13
  • IL-6 (SEQ ID NO: 14), bovine interferon beta-2 (SEQ ID NO: 15), bovine interferon beta-1 (SEQ ID NO:20), synthetic interferon beta-1 (SEQ ID NO:21).
  • the alignment was produced by the Megalign routine using the Clustal method with PAM250 residue weight table. Megalign is contained within the DNAstar suite of programs.
  • the present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding a Keratinocyte-Derived Interferon polypeptide (hereinafter "KDI") having the amino acid sequence shown in SEQ ID NO:2.
  • KDI Keratinocyte-Derived Interferon polypeptide
  • the nucleotide sequence shown in Figure 1 was obtained by sequencing the human HKAPI15 cDNA clone which was deposited on December 1, 1998 at the American Type Culture Collection, 10801 University Boulevard, Manassas, Virginia 20110-2209, USA, and given accession number ATCC 203500.
  • the deposited cDNA is contained in the plasmid pCMVSport 2.0 (Life
  • the KDI protein of the present invention shares sequence homology with many members of the interferon family, noteably the translation product of the human mRNA for IFN-omega (Figure 2) (SEQ ID NO:3).
  • IFN-omega has been shown to inhibit the proliferation of a variety of tumor cell lines in vitro, stimulate natural killer cell activity, enhance expression of major histocompatibility complex class I (but not class II) antigens and inhibit proliferation of lymphocytes stimulated with mitogens or allogeneic cells.
  • KDI has been determined to be primarily found in keratinocytes, dendritic cells and monocytes, but is particularly stong in keratinocytes. Stimulation of keratinocytes with TNF- ⁇ or PolylC
  • KDI (simulating viral infection) specifically and rapidly stimulates overexpression of the KDI transcript. Based on its structural similarity to IFN-omega and its increased expression in response to simulated viral infection, KDI is believed to share many of its biological activities of INF-Omega and other interferon proteins, including, inhibition of tumor proliferation, antiviral activities, NK cell activiation, and immune system enhancement.
  • nucleotide sequences determined by sequencing a DNA molecule herein were determined using an automated DNA sequencer (such as the Model 373 from Applied Biosystems, Inc., Foster City, CA), and all amino acid sequences of polypeptides encoded by DNA molecules determined herein were predicted by translation of a DNA sequence determined as above. Therefore, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein may contain some errors. Nucleotide sequences determined by automation are typically at least about 90% identical, more typically at least about 95% to at least about 99.9% identical to the actual nucleotide sequence of the sequenced DNA molecule. The actual sequence can be more precisely determined by other approaches including manual DNA sequencing methods well known in the art.
  • a single insertion or deletion in a determined nucleotide sequence compared to the actual sequence will cause a frame shift in translation of the nucleotide sequence such that the predicted amino acid sequence encoded by a determined nucleotide sequence will be completely different from the amino acid sequence actually encoded by the sequenced DNA molecule, beginning at the point of such an insertion or deletion.
  • nucleotide sequence of a nucleic acid molecule or polynucleotide is intended, for a DNA molecule or polynucleotide, a sequence of deoxyribonucleotides, and for an RNA molecule or polynucleotide, the corresponding sequence of ribonucleotides (A, G, C and U), where each thymidine deoxyribonucleotide (T) in the specified deoxyribonucleotide sequence is replaced by the ribonucleotide uridine (U).
  • nucleic acid molecule of the present invention encoding a KDI polypeptide may be obtained using standard molecular biology procedures, such as those for cloning cDNAs using mRNA as starting material.
  • standard molecular biology procedures such as those for cloning cDNAs using mRNA as starting material.
  • nucleic acid molecule described in Figure 1 was discovered in a cDNA library derived from isolated keratinocytes.
  • the nucleotide sequence of the KDI DNA of Figure 1 contains an open reading frame encoding a protein of 207 amino acid residues, with an initiation codon at nucleotide positions 35-37 of the nucleotide sequence in Figure 1 (SEQ ID NO: l).
  • the amino acid sequence of the KDI protein shown in SEQ ID NO:2 is about 35% identical to IFN-omega, ( Figure 2).
  • the sequences of INF-Omega can be accessed through GenBank with Accession No. gblA12140.
  • the actual complete KDI polypeptide encoded by the deposited cDNA which comprises about 207 amino acids, may be somewhat longer or shorter. More generally, the actual open reading frame may be anywhere in the range of ⁇ 20 amino acids, more likely in the range of ⁇ 10 amino acids, of that predicted from the methionine codon at the N-terminus shown in Figure 1 (SEQ ID NO: 1 ).
  • the amino acid sequence of the complete KDI protein includes a leader sequence and a mature protein, as shown in SEQ ID NO:2. More in particular, the present invention provides nucleic acid molecules encoding a mature form of the KDI protein.
  • proteins secreted by mammalian cells have a signal or secretory leader sequence which is cleaved from the complete polypeptide to produce a secreted "mature" form of the protein.
  • Most mammalian cells and even insect cells cleave secreted proteins with the same specificity.
  • cleavage of a secreted protein is not entirely uniform, which results in two or more mature species of the protein. Further, it has long been known that the cleavage specificity of a secreted protein is ultimately determined by the primary structure of the complete protein, that is, it is inherent in the amino acid sequence of the polypeptide. Therefore, the present invention provides a nucleotide sequence encoding the mature KDI polypeptide having the amino acid sequence encoded by the human cDNA in clone HKAPI15 (ATCC Deposit No. 203500).
  • mature KDI polypeptide having the amino acid sequence encoded by the human cDNA in clone HKAPI15 is meant the mature form(s) of the KDI protein produced by expression in a mammalian cell (e.g., COS cells, as described below) of the complete open reading frame encoded by the human DNA sequence of the clone contained in the deposited vector.
  • a mammalian cell e.g., COS cells, as described below
  • Virus Res. 3:271-286 (1985) uses the information from a short N-terminal charged region and a subsequent uncharged region of the complete (uncleaved) protein.
  • the method of von Heinje uses the information from the residues surrounding the cleavage site, typically residues -13 to +2 where +1 indicates the amino terminus of the mature protein.
  • the accuracy of predicting the cleavage points of known mammalian secretory proteins for each of these methods is in the range of 75-80% (von Heinje, supra). However, the two methods do not always produce the same predicted cleavage point(s) for a given protein.
  • the deduced amino acid sequence of the complete KDI polypeptide was analyzed by a computer program "PSORT", available from Dr. Kenta Nakai of the Institute for Chemical Research, Kyoto University (see K. Nakai and M. Kanehisa, Genomics 74:897- 911 (1992)), which is an expert system for predicting the cellular location of a protein based on the amino acid sequence.
  • PSORT a computer program available from Dr. Kenta Nakai of the Institute for Chemical Research, Kyoto University (see K. Nakai and M. Kanehisa, Genomics 74:897- 911 (1992)), which is an expert system for predicting the cellular location of a protein based on the amino acid sequence.
  • the computation analysis above predicted one potential cleavage site within the complete amino acid sequence shown in SEQ ID NO:2; that is, between residues 27 and 28 in Figure 1 (SEQ ID NO:2).
  • the invention provides a polypeptide having a portion of SEQ ID NO:2 as follows: residues 20-207 in SEQ ID NO:2, residues 21-207 in SEQ ID NO:2, residues 22-207 in SEQ ID NO:2, residues 23-207 in SEQ ID NO:2, residues 24-207 in SEQ ID NO:2, residues 25-207 in SEQ ID NO:2, residues 26-207 in SEQ ID NO:2, residues 27-207 in SEQ ID NO:2, residues 28-207 in SEQ ID NO:2, residues 29-207 in SEQ ID NO:2, residues 30-207 in SEQ ID NO:2, residues 31-207 in SEQ ID NO:2, residues 32-207 in SEQ ID NO:2, residues 33-207 in SEQ ID NO:2, and residues 34-127 in SEQ
  • nucleic acid molecules of the present invention may be in the form of RNA, or in the form of DNA.
  • the DNA may be double-stranded or single-stranded.
  • Single-stranded DNA or RNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the anti-sense strand.
  • the polynucleotides of this invention are less than 300 kb, 200 kb, 100 kb, 50 kb, 15 kb, 10 kb or 7.5 kb in length.
  • polynucleotides of the invention comprise at least 15 contiguous nucleotides of KDI coding sequence, but do not comprise all or a portion of any KDI intron.
  • the nucleic acid comprising KDI coding sequence does not contain coding sequences of a genomic flanking gene (i.e. 5' or 3' to the KDI coding sequence in the genome).
  • isolated nucleic acid molecule(s) is intended a nucleic acid molecule, DNA or RNA, which has been removed from its native environment
  • recombinant DNA molecules contained in a vector are considered isolated for the purposes of the present invention.
  • Further examples of isolated DNA molecules include recombinant DNA molecules maintained in heterologous host cells or purified (partially or substantially) DNA molecules in solution.
  • Isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA molecules of the present invention.
  • nucleic acid contained in a clone that is a member of a library e.g., a genomic or cDNA library
  • a chromosome isolated or removed from a cell or cell lysate e.g., a "chromosome spread", as in a karyotype
  • isolated nucleic acid molecules according to the present invention may be produced naturally, recombinantly or synthetically.
  • Isolated nucleic acid molecules of the present invention include DNA molecules comprising an open reading frame (ORF) with an initiation codon at positions 35-37 of the nucleotide sequence shown in Figure 1 (SEQ ID NO:l). Also included are DNA molecules comprising the coding sequence for the KDI protein lacking an N-terminal methionine shown at positions 2-207 of SEQ ID NO:2.
  • isolated nucleic acid molecules of the invention include DNA molecules which comprise a sequence substantially different from those described above but which, due to the degeneracy of the genetic code, still encode the KDI protein.
  • the genetic code and species-specific codon preferences are well known in the art.
  • the invention provides isolated nucleic acid molecules encoding the KDI polypeptide having an amino acid sequence encoded by the human cDNA in clone HKAPI15 (ATCC Deposit No.
  • this nucleic acid molecule will encode the mature polypeptide encoded by the above-described deposited human cDNA.
  • the invention further provides an isolated nucleic acid molecule having the nucleotide sequence shown in Figure 1 (SEQ ID NO: 1) or the nucleotide sequence of the KDI cDNA contained in the above-described deposited clone, or a nucleic acid molecule having a sequence complementary to one of the above sequences.
  • Such isolated molecules are useful for production of the KDI polypeptide of the invention and as a probe for detection of mRNA in cells transfected with a vector for the purpose of producing KDI; i.e., as a marker for determining expression of the heterologous gene in a host cell.
  • the present invention is further directed to nucleic acid molecules encoding portions of the nucleotide sequences described herein as well as to fragments of the isolated nucleic acid molecules described herein.
  • the invention provides a polynucleotide having a nucleotide sequence representing the portion of SEQ ID NO: l which consists of positions 35-
  • polynucleotide fragments of the invention comprise, or alternatively, consist of nucleotide residues 38-655, 41-655, 44-655, 47-655, 50- 655, 53-655, 56-655, 59-655, 62-655, 65-655, 68-655, 71-655, 74-655, 77-655, 80-655, 83- 655, 86-655, 89-655, 92-655, 95-655, 98-655, 101-655, 104-655, 107-655, 1 10-655, 113- 655, 116-655, 119-655, 122-655, 125-655, 128-655, 131-655, 134-655, 137-655, 140-655,
  • Still other particularly preferred polynucleotide fragments of the invention comprise, or alternatively, consist of nucleotide residues 38-68, 38-71 , 38-74, 38-77, 38-80, 38-83, 38-86, 38-89, 38-92, 38-95, 38-98, 38- 101 , 38- 104, 38-107, 38-1 10, 38- 1 13, 38-1 16, 38-1 19, 38-122, 38-125.
  • the invention includes a polynucleotide comprising any portion of at least about
  • a fragment of an isolated nucleic acid molecule having the nucleotide sequence of the deposited cDNA or the nucleotide sequence shown in Figure 1 is intended fragments at least about 15 nt, and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably, at least about 40 nt in length which are useful as diagnostic probes and primers as discussed herein.
  • fragments 50-600 nt in length fragments of 400 nt, 450 nt, 500 nt, 550 nt and 600 nt in length are specifically contempleted as are fragments of all lengths between 15 and 600 but will not be specifically recited for space considerations) are also useful according to the present invention as are fragments corresponding to most, if not all, of the nucleotide sequence of the deposited cDNA or as shown in Figure 1 (SEQ ID NO: 1).
  • fragments which include 20 or more contiguous bases from the nucleotide sequence of the deposited cDNA or the nucleotide sequence as shown in Figure 1 (SEQ ID NO: 1) and may, of course, comprise additional nucleic acid sequences not derived from SEQ ID NO: 1.
  • nucleic acid fragments of the present invention include nucleic acid molecules encoding epitope-bearing portions of the KDI polypeptide as identified in Figure 3 and described in more detail below.
  • the invention provides an isolated nucleic acid molecule comprising a polynucleotide which hybridizes under stringent hybridization conditions to a portion of the polynucleotide in a nucleic acid molecule of the invention described above, for instance, the human cDNA in clone HKAPI15 (ATCC Deposit No. 203500).
  • stringent hybridization conditions is intended overnight incubation at 42° C in a solution comprising: 50% formamide, 5x SSC (150 mM NaCI, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 ⁇ g/ml denatured, sheared salmon sperm DNA, followed by washing the filters twice in 0. lx SSC at about 65° C.
  • a polynucleotide which hybridizes to a "portion" of a polynucleotide is intended a polynucleotide (either DNA or RNA) hybridizing to at least about 15 nucleotides (nt), and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably about 30-70 (e.g., 50) nt of the reference polynucleotide. These are useful as diagnostic probes and primers as discussed above and in more detail below.
  • a portion of a polynucleotide of "at least 20 nt in length,” for example, is intended 20 or more contiguous nucleotides from the nucleotide sequence of the reference polynucleotide (e.g., the deposited cDNA or the nucleotide sequence as shown in Figure 1 (SEQ ID NO:l)).
  • polynucleotide which hybridizes only to a poly A sequence such as the 3' terminal poly(A) tract of the KDI cDNA shown in Figure 1 (SEQ ID NO: 1)
  • a complementary stretch of T (or U) residues would not be included in a polynucleotide of the invention used to hybridize to a portion of a nucleic acid of the invention, since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly (A) stretch or the complement thereof (e.g., practically any double-stranded cDNA clone).
  • the polynucleotides of the invention are less than 100000 kb
  • nucleic acid molecules of the present invention which encode a KDI polypeptide may include, but are not limited to those encoding the amino acid sequence of the complete polypeptide, by itself; and the coding sequence for the complete polypeptide and additional sequences, such as those encoding an added secretory leader sequence, such as a pre-, or pro- or prepro- protein sequence.
  • nucleic acids of the invention are the above protein sequences together with additional, non-coding sequences, including for example, but not limited to introns and non-coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription, mRNA processing, including splicing and polyadenylation signals, for example - ribosome binding and stability of mRNA; an additional coding sequence which codes for additional amino acids, such as those which provide additional functionalities.
  • additional, non-coding sequences including for example, but not limited to introns and non-coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription, mRNA processing, including splicing and polyadenylation signals, for example - ribosome binding and stability of mRNA; an additional coding sequence which codes for additional amino acids, such as those which provide additional functionalities.
  • the sequence encoding the polypeptide may be fused to a marker sequence, such as a sequence encoding a peptide which facilitates purification of the fused polypeptide.
  • the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 9131 1), among others, many of which are commercially available.
  • hexa-histidine provides for convenient purification of the fusion protein.
  • the "HA” tag is another peptide useful for purification which corresponds to an epitope derived from the influenza hemagglutinin protein, which has been described by Wilson et al, Cell 37: 767 (1984).
  • other such fusion proteins include the KDI fused to Fc at the N- or C-terminus.
  • variants of the nucleic acid molecules of the present invention which encode portions, analogs or derivatives of the KDI protein.
  • Variants may occur naturally, such as a natural allelic variant.
  • allelic variant is intended one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985). Non-naturally occurring variants may be produced using art-known mutagenesis techniques.
  • variants include those produced by nucleotide substitutions, deletions or additions.
  • the substitutions, deletions or additions may involve one or more nucleotides.
  • the variants may be altered in coding regions, non-coding regions, or both. Alterations in the coding regions may produce conservative or non-conservative amino acid substitutions, deletions or additions. Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the KDI protein or portions thereof. Also especially preferred in this regard are conservative substitutions.
  • nucleic acid molecule comprising a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical to a polynucleotide selected from the group consisting of: (a) a nucleotide sequence encoding the KDI polypeptide having the complete amino acid sequence in SEQ ID NO:2; (b) a nucleotide sequence encoding the KDI polypeptide having the complete amino acid sequence in SEQ ID NO:2 excepting the N-terminal methionine (i.e., residues 2-161 of SEQ ID NO:2; (c) a nucleotide sequence encoding the mature KDI polypeptide having the sequence shown as residues 28-207 in SEQ ID NO:2; (d) a nucleotide sequence encoding residues 165 to 183 shown in SEQ ID NO:2; (e) a nucleotide
  • nucleic acid molecules that comprise a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical, to any of the nucleotide sequences in (a), (b), (c), (d), (e), (f), (g) or (h), above, or a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide in (a), (b), (c), (d), (e), (f), (g) or (h) above.
  • An additional nucleic acid embodiment of the invention relates to an isolated nucleic acid molecule comprising a polynucleotide which encodes the amino acid sequence of an epitope-bearing portion of a KDI polypeptide having an amino acid sequence in (a), (b), (c),
  • the present invention also relates to recombinant vectors, which include the isolated nucleic acid molecules of the present invention, and to host cells containing the recombinant vectors, as well as to methods of making such vectors and host cells and for using them for production of KDI polypeptides or peptides by recombinant techniques.
  • a polynucleotide having a nucleotide sequence at least, for example, 95% "identical" to a reference nucleotide sequence encoding a KDI polypeptide is intended that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the KDI polypeptide.
  • a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence.
  • These mutations of the reference sequence may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.
  • nucleic acid molecule is at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the nucleotide sequence shown in Figure 1 or to the nucleotides sequence of the deposited cDNA clone can be determined conventionally using known computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 5371 1). Bestfit uses the local homology algorithm of Smith and Waterman to find the best segment of homology between two sequences (Advances in Applied Mathematics 2:482-489 (1981)).
  • the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference nucleotide sequence and that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.
  • a preferred method for determing the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. (1990) 6:237-245).
  • RNA sequence can be compared by converting U's to T's.
  • the result of said global sequence alignment is in percent identity.
  • the percent identity is corrected by calculating the number of bases of the query sequence that are 5' and 3' of the subject sequence, which are not matched aligned, as a percent of the total bases of the query sequence. Whether a nucleotide is matched/aligned is determined by results of the FASTDB sequence alignment.
  • This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score.
  • This corrected score is what is used for the purposes of the present invention. Only bases outside the 5' and 3' bases of the subject sequence, as displayed by the FASTDB alignment, which are not matched/aligned with the query sequence, are calculated for the purposes of manually adjusting the percent identity score.
  • a 90 base subject sequence is aligned to a 100 base query sequence to determine percent identity.
  • the deletions occur at the 5' end of the subject sequence and therefore, the FASTDB alignment does not show a matched/alignment of the first 10 bases at 5' end.
  • the 10 unpaired bases represent 10% of the sequence (number of bases at the 5' and 3' ends not matched/total number of bases in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 bases were perfectly matched the final percent identity would be 90%.
  • a 90 base subject sequence is compared with a 100 base query sequence.
  • deletions are internal deletions so that there are no bases on the 5' or 3' of the subject sequence which are not matched/aligned with the query.
  • percent identity calculated by FASTDB is not manually corrected.
  • bases 5' and 3' of the subject sequence which are not matched/aligned with the query sequence are manually corrected for. No other manual corrections are to made for the purposes of the present invention.
  • the present application is directed to nucleic acid molecules at least 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence shown in Figure 1 (SEQ ID NO: l) or to the nucleic acid sequence of the deposited DNA, irrespective of whether they encode a polypeptide having KDI activity. This is because even where a particular nucleic acid molecule does not encode a polypeptide having KDI activity, one of skill in the art would still know how to use the nucleic acid molecule, for instance, as a hybridization probe or a polymerase chain reaction (PCR) primer.
  • Uses of the nucleic acid molecules of the present invention that do not encode a polypeptide having KDI activity include, inter alia, isolating allelic variants in a cDNA library.
  • nucleic acid molecules having sequences at least 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence shown in Figure 1 (SEQ ID NO: 1) or to the nucleic acid sequence of the deposited DNA which do, in fact, encode a polypeptide having KDI protein activity.
  • a polypeptide having KDI activity is intended polypeptides exhibiting activity similar, but not necessarily identical, to an activity of the KDI protein of the invention, as measured in a particular biological assay.
  • the KDI protein of the present invention inhibits bone marrow colony formation in-vitro and can be assayed according to the method of Tiefenthaler M.
  • KDI can inhibit GM-CSF induced proliferation of the erythroleukaemic cell line TF-1 according to the assays reported by Mire-Sluis A.R. et al. (J. Immunol. Methods 1996 Sep 9;195(l-2):55-61, incorporated herein by reference).
  • KDI can be assayed for classical anti-viral activity by any of several assays known to those of skill in the art, for example, in the assay reported by Sugiyama, K. et al.
  • the KDI protein of the present invention inhibits bone marrow proliferation and shows anti-viral activity in a dose-dependent manner in the above-described assays.
  • a polypeptide having KDI protein activity includes polypeptides that also exhibit any of the same activities in the above-described assays in a dose-dependent manner.
  • a polypeptide having KDI protein activity will exhibit substantially similar dose-dependence in a given activity as compared to the KDI protein (i.e., the candidate polypeptide will exhibit greater activity or not more than about 25-fold less and, preferably, not more than about tenfold less activity relative to the reference KDI protein).
  • the candidate polypeptide will exhibit greater activity or not more than about 25-fold less and, preferably, not more than about tenfold less activity relative to the reference KDI protein.
  • nucleic acid sequence of the deposited cDNA or the nucleic acid sequence shown in Figure 1 will encode a polypeptide "having KDI protein activity.”
  • degenerate variants of these nucleotide sequences all encode the same polypeptide, this will be clear to the skilled artisan even without performing the above described comparison assay. It will be further recognized in the art that, for such nucleic acid molecules that are not degenerate variants, a reasonable number will also encode a polypeptide having KDI protein activity. This is because the skilled artisan is fully aware of amino acid substitutions that are either less likely or not likely to significantly effect protein function (e.g., replacing one aliphatic amino acid with a second aliphatic amino acid), as further described below.
  • the present invention also relates to vectors which include the isolated DNA molecules of the present invention, host cells which are genetically engineered with the recombinant vectors, and the production of KDI polypeptides or fragments thereof by recombinant techniques.
  • the vector may be, for example, a phage, plasmid, viral or retroviral vector. Retroviral vectors may be replication competent or replication defective. In the latter case, viral propagation generally will occur only in complementing host cells.
  • the polynucleotides may be joined to a vector containing a selectable marker for propagation in a host. Generally, a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid.
  • the vector may be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.
  • the DNA insert should be operatively linked to an appropriate promoter, such as the phage lambda PL promoter, the E. coli lac, trp, phoA and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few. Other suitable promoters will be known to the skilled artisan.
  • the expression constructs will further contain sites for transcription initiation, termination and, in the transcribed region, a ribosome binding site for translation.
  • the coding portion of the transcripts expressed by the constructs will preferably include a translation initiating codon at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated.
  • the expression vectors will preferably include at least one selectable marker.
  • markers include dihydrofolate reductase, G418 or neomycin resistance for eukaryotic cell culture and tetracycline, kanamycin or ampicillin resistance genes for culturing in
  • E. coli and other bacteria include, but are not limited to, bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, 293 and Bowes melanoma cells; and plant cells. Appropriate culture mediums and conditions for the above-described host cells are known in the art.
  • vectors preferred for use in bacteria include pQE70, pQE60 and pQE-9, available from QIAGEN, Inc., supra; pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNHl ⁇ a, pNH18A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia.
  • preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia.
  • Other suitable vectors will be readily apparent to the skilled artisan.
  • the construct into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection or other methods. Such methods are described in many standard laboratory manuals, such as Davis et al, Basic Methods In Molecular Biology (1986).
  • the polypeptide may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals, but also additional heterologous functional regions. For instance, a region of additional amino acids, particularly charged amino acids, may be added to the N-terminus of the polypeptide to improve stability and persistence in the host cell, during purification, or during subsequent handling and storage.
  • peptide moieties may be added to the polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the polypeptide.
  • a preferred fusion protein comprises a heterologous region from immunoglobulin that is useful to stabilize and purify proteins.
  • EP-A-O 464 533 (Canadian counterpart 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobulin molecules together with another human protein or part thereof.
  • the Fc part in a fusion protein is thoroughly advantageous for use in therapy and diagnosis and thus results, for example, in improved pharmacokinetic properties (EP-A 0232 262).
  • human proteins, such as hIL-5 have been fused with Fc portions for the purpose of high-throughput screening assays to identify antagonists of hIL-5. See, D. Bennett et al, J. Molecular Recognition S:52-58 (1995) and K.
  • the KDI protein can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography. affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography (“HPLC”) is employed for purification.
  • HPLC high performance liquid chromatography
  • Polypeptides of the present invention include: products purified from natural sources, including bodily fluids, tissues and cells, whether directly isolated or cultured; products of chemical synthetic procedures; and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells. Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. In addition, polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes.
  • N-terminal methionine encoded by the translation initiation codon generally is removed with high efficiency from any protein after translation in all eukaryotic cells. While the N-terminal methionine on most proteins also is efficiently removed in most prokaryotes, for some proteins this prokaryotic removal process is inefficient, depending on the nature of the amino acid to which the N-terminal methionine is covalently linked.
  • the invention further provides an isolated KDI polypeptide having the amino acid sequence encoded by the deposited DNA, or the amino acid sequence in SEQ ID NO:2, or a peptide or polypeptide comprising a portion of the above polypeptides.
  • KDI polypeptides protein engineering may be employed.
  • Recombinant DNA technology known to those skilled in the art can be used to create novel mutant proteins or "muteins including single or multiple amino acid substitutions, deletions, additions or fusion proteins.
  • modified polypeptides can show, e.g., enhanced activity or increased stability.
  • they may be purified in higher yields and show better solubility than the corresponding natural polypeptide, at least under certain purification and storage conditions.
  • N-Terminal and C-Terminal Deletion Mutants For instance, for many proteins, including the extracellular domain of a membrane associated protein or the mature form(s) of a secreted protein, it is known in the art that one or more amino acids may be deleted from the N-terminus or C-terminus without substantial loss of biological function. For instance, Ron et al., J. Bioi Chem., 268:2984-2988 (1993) reported modified KGF proteins that had heparin binding activity even if 3, 8, or 27 amino-terminal amino acid residues were missing.
  • deletions of N-terminal amino acids up to the cysteine at position 59 as shown in SEQ ID NO:2 may retain some biological activity such as antiviral activity or inhibition of bone marrow proliferation.
  • Polypeptides having further N- terminal deletions including the Cys-59 residue in SEQ ID NO:2 would not be expected to retain such biological activities because it is known that this residue in an interferon-related polypeptide is conserved among many, if not all, members of the family as is Leucine residue immediately adjacent to it (residue 60).
  • the cysteine residue at position 59 is thought to be required for forming a disulfide bridge to provide structural stability which is needed for receptor binding and signal transduction.
  • the present invention further provides polypeptides having one or more residues deleted from the amino terminus of the amino acid sequence of the KDI shown in SEQ ID NO:2, up to the Cys-59, and polynucleotides encoding such polypeptides.
  • the present invention provides polypeptides comprising the amino acid sequence of residues n-207 of SEQ ID NO:2, where n is an integer in the range of 1-59 and where Cys-59 is the position of the first residue from the N-terminus of the complete KDI polypeptide (shown in SEQ ID NO: 2) believed to be required for activity of the KDI protein.
  • the invention provides polypeptides having the amino acid sequence of residues 1-207, 2-207, 3-207, 4-207, 5-207, 6-207, 7-207, 8-207, 9-207, 10-207, 1 1-207,
  • Polypeptides having further C-terminal deletions including He- 183 of SEQ ID NO:2 would not be expected to retain such biological activities because it is known that this residue in an interferon-related polypeptide is conserved among many members and is thought to be important for receptor binding and signal transduction. Furthermore, the cysteine residue at position 181 is highly conserved and known to be required for antiviral activity of members of the interferon family.
  • the present invention further provides polypeptides having one or more residues from the carboxy terminus of the amino acid sequence of the KDI shown in SEQ ID NO:
  • the present invention provides polypeptides having the amino acid sequence of residues 1-m of the amino acid sequence in SEQ ID NO:2, where m is any integer in the range of 183-207 and residue Trp-183 is the position of the first residue from the C- terminus of the complete KDI polypeptide (shown in SEQ ID NO: 2) believed to be required for activity of the
  • the invention provides polypeptides having the amino acid sequence of residues 1-183, 1-184, 1-185, 1-186, 1-187, 1-188, 1-189, 1-190, 1-191, 1-192, 1-193, 1- 194, 1-195, 1-196, 1-197, 1-198, 1-199, 1-200, 1-201, 1-202, 1-203, 1-204, 1-205, 1-206 and 1-207 of SEQ ID NO:2. Polynucleotides encoding these polypeptides also are provided.
  • the invention also provides polypeptides having one or more amino acids deleted from both the amino and the carboxyl termini, which may be described generally as having residues n-m of SEQ ID NO:2, where n and m are integers as described above. Furthermore, the invention provides these mutant polypeptides optionally having an N-terminal methionine.
  • the polypeptides may therefore also be described by the formula x-n-m where X is either NH 2 or
  • Met and n and m are integers as described above. Polynucleotides encoding these polypeptides are, of course, also provided.
  • the invention preferrably provides polypeptides having the amino acid sequence of residues: 20-183, 21-183, 22-183, 23-183, 24-183, 25-183, 26-183, 27-183, 28-183, 29-183, 30-183, 31-183, 32-183, 33-183, 34-183, 35-183, 36-183, 37-183, 38-183,
  • Each of the foregoing polypeptides may additionally include an N-terminal methionine residue.
  • Polynucleotides encoding each of these polypeptides, with or without an N-terminal methionine residues are also are provided.
  • polypeptides consisting of a portion of the complete KDI amino acid sequence encoded by the human cDNA in clone HKAPI15, where this portion excludes from 1 to about 58 amino acids from the amino terminus of the complete amino acid sequence encoded by the human cDNA in clone HKAPI15, or from 1 to about 23 amino acids from the carboxy terminus, or any combination of the above amino terminal and carboxy terminal deletions, of the complete amino acid sequence encoded by the human cDNA in clone HKAPI15.
  • Polynucleotides encoding all of the above deletion mutant polypeptide forms also are provided.
  • the invention further includes variations of the KDI polypeptide which show substantial KDI polypeptide activity or which include regions of KDI protein such as the protein portions discussed below.
  • Such mutants include deletions, insertions, inversions, repeats, and type substitutions selected according to general rules known in the art so as have little effect on activity.
  • guidance concerning how to make phenotypically silent amino acid substitutions is provided in Bowie, J. U. et al., "Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitutions," Science 247:1306-1310 (1990), wherein the authors indicate that there are two main approaches for studying the tolerance of an amino acid sequence to change.
  • the first method relies on the process of evolution, in which mutations are either accepted or rejected by natural selection.
  • the second approach uses genetic engineering to introduce amino acid changes at specific positions of a cloned gene and selections or screens to identify sequences that maintain functionality.
  • proteins are surprisingly tolerant of amino acid substitutions.
  • the authors further indicate which amino acid changes are likely to be permissive at a certain position of the protein. For example, most buried amino acid residues require nonpolar side chains, whereas few features of surface side chains are generally conserved. Other such phenotypically silent substitutions are described in Bowie, J. U. et al, supra, and the references cited therein.
  • conservative substitutions are the replacements, one for another, among the aliphatic amino acids Ala, Val, Leu and He; interchange of the hydroxyl residues Ser and Thr, exchange of the acidic residues Asp and Glu, substitution between the amide residues Asn and Gin, exchange of the basic residues Lys and Arg and replacements among the aromatic residues Phe, Tyr.
  • the fragment, derivative or analog of the polypeptide of SEQ ID NO:2, or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the KDI polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the above form of the polypeptide, such as an IgG Fc fusion region peptide or leader or secretory sequence or a sequence which is employed for purification of the above form of the polypeptide or a proprotein sequence.
  • a conserved or non-conserved amino acid residue
  • the KDI of the present invention may include one or more amino acid substitutions, deletions or additions, either from natural mutations or human manipulation. As indicated, changes are preferably of a minor nature, such as conservative amino acid substitutions that do not significantly affect the folding or activity of the protein.
  • Amino acids in the KDI protein of the present invention that are essential for function can be identified by methods known in the art, such as site-directed mutagenesis or alanine- scanning mutagenesis (Cunningham and Wells, Science 244: 1081- 1085 (1989)). The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as receptor binding or in vitro proliferative activity.
  • substitutions for each of the KDI polypeptides described herein is the replacement of the arginine residues at position 192 with lysine (sometimes hereinafter referred to as "R192K”), and replacement of the cysteine residue at position 193 with a serine residue (sometimes hereinafter referred to as "C193S"). These substitutions can be found in a
  • KDI polypeptide indivudually or they can occur in the same KDI polypeptide.
  • polypeptides of the present invention are preferably provided in an isolated form, and preferably are substantially purified.
  • a recombinantly produced version of the KDI polypeptide can be substantially purified by the one-step method described in Smith and
  • Polypeptides of the invention also can be purified from natural or recombinant sources using anti-KDI antibodies of the invention in methods which are well known in the art of protein purification.
  • the invention further provides an isolated KDI polypeptide comprising an amino acid sequence selected from the group consisting of: (a) the amino acid sequence of the full-length
  • KDI polypeptide having the complete amino acid sequence shown in SEQ ID NO:2 (b) the amino acid sequence of the full-length KDI polypeptide having the complete amino acid sequence shown in SEQ ID NO:2 excepting the N-terminal methionine (i.e., residues 2 to 207 of SEQ ID NO:2); the amino acid sequence of the mature KDI polypeptide shown as residues 28-207 in SEQ ID NO:2; (d) the amino acid sequence shown in SEQ ID NO:2 as residues 165-
  • polypeptides of the present invention include polypeptides which have at least
  • polypeptides of the invention also comprise those which are at least 80% identical, more preferably at least 90% or 95% identical, still more preferably at least 96%, 97%, 98% or 99% identical to the polypeptide encoded by the deposited DNA or to the polypeptide of SEQ ID NO:2, and also include portions of such polypeptides with at least 10, 20 or 30 amino acids and more preferably at least 50 amino acids.
  • a further embodiment of the invention relates to a peptide or polypeptide which comprises the amino acid sequence of a KDI polypeptide having an amino acid sequence which contains at least one conservative amino acid substitution, but not more than 50 conservative amino acid substitutions, even more preferably, not more than 40 conservative amino acid substitutions, still more preferably not more than 30 conservative amino acid substitutions, and still even more preferably not more than 20 conservative amino acid substitutions.
  • a peptide or polypeptide it is highly preferable for a peptide or polypeptide to have an amino acid sequence which comprises the amino acid sequence of a KDI polypeptide, which contains at least one, but not more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 conservative amino acid substitutions.
  • % similarity for two polypeptides is intended a similarity score produced by comparing the amino acid sequences of the two polypeptides using the Bestfit program
  • polypeptide having an amino acid sequence at least, for example, 95% "identical" to a reference amino acid sequence of an IL-20 polypeptide is intended that the amino acid sequence of the polypeptide is identical to the query sequence except that the polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the reference amino acid of the IL-20 polypeptide.
  • up to 5% of the amino acid residues in the query sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence.
  • These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
  • any particular polypeptide is at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the amino acid sequence shown in SEQ ED NO:2 or to the amino acid sequence encoded by deposited cDNA clone can be determined conventionally using known computer programs such the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711).
  • Bestfit or any other sequence alignment program determines whether a particular sequence is, for instance, 95% identical to a reference sequence according to the present invention.
  • the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference amino acid sequence and that gaps in homology of up to 5% of the total number of amino acid residues in the reference sequence are allowed.
  • a preferred method for determing the best overall match between a query sequence (a sequence of the present invention) and a subject sequence also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. ( 1990) 6:237-245).
  • the query and subject sequences are either both nucleotide sequences or both amino acid sequences.
  • the result of said global sequence alignment is in percent identity.
  • the percent identity is corrected by calculating the number of residues of the query sequence that are N- and C-terminal of the subject sequence, which are not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence. Whether a residue is matched/aligned is determined by results of the FASTDB sequence alignment.
  • This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score.
  • This final percent identity score is what is used for the purposes of the present invention. Only residues to the N- and C-termini of the subject sequence, which are not matched/aligned with the query sequence, are considered for the purposes of manually adjusting the percent identity score. That is, only query residue positions outside the farthest N- and C-terminal residues of the subject sequence.
  • a 90 amino acid residue subject sequence is aligned with a 100 residue query sequence to determine percent identity.
  • the deletion occurs at the N-terminus of the subject sequence and therefore, the FASTDB alignment does not show a matching/alignment of the first 10 residues at the N-terminus.
  • the 10 unpaired residues represent 10% of the sequence (number of residues at the N- and C- termini not matched/total number of residues in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues were perfectly matched the final percent identity would be 90%.
  • a 90 residue subject sequence is compared with a 100 residue query sequence.
  • deletions are internal deletions so there are no residues at the N- or C-termini of the subject sequence which are not matched/aligned with the query.
  • percent identity calculated by FASTDB is not manually corrected.
  • residue positions outside the N- and C-terminal ends of the subject sequence, as displayed in the FASTDB alignment, which are not matched/aligned with the query sequence are manually corrected for. No other manual corrections are to made for the purposes of the present invention.
  • polypeptide of the present invention could be used as a molecular weight marker on SDS-PAGE gels or on molecular sieve gel filtration columns using methods well known to those of skill in the art.
  • polypeptides of the present invention can also be used to raise polyclonal and monoclonal antibodies, which are useful in assays for detecting KDI protein expression as described below or as agonists and antagonists capable of enhancing or inhibiting KDI protein function.
  • polypeptides can be used in the yeast two-hybrid system to "capture" KDI protein binding proteins which are also candidate agonists and antagonists according to the present invention.
  • the yeast two hybrid system is described in Fields and Song, Nature 340:245-246 (1989).
  • the invention provides a peptide or polypeptide comprising an epitope-bearing portion of a polypeptide of the invention.
  • the epitope of this polypeptide portion is an immunogenic or antigenic epitope of a polypeptide of the invention.
  • An "immunogenic epitope” is defined as a part of a protein that elicits an antibody response when the whole protein is the immunogen.
  • a region of a protein molecule to which an antibody can bind is defined as an "antigenic epitope.”
  • the number of immunogenic epitopes of a protein generally is less than the number of antigenic epitopes. See, for instance,
  • peptides or polypeptides bearing an antigenic epitope i.e., that contain a region of a protein molecule to which an antibody can bind
  • relatively short synthetic peptides that mimic part of a protein sequence are routinely capable of eliciting an antiserum that reacts with the partially mimicked protein. See, for instance, Sutcliffe, J. G., Shinnick, T. M., Green, N. and Learner, R. A. (1983) "Antibodies that react with predetermined sites on proteins," Science, 279:660-666.
  • Antigenic epitope-bearing peptides and polypeptides of the invention are therefore useful to raise antibodies, including monoclonal antibodies, that bind specifically to a polypeptide of the invention. See, for instance, Wilson et al, Cell 37:161-11% (1984) at 777.
  • Antigenic epitope-bearing peptides and polypeptides of the invention preferably contain a sequence of at least seven, more preferably at least nine and most preferably between about
  • Non-limiting examples of antigenic polypeptides or peptides that can be used to generate KDI-specific antibodies include: a polypeptide comprising amino acid residues from about Ser 49 to about Ser 54 in SEQ ID NO:2; a polypeptide comprising amino acid residues from about Cys 59 to about Ala 65 in SEQ LD NO:2; a polypeptide comprising amino acid residues from about Pro 78 to about Tyr 88 in SEQ ID NO:2; a polypeptide comprising amino acid residues from about His 101 to about Gin 1 13 in SEQ ID NO:2; a polypeptide comprising amino acid residues Gin 120 to about Glu 123 in SEQ ED NO:2; a polypeptide comprising amino acid residues Cys 128 to about Pro 155 in SEQ ID NO:2, a polypeptide comprising amino acid residues from about Leu 160 to about Arg 168 in SEQ ID NO:2; a polypeptide comprising amino acid residues from about Leu 160 to about Arg 168 in S
  • polypeptide fragments have been determined to bear antigenic epitopes of the KDI protein by the analysis of the Jameson-Wolf antigenic index, as shown in Figure 3, above.
  • the epitope-bearing peptides and polypeptides of the invention may be produced by any conventional means. See, e.g., Houghten, R. A. ( 1985) "General method for the rapid solid-phase synthesis of large numbers of peptides: specificity of antigen-antibody interaction at the level of individual amino acids.” Proc. Nati Acad. Sci. USA 82:5131-5135; this "Simultaneous Multiple Peptide Synthesis (SMPS)" process is further described in U.S. Patent No. 4,631,21 1 to Houghten et al. (1986).
  • SMPS Simultaneous Multiple Peptide Synthesis
  • Epitope-bearing peptides and polypeptides of the invention are used to induce antibodies according to methods well known in the art. See, for instance, Sutcliffe et al., supra; Wilson et al., supra; Chow, M. et al, Proc. Nati Acad. Sci. USA 82:910-914; and Bittle, F. J. et al, J. Gen. Virol 66:2347-2354 (1985).
  • Immunogenic epitope-bearing peptides of the invention i.e., those parts of a protein that elicit an antibody response when the whole protein is the immunogen, are identified according to methods known in the art. See, for instance, Geysen et al., supra.
  • U.S. Patent No. 5,194,392 to Geysen (1990) describes a general method of detecting or determining the sequence of monomers (amino acids or other compounds) which is a topological equivalent of the epitope (i.e., a "mimotope") which is complementary to a particular paratope (antigen binding site) of an antibody of interest. More generally, U.S. Patent No. 4,433,092 to Geysen (1989) describes a method of detecting or determining a sequence of monomers which is a topographical equivalent of a ligand which is complementary to the ligand binding site of a particular receptor of interest. Similarly, U.S. Patent No. 5,480,971 to Houghten, R. A.
  • non-peptide analogs of the epitope-bearing peptides of the invention also can be made routinely by these methods.
  • KDI polypeptides of the present invention and the epitope-bearing fragments thereof described above can be combined with parts of the constant domain of immunoglobulins (IgG), resulting in chimeric polypeptides.
  • IgG immunoglobulins
  • These fusion proteins facilitate purification and show an increased half-life in vivo. This has been shown, e.g., for chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins (EP A 394,827: Traunecker et al., Nature 331:84-86 (1988)).
  • Fusion proteins that have a disulfide-linked dimeric structure due to the IgG part can also be more efficient in binding and neutralizing other molecules than the monomeric KDI protein or protein fragment alone (Fountoulakis et al, J. Biochem. 270:3958-3964 (1995)).
  • KDI-protein specific antibodies for use in the present invention can be raised against the intact KDI protein or an antigenic polypeptide fragment thereof, which may be presented together with a carrier protein, such as an albumin, to an animal system (such as rabbit or mouse) or, if it is long enough (at least about 25 amino acids), without a carrier.
  • a carrier protein such as an albumin
  • antibody As used herein, the term "antibody” (Ab) or “monoclonal antibody” (Mab) is meant to include intact molecules as well as antibody fragments (such as, for example, Fab and F(ab')2 fragments) which are capable of specifically binding to KDI protein. Fab and F(ab')2 fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody (Wahl et al, J. Nucl. Med. 24:316-325 (1983)). Thus, these fragments are preferred.
  • Fab and F(ab')2 fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody (Wahl et al, J. Nucl. Med. 24:316-325 (1983)). Thus, these fragments are preferred.
  • the antibodies of the present invention may be prepared by any of a variety of methods.
  • cells expressing the KDI protein or an antigenic fragment thereof can be administered to an animal in order to induce the production of sera containing polyclonal antibodies.
  • a preparation of KDI protein is prepared and purified to render it substantially free of natural contaminants. Such a preparation is then introduced into an animal in order to produce polyclonal antisera of greater specific activity.
  • the antibodies of the present invention are monoclonal antibodies (or KDI protein binding fragments thereof).
  • monoclonal antibodies can be prepared using hybridoma technology (K ⁇ hler et al, Nature 256:495 (1975); Kohler et al, Eur. J. Immunol. 6:51 1 (1976); K ⁇ hler et al., Eur. J. Immunol. 6:292 ( 1976); Hammerling et al, in: Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y., (1981) pp. 563-681 ).
  • such procedures involve immunizing an animal (preferably a mouse) with a KDI protein antigen or, more preferably, with a KDI protein-expressing cell.
  • Suitable cells can be recognized by their capacity to bind anti-KDI protein antibody.
  • Such cells may be cultured in any suitable tissue culture medium; however, it is preferable to culture cells in Earle's modified Eagle's medium supplemented with 10% fetal bovine serum (inactivated at about 56° C), and supplemented with about 10 g/1 of nonessential amino acids, about 1,000 U/ml of penicillin, and about 100 ⁇ g/ml of streptomycin.
  • the splenocytes of such mice are extracted and fused with a suitable myeloma cell line.
  • Any suitable myeloma cell line may be employed in accordance with the present invention; however, it is preferable to employ the parent myeloma cell line (SP2O), available from the American Type Culture Collection, Rockville, Maryland.
  • SP2O parent
  • the resulting hybridoma cells are selectively maintained in HAT medium, and then cloned by limiting dilution as described by Wands et al. (Gastroenterology 80:225-232 (1981)).
  • the hybridoma cells obtained through such a selection are then assayed to identify clones which secrete antibodies capable of binding the KDI protein antigen.
  • additional antibodies capable of binding to the KDI protein antigen may be produced in a two-step procedure through the use of anti-idiotypic antibodies.
  • Such a method makes use of the fact that antibodies are themselves antigens, and that, therefore, it is possible to obtain an antibody which binds to a second antibody.
  • KDI-protein specific antibodies are used to immunize an animal, preferably a mouse.
  • the splenocytes of such an animal are then used to produce hybridoma cells, and the hybridoma cells are screened to identify clones which produce an antibody whose ability to bind to the KDI protein-specific antibody can be blocked by the KDI protein antigen.
  • Such antibodies comprise anti-idiotypic antibodies to the KDI protein-specific antibody and can be used to immunize an animal to induce formation of further KDI protein-specific antibodies.
  • Fab and F(ab')2 and other fragments of the antibodies of the present invention may be used according to the methods disclosed herein.
  • Such fragments are typically produced by proteolytic cleavage, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
  • enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
  • KDI protein-binding fragments can be produced through the application of recombinant DNA technology or through synthetic chemistry.
  • chimeric monoclonal antibodies For in vivo use of anti-KDI in humans, it may be preferable to use "humanized" chimeric monoclonal antibodies. Such antibodies can be produced using genetic constructs derived from hybridoma cells producing the monoclonal antibodies described above. Methods for producing chimeric antibodies are known in the art. See, for review, Morrison, Science 229: 1202 (1985); Oi et al., BioTechniques 4:214 (1986); Cabilly et al., U.S. Patent No.
  • the KDI protein of the invention is a member of the interferon family, when KDI is added to cells, tissues or the body of an individual, the protein will exert its physiological activities on its target cells of that individual. Therefore, it will be appreciated that conditions caused by a decrease in the standard or normal level of interferon activity in an individual, particularly disorders of the immune system, can be treated by administration of the KDI polypeptide.
  • the invention also provides a method of treatment of an individual in need of an increased level of interferon activity comprising administering to such an individual a pharmaceutical composition comprising an amount of an isolated KDI polypeptide of the invention, effective to increase the interferon activity level in such an individual.
  • KDI can be used clinically for anti -viral therapy, for example, in the treatment of AIDS, viral hepatitis including chronic hepatitis B, hepatitis C, papilloma viruses, viral encephalitis, and in the prophylaxis of rhinitis and respiratory infections.
  • KDI is also useful in the treatment of numerous cancers (e.g., hairy cell leukemia, acute myeloid leukemia, osteosarcoma, basal cell carcinoma, glioma, renal cell carcinoma, multiple myeloma, melanoma, and Hodgkin's disease).
  • cancers e.g., hairy cell leukemia, acute myeloid leukemia, osteosarcoma, basal cell carcinoma, glioma, renal cell carcinoma, multiple myeloma, melanoma, and Hodgkin's disease.
  • KDI is believed to stimulate natural killer cell activity. Accordingly, KDI may be used to treat parasitic and bacterial infection for example, for treating Cryptosporidium parvum infection and multidrug-resistant pulmonary tuberculosis. KDI is also believed to be useful as an immunotherapeutic agent, more specifically as an immunosuppressive agent. For example, KDI is believed to inhibit proliferation of lymphocytes stimulated with mitogens or allogeneic cells, myeloid progenitor cells and other bone marrow cells.
  • KDI is useful as a protective agent when administered prior to chemotherapy and in addition can be used to treat hyperproliferation of lymphocytes, myeloid progenitors and bone marrow stem cells, e.g., in the treatment of chronic myelogenous leukemia.
  • KDI polypeptides can also be used in the prevention of graft vs. host rejection, or to curtail the progressiveion of autoimmune diseases, such as arthritis, multiple sclerosis, (2) or diabetes (3).
  • KDI is also useful in the treatment of allergies in mammals, e.g., by inhibiting the humoral response.
  • KDI may be used as an adjuvant or coadjuvant to enhance or simulate the immune response in cases of prophylactic or therapeutic vaccination.
  • a method of treating infection in a patient comprising administering an effective amount of a polypeptide of the invention to a patient in need of anti- infective therapy.
  • the infection is of viral, bacterial, or parasitic etiology.
  • the infection is a viral infection.
  • a method of treating cancer in a patient comprising administerin an effective amount of a polypeptide of the invention to a patient in need of anti- cancer therapy.
  • a method of immunotherapy in a patient comprising administering an effective amount of a polypeptide of the invention to a patient in need of immunotherapy.
  • the KDI polypeptide composition will be formulated and dosed in a fashion consistent with good medical practice, taking into account the clinical condition of the individual patient (especially the side effects of treatment with KDI polypeptide alone), the site of delivery of the KDI polypeptide composition, the method of administration, the scheduling of administration, and other factors known to practitioners.
  • the "effective amount" of KDI polypeptide for purposes herein is thus determined by such considerations.
  • the total pharmaceutically effective amount of KDI polypeptide administered parenterally per dose will be in the range of about 1 ⁇ g/kg/day to 10 mg/kg/day of patient body weight, although, as noted above, this will be subject to therapeutic discretion. More preferably, this dose is at least 0.01 mg/kg/day, and most preferably for humans between about 0.01 and 1 mg/kg/day for the hormone.
  • the KDI polypeptide is typically administered at a dose rate of about 1 ⁇ g/kg/hour to about 50 ⁇ g/kg/hour, either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-pump. An intravenous bag solution may also be employed. The length of treatment needed to observe changes and the interval following treatment for responses to occur appears to vary depending on the desired effect.
  • compositions containing the KDI of the invention may be administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, drops or transdermal patch), bucally, or as an oral or nasal spray.
  • pharmaceutically acceptable carrier is meant a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
  • parenteral refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.
  • the KDI polypeptide is also suitably administered by sustained-release systems.
  • sustained-release compositions include semi-permeable polymer matrices in the form of shaped articles, e.g., films, or mirocapsules.
  • Sustained-release matrices include polylactides (U.S. Pat. No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman, U. et al., Biopolymers 22:547-556 (1983)), poly (2- hydroxyethyl methacrylate) (R. Langer et al., J. Biomed. Mater. Res.
  • Sustained-release KDI polypeptide compositions also include liposomally entrapped KDI polypeptide.
  • Liposomes containing KDI polypeptide are prepared by methods known per se: DE 3,218,121; Epstein et al., Proc. Nati. Acad. Sci. (USA) 82:3688-3692 ( 1985); Hwang et al, Proc. Nati. Acad. Sci.
  • the liposomes are of the small (about 200-800 Angstroms) unilamellar type in which the lipid content is greater than about 30 moi. percent cholesterol, the selected proportion being adjusted for the optimal KDI polypeptide therapy.
  • the KDI polypeptide is formulated generally by mixing it at the desired degree of purity, in a unit dosage injectable form (solution, suspension, or emulsion), with a pharmaceutically acceptable carrier, i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
  • a pharmaceutically acceptable carrier i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
  • the formulation preferably does not include oxidizing agents and other compounds that are known to be deleterious to polypeptides.
  • the formulations are prepared by contacting the KDI polypeptide uniformly and intimately with liquid carriers or finely divided solid carriers or both. Then, if necessary, the product is shaped into the desired formulation.
  • the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient. Examples of such carrier vehicles include water, saline, Ringer's solution, and dextrose solution. Non-aqueous vehicles such as fixed oils and ethyl oleate are also useful herein, as well as liposomes.
  • the carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability.
  • Such materials are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, succinate, acetic acid, and other organic acids or their salts; antioxidants such as ascorbic acid; low molecular weight (less than about ten residues) polypeptides, e.g., polyarginine or tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, manose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; counterions such as sodium; and/or nonionic surfactants such as polysorbates, poloxamers, or PEG.
  • buffers such as phosphate, cit
  • KDI polypeptide to be used for therapeutic administration must be sterile. Sterility is readily accomplished by filtration through sterile filtration membranes (e.g., 0.2 micron membranes).
  • Therapeutic KDI polypeptide compositions generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
  • KDI polypeptide ordinarily will be stored in unit or multi-dose containers, for example, sealed ampoules or vials, as an aqueous solution or as a lyophilized formulation for reconstitution.
  • a lyophilized formulation 10-ml vials are filled with 5 ml of sterile-filtered 1% (w/v) aqueous KDI polypeptide solution, and the resulting mixture is lyophilized.
  • the infusion solution is prepared by reconstituting the lyophilized KDI polypeptide using bacteriostatic Water-for-Injection.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • the polypeptides of the present invention may be employed in conjunction with other therapeutic compounds.
  • the invention also provides a method of screening compounds to identify those which enhance or block the action of KDI on cells, such as its interaction with KDI-binding molecules such as receptor molecules.
  • An agonist is a compound which increases the natural biological functions of KDI or which functions in a manner similar to KDI, while antagonists decrease or eliminate such functions.
  • the invention provides a method for identifying a receptor protein or other ligand-binding protein which binds specifically to a KDI polypeptide.
  • a cellular compartment such as a membrane or a preparation thereof, may be prepared from a cell that expresses a molecule that binds KDI. The preparation is incubated with labeled KDI. KDI and complexes of KDI bound to the receptor or other binding protein are isolated and characterized according to routine methods known in the art.
  • the KDI polypeptide may be bound to a solid support so that binding molecules solubilized from cells are bound to the column and then eluted and characterized according to routine methods.
  • a cellular compartment such as a membrane or a preparation thereof, may be prepared from a cell that expresses a molecule that binds KDI, such as a molecule of a signaling or regulatory pathway modulated by KDI.
  • the preparation is incubated with labeled KDI in the absence or the presence of a candidate molecule which may be a KDI agonist or antagonist.
  • the ability of the candidate molecule to bind the binding molecule is reflected in decreased binding of the labeled ligand.
  • Molecules which bind gratuitously, i.e., without inducing the effects of KDI on binding the KDI binding molecule are most likely to be good antagonists.
  • KDI-like effects of potential agonists and antagonists may by measured, for instance, by determining activity of a second messenger system following interaction of the candidate molecule with a cell or appropriate cell preparation, and comparing the effect with that of KDI or molecules that elicit the same effects as KDI.
  • Second messenger systems that may be useful in this regard include but are not limited to AMP guanylate cyclase, ion channel or phosphoinositide hydrolysis second messenger systems.
  • KDI antagonists are a competitive assay that combines KDI and a potential antagonist with membrane-bound KDI receptor molecules or recombinant KDI receptor molecules under appropriate conditions for a competitive inhibition assay.
  • KDI can be labeled, such as by radioactivity, such that the number of KDI molecules bound to a receptor molecule can be determined accurately to assess the effectiveness of the potential antagonist.
  • Potential antagonists include small organic molecules, peptides, polypeptides and antibodies that bind to a polypeptide of the invention and thereby inhibit or extinguish its activity. Potential antagonists also may be small organic molecules, a peptide, a polypeptide such as a closely related protein or antibody that binds the same sites on a binding molecule, such as a receptor molecule, without inducing KDI-induced activities, thereby preventing the action of KDI by excluding KDI from binding.
  • Antisense molecules can be used to control gene expression through antisense DNA or RNA or through triple-helix formation. Antisense techniques are discussed, for example, in Okano, J. Neurochem. 56: 560 (1991); "Oligodeoxy nucleotides as Antisense Inhibitors of Gene Expression.” CRC Press, Boca Raton, FL (1988). Triple helix formation is discussed in, for instance Lee et al, Nucleic Acids Research 6: 3073 (1979); Cooney et al, Science 241: 456 (1988); and Dervan et al, Science 251: 1360 (1991). The methods are based on binding of a polynucleotide to a complementary DNA or RNA.
  • the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and the production of KDI.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into KDI polypeptide.
  • the oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of KDI protein.
  • the agonists and antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as described above.
  • the antagonists may be employed for instance to inhibit interferon activity, for example, following chemotherapy to stimulate proliferation of bone marrow and haematopoietic progenitor cells. Any of the above antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.
  • the novel pHE4 series of bacterial expression vectors in particular, the pHE4a vector is used for bacterial expression in this example.
  • pHE4-5/KDI vector plasmid DNA contains the KDI coding polynucleotide shown in Figure 1 inserted between unique restriction enzyme sites Ndel and Asp718. The construct was deposited with the ATCC on February 25, 1998 and given Accession No. 209645, as a convenience to those of skill in the art.
  • the pHE4a bacterial expression vector includes a neomycin phosphotransferase gene for selection, an E. coli origin of replication, a T5 phage promoter sequence, two lac operator sequences, a Shine-Delgarno sequence, and the lactose operon repressor gene (laclq). These elements are arranged such that an inserted DNA fragment encoding a polypeptide expresses that polypeptide with the six His residues (i.e., a "6 X His tag”) covalently linked to the amino terminus of that polypeptide.
  • laclq lactose operon repressor gene
  • the DNA sequence encoding the mature KDI protein is amplified using PCR oligonucleotide primers which anneal to the amino terminal sequences of the desired portion of the KDI protein and to sequences in the deposited construct 3' to the cDNA coding sequence. Additional nucleotides containing restriction sites to facilitate cloning in the pHE4a vector are added to the 5' and 3' primer sequences, respectively.
  • the 5' primer has the sequence 5 '
  • GGCCGCATATGCTGGACTGTAACTTACTG 3' (SEQ ID NO: 16) containing the underlined Ndel restriction site.
  • the 3' primer has the sequence 5' GGCCGCGGTACCTTATTTCCTCCTGAATAGAGC 3' (SEQ ID NO: 17) containing the underlined Asp718 restriction site.
  • the amplified KDI DNA fragment is digested with Ndel and Asp718 and it and the linearized plasmid are then ligated together. Insertion of the KDI DNA into the restricted pHE4a vector places the KDI protein coding region downstream from the JPTG-inducible promoter and in-frame with an initiating AUG and the six histidine codons.
  • the ligation mixture is transformed into competent E. coli cells using standard procedures such as those described by Sambrook and colleagues (Molecular Cloning: a Laboratory Manual 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989)). E.
  • coli strain M15/rep4 containing multiple copies of the plasmid pREP4, which expresses the lac repressor and confers kanamycin resistance (“Kanr"), is used in carrying out the illustrative example described herein.
  • This strain which is only one of many that are suitable for expressing KDI protein, is available commercially (QIAGEN, Inc., supra). Transformants are identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA confirmed by restriction analysis, PCR and DNA sequencing.
  • Clones containing the desired constructs are grown overnight ("O/N") in liquid culture in LB media supplemented with both ampicillin (100 ⁇ g/ml) and kanamycin (25 ⁇ g/ml).
  • the O/N culture is used to inoculate a large culture, at a dilution of approximately 1:25 to 1 :250.
  • the cells are grown to an optical density at 600 nm ("OD600") of between 0.4 and 0.6.
  • Isopropyl- ⁇ -D-thiogalactopyranoside (“IPTG”) is then added to a final concentration of 1 mM to induce transcription from the lac repressor sensitive promoter, by inactivating the lacl repressor.
  • Cells subsequently are incubated further for 3 to 4 hours. Cells then are harvested by centrifugation.
  • Ni-NTA nickel-nitrilo-tri-acetic acid
  • the column is first washed with 10 volumes of 6 M guanidine-HCl, pH 8, then washed with 10 volumes of 6 M guanidine-HCl pH 6, and finally the KDI is eluted with 6 M guanidine-HCl, pH 5.
  • the purified protein is then renatured by dialyzing it against phosphate-buffered saline (PBS) or 50 mM Na-acetate, pH 6 buffer plus 200 mM NaCI.
  • PBS phosphate-buffered saline
  • the protein can be successfully refolded while immobilized on the Ni-NTA column.
  • the recommended conditions are as follows: renature using a linear 6M-1M urea gradient in 500 mM NaCI, 20% glycerol, 20 mM Tris/HCl pH 7.4, containing protease inhibitors.
  • the renaturation should be performed over a period of 1.5 hours or more.
  • the proteins can be eluted by the addition of 250 mM immidazole. Immidazole is removed by a final dialyzing step against PBS or 50 mM sodium acetate pH 6 buffer plus 200 mM NaCI.
  • the purified protein is stored at 4° C or frozen at -80° C.
  • the cell culture Upon completion of the production phase of the E. coli fermentation, the cell culture is cooled to 4-10°C and the cells are harvested by continuous centrifugation at 15,000 rpm
  • cell paste On the basis of the expected yield of protein per unit weight of cell paste and the amount of purified protein required, an appropriate amount of cell paste, by weight, is suspended in a buffer solution containing 100 mM Tris, 50 mM EDTA, pH 7.4. The cells are dispersed to a homogeneous suspension using a high shear mixer.
  • the cells ware then lysed by passing the solution through a microfluidizer
  • the resulting washed inclusion bodies are solubilized with 1.5 M guanidine hydrochloride (GuHCl) for 2-4 hours. After 7000 x g centrifugation for 15 min., the pellet is discarded and the KDI polypeptide-containing supernatant is incubated at 4°C overnight to allow further GuHCl extraction.
  • guanidine hydrochloride (GuHCl)
  • the GuHCl solubilized protein is refolded by quickly mixing the GuHCl extract with 20 volumes of buffer containing 50 mM sodium, pH 4.5, 150 mM NaCI, 2 mM EDTA by vigorous stirring.
  • the refolded diluted protein solution is kept at 4°C without mixing for 12 hours prior to further purification steps.
  • a previously prepared tangential filtration unit equipped with 0.16 ⁇ m membrane filter with appropriate surface area e.g., 0.16 ⁇ m membrane filter with appropriate surface area
  • the diluted sample is then loaded onto a previously prepared set of tandem columns of strong anion (Poros HQ-50, Perseptive Biosystems) and weak anion (Poros CM-20, Perseptive Biosystems) exchange resins.
  • the columns are equilibrated with 40 mM sodium acetate, pH
  • the resultant KDI polypeptide exhibits greater than 95% purity after the above refolding and purification steps. No major contaminant bands are observed from Commassie blue stained
  • the cell culture Upon completion of the production phase of the E. coli fermentation, the cell culture is cooled to 4-10°C and the cells are harvested by continuous centrifugation at 15,000 m
  • cell paste On the basis of the expected yield of protein per unit weight of cell paste and the amount of purified protein required, an appropriate amount of cell paste, by weight, is suspended in a buffer solution containing 100 mM Tris, 50 mM EDTA, pH 7.4. The cells are dispersed to a homogeneous suspension using a high shear mixer.
  • the cells ware then lysed by passing the solution through a microfluidizer
  • GuHCl solubilized protein is refolded by quickly mixing the GuHCl extract with 20 volumes of
  • the refolded diluted protein solution is kept at 4°C without mixing for 12 hours prior to further purification steps.
  • a previously prepared tangential filtration unit equipped with 0.16 ⁇ m membrane filter with appropriate surface area e.g., Filtron
  • 40 mM sodium acetate, pH 6.0 is employed.
  • the filtered sample is loaded onto a cation exchange resin (e.g., Poros HS-50, Perseptive Biosystems).
  • the column is washed with 40 mM sodium acetate, pH 6.0 and eluted with 250 mM, 500 mM, 1000 mM, and 1500 mM NaCI in the same buffer, in a stepwise manner.
  • the absorbance at 280 mm of the effluent is continuously monitored. Fractions are collected and further analyzed by SDS- PAGE.
  • Fractions containing the KDI polypeptide are then pooled and mixed with 4 volumes of water.
  • the diluted sample is then loaded onto a previously prepared set of tandem columns of strong anion (Poros HQ-50, Perseptive Biosystems) and weak anion (Poros CM-20, Perseptive Biosystems) exchange resins.
  • the columns are equilibrated with 40 mM sodium acetate, pH 6.0. Both columns are washed with 40 mM sodium acetate, pH 6.0, 200 mM NaCI.
  • coli based constucts are as follows: ( 1) pQE9:KDI.S27-K207 (expresses amino acids 27-207 of SEQ ID NO:2); (2) pHE4:KDI.S27-K207 (expresses amino acids 27-207 of SEQ ID NO:2); (3) pHE4:KDI.A23-K207 (expresses amino acids 23-207 of SEQ ID NO:2); (4) pHE4.KDI.G24-K207 (expresses amino acids 24-207 of SEQ ID NO:2); and (5) pHE4.KDI.C30-K207 (expresses amino acids 30-207 of SEQ ID NO:2).
  • Example 2 Cloning and Expression of KDI protein in a Baculovirus Expression System
  • the plasmid shuttle vector pA2 GP is used to insert the cloned DNA encoding KDI, into a baculovirus to express the KDI protein, using a baculovirus leader and standard methods as described in Summers et al., A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas Agricultural Experimental Station Bulletin No. 1555 ( 1987).
  • This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by the secretory signal peptide (leader) of the baculovirus gp67 protein and convenient restriction sites such as BamHI, Xba I and Asp718.
  • the polyadenylation site of the simian virus 40 ("SV40") is used for efficient polyadenylation.
  • the plasmid contains the beta-galactosidase gene from E. coli under control of a weak Drosophila promoter in the same orientation, followed by the polyadenylation signal of the polyhedrin gene.
  • the inserted genes are flanked on both sides by viral sequences for cell-mediated homologous recombination with wild-type viral DNA to generate viable virus that expresses the cloned polynucleotide.
  • baculovirus vectors could be used in place of the vector above, such as pAc373, pVL941 and pAcIMl, as one skilled in the art would readily appreciate, as long as the construct provides appropriately located signals for transcription, translation, secretion and the like, including a signal peptide and an in-frame AUG as required.
  • Such vectors are described, for instance, in Luckow et al., Virology 170:31-39 (19989).
  • the 5' primer has the sequence 5'
  • the 3' primer has the sequence 5' GGCCGCGGTACCTTATTTCCTCCTGAATAGAGC 3' (SEQ ID NO: 19) containing the underlined Asp718 restriction site.
  • the amplified fragment is isolated from a 1 % agarose gel using a commercially available kit ("Geneclean,” BIO 101 Inc., La Jolla, Ca.). The fragment then is digested with BamHI and Asp718 and again is purified on a 1% agarose gel.
  • the plasmid is digested with the restriction enzymes BamHI and Asp718 and optionally, can be dephosphorylated using calf intestinal phosphatase, using routine procedures known in the art.
  • the DNA is then isolated from a 1 % agarose gel using a commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.).
  • E. coli HB101 or other suitable E. coli hosts such as XL-1 Blue (Statagene Cloning Systems,
  • Bacteria are identified that contain the plasmid with the human KDI gene by digesting DNA from individual colonies using BamHI and Asp718 and then analyzing the digestion product by gel electrophoresis. The sequence of the cloned fragment is confirmed by DNA sequencing.
  • This plasmid is designated herein pA2GPKDI. j 0 Five ⁇ g of the plasmid pA2GPKDI is co-transfected with 1.0 ⁇ g of a commercially available linearized baculovirus DNA ("BaculoGoldTM baculovirus DNA", Pharmingen, San Diego, CA), using the lipofection method described by Feigner et al., Proc. Nati Acad. Sci.
  • plaque assay of this type can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-10). After appropriate incubation, blue stained plaques are picked with the tip of a micropipettor (e.g., Eppendorf). The agar containing the recombinant viruses is then resuspended in a microcentrifuge tube containing 200 ⁇ l of Grace's
  • V-KDI The recombinant virus
  • Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS.
  • the cells are infected with the recombinant
  • MOI multiplicity of infection
  • the medium is removed and is replaced with SF900 II medium minus methionine and cysteine (available from Life Technologies Inc., Rockville, MD).
  • 5 ⁇ Ci of 35 S-methionine and 5 ⁇ Ci 35 S-cysteine (available from Amersham) are added.
  • the cells are further incubated for 16 hours and then are harvested by centrifugation.
  • the proteins in the supernatant as well as the intracellular proteins are analyzed by SDS-PAGE followed by autoradiography (if radiolabeled).
  • Microsequencing of the amino acid sequence of the amino terminus of purified protein may be used to determine the amino terminal sequence of the of the KDI protein.
  • baculovirus expression constructs were constructed as follows: (1) pA2:KDI (which expresses residues 1-207 of SEQ ID NO:2); (2) pA2.KDI.M7-K207 (which expresses residues 7-207 of SEQ ID NO:2); (3) pA2gp.KDI.L28-K207 (which expresses residues 28-
  • a typical mammalian expression vector contains the promoter element, which mediates the initiation of transcription of mRNA, the protein coding sequence, and signals required for the termination of transcription and polyadenylation of the transcript. Additional elements include enhancers, Kozak sequences and intervening sequences flanked by donor and acceptor sites for RNA splicing. Highly efficient transcription can be achieved with the early and late promoters from SV40, the long terminal repeats (LTRs) from Retroviruses, e.g., RSV, HTLVI, HrVI and the early promoter of the cytomegalovirus (CMV). However, cellular elements can also be used (e.g., the human actin promoter).
  • Suitable expression vectors for use in practicing the present invention include, for example, vectors such as pSVL and pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and pBC12MI (ATCC 67109).
  • Mammalian host cells that could be used include, human Hela, 293, H9 and Jurkat cells, mouse NIH3T3 and C127 cells, Cos 1, Cos 7 and CV1, quail QC1-3 cells, mouse L cells and Chinese hamster ovary (CHO) cells.
  • the gene can be expressed in stable cell lines that contain the gene integrated into a chromosome.
  • a selectable marker such as dhfr, gpt, neomycin, hygromycin allows the identification and isolation of the transfected cells.
  • the transfected gene can also be amplified to express large amounts of the encoded protein.
  • the DHFR (dihydrofolate reductase) marker is useful to develop cell lines that carry several hundred or even several thousand copies of the gene of interest.
  • Another useful selection marker is the enzyme glutamine synthase (GS) (Mu ⁇ hy et al., Biochem J.
  • the expression vectors pCl and pC4 contain the strong promoter (LTR) of the Rous Sarcoma Virus (Cullen et al, Molecular and Cellular Biology, 438-447 (March, 1985)) plus a fragment of the CM V-enhancer ( ⁇ s/i ⁇ rt et ⁇ /., Cell 47:521-530 (1985)). Multiple cloning sites, e.g., with the restriction enzyme cleavage sites BamHI, Xbal and Asp718, facilitate the cloning of the gene of interest.
  • the vectors contain in addition the 3' intron, the polyadenylation and termination signal of the rat preproinsulin gene.
  • Plasmid pC4-Sig is used for the expression of KDI polypeptide.
  • Plasmid pC4-Sig is a derivative of the plasmid pSV2-dhfr (ATCC Accession No. 37146). It contains coding region for the secretory leader sequence from chemokine beta-8 (see US95/09508) upstream from the multiple cloning site and is designed to be inframe with inserted heterologous DNA.
  • the plasmid contains the mouse DHFR gene under control of the SV40 early promoter.
  • Chinese hamster ovary- or other cells lacking dihydrofolate activity that are transfected with these plasmids can be selected by growing the cells in a selective medium (alpha minus MEM, Life Technologies) supplemented with the chemotherapeutic agent methotrexate.
  • a selective medium alpha minus MEM, Life Technologies
  • methotrexate MTX
  • cell lines which contain the amplified gene integrated into one or more chromosome(s) of the host cell.
  • Plasmid pC4 contains for expressing the gene of interest the strong promoter of the long terminal repeat (LTR) of the Rouse Sarcoma Virus (Cullen, et al., Molecular and Cellular Biology, March 1985:438-447) plus a fragment isolated from the enhancer of the immediate early gene of human cytomegalovirus (CMV) (Boshart et al., Cell 47:521-530 (1985)). Downstream of the promoter are the following single restriction enzyme cleavage sites that allow the integration of the genes: BamHI, Xba I, and Asp718. Behind these cloning sites the plasmid contains the 3' intron and polyadenylation site of the rat preproinsulin gene.
  • LTR long terminal repeat
  • CMV cytomegalovirus
  • promoters can also be used for the expression, e.g., the human ⁇ -actin promoter, the SV40 early or late promoters or the long terminal repeats from other retroviruses, e.g., HIV and HTLVI.
  • Clontech' s Tet-Off and Tet-On gene expression systems and similar systems can be used to express the KDI polypeptide in a regulated way in mammalian cells (Gossen, M., & Bujard, H. 1992, Proc. Nati. Acad. Sci. USA 89:5547-5551).
  • other signals e.g., from the human growth hormone or globin
  • Stable cell lines carrying a gene of interest integrated into the chromosomes can also be selected upon co-transfection with a selectable marker such as gpt, G418 or hygromycin. It is advantageous to use more than one selectable marker in the beginning, e.g., G418 plus methotrexate.
  • the plasmid pC4 is digested with the restriction enzymes BamHI and Asp718 and then l 0 dephosphorylated using calf intestinal phosphates by procedures known in the art.
  • the vector is then isolated from a 1% agarose gel.
  • the DNA sequence encoding the KDI polypeptide is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the desired portion of the gene.
  • the 5' primer containing the underlined BamHI site, a Kozak sequence, and an AUG j 5 start codon, has the following sequence:
  • the 3' primer, containing the underlined Asp718 restriction site has the following sequence: 5' GGCCGCGGTACCTTATTTCCTCCTGAATAGAGC 3' (SEQ ID NO: 19).
  • the amplified fragment is digested with the endonucleases BamHI and Asp718 and then
  • E. coli HB101 or XL-1 Blue cells are then transformed and bacteria are identified that contain the fragment inserted into plasmid pC4 using, for instance, restriction enzyme analysis.
  • the expression plasmid pC4 is cotransfected with 0.5 ⁇ g of the plasmid pSVneo using lipofectin (Feigner et al., supra).
  • the plasmid pSV2-neo contains a dominant selectable marker, the neo gene from Tn5 encoding an enzyme that confers resistance to a group of antibiotics including G418.
  • the cells are seeded in alpha minus MEM supplemented with 1 mg/ml G418. After 2 days, the cells are trypsinized and seeded in hybridoma cloning plates
  • 35 methotrexate (1 ⁇ M, 2 ⁇ M, 5 ⁇ M, 10 mM, 20 mM). The same procedure is repeated until clones are obtained which grow at a concentration of 100 - 200 ⁇ M. Expression of the desired gene product is analyzed, for instance, by SDS-PAGE and Western blot or by reversed phase HPLC analysis.
  • pC4:KDI which expresses residues 1-207 of SEQ ID NO:2
  • pC4sp:KDI.C30-K207 which expresses a heterologous signal peptide (the chemokine beta-8 (MPIF-1) signal peptide) followed by amino acid residues 30-207 of KDI
  • pC4sp:KDI.L28-K207 which expresses a heterologous signal peptide (the chemokine beta-8 (MPIF-1) signal peptide) followed by amino acid residues 28-207 of KDI.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Zoology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Pulmonology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US1999/016424 1998-07-21 1999-07-21 Keratinocyte derived interferon Ceased WO2000005371A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
EP99935752A EP1100902A4 (en) 1998-07-21 1999-07-21 INTERFERON OF KERATINOCYTES
CA002335655A CA2335655A1 (en) 1998-07-21 1999-07-21 Keratinocyte derived interferon
JP2000561317A JP2002522021A (ja) 1998-07-21 1999-07-21 ケラチノサイト由来のインターフェロン
AU51161/99A AU765890B2 (en) 1998-07-21 1999-07-21 Keratinocyte derived interferon
NZ509402A NZ509402A (en) 1998-07-21 1999-07-21 Keratinocyte derived interferon
US09/487,792 US6433145B1 (en) 1998-07-21 2000-01-20 Keratinocyte derived interferon
PCT/US2000/001239 WO2001007608A1 (en) 1999-07-21 2000-01-20 Keratinocyte derived interferon
AU25099/00A AU2509900A (en) 1999-07-21 2000-01-20 Keratinocyte derived interferon
US09/908,594 US6472512B1 (en) 1998-07-21 2001-07-20 Keratinocyte derived interferon
US10/197,816 US7390637B2 (en) 1998-07-21 2002-09-12 Keratinocyte derived interferon

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US9364398P 1998-07-21 1998-07-21
US60/093,643 1998-07-21

Related Child Applications (4)

Application Number Title Priority Date Filing Date
US35858799A Continuation-In-Part 1998-07-21 1999-07-21
US09/487,792 Continuation-In-Part US6433145B1 (en) 1998-07-21 2000-01-20 Keratinocyte derived interferon
US35858701A Continuation-In-Part 1998-07-21 2001-05-24
US09/908,594 Continuation-In-Part US6472512B1 (en) 1998-07-21 2001-07-20 Keratinocyte derived interferon

Publications (1)

Publication Number Publication Date
WO2000005371A1 true WO2000005371A1 (en) 2000-02-03

Family

ID=22240013

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/016424 Ceased WO2000005371A1 (en) 1998-07-21 1999-07-21 Keratinocyte derived interferon

Country Status (8)

Country Link
EP (1) EP1100902A4 (https=)
JP (1) JP2002522021A (https=)
KR (1) KR100688051B1 (https=)
CN (1) CN1319137A (https=)
AU (1) AU765890B2 (https=)
CA (1) CA2335655A1 (https=)
NZ (1) NZ509402A (https=)
WO (1) WO2000005371A1 (https=)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001042474A3 (en) * 1999-12-08 2002-02-28 Amgen Inc Interferon-like molecules and uses thereof
WO2001061009A3 (en) * 2000-02-15 2002-05-02 Curagen Corp Polypeptides and nucleic acids encoding same
EP1605045A3 (en) * 2000-02-15 2006-03-01 Curagen Corporation Polypeptides and nucleic acids encoding same

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100975013B1 (ko) * 2008-02-29 2010-08-09 김성일 원터치로 개폐되는 키홀더
KR200457865Y1 (ko) * 2009-09-11 2012-01-05 한국알프스 주식회사 자동차용 키
CN108752457B (zh) * 2018-05-23 2019-06-21 华中农业大学 一种来源于草鱼干扰素的衍生多肽及其应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5710027A (en) * 1993-05-26 1998-01-20 Boehringer Ingelheim International Gmbh Process and vector for expressing alpha-interferon in E. coli

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5710027A (en) * 1993-05-26 1998-01-20 Boehringer Ingelheim International Gmbh Process and vector for expressing alpha-interferon in E. coli

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE DBEST 30 September 1998 (1998-09-30), MARRA M. ET AL: "The WashU-HHMI Mouse EST Project, database record, Especially the subsequences AGTGGAAATAAGAAGATGTTT and AGAATCACCCACCTTCAAGCAAGAA." *
See also references of EP1100902A4 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001042474A3 (en) * 1999-12-08 2002-02-28 Amgen Inc Interferon-like molecules and uses thereof
US7811791B2 (en) 1999-12-08 2010-10-12 Amgen Inc. Interferon-like molecules and uses thereof
US8148109B2 (en) 1999-12-08 2012-04-03 Amgen Inc. Interferon-like proteins and uses thereof
WO2001061009A3 (en) * 2000-02-15 2002-05-02 Curagen Corp Polypeptides and nucleic acids encoding same
EP1605045A3 (en) * 2000-02-15 2006-03-01 Curagen Corporation Polypeptides and nucleic acids encoding same

Also Published As

Publication number Publication date
AU5116199A (en) 2000-02-14
EP1100902A4 (en) 2004-09-29
NZ509402A (en) 2003-08-29
AU765890B2 (en) 2003-10-02
JP2002522021A (ja) 2002-07-23
CA2335655A1 (en) 2000-02-03
KR100688051B1 (ko) 2007-02-28
EP1100902A1 (en) 2001-05-23
KR20010083132A (ko) 2001-08-31
CN1319137A (zh) 2001-10-24

Similar Documents

Publication Publication Date Title
EP1015488B1 (en) Interleukin-17 receptor-like protein
CA2296762A1 (en) Interleukin-20
US20030203452A1 (en) Human chemokine beta-13
US20080317756A1 (en) Antibodies to Chemokine Alpha-5
US6843988B2 (en) Synferon
CA2295326A1 (en) Cardiotrophin-like cytokine
AU765890B2 (en) Keratinocyte derived interferon
WO1998011138A1 (en) Chemokine alpha-4
WO1998038311A1 (en) T1/st2-receptor ligand iii
US6979443B2 (en) Chemokine α-6
AU2003271323A1 (en) Keratinocyte derived interferon
MXPA01000692A (en) Keratinocyte derived interferon
US20020132304A1 (en) Human parotid secretory protein
EP1712631A2 (en) Fc receptors and polypeptides

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 99811157.0

Country of ref document: CN

AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 509402

Country of ref document: NZ

Ref document number: 51161/99

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2000 561317

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2335655

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: PA/a/2001/000692

Country of ref document: MX

Ref document number: 1020017000891

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 1999935752

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1999935752

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1020017000891

Country of ref document: KR

WWG Wipo information: grant in national office

Ref document number: 51161/99

Country of ref document: AU

WWG Wipo information: grant in national office

Ref document number: 1020017000891

Country of ref document: KR