WO1999055874A2 - Acides nucleiques du gene de l'antigene m d'histoplasma capsulatum, antigenes, vaccins, anticorps, procedes et trousses servant a detecter l'histoplasmose - Google Patents

Acides nucleiques du gene de l'antigene m d'histoplasma capsulatum, antigenes, vaccins, anticorps, procedes et trousses servant a detecter l'histoplasmose Download PDF

Info

Publication number
WO1999055874A2
WO1999055874A2 PCT/US1999/009151 US9909151W WO9955874A2 WO 1999055874 A2 WO1999055874 A2 WO 1999055874A2 US 9909151 W US9909151 W US 9909151W WO 9955874 A2 WO9955874 A2 WO 9955874A2
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
nucleotide sequence
seq
set forth
antigen
Prior art date
Application number
PCT/US1999/009151
Other languages
English (en)
Other versions
WO1999055874A3 (fr
Inventor
Rosely M. Zancope-Oliveira
Timothy J. Lott
Leonard W. Mayer
Errol Reiss
George S. Deepe, Jr.
Original Assignee
The Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services filed Critical The Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services
Priority to CA002327456A priority Critical patent/CA2327456A1/fr
Priority to US09/674,195 priority patent/US7018827B1/en
Priority to AU37668/99A priority patent/AU3766899A/en
Publication of WO1999055874A2 publication Critical patent/WO1999055874A2/fr
Publication of WO1999055874A3 publication Critical patent/WO1999055874A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies

Definitions

  • the present invention relates to reagents and methods for the detection of histoplasmosis.
  • the present invention relates to nucleic 0 acids (DNAs) relating to the M antigen gene of
  • Histoplasma capsula tum to vectors and host expression systems containing these nucleic acids; to nucleic acids (RNAs) which encode the M antigen of H. capsulatum; to isolated and recombinantly-produced antigens encoded by 5 these nucleic acids; to antibodies produced against these antigens; to methods and kits for detecting histoplasmosis using these nucleic acids, antigens and antibodies; and to vaccines for the treatment or prevention of histoplasmosis.
  • RNAs nucleic acids
  • antigens encoded by 5 these nucleic acids
  • antibodies produced against these antigens to methods and kits for detecting histoplasmosis using these nucleic acids, antigens and antibodies
  • vaccines for the treatment or prevention of histoplasmosis.
  • Histoplasmosis is a systemic fungal disease resulting from the inhalation or, less frequently, the ingestion of spores of the fungus Histoplasma capsula tum, variety capsulatum, which is worldwide in distribution. 5
  • the infection often causes acute pneumonia, or disseminated reticuloendothelial hyperplasia, or an influenza-like illness with joint effusion and erythema nodosum.
  • Reactivated infection involves the lungs, meninges, heart, peritoneum and adrenals.
  • Clinically 0 inapparent or mild disease can result from limited, primary site infection of H.
  • H. capsula tum in the lungs, but an often life-threatening, disseminated form of histoplasmosis can occur in immunodeficient patients, particularly the elderly, and those who have acquired 5 immunodeficiency syndrome (AIDS) . It is important to properly identify H. capsula tum from other fungal species in order to determine the proper treatment for a fungal infection.
  • AIDS immunodeficiency syndrome
  • H. capsulatum is a dangerous, dimorphic, pathogenic fungus which, under different environmental conditions, may exist as either the yeast or mold phase.
  • the organism exists as a multicellular mycelium at room temperature in rich soils, and in organic matter, in temperate environments worldwide, and proliferates as a unicellular yeast form at 37°C, and in infected host tissues. Only the yeast phase is known to survive within tissues, or within macrophages .
  • the unicellular yeast form reproduces by budding on specialized media at 37°C.
  • the mold form produces multicellular filamentous colonies that consist of cylindrical tubular structures called hyphae, and may contain microconidia and macroconidia which primarily grow under appropriate soil conditions, or on specialized fungal media, at 25°C.
  • H. capsulatum occurs throughout the world, particularly in Brazil, Africa, India, Southeast Asia and the United States, but is most commonly found in soil from the fertile river valleys (Mississippi and Missouri river valleys) of the central United States
  • H. capsula tum is associated with bird (particularly black bird and seagull) and bat excrement.
  • bird particularly black bird and seagull
  • bat excrement See, for example, Loyd et al . , Histoplasma capsulatum. In Principles and Practice of Infectious Disease (3rd ed., Coordinating ed. , Mandell et al . , New York, (1990)); Wheat, "Diagnosis and Management of Histoplasmosis, " Eur . J. Clin . Microbiol . Infect . Dis . 8:480 (1989).)
  • the fungus infects the soil, and the resulting infected soil is often used as a habitat by birds and/or bats.
  • H. capsulatum var. capsulatum two variants of Histoplasma exist: H. capsulatum var. duboisii (African histoplasmosis) and H. capsulatum var. farciminosum (epizootic lymphangitis of horses and mules) .
  • H. capsulatum var. duboisii African histoplasmosis
  • H. capsulatum var. farciminosum epizootic lymphangitis of horses and mules.
  • Many strains of H. capsulatum are currently deposited with the American Type Culture Collection
  • H. capsulatum strain CDC6623 deposited under accession number ATCC 26320, is discussed in Pine et al . , "Procedures for the Production and Separation of H and M Antigens in Histoplasmin, and Chemical and Serological Properties of the Isolated Products, " Mycopathlogia 61:131-141 (1977) .
  • the following other strains or variants of H. capsula tum are also deposited with the ATCC: H. capsulatum (attenuated Downs strain, filamentous phase, accession number ATCC 38904) ,
  • H. capsulatum (attenuated Downs strain, yeast phase, accession number ATCC 38904) , H. capsulatum (filamentous phase, accession number ATCC 11407) , H. capsulatum (yeast phase, accession number ATCC 11407) , H capsulatum variant duboisii (filamentous phase, accession number ATCC
  • H. capsula tum variant duboisii (yeast phase, accession number ATCC 32281) , H. capsulatum variant farciminosum (filamentous phase, accession number ATCC 58332) and H. capsulatum variant farciminasum (yeast phase, accession number ATCC 58332) .
  • the M antigen of H. capsulatum is a pluripotent glycoprotein having a molecular mass of 94 kDa, an isoelectric point of 4.7, oligosaccharide side chains, glycosidic epitopes which are N- linked to the peptide core, and protein epitopes, which have been shown to be unique to the H. capsula tum fungus.
  • the peptide epitopes react with human antibodies, are not affected by N- deglycosylation, and trigger the proliferation of T cells.
  • the M antigen is an immunodominant antigen of H. capsulatum, and elicits both humoral and cell-mediated immune responses. The glycopeptide bonds present in the glycoprotein are N linked.
  • capsulatum is considered to be the immunodominant antigen of H. capsulatum because antibodies generated against the M antigen are first to arise in infection, and are more commonly present during all phases of histoplasmosis. Because the presence of this M antigen is indicative of histoplasmosis infection, the M antigen can serve as a marker for histoplasmosis infection. However, the biological identity of the M antigen has remained unknown. One report demonstrated that M protein was a catalase, based upon its ability to react with anti- catalase antibodies.
  • H. capsulatum infection Currently, histoplasmosis is diagnosed by culture, or by the demonstration of a rise in complement-fixing antibody titers in serum.
  • a definitive diagnosis of an H. capsulatum infection currently requires the isolation and propagation of the fungus, which is time-consuming and lacking in sensitivity, and which is dangerous for laboratory personnel, who must take extreme caution to prevent inhalation of the pathogenic fungus, so as not to become ill with a pulmonary infection. Further, only small quantities of antigens of H. capsulatum for use as biological reagents may be prepared in this manner.
  • H. capsula tum Conventional laboratory identification methods used to isolate and identify H. capsula tum include the culture of a clinical specimen at room temperature on specialized fungal media. This procedure isolates the slower growing H. capsulatum colonies from possible contaminants, such as bacteria, and from faster growing saprobic fungi. This method, however, has several disadvantages. Because the growth of H. capsula tum to a visible colony normally takes from about two to four weeks, and sometimes as long as 12 weeks, this procedure is very slow. (See, for example, Rippon, Histoplasmosis . In Medical Mycolocrv, The Pathogenic Fungi and the Pathogenic Actinomyestes , supra.; Koneman at al .
  • Sepedonium sp. produce similar colony and sporulation characteristics. Thus, additional testing is usually necessary to definitively identify the organism.
  • One method of converting the mycelial colony of H. capsulatum to the yeast phase is performed by subculturing the organism onto highly enriched cysteine- containing media, and incubating it at 35°-37°C.
  • conversion to the yeast phase is often difficult, and may require several additional subcultures at three-day intervals.
  • Serologic evidence is the prime diagnostic indicator of histoplasmosis . Such evidence may be obtained with several serologic tests, such as the immunodiffusion test, which detects precipitants against the species- specific H and M antigens found in histoplasmin. (See, for example, Kaufman, "Laboratory Methods for the Diagnosis and Confirmation of Systemic Mycoses, " Clin . Infect . Dis . 14:23-29 (1992), and Wheat, "Diagnosis and Management of Histoplasmosis,” supra.) Histoplasmin, an unpurified culture supernatant obtained from the mycelial phase of H. capsulatum grown in a chemically-defined medium containing H.
  • capsulatum M antigens is currently used to probe both humoral and cell-mediated responses in patients with histoplasmosis. It is used for the serologic diagnosis of histoplasmosis, and as a skin test antigen to demonstrate delayed hypersensitivity to infection in skin tests for histoplasmosis.
  • the purification of histoplasmin is described by Bradley et al , "Purification, Composition, and Serological Characterization of Histoplasmin-H and M Antigens," Infect . Immun . 9:870-880 (1974).
  • the preparation of H and M antigens of H. capsula tum free of heterologous antigens is described by Green et al . , "Preparation of h and m Antigens of Histoplasma capsula tum Free of Heterologous Antigens," Curr. Microbiol . 12:209-216 (1985). (See also, Pine,
  • M antigen of H. capsula tum is useful in immunoassays for the diagnosis of histoplasmosis, purification of the M antigen from a batch culture is a laborious and low-yield process.
  • the use of a recombinantly-produced M antigen of H. capsulatum in such immunoassays would significantly diminish the labor necessary to obtain M antigens which are pure enough to be useful in the immunoassays, and would result in high yields of the M antigen.
  • Such biological reagents and methods would allow a clinician to improve the speed and accuracy of processing large numbers of clinical samples.
  • Such reagents and methods would also aid the clinician in patient management, eliminate unnecessary tests, improve the speed, ease and accuracy of diagnosis and prognosis, help control histoplasmosis infection and reduce the use of unnecessary medications.
  • the present invention provides the DNA nucleotide sequence of the M antigen gene of H. capsula tum, and of related nucleotide sequences, which can be used to safely and rapidly produce, by recombinant DNA techniques, large quantities of the M antigen of H. capsula tum when inserted into a vector and placed into a suitable host for protein expression.
  • the recombinantly- produced M antigens may be quickly and safely produced in large quantities in a pure, undegraded form.
  • the present invention also provides the RNA nucleotide sequence which encodes the M antigen of H. capsulatum, and related nucleotide sequences. Nucleic acids, and fragments thereof, within the invention can also be used as nucleic acid probes in hybridization assays, or as primers in polymerase chain reaction assays, to detect H. capsulatum in clinical samples.
  • the present invention also provides the deduced amino acid sequence of the H. capsula tum M antigen.
  • Isolated and recombinant M antigens encoded by nucleic acids within the present invention can be used as biological reagents in a wide variety of tests for histoplasmosis, such as skin tests, and immunoassays to detect a previous or current H. capsulatum infection in a tissue or fluid sample obtained from a human being or animal suspected of having, or having had, histoplasmosis.
  • these antigens can be used as skin test antigens to ascertain the cell-mediated immune status of persons who have been exposed to H. capsulatum .
  • the nucleic acids and antigens of the invention can also be used in a vaccine for the prevention or treatment of histoplasmosis.
  • the present invention also provides antibodies generated against the above antigens, which can be used in a wide variety of immunoassays to detect a current infection by H. capsulatum.
  • the present invention further provides methods for the detection of histoplasmosis, and related kits, using nucleic acids, antigens or antibodies within the invention.
  • the nucleic acids, vectors, hosts, isolated and recombinantly-produced antigens, antibodies, methods of detection and kits of the present invention permit the safe, direct, rapid, efficient, and accurate detection of a previous or current infection by H. capsula tum in a patient, and a positive diagnosis of histoplasmosis.
  • Zancope-Oliveira et al . " Immunochemical Analysis of the H and M Glycoproteins from Histoplasma Capsulatum, " Clin . Diagn . Lab . Immunol . Vol. 1, No. 5, 563-568 (1994), describes the use of different physicochemical methods to characterize the M and H antigens obtained from histoplasmin. Zancope-Oliveira et al .
  • Zancope-Oliveira et al . "Effects of Histoplasmin M. Antigen Chemical and Enzymatic Deglycosylation on Cross- Reactivity in the Enzyme-Linked Immunoelectrotransfer Blot Method, " Clinical and Diagnostic Laboratory Immunology 1 , No. 4, 390-393 (1994), describes an evaluation of the enzyme-linked immunoelectrotransfer blot (EITB) method as a suitable method for detecting antibodies present in sera from patients with histoplasmosis against M antigen, and the effect of chemical and enzymatic deglysolyation of M antigen as a means of increasing diagnostic specificity.
  • EITB enzyme-linked immunoelectrotransfer blot
  • Keath "Molecular Cloning and Sequence Analysis of yps-3, a Yeast-Phase-Specific Gene in the Dimorphic Fungal Pathogen Histoplasma capsulatum, " Microbiology 140, 759-767 (1994) , describes the cloning of the H. capsulatum yeast-phase-specific (yps-3) gene to clarify the mechanisms underlying pathogenesis and morphogenesis in the fungus H. capsula tum .
  • the nucleotide sequence of the yps-3 gene, and the predicted amino acid sequence of its product, are provided.
  • capsula tum and no other fungi which have the nucleotide sequence 5 CGAAGTCGAGGCTTTCAGCATG3 , or the nucleotide sequence complementary thereto.
  • a probe having the above nucleotide sequence is stated to hybridize to the 18S rRNA of H. capsulatum corresponding to bases 172-193 of Sacchromyces cerevisiae .
  • This patent also describes the use of helper probes having the sequence 5 TATTAGCTCTAGAATTACCACGGGTATCCAAGTAGTAAGG3 , or the sequence
  • the present invention provides the nucleotide sequence of the M antigen gene (DNA) of the Histoplasma capsulatum species of fungus, which is set forth in the Sequence Listing as SEQ ID NO : 1.
  • the present invention also provides a nucleic acid specific to Histoplasma capsulatum comprising a nucleic acid having a nucleotide sequence as set forth in the
  • the isolated nucleic acid is not a nucleic acid consisting essentially of between 10 and 100 nucleotides which is able to form a hybrid at 60 °C with a nucleotide polymer having a nucleotide base sequence of
  • the present invention further provides the amino acid sequence of the isolated or recombinantly-produced M antigen of the Histoplasma capsulatum species of fungus, which is set forth in the Sequence Listing as SEQ ID NO:2.
  • the antigen is encoded by a nucleic acid (RNA) having a nucleotide sequence which is complementary to the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:l.
  • the present invention also provides an isolated or recombinantly-produced antigen specific to Histoplasma capsulatum comprising a polypeptide encoded by a nucleic acid having a nucleotide sequence which is complementary to the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:l, a fragment of a polypeptide encoded by a nucleic acid having a nucleotide sequence which is complementary to the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:l, a polypeptide encoded by a nucleic acid which is substantially the same as a nucleic acid having a nucleotide sequence which is complementary to the nucleotide sequence set forth in the Sequence Listing as SEQ ID N0:1, or a fragment of a polypeptide encoded by a nucleic acid which is substantially the same as a nucleic acid having a nucleotide sequence which is complementary to the nucleotide sequence set forth in the Sequence Listing as SEQ
  • the invention further provides monoclonal or polyclonal antibodies generated against one of the isolated or recombinantly-produced antigens described above .
  • the present invention also provides a vector comprising a nucleic acid specific to Histoplasma capsulatum, wherein the nucleic acid has a nucleotide sequence as set forth in the Sequence Listing as SEQ ID N0:1, has a nucleotide sequence which is substantially the same as a nucleic acid having a nucleotide sequence as set forth in the Sequence Listing as SEQ ID N0:1, is a fragment of a nucleic acid having a nucleotide sequence as set forth in the Sequence Listing as SEQ ID N0:1, or is a fragment of a nucleic acid which is substantially the same as a nucleic acid having a nucleotide sequence as set forth in the Sequence Listing as SEQ ID N0:1, and wherein the vector is suitable for expressing the nucleic acid.
  • the present invention still further provides a host for expressing an antigen which is specific to Histoplasma capsulatum comprising a vector containing a nucleic acid, wherein the vector is suitable for expressing the nucleic acid, and wherein the nucleic acid is as described above for the vector of the present invention.
  • the present invention also provides a vaccine for the treatment or prevention of histoplasmosis comprising:
  • the present invention further provides a method for detecting a previous or current Histoplasma capsulatum infection in a subject, comprising: (a) contacting a fluid or tissue sample from the subject which contains antibodies with an isolated or recombinantly-produced antigen which is specific to Histoplasma capsulatum; and
  • the present invention further provides a method for detecting a past exposure to the fungus Histoplasma capsula tum comprising: (a) injecting intradermally in the skin of a subject a liquid containing an isolated or recombinantly-produced antigen which is specific to Histoplasma capsulatum; and (b) observing the skin of the subject at the injection site at one or more predetermined times after injection for the presence of swelling of the skin, the presence of swelling of the skin indicating a past exposure by the subject to the fungus Histoplasma capsulatum, wherein the antigen is one of the antigens described above.
  • the present invention still further provides a kit for detecting a previous or current Histoplasma capsulatum infection in a sample comprising: (a) a nucleic acid, an isolated or recombinantly-produced antigen, or an antibody described above; and (b) instructions describing the use of the nucleic acid, antigen or antibody in the detection of a previous or current Histoplasma capsulatum infection.
  • the present invention also provides a method for detecting a current H. capsulatum infection in a subject suspected of having an H. capsulatum infection comprising: (a) contacting a fluid or tissue sample from the subject which contains antigens with antibodies generated against an antigen which contains an epitope which is unique to H.
  • the phrases “specific to” and “unique to” the fungus H. capsulatum as used herein in relation to an antigen means that the antigen (an antigenic polypeptide or polypeptide fragment) contains at least one epitope which is not common to other related fungi or other microorganisms (i.e., it is unique to the fungus H. capsula tum) , and binds with a higher affinity to antibodies generated against antigens of the fungus H. capsula tum than with antibodies generated against other related fungi or microorganisms. Thus, such an antigen can be distinguished from other antigens by such higher binding affinity.
  • capsulatum as used herein in relation to a nucleic acid or nucleic acid fragment means a nucleic acid or nucleic acid fragment which is not common to other related fungi or other microorganisms (i.e., it is only present in the fungus H. capsulatum) .
  • nucleic acid which is both the same length as, and exactly complementary in base pairing to, a given nucleic acid.
  • fluid or tissue sample means any sample of fluid, or of solubilized or nonsolubilized tissue, obtained from a subject, or solubilized or nonsolubilized cultured cells, which contains components, such as nucleic acids, antibodies or antigens, or fragments thereof, which may be employed in one of the tests described herein to detect a previous or current infection by, or exposure to, the fungus H. capsulatum, or to make a positive diagnosis of histoplasmosis.
  • Such fluid or tissue samples include blood, serum, plasma, sputum, urine, mucus, saliva, gastric juice, lymph, feces, or other bodily fluids, and tissues from the lungs, spleen, liver, skin or other organs.
  • the tissue or fluid samples can also be supernatant from incubated tissue samples or cultured cells .
  • fragment as used herein in relation to a polypeptide means a subsequence of the polypeptide which is of a sufficient size and conformation to remain immunogenic (i.e., to have at least one epitope) and/or to produce swelling of the skin of a subject in a skin test for histoplasmosis.
  • fragment as used herein in relation to a nucleic acid means a subsequence of the nucleic acid which is of a sufficient size and confirmation to properly function as a hybridization probe, as a primer in a polymerase chain reaction, to code for a polypeptide or polypeptide fragment, or in another manner characteristic of nucleic acids.
  • hybridization refers to the formation of a duplex structure by two single- stranded nucleic acids due to fully (100%) or less than fully (less than 100%) complementary base pairing. Hybridization can occur between fully complementary nucleic acid strands, or between less than fully complementary nucleic acid strands which contain regions of mismatch due to one or more nucleotide substitutions, deletions or additions.
  • immunogenic and antigenic as used herein mean that a polypeptide, or a fragment thereof, elicits a protective immune response, for example, the production of antibodies against the polypeptide, or fragment thereof, in a subject to which it is administered. The polypeptide or polypeptide fragment will have at least one epitope present therein.
  • isolated means that the nucleic acids, nucleic acid fragments, polypeptides, polypeptide fragments or antibodies are of sufficient purity so that they may be employed, and will function properly, in a clinical, diagnostic, experimental or other procedure, such as an immunoassay, a hybridization assay, an amplification reaction, or a skin test for histoplasmosis.
  • procedures are known by those of ordinary skill in the art for purifying nucleic acids, nucleic acid fragments, polypeptides, polypeptide fragments and antibodies from other proteins, contaminants, and materials with which they may normally be associated prior to their use in various procedures.
  • the M antigen of H. capsulatum obtained from histoplasmin may be purified by standard chromatography procedures, such as cation-exchange chromatography or anion-exchange chromatography, to remove other antigens (c and h antigens, etc.) and proteins, and other components, of histoplasmin therefrom.
  • Recombinantly- produced H. capsulatum M antigen may be purified by bound nickel-ion exchange chromatography, or by a combination of Fast Protein Liquid Chromatography (FPLC) using size exclusion chromatography and anion and/or cation exchange chromatography .
  • FPLC Fast Protein Liquid Chromatography
  • nucleotides used herein follow the nomenclature described by the Nomenclature Committee for the International Union of Biochemistry, "Nomenclature for Incompletely Specified Bases in Nucleic Acid Sequences," Eur . J. Biochem . 150:1-5 (1985), in which "A” represents adenine residues, “C” represents cytosine residues, “T” represents thymine residues, “G” represents guanine residues, “I” represents deoxyinosine residues, “M” represents adenine or cytosine residues, “R” represents adenine or guanine residues and "Y” represents cytosine or thymine residues.
  • nucleic acid and oligonucleotide include polydeoxyribonucleotides (containing 2-deoxy-D- ribose) , polyribonucleotides (containing D-ribose) , and to any other type of polynucleotide which is an N glycoside of a purine or pyrimidine base, or modified purine or pyrimidine base.
  • nucleic acid and oligonucleotide are used interchangeably herein. These terms refer only to the primary structure of the molecule. Thus, these terms include double- and single- stranded DNA, as well as double- and single-stranded RNA.
  • Nucleic acids and oligonucleotides can be prepared by any of several well-known methods. For example, they may be prepared by cloning and restriction of desired sequences, or by direct chemical synthesis by the phosphotriester methods described by Narang et al . , Meth . Enzymol . 68:90- 99 (1979) and Brown et al . , Meth . Enzymol . 68:109-151 (1979) ; by the diethylphosphoramidite method described by Beaucage et al . , Tetrahedron Let t . 22:1859-1862 (1981); or by the solid support method described in U.S. Patent No. 4,458,066. A review of nucleic acid syntheses methods is provided in Goodchild, Bioconjugate Chemistry 1 (3) :165-187 (1990) .
  • polypeptide as used herein means a sequence of four or more amino acids which is immunogenic and/or produces swelling of a subject's skin in a skin test for histoplasmosis, for example the M antigen protein of H. capsulatum .
  • the sequence of four or more amino acids can be modified, for example, by chemical, enzymatic or other treatment which does not diminish the immunogenic activity of the polypeptide to any substantial extent.
  • recombinant DNA techniques means well-known techniques which permit the isolation and propagation of individual genes, such as the M antigen gene of H. capsulatum, and the efficient expression of their products, such as the M antigen of H. capsulatum, by plasmid or other expression vectors in various bacterial, yeast or mammalian host expression systems.
  • General information concerning recombinant DNA techniques is present, for example, in Rodriguez et al . , Recombinant DNA Technigues : An Introduction (The
  • nucleic acid having a nucleotide sequence which is similar to the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO : 1 , or to the nucleotide sequence which is fully complementary thereto, and which retains the functions of such nucleic acid, but which differs from such nucleic acid by the substitution, deletion and/or addition of one or more nucleotides, and/or by the incorporation of some other advantageous feature into the nucleic acid, such as a radio label or other label (biotin, etc.) for nucleic acid detection or immobilization.
  • a radio label or other label biotin, etc.
  • nucleic acid which is substantially the same as the above nucleic acids
  • these nucleic acids will have a nucleotide sequence which has less than about 10% divergence from the nucleo- tide sequence set forth in the Sequence Listing as SEQ ID NO:l, or from the nucleotide sequence which is fully complementary thereto.
  • the nucleic acids will have about 90%, or more preferably about 95%, or even more preferably about 99% homology with the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:l, or with the nucleotide sequence fully complementary thereto. Due to the degeneracy in the genetic code, a sequence of three nucleotides (a codon) codes for each of the twenty natural amino acids. However, because there are twenty amino acids and sixty-four possible codons, most amino acids are specified by more than one codon. Thus, the nucleotide sequence of the H. capsulatum
  • nucleic acids within the present invention are not limited to nucleic acids having a nucleotide sequence as set forth in the Sequence Listing as SEQ ID N0:1, or having a nucleotide sequence fully complementary thereto.
  • the nucleic acids of the present invention will have the ability of the nucleic acid whose nucleotide sequence is set forth in the Sequence Listing as SEQ ID NO : 1 , or whose nucleotide sequence is fully complementary thereto, to encode the H. capsulatum antigen gene, or M antigen product of this gene, with the M antigen being specific to H. capsula tum and being antigenic (being able to stimulate the production of antibodies against the antigen) .
  • the nucleic acids of the present invention will have the ability to function as hybridization probes, or as primers in amplification reactions, for the detection of H. capsulatum.
  • Modifications at the 5'- end of a nucleic acid can include, for example, the addition of an isotope, such as 32 P, or a chemical, such as digoxigenin, for detection when using a commercial kit, such as the Boehringer- Mannheim Dig/Genius detection system.
  • an isotope such as 32 P
  • a chemical such as digoxigenin
  • restriction enzyme sites and/or cloning sites can be
  • nucleic acid from about 6 to more than about 12 nucleotides
  • target region and “target nucleic acid” refer to a region of a nucleic acid which is to be amplified, detected, or otherwise analyzed.
  • sequence to which a primer hybridizes is referred to as a “target sequence . "
  • nucleic acids which are specific to the fungus H. capsulatum.
  • nucleic acids of the present invention include a DNA having the nucleotide sequences set forth in the Sequence Listing as SEQ ID NO:l, an RNA having a nucleotide sequence which is fully complementary to the DNA nucleotide sequence set forth in the Sequence Listing as SEQ ID NO : 1 , and fragments of the foregoing nucleic acids.
  • Nucleic acids within the present invention also include nucleic acids which are substantially the same as the nucleic acids having the nucleotide sequence set forth in the Sequence Listing as SEQ ID N0:1, or the nucleotide sequence which is fully complementary to the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:l.
  • modified nucleic acids are within the scope of the present invention if they have the ability to function to encode the H. capsulatum M antigen gene, to encode an antigenic polypeptide which is specific to H. capsulatum, to function as a nucleic acid probe in a hybridization assay for the detection of H. capsulatum, to function as a primer in a polymerase chain reaction used to detect H. capsulatum, or to function in some other manner which is characteristic of nucleic acids.
  • Computer programs are readily available to the skilled artisan which can be used to compare modified nucleotide sequences to previously published nucleotide sequences of H. capsulatum to select appropriate sequences for use.
  • a computerized comparison of modified sequences with known sequences catalogued in GENBANK, a computerized database may be made using the commercially-available computer programs DNASIS (Hitachi Engineering, Inc.), Word Search or FASTA of the Genetics Computer Group (Madison, WI) , which search the catalogued nucleotide sequences for similarities to the nucleic acid in question.
  • the nucleic acids of the present invention can be used to detect a current H. capsulatum infection in a sample by any of a number of well-known nucleic acid-based detection techniques, such as hybridization techniques, polymerase chain reaction (PCR) , reverse transcription polymerase chain reaction (RT-PCR) , ligase chain reaction (LCR) , nucleic acid sequencing techniques, elect.ro- phoretic and non-electrophoretic identification of nucleic acids, and the like.
  • these nucleic acids can also be used in vectors to safely produce large quantities of the H. capsulatum M antigen in suitable host cells for use in the immunodiagnostic techniques and skin tests for histoplasmosis described herein.
  • nucleic acids of the present invention which can vary in length, can be used as probes in nucleic hybridization assays for the detection of H. capsulatum, or as primers in polymerase chain reactions for the detection of H. capsulatum. It is also contemplated that the nucleic acids of the present invention can be labeled or tagged for use in radioactive, chemiluminescence, fluorescent, or other detection systems.
  • H. capsulatum infection in a tissue or fluid sample suspected of containing H. capsulatum infection may be detected by detecting nucleic acids of H. capsulatum. Based upon the nucleotide sequence set forth in SEQ ID NO:l, one can design reagents by known methods to detect the presence of H. capsulatum in a sample. For example,
  • DNA or RNA obtained from a sample suspected of containing H. capsula tum can be sequenced by known methods, and the sequence compared to the nucleotide sequence set forth in SEQ ID N0:1. If the sequence of DNA or RNA obtained from the sample has greater than about 10% divergence from the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:l, or from a nucleotide sequence complementary thereto, then the sample does not contain H. capsulatum.
  • Amplification reactions can also be used for detecting H. capsulatum infection in a sample.
  • DNA obtained from the sample can be amplified using nucleic acid primers specific to H. capsula tum, and detecting the presence of a nucleic acid which is unique to H. capsulatum.
  • the presence of a nucleic acid which is unique to H. capsulatum indicates the presence of H. capsulatum in the sample.
  • the detection of a nucleic acid which is unique to H. capsula tum can be by the detection of amplification product when H. capsulatum- specific primers are used.
  • the detection of a nucleic acid unique to H. capsulatum can be performed by direct hybridization utilizing a H.
  • the primers (and probes) can, for example, be derived from the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:l, or the sequence complementary thereto. Particularly useful regions of the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO : 1 for such purpose are
  • Standard criteria for the selection of sequences for primer development are applicable. The crucial requirement is that the primers be such that an amplification protocol using them can distinguish H. capsulatum nucleic acids from the nucleic acids of other fungi, and other microorganisms. While non-specific amplification may also occur, the skilled artisan can distinguish non-specific amplification from the amplification of nucleic acids of H. capsulatum, for example, by following amplification with the use of a specific probe derived from the nucleotide sequence set
  • the nucleic acids are typically between about 10 and about 100 nucleotides in length, preferably between about 12 and about 30 nucleotides in length, and most preferably between about 15 and about 25 nucleotides in length.
  • An optimal length for a particular primer application may be readily determined in the manner described in H. Erlich, PCR Technology, Principles and Application for DNA Amplification, (1989) .
  • Several computer software programs are available to facilitate primer design, for example, Lowe, "Computer Program for Selection of Oligonucleotide Primers for Polymerase Chain Reactions," Nucl . Acids . Res . 18:1757-1761 (1991) and RT- PCR, Methods and Applications Book 1, (Clontech Laboratories, Inc. (1991)).
  • an isolated nucleic acid that selectively hybridizes with (or selectively amplifies) the nucleic acid set forth in SEQ ID NO : 1 , or the nucleic acid fully complementary thereto, under stringent conditions, and comprises at least 10 nucleotides complementary to the sequence set forth in SEQ ID NO:l, or the nucleic acid fully complementary thereto, is provided.
  • the hybridizing nucleic acid should have at least about 97% (and preferably about 98% or 99%) complementarity with the segment of the nucleic acid of SEQ ID NO:l, or the nucleic acid fully complementary thereto, to which it hybridizes.
  • the term "selectively hybridizes" means that a nucleic acid hybridizes with a particular nucleotide sequence, and not with others, and excludes the occasional randomly hybridizing nucleic acids.
  • the hybridizing nucleic acids can be used, for example, as probes or primers for detecting an isolate of H. capsula tum that has the nucleic acid to which the primer or probe hybridizes.
  • these nucleic acids can be the coding sequence for the H. capsula tum M antigen protein, or for fragments thereof, that can be utilized to produce an antigenic protein or protein fragment.
  • the invention provides compositions including at least two nucleic acids which hybridize with different regions of the target H.
  • the target region can range from about 97% complementary bases and full complementarity and still hybridize under stringent conditions.
  • nucleic acids of the present invention may be prepared and tested for the ability to selectively hybridize with a target nucleic acid in the manner described herein, or by modifications thereof, using readily-available starting materials, reagents and equipment .
  • the polymerase chain reaction for amplifying DNA
  • the reverse transcription polymerase chain reaction for reverse transcription
  • the nucleic acids present in a sample which are being amplified may be a single- or double-stranded DNA or RNA. If the starting material is RNA, reverse transcriptase is used to prepare a first strand cDNA prior to conventional polymerase chain reaction.
  • a double-stranded target nucleic acid sequence present in a sample is denatured and, due to the presence of a large molar excess of the primers, primers are annealed to each strand of the denatured target sequence.
  • the primers oriented with their 3 ' ends pointing towards each other, hybridize to opposite strands of the target sequence and, due to the action of DNA polymerase, prime enzymatic extension along the nucleic acid template in the presence of the four deoxyribonucleotide triphosphates .
  • the two primers anneal to opposite ends of the target nucleic acid sequence, and in orientations such that the extension product of each primer is a complementary copy of the target nucleic acid sequence and, when separated from its complement, can hybridize to the other primer.
  • the end product is then denatured again for another cycle.
  • amplification of a nucleic acid segment by more than one million-fold can be achieved.
  • Each cycle if 100% efficient, would result in a doubling of the number of target sequences present , thereby leading to exponential increases in the concentration of desired nucleic acid sequences. Better amplification is generally obtained when both primers are approximately the same length.
  • Denaturation of nucleic acid strands usually takes place at about 94°C.
  • the normal annealing (55 to 60°C) and extension (65 to 72 °C) temperatures generally used for in vi tro amplifica ion by polymerase chain reaction may be used.
  • suitable reaction times are from about 30 seconds to about 1 minute denaturing; from about 30 seconds to about 1 minute of annealing; and from about 30 seconds to about 2 minutes of extension.
  • One of ordinary skill in the art can, of course, easily determine optimum reaction times and conditions using conventional techniques .
  • Suitable assay formats for detecting amplification products or hybrids formed between probes and target nucleic acid sequences in a sample are described, for example, in Ausubel et al . , Current Protocols in Molecular Biology, supra., and in Sambrook et al . ,
  • Examples of these assay formats include the dot -blot and reverse dot- blot assay formats.
  • a dot-blot format amplified target DNA is immobilized on a solid support, such as a nylon membrane.
  • the membrane-target complex is incubated with labeled probe under suitable hybridization conditions, unhybridized probe is removed by washing under suitable stringent conditions, and the membrane is monitored for the presence of bound probe.
  • a dot-blot format amplified target DNA is immobilized on a solid support, such as a nylon membrane.
  • the membrane-target complex is incubated with labeled probe under suitable hybridization conditions, unhybridized probe is removed by washing under suitable stringent conditions, and the membrane is monitored for the presence of bound probe.
  • the amplified target DNA is labeled and the probes are immobilized on a solid support (e.g., nylon membrane) .
  • the target DNA is typically labeled during amplification by the incorporation of labeled primers therein.
  • One or both of the primers can be labeled.
  • the membrane-probe complex is incubated with the labeled amplified target DNA under suitable hybridization conditions, unhybridized target DNA is removed by washing under suitably stringent conditions, and the filter is then monitored for the presence of bound target DNA.
  • “Stringent conditions” refers to the hybridization conditions used in a hybridization protocol, for example, DNA/DNA hybridization, or in the primer/template hybridization in a PCR reaction. In general, these conditions should be a combination of temperature and salt concentration for washing chosen so that the denaturation temperature is approximately 5-20°C below the calculated T m (melting/denaturation temperature) of the hybrid under study.
  • the temperature and salt conditions are readily determined empirically in preliminary experiments in which samples of reference DNA are hybridized to the primer nucleic acid of interest, and then amplified under conditions of different stringencies. The stringency conditions are easily tested, and the parameters altered will be apparent to one skilled in the art.
  • MgCl 2 concentrations used in the reaction buffer can be altered to increase the specificity with which the primer binds to the template, but the concentration range of this compound used in hybridization reactions is narrow and, therefore, the proper stringency level is easily determined.
  • hybridizations with oligonucleotide probes 18 nucleotides in length can be done at 5-10°C below the estimated T ra in 6X SSPE, then washed at the same temperature in 2X SSPE. (See, e.g., Sambrook et al . ,
  • T ra of such an oligonucleotide can be estimated by allowing 2°C for each A or T nucleotide, and 4°C for each G or C.
  • An 18 nucleotide probe of 50% G+C would, therefore, have an approximate T ra of 54 °C.
  • the starting salt concentration of an 18 nucleotide primer or probe would be about 100-200mM.
  • stringent conditions for such an 18 nucleotide primer or probe would be a T ra of about 54 °C, and a starting salt concentration of about 150 mM, and modified accordingly by preliminary experiments.
  • T m values can also be calculated for a variety of conditions utilizing commercially available computer software (e.g., OLIGO ® ) .
  • the present invention also provides a vector comprising a nucleic acid having the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO : 1 , having a nucleotide sequence which is substantially the same as the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:l, a nucleic acid complementary to, or capable of hybridizing with, either of the foregoing nucleic acids, or a fragment of any of the foregoing nucleic acids.
  • the vectors of the invention can be placed into a host (e.g., cell line or transgenic animal) that can express the polypeptides and polypeptide fragments of the present invention.
  • the H. capsulatum M antigen gene (and other nucleic acids within the invention) can be cloned into suitable expression vectors by linking the gene to a suitable promoter in a replicable vector, and expressed in various bacterial, yeast or mammalian host expression systems, as is described in the Example, to safely produce large quantities of the H. capsulatum M antigen by propagating the vector in the host under conditions conducive to protein expression.
  • a DNA sequence containing the H. capsulatum M antigen gene can be cloned from H. capsulatum genomic DNA.
  • the DNA can be converted to double-stranded DNA using cloning techniques well known in the art, including PCR techniques.
  • Linkers or tails may be placed on the ends of the double-stranded DNA to provide convenient restriction sites.
  • the DNA may be introduced to any site in a vector, such as a plasmid vector, which has been restricted with a restriction enzyme which generates compatible ends.
  • the DNA can then be introduced into a suitable host system, where it can be expressed to produce the desired H. capsulatum M antigen protein.
  • the coding sequence for the H. capsulatum M antigen gene can be subjected to site- specific mutagenesis, in the manner discussed by Maniatis et al . , Molecular Cloning: A Laboratory Manual, supra., to alter selected base pairs.
  • Oligonucleotides containing a mutation to be introduced to the cloned gene can be synthesized by well-known DNA synthetic techniques, preferably by phosphorasmidite chemistry, and preferably as implemented on an automated synthesizer, such as the synthesizer commercialized by Applied Biosystems.
  • E. coli expression vectors known to those of ordinary skill in the art which are useful for the expression of the polypeptides and polypeptide fragments of the invention.
  • Other microbial hosts suitable for such use include bacilli, such as Bacillus subtilis, and other enterobacteriaceae, such as Salmonella, Serra tia and various Pseudomonas species.
  • bacilli such as Bacillus subtilis
  • enterobacteriaceae such as Salmonella, Serra tia and various Pseudomonas species
  • prokaryotic hosts one can also make expression vectors which contain expression control sequences compatible with the host cell, such as an origin of replication.
  • any number of a variety of well-known compatible promoters will be present, such as a lactose promoter system, a tryptophan (Trp) promoter system, a beta-lactamase promoter system, or a promoter system from phage lambda.
  • the promoters will typically control expression, optionally with an operator sequence, and have ribosome binding site sequences for initiating and completing transcription and translation.
  • an amino terminal methionine can be provided by the insertion of a Met codon 5' in-frame with the polypeptide or polypeptide fragment.
  • the carboxyl - terminal extension of the antigen can be removed using standard oligonucleotide mutagenesis procedures.
  • yeast expression systems can be used for the recombinant production of the polypeptide or polypeptide fragment .
  • the Saccharomyces cerevisiae pre-pro-alpha- factor leader region is routinely used to direct protein secretion from yeast. (See, for example, Brake et al . , " -Factor-Directed Synthesis and Secretion of Mature Foreign Proteins in
  • the leader region of pre-pro-alpha-factor contains a signal peptide and a pro-segment which includes a recognition sequence for a yeast protease encoded by the KEX2 gene. This enzyme cleaves the precursor protein on the carboxyl side of a Lys-Arg dipeptide cleavage-signal sequence.
  • the antigen coding sequence can be fused in- frame to the pre-pro-alpha- factor leader region. This construct is then put under the control of a strong transcription promoter, such as the alcohol dehydrogenase I promoter or a glycolytic promoter.
  • the antigen coding sequence is followed by a translation termination codon, which is followed by transcription termination signals.
  • the antigen coding sequences can be fused to a second protein coding sequence, such as Sj26 or ⁇ -galactosidase, used to facilitate purification of the fusion protein by affinity chromatography.
  • a second protein coding sequence such as Sj26 or ⁇ -galactosidase
  • Efficient post translational glycosylation and expression of recombinant proteins can also be achieved in Baculovirus systems .
  • Mammalian cells permit the expression of proteins in an environment which favors important post-transitional modifications, such as folding and cysteine pairing, the addition of complex carbohydrate structures, and the secretion of active protein.
  • Vectors useful for the expression of antigen in mammalian cells are characterized by insertion of the antigen coding sequence between a strong viral promoter and a polyadenylation signal .
  • the vectors can contain genes conferring either gentamicin or methotrexate resistance for use as selectable markers.
  • the antigen coding sequence can be introduced, for example, into a Chinese hamster ovary cell line using a methotrexate resistance-encoding vector.
  • RNA corresponding to the antigen coding sequence can be confirmed by Southern blot analysis.
  • suitable host cell lines capable of secreting intact human proteins include the CHO cell lines, HeLa cells, myeloma cell lines, Jurkat cells, and the like.
  • Expression vectors for these cells can include expression control sequences, such as an origin of replication, a promoter, an enhancer, and necessary information processing sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcriptional terminator sequences.
  • Preferred expression control sequences are promoters derived from immunoglobulin genes, SV40, Adenovirus and Bovine Papilloma Virus.
  • the vectors containing the nucleic acid segments of interest can be transferred into the host cells by well-known methods, which vary depending upon the type of cellular host. For example, calcium chloride transfection is commonly utilized for prokaryotic cells, whereas calcium phosphate treatment or electroporation may be used for other cellular hosts.
  • vectors for the expression of antigen in mammalian cells such as those which are similar to the vectors developed for the expression of human gamma- interferon, tissue plasminogen activator, clotting Factor VIII, hepatitis B virus surface antigen, protease Naxinl, and eosinophil major basic protein, can also be employed.
  • the vector can include CMV promoter sequences and a polyadenylation signal available for expression of inserted nucleic acid in mammalian cells, such as COS7.
  • the nucleic acid sequences can be expressed in hosts after the sequences have been operably linked, i.e., positioned, to ensure the functioning of an expression control sequence.
  • These expression vectors are typically replicable in the host organisms either as episomes, or as an integral part of the host chromosomal DNA.
  • expression vectors can contain selection markers, e.g., tetracycline resistance or hygromycin resistance, to permit detection and/or selection of those cells transformed with the desired nucleic acid sequences. (See, for example, U.S. Patent 4,704,362).
  • Nucleic acids encoding a variant polypeptide may include sequences which facilitate transcription (expression sequences) and translation of the coding sequences, such that the encoded polypeptide product is produced.
  • nucleic acids can include a promoter, a transcription termination site (polyadenylation site in eukaryotic expression hosts) , a ribosome binding site and, optionally, an enhancer for use in eukaryotic expression hosts and sequences necessary for replication of a vector.
  • the antigens of the present invention are useful as diagnostic reagents for detecting the presence of the fungus H. capsulatum in a sample, the presence of a previous or current infection by H. capsula tum, and for diagnosing histoplasmosis.
  • Numerous assay techniques based upon immunological reactions between antigens and antibodies may be performed with the antigens and antibodies of the invention to detect the presence of H. capsula tum in a sample, the presence of a previous or current infection by H. capsula tum, and for making a positive diagnosis of histoplasmosis, including the well-known enzyme -linked immunosorbent assays (ELISA) , immunofluorescence assays (IFA) , radioimmuno assays, immunoelectrophoresis , immunoblotting and the like.
  • ELISA enzyme -linked immunosorbent assays
  • IFA immunofluorescence assays
  • radioimmuno assays radioimmuno assays
  • immunoelectrophoresis immunoblotting and the like.
  • a previous or current H. capsula tum infection in a subject may be detected by the steps comprising: (a) contacting a fluid or tissue sample from the subject which contains antibodies with an isolated or recombinantly-produced antigen of the present invention; and (b) detecting the presence of binding between the antibodies and the antigen, the presence of binding indicating the presence of a previous or current H. capsulatum infection in the subject.
  • the antigen employed can be any of the isolated or recombinantly- produced polypeptides or polypeptide fragments described hereinabove. Because large quantities of polypeptides and polypeptide fragments can be safely produced by recombinant DNA techniques using nucleic acids described herein, and purified, it is preferable to use recombinantly-produced polypeptides and polypeptide fragments in the immunodiagnostic techniques of the invention.
  • the nucleotide sequence which is complementary to the DNA nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:l encodes the H. capsulatum M antigen.
  • the antigen employed in the immunoassay techniques described herein can be this protein, an antigenic polypeptide fragment of this protein, or any other antigenic polypeptide or polypeptide fragment encoded by nucleic acid which has a nucleotide sequence which is complementary to SEQ ID NO:l, or to a nucleic acid which has a nucleotide sequence which is substantially the same as the nucleotide sequence which is complementary to SEQ ID NO:l. It is already well established that the H. capsulatum M antigen is antigenic, and is specific for H. capsulatum.
  • H. capsulatum M antigen may also possess one or more epitopes of the M antigen protein which are unique to H. capsula tum. These epitopes, and the polypeptides and polypeptide fragments containing them, can be readily determined by the well-known techniques of epitope mapping and conformational dependency analysis . Monoclonal antibodies directed against the M antigen may be utilized, as described in Zancope-Oliveira et al . , "Evaluation of Cation Exchange Chromatography for
  • the monoclonal antibodies can be applied in the enzyme-linked immunoelectrotransfer blot (western blot) method.
  • partial digestion with proteinases can be utilized to fragment recombinant M antigen.
  • the fragments can be purified by Fast Protein Liquid
  • FPLC Chromatography
  • Polypeptides which may be employed in the immunodiagnostic assays and skin tests of the present invention are those encoded by the plus strands of the nucleic acids of the invention.
  • Antigenic fragments of the polypeptides can be synthesized directly, or obtained by chemical or mechanical disruption of the fungus, or of the larger polypeptides.
  • the antigenic polypeptides and polypeptide fragments of the present invention can also be recombinant proteins, polypeptides or fragments thereof, obtained by cloning nucleic acids encoding the proteins, polypeptides or fragments in an expression system capable of producing the antigenic proteins, polypeptides, or fragments thereof. Using the deduced amino acid sequence of the H.
  • amino acid sequences of the antigens of the invention can contain an immunoreactive region attached to sequences designed to provide for some additional property, such as solubility. These amino acid sequences can also include amino acid substitutions to provide for some additional property, such as to remove or add amino acids capable of disulfide bonding, to increase antigenicity and/or bio- longevity, or to alter enzymatic activity.
  • polypeptides and polypeptide fragments derived from the H. capsulatum M antigen are possible.
  • these polypeptides and polypeptide fragments need to have a bioactive property, such as antigenicity.
  • the isolated polypeptides and polypeptide fragments obtained or produced can be tested to determine their antigenicity (immunoreactivity) , immunogenicity and specificity by the well-known methods discussed hereinabove .
  • One example of an immunologic technique that may be used for the detection of current or previous infection by H. capsulatum utilizes monoclonal antibodies (MAbs) for detection of antibodies that specifically bind H. capsulatum M antigen.
  • MAbs monoclonal antibodies
  • H. capsulatum M antigen bound to a substrate e.g., an ELISA 96-well plate
  • a labeled (e.g., enzyme-linked, fluorescent, radioactive, or the like) monoclonal antibody is then reacted with the previously reacted antigen-serum antibody complex. The amount of inhibition of monoclonal antibody binding is measured relative to a control (no patient serum antibody) .
  • the isolated or recombinantly-produced antigens of the invention can also be used as skin test antigens in skin tests for histoplasmosis. These skin tests are performed in a manner known by those of skill in the art for this disease, and for other pulmonary diseases, such as tuberculosis. Generally, a small quantity (generally about 0.1 ml) of liquid, such as physiological saline, containing an antigen of the invention, such as the H. capsulatum M antigen, is injected intradermally beneath the skin (on the forearm or other convenient location) of a patient, and the site of injection is observed at predetermined times, such as 24 and 48 hours post injection, for the presence of swelling of the skin.
  • an antigen of the invention such as the H. capsulatum M antigen
  • capsulatum glycoproteins in a skin test for the diagnosis of histoplasmosis see Sprouse, "Determination of Molecular Weight, Isoelectric Point, and Glycoprotein Moiety for the Principal Skin Test-Reactive Component of Histoplasmin, " Infection and Immuni ty 15, 263-271 (1977) .
  • the antigens Prior to using the isolated or recombinantly- produced antigens in any immunodiagnostic assays or skin tests, it is preferable that the antigens be partially or fully deglycosylated by, for example, mild periodate oxidation with about 0.025 M sodium meta-periodate at about 4°C for about 4-8 hours in the dark, followed by reduction with sodium borohydride, and then an equimolar amount of glycerol .
  • the antibodies can be polyclonal or monoclonal, and should specifically bind an epitope of an antigen which is specific to H. capsula tum.
  • bind means the well-understood antigen-antibody interactions, or other nonrandom association with an antigen.
  • Specific binding as used herein means an antibody that has a higher affinity for its target molecule (e.g., an antigen of the invention) than for non-target molecules (e.g., antigens of other closely-related fungi, or of other microorganisms).
  • Antibodies can be made by many well-known methods. See, for example, Harlow and Lane, Antibodies; A
  • an isolated or recombinantly-produced antigen can be injected into an animal in an amount, and in intervals, sufficient to elicit an immune response (i.e., the production of antibodies against the antigen) .
  • Antibodies can be obtained from the animal and purified directly by well- known methods.
  • spleen cells can be obtained from the animal, and then fused with an immortal cell line and screened for monoclonal antibody secretion.
  • the antibodies can be used to screen nucleic acid clone libraries for cells secreting the antigen. These positive clones can then be sequenced.
  • capsulatum antigens include antibodies which specifically bind with an isolated or recombinantly-produced polypeptide encoded by a nucleic acid which has a nucleotide sequence which is complementary to SEQ ID N0:1, or to antigenic fragments thereof .
  • a current H. capsulatum infection in a subject suspected of having an H. capsulatum infection may be detected by the steps comprising: (a) contacting a fluid or tissue sample from the subject which contains antigens with antibodies generated against an antigen of the present invention; and (b) detecting the presence of binding between the antigens and the antibodies, the presence of binding indicating the presence of a current H. capsulatum infection in the subject.
  • Kits The present invention also provides a kit for detecting a previous or current H. capsulatum infection in a sample, or for diagnosing histoplasmosis.
  • the kit will contain one or more of the isolated nucleic acids, isolated or recombinantly- produced antigens, or isolated antibodies of the invention, and instructions describing the use of the nucleic acids, antigens or antibodies in the detection of a previous or current H. capsulatum infection, or in the diagnosis of histoplasmosis.
  • Vaccines are examples of the isolated nucleic acids, isolated or recombinantly- produced antigens, or isolated antibodies of the invention, and instructions describing the use of the nucleic acids, antigens or antibodies in the detection of a previous or current H. capsulatum infection, or in the diagnosis of histoplasmosis.
  • the isolated nucleic acids and isolated or recombinantly-produced antigens of the present invention may be used as the active component in an immunogenically-effective amount (an amount which is effective to stimulate the production of antibodies against the nucleic acids or antigens in the particular subject being vaccinated) in a vaccine for the prevention or treatment of histoplasmosis along with a pharmaceutically-acceptable carrier for the nucleic acids or antigens to provide protective resistance against H. capsula tum.
  • a vaccine would be particularly useful for individuals who are at a high risk for contracting histoplasmosis, such as individuals who explore caves where birds and/or bats may be present, and individuals who deconstruct vacant buildings, which be inhabited by birds and/or bats .
  • Active immunization can be achieved through natural infection with an organism or virus, or artificially by vaccination. (See, for example, Kuby, Immunology (W.H. Freeman and Co., New York (1992)) .) It is also contemplated that immunization against disease caused by H. capsulatum can be achieved by a "naked" DNA vaccine approach. Briefly, DNA constructs containing promoter sequences upstream of H. capsulatum M antigen coding sequences can be injected into muscle tissue or administered via the mucosa and result in expression of antigens that induce a protective immune response.
  • An immunogenically-effective amount of the nucleic acids or antigens of the invention will generally range from about 100 nanograms to about 1 microgram of the nucleic acids, and from about 10 to about 100 micrograms of the antigens.
  • Immunogenically-effective amounts of the vaccine, nucleic acid or antigen can be determined using standard procedures. Briefly, various concentrations of the nucleic acid or antigen are prepared and administered to an animal, and then the immunological response (e.g., the production of antibodies or cell mediated immunity) of the animal to each concentration is determined. The amounts of nucleic acid or antigen administered depend on the subject, e.g. a human or an animal, the condition of the subject, the size of the subject, etc.
  • the animal so inoculated with the nucleic acid or antigen can be exposed to H. capsulatum to test the potential vaccine effect (protective immunogenicity) of the specific nucleic acid or antigen.
  • the specificity of the nucleic acid or antigen can be ascertained by testing sera, other fluids or lymphocytes from the inoculated animal for cross reactivity with other closely-related fungi, or other microorganisms.
  • the pharmaceutically-acceptable carrier which may be employed in the vaccines can comprise saline or other suitable carriers. See, for example, Arnon, R. (Ed.) Synthetic Vaccines (CRC Press, Inc., Boca Raton, Florida (1987) ) .
  • pharmaceutically-acceptable is meant a material that may be administered to a subject along with a selected nucleic acid or antigen without causing any undesirable biological effects, or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.
  • the carrier will depend upon the method of administration and choice of adjuvant, if one is used.
  • An adjuvant can also be a part of the carrier of the vaccine, in which case it can be selected by standard criteria based upon the nucleic acid or antigen used, the mode of administration and the subject. Methods of administration can be by oral or sublingual means, or by injection, depending on the particular vaccine used, and the subject to whom it is administered.
  • the vaccine can be used as a prophylactic or a therapeutic modality.
  • the invention contemplates methods of preventing or treating infection from H. capsulatum, and the associated diseases, by administering the vaccine to a subject.
  • Example 2 describes and illustrates the methods for the cloning and sequencing of the H. capsulatum M antigen gene.
  • This Example is intended to be merely illustrative of the present invention, and not limiting thereof in either scope of spirit. Those of skill in the art will readily understand that variations of the reagents used in, and the conditions and processes of, the procedures described in this Example can be used to clone and sequence nucleic acids which are specific to H. capsulatum.
  • a homology search through a protein data base revealed significant similarity of these amino acid sequences to both eukaryotic and prokaryotic catalases . This degree of conservation facilitated peptide alignments.
  • Degenerate oligonucleotides were constructed in the proper orientation for polymerase chain reactions (PCR) .
  • PCR polymerase chain reactions
  • the amino acid sequence derived from the resulting amplicon confirmed that it encoded a region of the M antigen gene.
  • This probe was used to screen an H. capsulatum genomic library, and a 4.0 kb fragment containing the entire M antigen gene was cloned and sequenced by the dideoxy chain termination method of Sanger et al . , "DNA Sequencing with Chain-Terminating Inhibitors," Proc. Natl .
  • Introns are present in the nucleotide sequence between six exons, which are present at base pair numbers 566-793, 852-1077, 1168-1583, 1706-1870, 1950-2124 and 2208-3121.
  • the sequence of the clone containing the M antigen gene has been deposited in GenBank under accession number AFO 26268.
  • H. capsulatum strain 6623 ATCC 26320
  • E. coli strain q358 was used as the host for the bacteriophage 1 Gemll
  • E. coli INV aF ' (Invitrogen Co., Carlsbad, CA) was used as the recipient for the subcloning vector pBluescript SK (Stratagene, La Jolla, CA) .
  • M antigen was purified by tandem cation exchange chromatography in columns of CM Sepharose CL-6B from histoplasmin, as described by Zancope-Oliveira et al . , "Evaluation of Cation Exchange Chromatography for the Isolation of M Glycoprotein from Histoplasmin," supra.
  • the band corresponding to M antigen (200 pmol/protein band) bound to the membrane was excised, and submitted to Edman degradation without any prior modification.
  • the band was digested in situ with lysyl endopeptidase (Boehringer Mannheim, Indianapolis, IN) , and peptides were purified using microbore reverse-phase high-performance liquid chromatography (HPLC) on reverse phase C18 silica. All amino acid sequences were obtained using ABI sequencers (models 477A Protein Sequencer or Procise, Applied Biosystems, Foster City, CA) which utilize pulse-liquid chemistry.
  • Yeast cells grown in 50 ml of Pine's broth were harvested by filtration on 0.45 ⁇ m porosity membrane (Nalgene) , washed 3 times with deionized H2O and blotted to remove excess moisture. Cells were placed in a sterile mortar with approximately 1 g glass beads (0.5 mm) , and liquid nitrogen, and were ground to a fine powder. The powder was resuspended in 20 ml of TE Buffer, pH 8.0 (10 mM Tris-1 mM EDTA) , and DNA was extracted with phenol, ethanol precipitated, and dried and redissolved in 0.05 M TE .
  • TE Buffer pH 8.0 (10 mM Tris-1 mM EDTA)
  • RNAse 10 ⁇ g/ml final concentration
  • proteinase K treatment 50 ⁇ g/ml
  • the DNA was subjected again to phenol extraction, and EtOH precipitation, and redissolved in TE .
  • H. capsulatum genomic DNA was used to amplify a DNA fragment encoding an internal portion of the M protein by PCR.
  • Degenerated oligonucleotides primers (1 ⁇ M) were designed on the basis of two of six internal peptides (V22 and V18) derived from the amino acid sequence of the M antigen, which are set forth in Table 1, because the NH2 terminus appeared to be blocked:
  • the sense primer M4F [5 ' -AA (AG) AA(CT) CC (AGC) GA (CT) TT (CT) -3 ' SEQ ID NO: 10] was a 15-mer with 48-fold degeneracy,
  • M8R [5' -TT(AGCT)CC(AGT)AT(AGCT)GT(AG)AA-3 ' , SEQ ID NO: 11] was a 14-mer with 96 -fold degeneracy.
  • PCR was carried out in a total volume of 100 ⁇ l containing 100 ng of DNA as template, 100 M each of dNTP, 1 M of each oligonucleotide primer, and 10X PCR Buffer containing 500 mM KC1, 100 mM Tris-HCl, pH 8.3, 25 mM MgCl 2 , and 2.5 U of Tag polymerase (Boehringer Mannheim) .
  • the amplification conditions consisted of a denaturation at 95°C for 5 minutes followed for 35 cycles of the succeeding steps: denaturation at 95°C for 5 minutes, annealing at 50°C for 1 minute, and extension at 72°C for 1 minute. A final elongation was done at 72 °C for 5 minutes.
  • a 300-bp PCR product was subcloned into the pCRII vector using the TA cloning kit (Invitrogen, San Diego, Calif.), and using procedures recommended by the vendor, and sequenced using a dye-labeled terminator and automated sequencer (Applied Biosystems) .
  • 300-bp amplicon was labeled with [- 32 P]dCTP by High Prime DNA Labeling Mix (Boehringer Mannheim) , purified in a DEAE column (NACS Prepac Convertible - BRL Life Technologies, Inc.), and used for screening the genomic library, derived from DNA partially digested with Sau3Al and cloned into lGemll via the Xho 1 half-site.
  • An E. coli q358 strain bacterium infected with the genomic library was replica plated onto nitrocellulose membranes. Plaques were lysed, and then heat fixed. Filters were hybridized with 32 P-labeled probe. Twelve positive colonies were picked, and rescreened as large plaques. Two strongly positive plaques were purified and mapped by Southern analysis. These clones were digested with BamHl and one fragment of 4.0 kb was obtained.
  • the antisense primer was 5 ' -ACCAAGCTTCTATCCAACGGGAACCGA-3 ' (SEQ ID NO: 13).
  • a 5 ' EcoRI site was added to the sense primer, and a HindiII site (underlined) was added to the antisense primer to facilitate cloning in pBluescript SK- .
  • PCR was performed for 35 cycles of 94°C for 45 seconds, 50°C for 45 seconds and 72°C for 2 minutes with 5 U of Vent polymerase (New England Biolabs, Beverly, Mass.) .
  • the PCR product was digested with EcoRI and HindiII and cloned into pBluescript SK- , restriction mapped and sequenced in its entirety.
  • the gene encoding the M antigen was deposited in GenBank, and its accession number is AF026268.
  • M antigen amino acid sequencing Peptides sequences of the M antigen were determined after digestion of purified M glycoprotein with lysyl endopeptidase, and purification using high-performance liquid chromatography (HPLC) . Undigested antigen and internal peptides were sequenced by Edman degradation. The amino acid sequences of the NH 2 terminus and 6 internal peptides are shown in Table 1. The amino acid sequences of two internal peptides of two internal
  • peptides, V22 and V18, of the M protein showed 66-73% of identity with sequences of catalases of Schizosaccharomyces pombe (gpD55675 YSPC_ 1) and Aspergillus niger (gpZ23138 ANCATRGNA_1) . Cloning and sequencing of the M gene. The significant degree of homology of the two internal peptides V22 and V18 to fungi catalases suggested a certain arrangement in the protein.
  • sense primer M4F and antisense primer M8R two degenerate oligonucleotides (sense primer M4F and antisense primer M8R) were designed, based upon the two internal peptides V22 and V18, respectively, and used in a PCR reaction to amplify a 320 base pair fragment of H. capsulatum genomic DNA.
  • a 300 base pair PCR product was achieved using M4F and M8R as primers, and confirmed by Southern blot to represent a unique gene of H. capsulatum . Sequence analysis of this 300 base pair amplicon obtained by the dideoxy chain terminator method enclosed the two native internal peptides, confirming that the PCR product encoded a region of the gene encoding the M antigen.
  • SEQ ID NO : 1 shows the complete nucleotide sequence of the H. capsulatum gene encoding the M antigen
  • SEQ ID NO: 2 shows the deduced amino acid sequence, which consisted of 707 amino acid residues (including a sixteen amino acid leader sequence) with an estimated molecular weight of about 78,172 Da.
  • the coding region of the M antigen gene is set forth in SEQ ID NO:l. It is interrupted by 5 introns, which begin and end at the base pair numbers 794-851, 1078-1167, 1584-1705, 1871-1949 and 2125-2207, with the 5' and 3' extremities presenting the GT/AG consensus.
  • the 5 '-565 base pair flanking sequence of this gene (the 565-base pair sequence directly preceding the first exon (first coding sequence) ) exhibited similarity with the promoter regions of eucaryotic genes.
  • a TATA element is present at base pair position 318, and a T+C-rich pyrimidine block is found downstream at base pair position 365.
  • the CAA motif is found twice upstream of the T+C block at base pair positions 34 and 341.
  • the 3'- region downstream from the M antigen gene open reading frame contains a pentanucleotide (5 ' -AAATA-3 ' ) at base pair position 3134, 19 nucleotides downstream from the termination codon.
  • This sequence is similar to the polyadenylation consensus sequence described in eukaryotic organisms. It may play a role in the termination of transcription, processing, and addition of poly (A) at the 3 '-terminus.
  • M deduced amino acid sequence Comparison of the M deduced amino acid sequence with known fungal catalases from Aspergillus fumigatus (GenBank accession number u87850) , Eimericella nidulans (GenBank accession number u80672) , Aspergillus niger (GenBank accession number 115474) , and Saccharomyces cerevisiae (GenBank accession number xl3028) , using a Genetics Computer Group, Inc., computer program, demonstrated 61.2, 60.4, 53.2 and 21.7% of similarity at the amino acid level, respectively.
  • the M antigen amino acid sequence can be divided into parts of high and low homology with these other amino acid sequences, which may suggest functional domains.
  • nucleic acids, antigens, antibodies, vaccines, methods and kits within the scope of the invention include, but are not limited to, the nucleic acids, antigens, antibodies, vaccines, methods and kits described herein.
  • Contemplated equivalents of the nucleic acids, antigens, antibodies, vaccines, methods and kits described herein include nucleic acids, antigens, antibodies, vaccines, methods and kits which otherwise correspond thereto, and which have the same general properties thereof, wherein one or more simple variations are made which do not adversely affect the function of the nucleic acids, antigens, antibodies, vaccines, methods and kits as described herein.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Mycology (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne la séquence de nucléotides du gène de l'antigène M de H. capsulatum désignée SEQ ID N0 :1 dans l'énoncé des séquences, un acide nucléique possédant la séquence de nucléotides complémentaire de cette première séquence, et des acides nucléiques possédant une séquence de nucléotides pratiquement semblable à ces dernières séquences de nucléotides. Elle concerne également des vecteurs et des systèmes d'expression d'hôtes contenant ces acides nucléiques, ainsi que des antigènes isolés ou produits par recombinaison et codés par ces acides nucléiques. Elle concerne, de plus, des anticorps générés contre ces antigènes, des procédés et des trousses servant à détecter une infection anté
PCT/US1999/009151 1998-04-30 1999-04-27 Acides nucleiques du gene de l'antigene m d'histoplasma capsulatum, antigenes, vaccins, anticorps, procedes et trousses servant a detecter l'histoplasmose WO1999055874A2 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CA002327456A CA2327456A1 (fr) 1998-04-30 1999-04-27 Acides nucleiques du gene de l'antigene m d'histoplasma capsulatum, antigenes, vaccins, anticorps, procedes et trousses servant a detecter l'histoplasmose
US09/674,195 US7018827B1 (en) 1998-04-30 1999-04-27 Nucleic acids of the M antigen gene of Histoplasma capsulatum, antigens, vaccines and antibodies, methods and kits for detecting histoplasmas
AU37668/99A AU3766899A (en) 1998-04-30 1999-04-27 Nucleic acids of the m antigen gene of (histoplasma capsulatum), antigens, vaccines and antibodies, methods and kits for detecting histoplasmosis

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US8367698P 1998-04-30 1998-04-30
US60/083,676 1998-04-30

Publications (2)

Publication Number Publication Date
WO1999055874A2 true WO1999055874A2 (fr) 1999-11-04
WO1999055874A3 WO1999055874A3 (fr) 2000-01-06

Family

ID=22179968

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/009151 WO1999055874A2 (fr) 1998-04-30 1999-04-27 Acides nucleiques du gene de l'antigene m d'histoplasma capsulatum, antigenes, vaccins, anticorps, procedes et trousses servant a detecter l'histoplasmose

Country Status (3)

Country Link
AU (1) AU3766899A (fr)
CA (1) CA2327456A1 (fr)
WO (1) WO1999055874A2 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7018827B1 (en) 1998-04-30 2006-03-28 The United States Of America As Represented By The Department Of Health And Human Services Nucleic acids of the M antigen gene of Histoplasma capsulatum, antigens, vaccines and antibodies, methods and kits for detecting histoplasmas
US7052837B2 (en) 2001-03-13 2006-05-30 The Board Of Trustees Of The University Of Arkansas Histoplasma capsulatum catalase sequences and their use in the detection of Histoplamsa capsulatum and histoplasmosis
US7217519B1 (en) 2002-11-21 2007-05-15 The Board Of Trustees Of The University Of Arkansas Histoplasma capsulatum chitin synthase sequences and their use for detection of Histoplasma capsulatum and histoplasmosis
CN104762396A (zh) * 2015-04-15 2015-07-08 中国人民解放军第二军医大学 一种基于环介导等温扩增技术原理的组织胞浆菌感染分子诊断试剂盒及其应用
EP2902495A1 (fr) 2007-11-09 2015-08-05 The Salk Institute for Biological Studies Utilisation d'inhibiteurs de récepteurs Tam en tant qu'immunostimulateurs et activateurs Tam en tant

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Abstracts of the 97th General Meeting of the American Society for Microbiology, vol. 97, 1997 XP002121615 *
EMBL Database, Heidelberg, FRG Accession Number AF026268, 14/11/1997 Zancope-Oliveira: "Molecular cloning, characterization, and expression of the M antigen of histoplasma capsulatum" XP002119768 *
R. M. ZANCOPE-OLIVEIRA AT AL.: "Molecular cloning, characterisation and expression of the M antigen of Histoplasma capsulatum" INFECT. IMMUN., vol. 67, no. 4, 1999, pages 1947-1953, XP002119766 *
R. M. ZANCOPE-OLIVEIRA ET AL.: "Effect of Histoplasmin M antigen chemical and enzymatic deglycosylation on cross reactivity in the Enzyme-linked immunoelecttrotransfer blot methid" CLIN. DIAGNOS. LAB. IMMUNOL., vol. 1, no. 4, 1994, pages 390-393, XP002119767 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7018827B1 (en) 1998-04-30 2006-03-28 The United States Of America As Represented By The Department Of Health And Human Services Nucleic acids of the M antigen gene of Histoplasma capsulatum, antigens, vaccines and antibodies, methods and kits for detecting histoplasmas
US7052837B2 (en) 2001-03-13 2006-05-30 The Board Of Trustees Of The University Of Arkansas Histoplasma capsulatum catalase sequences and their use in the detection of Histoplamsa capsulatum and histoplasmosis
US7217519B1 (en) 2002-11-21 2007-05-15 The Board Of Trustees Of The University Of Arkansas Histoplasma capsulatum chitin synthase sequences and their use for detection of Histoplasma capsulatum and histoplasmosis
EP2902495A1 (fr) 2007-11-09 2015-08-05 The Salk Institute for Biological Studies Utilisation d'inhibiteurs de récepteurs Tam en tant qu'immunostimulateurs et activateurs Tam en tant
CN104762396A (zh) * 2015-04-15 2015-07-08 中国人民解放军第二军医大学 一种基于环介导等温扩增技术原理的组织胞浆菌感染分子诊断试剂盒及其应用

Also Published As

Publication number Publication date
CA2327456A1 (fr) 1999-11-04
WO1999055874A3 (fr) 2000-01-06
AU3766899A (en) 1999-11-16

Similar Documents

Publication Publication Date Title
Lecordier et al. Characterization of a dense granule antigen of Toxoplasma gondii (GRA6) associated to the network of the parasitophorous vacuole
US7700755B2 (en) Helicobacter pylori CAI antigen
EP0643770B1 (fr) Antigen immunodominant associe avec le cytotoxin d'helicobacter pylori utiles pour des vaccins et des diagnostics
US5686248A (en) Fungal stress proteins
Banerjee et al. Molecular cloning and expression of a recombinant Aspergillus fumigatus protein Asp f II with significant immunoglobulin E reactivity in allergic bronchopulmonary aspergillosis
Liu et al. Trypanosome variant surface glycoprotein genes expressed early in infection
JP2006166919A (ja) 空胞形成毒素欠損Ｈ．ｐｙｌｏｒｉおよび関連する方法
JPH06508994A (ja) 日本杉花粉からのアレルゲン性蛋白質及びペプチド
US6171805B1 (en) DNA and host cells encoding a cell surface protein of Porphyromonas gingivalis
WO1999055874A2 (fr) Acides nucleiques du gene de l'antigene m d'histoplasma capsulatum, antigenes, vaccins, anticorps, procedes et trousses servant a detecter l'histoplasmose
EP0879244B1 (fr) Polypeptides de recombinaison de mycoplasmes et vaccins
KR19990071959A (ko) 말라세지아에서 유래된 항원성 단백질
US7018827B1 (en) Nucleic acids of the M antigen gene of Histoplasma capsulatum, antigens, vaccines and antibodies, methods and kits for detecting histoplasmas
US5633139A (en) Toxoplasma gondii P28 gene and methods for its use
US20070243204A1 (en) Helicobacter pylori proteins useful for vaccines and diagnostics
US5442050A (en) Molecular cloning of antigens shared by rat- and human-derived Pneumocystis carinii
US6130059A (en) Helicobacter pylori proteins useful for vaccines and diagnostics
AU756866B2 (en) A mutant human hepatitis B viral strain and uses thereof
US6514697B1 (en) Methods for detection of Crytosporidium species and isolates and for diagnosis of Cryptosporidium infections
US5916754A (en) Bayou hantavirus and related methods
JP2003501084A (ja) 新規なカンジダ・アルビカンス遺伝子及びこれらの遺伝子によりコードされるタンパク質
US6620913B1 (en) Polypeptides of a novel hantavirus
WO1992018532A1 (fr) Arn, adn et proteine antigenique virale du virus de l'hepatite non-a, non-b
JP2002531068A (ja) カンジダ・アルビカンスｔｆＩＩＩＡ遺伝子（ＣａｔｆＩＩＩＡ）及びコードされるＣＡＴＦＩＩＩＡタンパク質
WO2000063392A1 (fr) Nouvelle tyrosine phosphatase

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

ENP Entry into the national phase

Ref document number: 2327456

Country of ref document: CA

Ref country code: CA

Ref document number: 2327456

Kind code of ref document: A

Format of ref document f/p: F

NENP Non-entry into the national phase

Ref country code: KR

WWE Wipo information: entry into national phase

Ref document number: 37668/99

Country of ref document: AU

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWE Wipo information: entry into national phase

Ref document number: 09674195

Country of ref document: US

122 Ep: pct application non-entry in european phase