WO1999037819A2 - Amplification of nucleic acids with electronic detection - Google Patents

Amplification of nucleic acids with electronic detection Download PDF

Info

Publication number
WO1999037819A2
WO1999037819A2 PCT/US1999/001705 US9901705W WO9937819A2 WO 1999037819 A2 WO1999037819 A2 WO 1999037819A2 US 9901705 W US9901705 W US 9901705W WO 9937819 A2 WO9937819 A2 WO 9937819A2
Authority
WO
WIPO (PCT)
Prior art keywords
probe
nucleic acid
primer
probes
target sequence
Prior art date
Application number
PCT/US1999/001705
Other languages
English (en)
French (fr)
Other versions
WO1999037819A3 (en
Inventor
Jon Faiz Kayyem
Original Assignee
Clinical Micro Sensors, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US09/014,304 external-priority patent/US6063573A/en
Application filed by Clinical Micro Sensors, Inc. filed Critical Clinical Micro Sensors, Inc.
Priority to AU24737/99A priority Critical patent/AU764926B2/en
Priority to CA002319170A priority patent/CA2319170A1/en
Priority to JP2000528725A priority patent/JP2002500897A/ja
Priority to EP99904316A priority patent/EP1051517A2/en
Publication of WO1999037819A2 publication Critical patent/WO1999037819A2/en
Publication of WO1999037819A3 publication Critical patent/WO1999037819A3/en

Links

Classifications

    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01D—SEPARATION
    • B01D24/00—Filters comprising loose filtering material, i.e. filtering material without any binder between the individual particles or fibres thereof
    • B01D24/02—Filters comprising loose filtering material, i.e. filtering material without any binder between the individual particles or fibres thereof with the filter bed stationary during the filtration
    • B01D24/10—Filters comprising loose filtering material, i.e. filtering material without any binder between the individual particles or fibres thereof with the filter bed stationary during the filtration the filtering material being held in a closed container
    • B01D24/105—Filters comprising loose filtering material, i.e. filtering material without any binder between the individual particles or fibres thereof with the filter bed stationary during the filtration the filtering material being held in a closed container downward filtration without specifications about the filter material supporting means
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01D—SEPARATION
    • B01D17/00—Separation of liquids, not provided for elsewhere, e.g. by thermal diffusion
    • B01D17/02—Separation of non-miscible liquids
    • B01D17/0208—Separation of non-miscible liquids by sedimentation
    • B01D17/0214—Separation of non-miscible liquids by sedimentation with removal of one of the phases
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01D—SEPARATION
    • B01D17/00—Separation of liquids, not provided for elsewhere, e.g. by thermal diffusion
    • B01D17/02—Separation of non-miscible liquids
    • B01D17/04—Breaking emulsions
    • B01D17/045—Breaking emulsions with coalescers
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01D—SEPARATION
    • B01D24/00—Filters comprising loose filtering material, i.e. filtering material without any binder between the individual particles or fibres thereof
    • B01D24/46—Regenerating the filtering material in the filter
    • B01D24/4631—Counter-current flushing, e.g. by air
    • B01D24/4642—Counter-current flushing, e.g. by air with valves, e.g. rotating valves
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01D—SEPARATION
    • B01D24/00—Filters comprising loose filtering material, i.e. filtering material without any binder between the individual particles or fibres thereof
    • B01D24/48—Filters comprising loose filtering material, i.e. filtering material without any binder between the individual particles or fibres thereof integrally combined with devices for controlling the filtration
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01D—SEPARATION
    • B01D35/00—Filtering devices having features not specifically covered by groups B01D24/00 - B01D33/00, or for applications not specifically covered by groups B01D24/00 - B01D33/00; Auxiliary devices for filtration; Filter housing constructions
    • B01D35/12—Devices for taking out of action one or more units of multi- unit filters, e.g. for regeneration
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y15/00—Nanotechnology for interacting, sensing or actuating, e.g. quantum dots as markers in protein assays or molecular motors
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y30/00—Nanotechnology for materials or surface science, e.g. nanocomposites
    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F1/00—Treatment of water, waste water, or sewage
    • C02F1/28—Treatment of water, waste water, or sewage by sorption
    • C02F1/283—Treatment of water, waste water, or sewage by sorption using coal, charred products, or inorganic mixtures containing them
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/6825—Nucleic acid detection involving sensors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C12Q1/6874—Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
    • G01N27/28—Electrolytic cell components
    • G01N27/30—Electrodes, e.g. test electrodes; Half-cells
    • G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
    • G01N27/3275—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction
    • G01N27/3277—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction being a redox reaction, e.g. detection by cyclic voltammetry

Definitions

  • the invention relates to compositions and methods useful in the detection of nucleic acids using a variety of amplification techniques, including both signal amplification and target amplification Detection proceeds through the use of an electron transfer moiety (ETM) that is associated with the nucleic acid, either directly or indirectly, to allow electronic detection of the ETM using an electrode
  • ETM electron transfer moiety
  • Gene probe assays currently play roles in identifying infectious organisms such as bacteria and viruses, in probing the expression of normal genes and identifying mutant genes such as oncogenes, in typing tissue for compatibility preceding tissue transplantation, in matching tissue or blood samples for forensic medicine, and for exploring homology among genes from different species
  • a gene probe assay should be sensitive, specific and easily automatable (for a review, see Nickerson, Current Opinion in Biotechnology 4 48-51 (1993))
  • sensitivity i e low detection limits
  • Sensitivity, i e detection limits remain a significant obstacle in nucleic acid detection systems, and a variety of techniques have been developed to address this issue Briefly, these techniques can be classified as either target amplification or signal amplification
  • Target amplification involves the amplification (i e replication) of the target sequence to be detected, resulting in a significant increase in the number of target molecules
  • Target amplification strategies include the polymerase chain reaction (PCR), strand displacement amplification (SDA), and nucleic acid detection methods.
  • amplification strategies include the gase chain reaction (LCR), cycling probe technology (CPT), and the use of "amplification probes” such as "branched DNA” that result in multiple label probes binding to a single target sequence
  • PCR polymerase chain reaction
  • SDA Strand displacement amplification
  • NASBA Nucleic acid sequence based amplification
  • Cycling probe technology is a nucleic acid detection system based on signal or probe amplification rather than target amplification, such as is done in polymerase chain reactions (PCR) Cycling probe technology relies on a molar excess of labeled probe which contains a scissile linkage of RNA Upon hybridization of the probe to the target, the resulting hybrid contains a portion of RNA DNA This area of RNA DNA duplex is recognized by RNAseH and the RNA is excised, resulting in cleavage of the probe The probe now consists of two smaller sequences which may be released, thus leaving the target intact for repeated rounds of the reaction The unreacted probe is removed and the label is then detected CPT is generally described in U S Patent Nos 5,011 ,769, 5,403,711 ,
  • LCR ligation chain reaction
  • Branched DNA signal amplification relies on the synthesis of branched nucleic acids, containing a multiplicity of nucleic acid "arms” that function to increase the amount of label that can be put onto one probe
  • This technology is generally described in U S Patent Nos 5,681 ,702, 5,597,909, 5,545,730, 5,594,117, 5,591 ,584, 5,571 ,670, 5,580,731 , 5,571 ,670, 5,591 ,584, 5,624,802, 5,635,352, 5,594,118, 5,359,100, 5,124,246 and 5,681 ,697, all of which are hereby incorporated by reference
  • dend ⁇ mers of nucleic acids serve to vastly increase the amount of label that can be added to a single molecule, using a similar idea but different compositions
  • This technology is as described in U S Patent No 5,175,270 and Nilsen et al , J Theor Biol 187 273 (1997), both of which are incorporated herein by reference
  • the present invention provides methods for detecting a target nucleic acid sequence
  • the methods comprise hybridizing at least a first primer nucleic acid to the target sequence to form a first hybridization complex, and contacting the first hybridization complex with a first enzyme to form a modified first primer nucleic acid
  • the first hybridization complex is then disassociated These steps may be repeated a plurality of times
  • a first assay complex is then formed comprising at least one ETM and the modified first primer nucleic acid
  • the assay complex is covalently attached to an electrode Electron transfer is then detected between the ETM and the electrode as an indication of the presence of the target sequence
  • the method can include the same method on a second target sequence substantially complementary to the first target sequence
  • the method utilizes a DNA polymerase and the modification to the primer is an extension of the primer such that the polymerase chain reaction (PCR) occurs
  • the method utilizes a ligase and the modification to the primer comprises a ligation of the first primer which hybridizes to a first domain of the first target sequence to a third primer which hybridizes to a second adjacent domain of the first target sequence, such that the ligase chain reaction (LCR) occurs
  • the method utilizes a first primer comprising a first probe sequence, a first scissile linkage and a second probe sequence
  • the enzyme will cleave the first scissile linkage resulting in the separation of the first and the second probe sequences and the disassociation of the hybridization complex while leaving the first target sequence intact, such that the cycling probe technology (CPT) reaction occurs
  • the method utilizes a first enzyme that is a polymerase that extends the first primer to form a modified first primer comprising a first newly synthesized strand, and said method further comprises the addition of a second enzyme comprising a nicking enzyme that nicks the extended first primer leaving the first target sequence intact
  • the method additionally comprises extending from the nick using the polymerase, thereby displacing the first newly synthesized strand and generating a second newly synthesized strand, such that strand displacement amplification (SDA) occurs
  • the method utilizes a first target sequence that is a RNA target sequence, a first primer nucleic acid that is a DNA primer comprising an RNA polymerase promoter, and the first enzyme is a reverse-transcnptase that extends the first primer to form a first newly synthesized DNA strand
  • the method further comprises the addition of a second enzyme comprising an RNA ⁇ egrading enzyme that degrades the first target sequence
  • a third primer is then added that hybridizes to the first newly synthesized DNA strand
  • a third enzyme is added comprising a DNA polymerase that extends the third primer to form a second newly synthesized DNA strand, to form a newly synthesized DNA hybrid
  • a fourth enzyme is then added comprising an RNA polymerase that recognizes the RNA polymerase promoter and generates at least one newly synthesized RNA strand from the DNA hybrid, such that nucleic acid sequence-based amplification (NASBA) occurs
  • NASBA nucleic acid sequence-based amplification
  • the invention provides methods for detecting a target nucleic acid sequence comprising forming a first hybridization complex comprising an amplifier probe and a target sequence, wherein the amplifier probe comprises at least two amplification sequences and hybridizing a first portion of at least one label probe to all or part of at least one amplification sequence A second portion of the label probe is then hybridized to a detection probe covalently attached to an electrode via a conductive oligomer to form a second hybridization complex that contains at least a first electron transfer moiety (ETM) The label probe is then detected by measuring electron transfer between said first ETM and said electrode.
  • the invention provides methods for detecting a target nucleic acid sequence comprising forming a first hybridization complex comprising an amplifier probe and a target sequence, wherein the amplifier probe comprises at least two amplification sequences and wherein the first hybridization complex is covalently attached to an electrode comprising a monolayer comprising conductive oligomers At least one label probe comprising at least one electron transfer moiety (E
  • kits for the detection of a first target nucleic acid sequence comprising at least a first nucleic acid primer substantially complementary to at least a first domain of the target sequence and at least a first enzyme that will modify the first nucleic acid primer
  • the kits additionally comprise an electrode comprising at least one detection probe covalently attached to the electrode via a conductive oligomer
  • Figures 1 A-10 depict depict a number of different compositions of the invention, the results are shown in Example 1 and 2 Figure 1A depicts I, also referred to as P290 Figure 1 B depicts II, also referred to as P291 Figure 1C depicts III, also referred to as W31 Figure 1D depicts IV, also referred to as N6 Figure 1 E depicts V, also referred to as P292 Figure 1 F depicts II, also referred to as C23 Figure 1G depicts VII, also referred to as C15 Figure 1 H depicts VIII, also referred to as C95 Figure 11 depicts Y63 Figure 1 J depicts another compound of the invention Figure 1 K depicts N11 Figure IL rieDJCts C131 with a Dhosphoramidite group and a DMT protecting grouD Figure 1M deDicts W38 also with a phosphoramidite group and a DMT protecting group
  • Figure 1 N depicts the commercially available moiety that enables ' branching' to occur, as its incorporation into a growing
  • Figure 2 depicts the synthetic scheme of a preferred attachment of an ETM, in this case ferrocene, to a nucleoside (in this case adenosine) via an oxo linkage to the ⁇ bose, forming the N6 compound of the invention
  • Figure 3 is similar to Figure 2 except that the nucleoside is cytidine, forming the W38 compound of the invention
  • Figure 4 depicts the synthetic scheme of a preferred attachment of an ETM, in this case ferrocene, to a nucleoside via the phosphate, forming the Y63 compound of the invention
  • Figure 5 depicts the synthetic scheme of a t ⁇ phosphate nucleotide, in this case adenosine, with an attached ETM, in this case ferrocene, via an oxo linkage to the ⁇ bose
  • Figure 6 depicts the use of an activated carboxylate for the addition of a nucleic acid functionalized with a primary amine to a pre-formed SAM
  • Figure 7 depicts a schematic of the use of "universal" type gene chips, utilizing restriction endonuclease sites
  • Figures 8A and 8B depicts two phosphate attachments of conductive oligomers that can be used to add the conductive oligomers at the 5' position, or any position
  • Figure 9 depicts the synthesis of an insulator (C109) to the ⁇ bose of a nucleoside for attachment to an electrode
  • Figure 10 depicts the synthetic scheme of ethylene glycol terminated conductive oligomers
  • Figures 11 A, 11 B and 11C depict the synthesis of three different "branch" points (in this case each using adenosine as the base), to allow the addition of ETM polymers
  • Figure 11 A depicts the synthesis of the N17 compound of the invention
  • Figure 11 B depicts the synthesis of the W90 compound
  • Figure 11C depicts the synthesis of the N38 compound
  • Figure 12 depicts a schematic of the synthesis of simultaneous incorporation of multiple ETMs into a nucleic acid, using the N17 "branch" point nucleoside
  • FIG 13 depicts a schematic of an alternate method of adding large numbers of ETMs simultaneously to a nucleic acid using a "branch" point phosphoramidite, in this case utilizing three branch points (although two branch points are also possible, see for example Figure 1 N) as is known in the art
  • each end point can contain any number of ETMs
  • Figure 14 shows a representative hairpin structure 500 is a target binding sequence, 510 is a loop sequence, 520 is a self-complementary region, 530 is substantially complementary to a detection probe, and 530 is the "sticky end", that is, a portion that does not hybridize to any other portion of the probe, that contains the ETMs
  • Figures 15A, 15B and 15C depict three preferred embodiments for attaching a target sequence to the electrode
  • Figure 15A depicts a target sequence 120 hybridized to a capture probe 100 linked via a attachment linker 106, which as outlined herein may be either a conductive oligomer or an insulator
  • the electrode 105 comprises a monolayer of passivation agent 107, which can comprise conductive oligomers (herein depicted as 108) and/or insulators (herein depicted as 109)
  • n is an integer of at least 1 , although as will be appreciated by those in the art, the system may not utilize a capture probe at all (
  • Figures 16A, 16B, 16C, 16D, 16E, 16F and 16G depict some of the embodiments of the invention All of the monolayers depicted herein show the presence of both conductive oligomers 108 and insulators
  • any one of these structures may be repeated for a particular target sequence, that is, for long target sequences, there may be multiple assay complexes formed Additionally, any of the electrode- attachment embodiments of Figure 15 may be used in any of these systems
  • Figures 16A, 16B and 16D have the target sequence 120 containing the ETMs 135, as discussed herein, these may be added enzymatically, for example during a PCR reaction using nucleotides modified with ETMs, resulting in essentially random incorporation throughout the target sequence, or added to the terminus of the target sequence
  • Figure 16C depicts the use of two different capture probes 100 and 100", that hybridize to different portions of the target sequence 120
  • the 5'-3' orientation of the two capture probes in this embodiment is different
  • Figure 16C depicts the use of label probes 145 that hybridize directly to the target sequence 120
  • Figure 16C shows the use of a label probe 145, comprising a first portion 141 that hybridizes to a portion of the target sequence 120, a second portion 142 comprising ETMs 135
  • Figures 16E, 16F and 16G depict systems utilizing label probes 145 that do not hybridize directly to the target, but rather to amplifier probes that are directly (Figure 16E) or indirectly ( Figures 16F and
  • FIG. 16G hybridized to the target sequence Figure 16E utilizes an amplifier probe 150 has a first portion 151 that hybridizes to the target sequence 120 and at least one second portion 152, i e the amplifier sequence, that hybridizes to the first portion 141 of the label probe Figure 16F is similar, except that a first label extender probe 160 is used, comprising a first portion 161 that hybridizes to the target sequence 120 and a second portion 162 that hybridizes to a first portion 151 of amplifier probe 150 A second portion 152 of the amplifier probe 150 hybridizes to a first portion 141 of the label probe 140, which also comprises a recruitment linker 142 comprising ETMs 135 Figure 16G adds a second label extender probe 170, with a first portion 171 that hybridizes to a portion of the target sequence 120 and a second portion that hybridizes to a portion of the amplifier probe
  • Figure 16H depicts a system that utilizes multiple label probes The first portion 141 of the label probe
  • Figures 17A, 17B, 17C, 17D and 17E depict different possible configurations of label probes and attachments of ETMs
  • the recruitment linker is nucleic acid
  • in Figures 17D and E is is not
  • A nucleoside replacement
  • B attachment to a base
  • C attachment to a nbose
  • D attachment to a phosphate
  • E metallocene polymer (although as described herein, this can be a polymer of other ETMs as well), attached to a base, nbose or phosphate (or other backbone analogs)
  • F dendnmer structure, attached via a base, nbose or phosphate (or other backbone analogs)
  • G attachment via a "branching" structure, through base, nbose or phosphate (or other backbone analogs)
  • H attachment of metallocene (or other ETM) polymers
  • I attachment via a dendnmer structure
  • J attachment using standard link
  • Figure 18 depicts an improvement utilizing a stem-loop probe This can be desirable as it creates torsional strain on the surface-bound probe, which has been shown to increase binding efficiency and in some cases thermodynamic stability
  • the surface bound probe comprises a capture probe 100, a first stem-loop sequence 550, a target binding sequence 560, and a second stem-loop sequence 570 that is substantially complementary to the first stem-loop sequence.
  • the target sequence 120 which can contain the ETMs 135 either directly or indirectly using a label probe 145, the effective concentration of the target at the surface increases
  • Figures 19A-19AA depict some of the sequences used in Example 1
  • Figures 20A - 20O depict representative scans from the experiments outlined in Example 1 Unless otherwise noted, all scans were run at initial voltage -0 11 V, final voltage 0 5 V, with points taken every 10 mV, amplitude of 0 025, frequency of 10 Hz, a sample period of 1 sec, a quiet time of 2 sec
  • Figure 20A has a peak potential of 0 160 V, a peak current of 1 092 X 10 8 A, and a peak A of 7 563 X
  • VA Figure 20C has a peak potential of 0 190 V, a peak current of 2 046 X 10 '7 A, and a peak area of 2 046 X 10 "8 VA Figure 20d has a peak potential of 0 190 V, a peak current of 3 552 X 10 8 A, and a peak A of 3 568 X 10 9
  • VA Figure 20E has a peak potential of 0 190 V, a peak current of 2 3762 X 10 7 A, and a peak area of 2 594 X 10 8
  • VA Figure 20F has a peak potential of 0 180 V, a peak current of 2 992 X 10 -6 A, and a peak area of 2 709 X 10 9 VA Figure 20G has a peak potential of
  • 0 150 V, a peak current of 1 494 X 10 7 A and a peak area of 1 1 X 10 8 VA Figure 20H has a peak potential of 0 160 V, a peak current of 1 967 X 10 8 A, and a peak area of 1 443 X 10 9
  • Figure 21 depicts the ligation chain reaction (LCR) experiment of Example 13
  • Figures 22A and 22B depicts the results of Example 12
  • the "hybrid code' refers to the system number, + and - refer to the presence or absence of the rRNA target
  • Figures 23A, 23B, 23C, 23D, 23E and 23F depict the compositions and results of Example 3
  • FIGS. 24A and 24B depict the compositions and results from Example 13
  • FIGS 25A and 25B depict the set up of two of the experiments of Example 8.
  • Figure 26 shows the results of a PCR experiment as outlined in Example 9
  • Figures 27A, 27B, 27C, 27D, 27E and 2 7 F depict some "mechan ⁇ sm-1" detection systems
  • Figure 27A shows portions of target sequence 120 hybridized to detection probes 300 linked via conductive oligomers 108 to electrode 105
  • the hybridization complex comprises an ETM 135 that can be covalently linked either to the target sequence or the detection probe 300, or non-covalently (i e a hybridization indicator)
  • the monolayer is depicted with insulators 107, although as outlined herein, any type of passivation agent may be used
  • Figure 27B depicts the use of capture probe 100 linked via attachment linker 106 to electrode 105, although as will be appreciated, since the label probe 145 hybridizes to the detection probe 300 this can serve as a type of capture probe
  • a label probe 145 comprising a first portion 141 that hybridizes to a portion of the target sequence 120 and a second portion 142 that hybridizes to the detection probe 300
  • Figure 27C depicts the use of branche
  • Figure 28 depicts an LCR embodiment of the invention
  • a first probe nucleic acid 200 and a second probe nucleic acid 210 are hybridized to a a first and second target domains of a single-stranded target sequence 120
  • the probes are attached, generally through ligation, to form a ligated probe 220
  • the first hybridization complex 225 is denatured, and the process is repeated, to generate a pool of ligated probes 220
  • the unligated probes 200 and 210 are removed as is known in the art, and then the ligated probes 220 are hybridized to detection probes 300 and detected as outlined herein
  • the target domains depicted are directly adjacent, i e contiguous, but gaps that are then filled using nucleotides and polymerase can also be used
  • the probes are depicted with attached ETMs 135, although as will be appreciated, non-covalently attached ETMs may also be used
  • Figure 29 depicts an alternate LCR embodiment of the invention
  • a first probe nucleic acid 200 and a second probe nucleic acid 210 are hybridized to a a first and second target domains of a single- stranded target sequence 120
  • a third probe nucleic acid 200 and a fourth probe nucleic acid 210 are hybridized to a third and fourth target domains of the complementary single-stranded target sequence 125
  • the probes are attached, generally through ligation, to form ligated probes 220 and 221
  • the hybridization complexes 225 and 226 are denatured, and the process is repeated to generate a pool of ligated probes 220 and 221
  • the unligated probes 200, 201, 210 and 211 are removed as is known in the art, and then the ligated probes 220 and 221 are hybridized to detection probes 300 and detected as outlined herein
  • the target domains depicted are directly adjacent, i e contiguous, but gaps that are then filled using nucle
  • Figure 30 depicts a preferred CPT embodiment of the invention
  • Figure 30 depicts a "mechan ⁇ sm-1" system, but as will be appreciated by those in the art, “mechan ⁇ sm-2" systems may be used as well
  • additional probe sequences, and additional scissile linkages may also be used Upon subjection to cleavage conditions, the scissile linkage 11 is cleaved, leaving the two probe sequences 10 and 12 hybridized to the target sequence 120 These probe sequences then disassociate, leaving the probe sequences 10 and 12, and the target sequence 120 The target sequence is then free to hybridize with additional primary probes 1 , and the reaction is repeated, generating a
  • Figure 31 depicts an additional CPT embodiment utilizing a single capture sequence
  • a primary probe 1 comprising a first capture sequence 14, first probe sequence 10, a scissile linkage 11, and a second probe sequence 12, with a covalently attached ETM 135, is added to a target sequence 124, to form a hybridization complex, 6
  • the capture sequence 14 ⁇ oes not hybridize to the target, although it can While Figure 31 depicts only one covalently attached ETM, the other probe sequence
  • the scissile linkage 11 is cleaved, leaving the two probe sequences 10 and 12 hybridized to the target sequence 120 These probe sequences then disassociate, leaving the probe sequences 14-10 and 12, and the target sequence 5 The target sequence is then free to hybridize with additional primary probes 1, and the reaction is repeated, generating a pool of probe sequences
  • the uncleaved primary probes are removed as outlined herein, and the pool of probe sequences is added to an electrode 105, with an optional layer of passivation agent 107, and a detection probe, comprising the substantial complement of the capture sequence 24 and the substantial complement of the first probe sequence 20, covalently attached via conductive oligomers 108
  • detection probes 304 that only comprise probes for the capture sequence The detection probes and the probe sequences form a hybridization complex, 30 Additional ETMs in the form
  • Figure 32 depicts the use of two capture sequences in a CPT aplication
  • a primary probe 1 comprising a first capture sequence 14, a first probe sequence 10, a scissile linkage 11, a second probe sequence 12, and a second capture sequence 15, with two covalently attached ETMs 135, is added to a target sequence 120, to form a hybridization complex, 6
  • the capture sequence 14 does not hybridize to the target, although it can While Figure 32 depicts two covalently attached ETMs, there may be only one or none
  • additional probe sequences, and additional scissile linkages may also be used
  • the scissile linkage 11 is cleaved leaving the two probe sequences with associated capture sequences, 14-10 and 12-15 hybridized to the target sequence 120
  • These probe sequences then disassociate, leaving the probe/capture sequences 14-10 and 12-15, and the target sequence 120
  • the target sequence is then free to hybridize with additional primary probes 1, and the reaction is repeated, generating a pool of probe
  • Figure 33 depicts a similar reaction, where a separation sequence 210 is used to remove the uncleaved scissile probe, in this case a primary probe 1
  • a primary probe 1 comprising a first probe sequence 10, a first scissile linkage 11, a separation sequence 210, a second scissile linkage 11, and a second probe sequence 12, with two covalently attached ETMs 13, is added to a target sequence 120, to form a hybridization complex, 6
  • Other configurations include those depicted While Figure 33 depicts two ETMs, only one of the probe sequences may be covalently labeled with an ETM
  • additional probe sequences, and additional scissile linkages may also be used Upon subjection to cleavage conditions, the scissile linkage 11 is cleaved, leaving the two probe sequences 10 and 12 and the separation sequence 210 hybridized to the target sequence 120
  • the separation sequence does not hybridize to the target, for example when it is at a terminus of the probe, this may be preferred as it
  • Figure 34 depicts the use of solid-support bound primary scissile probes
  • a solid support bead 200 with attached primary probes 1 is added to the target sequence 120, to form a hybridization complex, 6
  • the primary probes may comprise an optional additional sequence 16 (which may be used to stabilize the first scissile linkage hybrid, if necessary), a first scissile linkage 11 , a first probe sequence 10, a second scissile linkage 11, and a second probe sequence 12 While Figure 34 does not utilize covalently attached ETMs, one or more of the probe sequences may be so labelled Furthermore, additional probe sequences, and additional scissile linkages, may also be used Upon subjection to cleavage conditions, the scissile linkage 11 is cleaved, leaving the two probe sequences 10 and 12 hybridized to the target sequence 120 These probe sequences then disassociate, leaving the probe sequences 10 and 12, and the target sequence 120 The target sequence is then free to hybridize with additional primary probes 1, and the reaction is repeated,
  • FIG. 35 depicts the use of bead-bound primary and secondary probes
  • the first type is a solid support bead 250 with attached secondary scissile probes 2 comprising a first scissile linkage 11 , a first secondary probe sequence 60, a second scissile linkage 11, and a second secondary probe sequence 70
  • a second secondary scissile probe may be preferably used, comprising a first scissile linkage 11 , a first secondary probe sequence 80, a second scissile linkage 11, and a second secondary probe sequence 90
  • the present invention is directed to compositions and methods useful in the detection of nucleic acids using a variety of amplification techniques, including both signal amplification and target amplification
  • detection proceeds based on electron transfer, as is described below and generally outlined in U S Patent Nos 5,591 ,578, 5,824,473, 5,770,369, 5,705,348, and 5,780,234, and PCT application WO98/20162, all of which are expressly incorporated herein by reference in their entirety
  • the present invention provides methods of detecting target nucleic acids utilizing amplification
  • target nucleic acid or "target sequence” or grammatical equivalents herein means a nucleic acid sequence on a single strand of nucleic acid
  • the target sequence may be a portion of a gene, a regulatory sequence, genomic DNA, cDNA, RNA including mRNA and rRNA, or others It may be any length, with the understanding that longer sequences are more specific In some embodiments, it may be desirable to
  • probes are made to hybridize to target sequences to determine the presence or absence of the target sequence in a sample Generally speaking, this term will be understood by those skilled in the art
  • the target sequence may also be comprised of different target domains, for example, in "sandwich" type assays as outlined below, a first target domain of the sample target sequence may hybridize to a capture probe or a portion of capture extender probe, a second target domain may hybridize to a portion of an amplifier probe, a label probe, or a different capture or capture extender probe, etc
  • the target domains may be adjacent (i e contiguous) or separated
  • a first primer may hybridize to a first target domain and a second primer may hybridize to a second target domain, either the domains are adjacent, or they may be separated by one or more nucleotides, coupled with the use of a polymerase and dNTPs, as is more fully outlined below
  • first and second are not meant to confer an orientation of the sequences with respect to the 5'-3' orientation of the target sequence
  • first target domain may be located either 5' to the second domain, or 3' to the second domain
  • the target sequence is prepared using known techniques
  • the sample may be treated to lyse the cells, using known lysis buffers, sonication, electroporation, etc , with purification occu ⁇ ng as needed, as will be appreciated by those in the art
  • the reactions outlined herein may be accomplished in a variety of ways, as will be appreciated by those in the art Components of the reaction may be added simultaneously, or sequentially, in any order, with preferred embodiments outlined below
  • the reaction may include a variety of other reagents may be included in the assays These include reagents like salts, buffers, neutral proteins, e g albumin, detergents, etc which may be used to facilitate optimal hybridization and detection, and/or reduce nonspecific or background interactions Also reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc , may be used, depending on the sample preparation methods and purity of the target
  • double stranded target nucleic acids are denatured to render them single stranded so as to permit hybridization of the primers and other probes of the invention
  • a preferred embodiment utilizes a thermal step, generally by raising the temperature of the reaction to about 95°C, although pH changes and other techniques may also be used
  • primer nucleic acid is then contacted to the target sequence to form a hybridization complex
  • primer nucleic acid herein is meant a probe nucleic acid that will hybridize to some portion, i e a domain, of the target sequence
  • Probes of the present invention are designed to be complementary to a target sequence (either the target sequence of the sample or to other probe sequences, as is described below), such that hybridization of the target sequence and the probes of the present invention occurs as outlined below, this complementarity need not be perfect, there may be any number of base pair mismatches which will interfere with hybridization between the target sequence and the single stranded nucleic acids of the present invention However, if the number of mutations is so great that no hybridization can occur under even the least stringent of hybridization conditions, the sequence is not a complementary target sequence
  • substantially complementary herein is meant that the probes are sufficiently complementary to the target sequences to hybridize under normal reaction conditions
  • hybridization conditions may be used in the present invention, including high, moderate and low stringency conditions, see for example Maniatis et ai , Molecular Cloning A Laboratory Manual, 2d Edition, 1989, and Short Protocols in Molecular Biology, ed Ausubel, et al, hereby incorporated by reference
  • Stringent conditions are sequence-dependent and will be different in different circumstances Longer sequences hybridize specifically at higher temperatures An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays" (1993)
  • stringent conditions are selected to be about 5-10°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH
  • Tm is the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequence
  • the assays are generally run under stringency conditions which allows formation of the hybridization complex only in the presence of target Stringency can be controlled by altering a step parameter that is a thermodynamic variable, including, but not limited to, temperature, formamide concentration, salt concentration, chaotropic salt concentration pH, organic solvent concentration, etc
  • Patent No 5,681 ,697 Thus it may be desirable to perform certain steps at higher stringency conditions to reduce non-specific binding
  • nucleic acid or "oligonucleotide” or grammatical equivalents herein means at least two nucleotides covalently linked together
  • a nucleic acid of the present invention will generally contain phosphodiester bonds, although in some cases, as outlined below, nucleic acid analogs are included that may have alternate backbones comprising, for example, phosphoramide (Beaucage et al , Tetrahedron 49(10) 1925 (1993) and references therein, Letsinger, J Org Chem 35 3800 (1970), Sp ⁇ nzl et al , Eur J Biochem 81 579 (1977), Letsinger et al , Nucl Acids Res 14 3487 (1986), Sawai et al, Chem Lett 805 (1984), Letsinger et al , J Am Chem Soc 110 4470 (1988), and Pauwels et al , Chemica Sc ⁇ pta 26 141 9198
  • nucleic acid analogs may find use in the present invention
  • mixtures of naturally occurring nucleic acids and analogs can be made, for example, at the site of conductive oligomer or ETM attachment, an analog structure may be used
  • mixtures of different nucleic acid analogs, and mixtures of naturally occu ⁇ ng nucleic acids and analogs may be made
  • PNA peptide nucleic acids
  • These backbones are substantially non-ionic under neutral conditions, in contrast to the highly charged phosphodiester backbone of naturally occurring nucleic acids
  • Tm melting temperature
  • RNA typically exhibit a 2-4°C drop in Tm for an internal mismatch
  • Tn salt concentration
  • the nucleic acids may be single stranded or double stranded, as specified, or contain portions of both double stranded or single stranded sequence
  • the nucleic acid may be DNA, both genomic and cDNA, RNA or a hybrid, where the nucleic acid contains any combination of deoxy ⁇ bo- and nbo- nucleotides, and any combination of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xathanine hypoxathanine, isocytosine, isoguanine, etc
  • a preferred embodiment utilizes isocytosine and isoguanine in nucleic acids designed to be complementary to other probes, rather than target sequences, as this reduces non-specific hybridization, as is generally described in U S Patent No 5,681 ,702
  • the term "nucleoside” includes nucleotides as well as nucleoside and nucleotide analogs, and modified nucle
  • the size of the primer nucleic acid may vary, as will be appreciated by those in the art, in general varying from 5 to 500 nucleotides in length, with primers of between 10 and 100 being preferred, between 15 and 50 being particularly preferred, and from 10 to 35 being especially preferred, depending on the use and amplification technique
  • the different amplification techniques may have further requirements of the primers, as is more fully described below
  • an enzyme sometimes termed an "amplification enzyme" is used to modify the primer
  • the enzymes may be added at any point during the assay, either prior to, during, or after the addition of the primers.
  • the identification of the enzyme will depend on the amplification technique used, as is more fully outlined below
  • the modification will depend on the amplification technique, as outlined below, although generally the first step of all the reactions herein is an extension of the primer, that is, nucleotides are added to the primer to extend its length
  • the hybridization complex is disassociated Generally, the amplification steps are repeated for a period of time to allow a number of cycles, depending on the number of copies of the original target sequence and the sensitivity of detection, with cycles ranging from 1 to thousands, with from 10 to 100 cycles being preferred and from 20 to 50 cycles being especially preferred
  • the modified primer is incorporated into an assay complex, as is more fully outlined below
  • the assay complex is covalently attached to an electrode, and comprises at least one electron transfer moiety (ETM), described below Electron transfer between the ETM and the electrode is then detected to indicate the presence or absence of the original target sequence, as described below
  • the amplification is target amplification
  • Target amplification involves the amplification (replication) of the target sequence to be detected, such that the number of copies of the target sequence is increased
  • Suitable target amplification techniques include, but are not limited to, the polymerase chain reaction (PCR), strand displacement amplification (SDA), and nucleic acid sequence based amplification (NASBA)
  • the target amplification technique is PCR
  • the polymerase chain reaction (PCR) is widely used and described, and involve the use of primer extension combined with thermal cycling to amplify a target sequence, see U S Patent Nos 4,683,195 and 4,683,202, and PCR Essential Data, J W Wiley & sons, Ed C R Newton, 1995, all of which are incorporated by reference
  • PCR polymerase chain reaction
  • the amplification technique is not PCR
  • PCR may be briefly described as follows A double stranded target nucleic acid is denatured, generally by raising the temperature, and then cooled in the presence of an excess of a PCR primer, which then hybridizes to the first target strand A DNA polymerase then acts to extend the primer, resulting in the synthesis of a new strand forming a hybridization complex The sample is then heated again, to disassociate the hybridization complex, and the process is repeated By using a second PCR primer for the complementary target strand, rapid and exponential amplification occurs
  • PCR steps are denaturation, annealing and extension
  • the particulars of PCR are well known, and include the use of a thermostabile polymerase such as Taq I polymerase and thermal cycling
  • the PCR reaction requires at least one PCR primer and a polymerase
  • the target amplification technique is SDA Strand displacement amplification (SDA) is generally described in Walker et al , in Molecular Methods for Virus Detection,
  • SDA may be described as follows A single stranded target nucleic acid, usually a DNA target sequence, is contacted with an SDA primer
  • An "SDA primer” generally has a length of 25-100 nucleotides, with SDA primers of approximately 35 nucleotides being preferred
  • An SDA primer is substantially complementary to a region at the 3' end of the target sequence, and the primer has a sequence at its 5' end (outside of the region that is complementary to the target) that is a recognition sequence for a restriction endonuclease, sometimes referred to herein as a "nicking enzyme” or a "nicking endonuclease", as outlined below
  • the SDA primer then hybridizes to the target sequence
  • the SDA reaction mixture also contains a polymerase (an “SDA polymerase”, as outlined below) and a mixture of all four deoxynucleoside-t ⁇ phosphates (also called deoxynucleotides or dNTPs, i e
  • SDA primer is modified, i e extended, to form a modified primer, sometimes referred to herein as a "newly synthesized strand"
  • the substituted dNTP is modified such that it will inhibit cleavage in the strand containing the substituted dNTP but will not inhibit cleavage on the other strand
  • suitable substituted dNTPs include, but are not limited, 2'deoxyadenos ⁇ ne 5'-0-(1-th ⁇ otr ⁇ phosphate), 5- methyldeoxycytidine 5'-t ⁇ phosphate, 2'-deoxyu ⁇ d ⁇ ne 5'-t ⁇ phosphate, adn 7-deaza-2'-deoxyguanos ⁇ ne
  • the substitution of the dNTP may occur after incorporation into a newly synthesized strand, for example, a methylase may be used to add methyl groups to the synthesized strand
  • the polymerase may have 5'-3' exonuclease activity
  • the polymerase preferably lacks 5'-3' exonuclease activity
  • the recognition site/endonuclease pair can be any of a wide variety of known combinations
  • the endonuclease is chosen to cleave a strand either at the recognition site, or either 3' or 5' to it, without cleaving the complementary sequence, either because the enzyme only cleaves one strand or because of the incorporation of the substituted nucleotides
  • suitable recognition site/endonuclease pairs are well known in the art, suitable endonucleases include, but are not limited to, Hindi, Malawi, Aval, Fnu4HI, Tthllll, Nell, BstXI, Baml, etc
  • a chart depicting suitable enzymes, and their corresponding recognition sites and the modified dNTP to use is found in U S Patent No 5,455,166 hereby expressly incorporated by reference
  • a polymerase (an "SDA polymerase") is used to extend the newly nicked strand, 5'-3', thereby creating another newly synthesized strand
  • SDA polymerase an "SDA polymerase”
  • suitable polymerases in SDA include, but are not limited to, the Kienow fragment of DNA polymerase I, SEQUENASE 1 0 and SEQUENASE 2 0 (U S Biochemical), T5 DNA polymerase and Ph ⁇ 29 DNA polymerase
  • the SDA reaction requires, in no particular order, an SDA primer, an SDA polymerase, a nicking endonuclease, and dNTPs, at least one species of which is modified
  • SDA does not require thermocycling
  • the temperature of the reaction is generally set to be high enough to prevent non-specific hybridization but low enough to allow specific hybridization, this is generally from about 37°C to about 42°C, depending on the enzymes
  • a second amplification reaction can be done using the complementary target sequence, resulting in a substantial increase in amplification during a set period of time That is, a second primer nucleic acid is hybridized to a second target sequence, that is substantially complementary to the first target sequence, to form a second hybridization complex
  • the addition of the enzyme, followed by disassociation of the second hybridization complex results in the generation of a number of newly synthesized second strands
  • the ETM(s) may be incorporated in three ways (1 ) the primers comprise the ETM(s), for example attached to the base, a nbose, a phosphate, or to analogous structures in a nucleic acid analog, (2) modified nucleosides are used that are modified at either the base or the nbose (or to analogous structures in a nucleic acid analog) with the ETM(s), these ETM modified nucleosides are then
  • indirect detection proceeds as a sandwich assay, with the newly synthesized strands containing few or no ETMs Detection then proceeds via the use of label probes that comprise the
  • these label probes will hybridize either directly to the newly synthesized strand or to intermediate probes such as amplification probes, as is more fully outlined below In this case, it is the ETMs on the label probes that are used for detection as outlined below
  • the target amplification technique is nucleic acid sequence based amplification (NASBA)
  • NASBA nucleic acid sequence based amplification
  • a single stranded target nucleic acid usually an RNA target sequence (sometimes referred to herein as "the first target sequence” or "the first template")
  • RNA target sequence sometimes referred to herein as "the first target sequence” or "the first template”
  • a "NASBA primer” generally has a length of 25- 100 nucleotides, with NASBA primers of approximately 50-75 nucleotides being preferred
  • the first NASBA primer is preferably a DNA primer that has at its 3' end a sequence that is substantially complementary to the 3' end of the first template
  • the first NASBA primer has an RNA polymerase promoter at its 5' end
  • the first NASBA primer is then hybridized to the first template to form
  • RNA-directed DNA polymerase an enzyme capable of synthesizing DNA from a DNA primer and an RNA template Suitable RNA-directed DNA polymerases include, but are not limited to, avian myloblastosis virus reverse transcnptase ("AMV RT”) and the Moloney murine leukemia virus RT
  • the NASBA reaction also includes an RNA degrading enzyme, also sometimes referred to herein as a ⁇ bonuclease, that will hydrolyze RNA of an RNA DNA hybrid without hydrolyzing single- or double-stranded RNA or DNA Suitable nbonucleases include, but are not limited to, RNase H from E coli and calf thymus
  • the ⁇ bonuclease degrades the first RNA template in the hybridization complex, resulting in a disassociation of the hybridization complex leaving a first single stranded newly synthesized DNA strand, sometimes referred to herein as "the second template"
  • the NASBA reaction also includes a second NASBA primer, generally comprising DNA (although as for all the probes herein, including primers, nucleic acid analogs may also be used)
  • This second NASBA primer has a sequence at its 3' end that is substantially complementary to the 3' end of the second template, and also contains an antisense sequence for a functional promoter and the antisense sequence of a transcription initiation site
  • this pnm ⁇ r sequence when used as a template for synthesis of the tlrrd DNA template, contains sufficient information to allow specific and efficient binding of an RNA polymerase and initiation of transcription at the desired site
  • Preferred embodiments utilizes the antisense promoter and transcription initiation site are that of the T7 RNA polymerase, although other RNA polymerase promoters and initiation sites can be used as well, as outlined below.
  • the second primer hybridizes to the second template, and a DNA polymerase, also termed a "DNA- directed DNA polymerase", also present in the reaction, synthesizes a third template (a second newly synthesized DNA strand), resulting in second hybridization complex comprising two newly synthesized DNA strands
  • RNA polymerase ( ⁇ bonucleotides or NTPs) results in the synthesis of an RNA strand (a third newly synthesized strand that is essentially the same as the first template)
  • the RNA polymerase sometimes referred to herein as a "DNA-directed RNA polymerase" recognizes the promoter and specifically initiates RNA synthesis at the initiation site
  • the RNA polymerase preferably synthesizes several copies of RNA per DNA duplex
  • Preferred RNA polymerases include, but are not limited to, T7 RNA polymerase, and other bacteriophage RNA polymerases including those of phage T3, phage ⁇ ll, Salmonella phage sp6, or Pseudomonase phage gh-1
  • the NASBA reaction requires, in no particular order, a first NASBA primer, a second NASBA primer comprising an antisense sequence of an RNA polymerase promoter, an RNA polymerase that recognizes the promoter, a reverse transc ⁇ ptase, a DNA polymerase, an RNA degrading enzyme, NTPs and dNTPs, in addition to the detection components outlined below
  • the detection of the newly synthesized strands can proceed in several ways Direct detection can be done when the newly synthesized strands comprise ETM labels, either by incorporation into the primers or by incorporation of modified labelled nucleotides into the growing strand Alternatively, as is more fully outlined below, indirect detection of unlabelled strands (which now serve as "targets" in the detection mode) can occur using a variety of sandwich assay configurations As will be appreciated by those in the art, it is preferable to detect DNA strands during
  • the amplification technique is signal amplification
  • Signal amplification involves the use of limited number of target molecules as templates to either generate multiple signalling probes or allow the use of multiple signalling probes
  • Signal amplification strategies include LCR, CPT, and the use of amplification probes in sandwich assays
  • the signal amplification technique is LCR, as is generally depicted in Figures 21 , 28 and 29
  • the method can be run in two different ways, in a first embodiment, only one strand of a target sequence is used as a template for ligation (Figure 28), alternatively, both strands may be used (Figure 29) See generally U S Patent Nos 5,185,243 and 5,573,907, EP 0 320 308 B1 , EP 0 336 731 B1 , EP 0 439 182 B1 WO 90/01069, WO 89/12696, and WO 89/09835, and U S S N s
  • the single-stranded target sequence comprises a first target domain and a second target domain, and a first LCR primer and a second LCR primer nucleic acids are added, that are substantially complementary to its respective target domain and thus will hybridize to the target domains
  • target domains may be directly adjacent, i e contiguous, or separated by a number of nucleotides If they are non-contiguous, nucleotides are added along with means to join nucleotides, such as a polymerase, that will add the nucleotides to one of the primers
  • the two LCR primers are then covalently attached, for example using a ligase enzyme such as is known in the art This forms a first hybridization complex comprising the ligated probe and the target sequence This hybridization complex is then denatured (disassociated), and the process is repeated to generate a pool of ligated probes
  • the detection probes described below, comprise a mismatch at the probe junction site, such that
  • LCR is done for two strands of a double-stranded target sequence
  • the target sequence is denatured, and two sets of probes are added one set as outlined above for one strand of the target, and a separate set (i e third and fourth primer robe nucleic acids) for the other strand of the target
  • the first and third probes will hybridize, and the second and fourth probes will hybridize, such that amplification can occur That is, when the first and second probes have been attached, the ligated probe can now be used as a template, in addition to the second target sequence, for the attachment of the third and fourth probes Similarly, the ligated third and fourth probes will serve as a template for the attachment of the first and second probes, in addition to the first target strand In this way, an exponential, rather than just a linear, amplification can occur
  • the detection of the LCR reaction Lan occur directly, in the ca e where one or both of tne primers comprises at least one ETM, o ⁇ ndiiectiy, using sandwich assays, through the use of additional probes, that is, the ligated probes can serve as target sequences, and detection may utilize amplification probes, capture probes, capture extender probes, label probes, and label extender probes, etc
  • a variation of LCR utilizes a "chemical ligation" of sorts, as is generally outlined in U S Patent Nos 5,616,464 and 5,767,259, both of which are hereby expressly incorporated by reference in their entirety
  • a pair of primers are utilized, wherein the first primer is suostantially complementary to a first domain of the target and the second primer is substantially complementary to an adjacent second domain of the target (although, as for LCR, if a "gap" exists, a polymerase and dNTPs may
  • At least one of the side chains of the primers comprises an activatable cross-linking agent, generally covalently attached to the side chain, that upon activation, results in a chemical cross-link or chemical ligation
  • the activatible group may comprise any moiety that will allow cross-linking of the side chains, and include groups activated chemically, photonically and thermally, with photoactivatable groups being preferred
  • a single activatable group on one of the side chains is enough to result in cross-linking via interaction to a functional group on the other side chain, in alternate embodiments, activatable groups are required on each side chain
  • the reaction is subjected to conditions to allow for the disassocation of the hybridization complex, thus freeing up the target to serve as a template for the next ligation or cross-linking In this way, signal amplification occurs, and can be detected as outlined herein
  • the signal amplification technique is CPT CPT technology
  • CPT CPT technology is described in a number of patents and patent applications, including U S Patent Nos 5,011 ,769, 5,403,711 , 5,660,988, and 4,876,187, and PCT published applications WO 95/05480, WO 95/1416, and WO 95/00667, and U S S N 09/014,304, all of which are expressly incorporated by reference in their entirety
  • CPT may be described as follows
  • a CPT primer also sometimes referred to herein as a
  • scissile primer comprises two probe sequences separated by a scissile linkage
  • the CPT primer is substantially complementary to the target sequence and thus will hybridize to it to form a hybridization complex
  • the scissile linkage is cleaved, without cleaving the target sequence, resulting in the two probe sequences being separated
  • the two probe sequences can thus be more easily disassociated from the target, and the reaction can be repeated any number of times
  • the cleaved primer is then detected as outlined herein
  • scissile linkage herein is meant a linkage within the scissile probe that can be cleaved when the probe is part of a hybridization complex, that is, when a double-stranded complex is formed It is important that the scissile linkage cleave only the scissile probe and not the sequence to which it is hybridized (i e either the target sequence or a probe sequence), such that the target sequence may be reused in the reaction for amplification of the signal
  • the scissile linkage is any connecting chemical structure which joins two probe sequences and which is capable of being selectively cleaved without cleavage of either the probe sequences or the sequence to which the scissile probe is hybridized
  • the scissile linkage may be a single bond, or a multiple unit sequence As will be appreciated by those in the art, a number of possible scissile linkages may be used
  • the scissile linkage comprises RNA
  • the entire scissile probe is made of RNA
  • the nicking is facilitated especially when carried out with a double-stranded ⁇ bonuclease, such as RNAseH or Exo III
  • RNA probes made entirely of RNA sequences are particularly useful because first, they can be more easily produced enzymatically, and second, they have more cleavage sites which are accessible to nicking or cleaving by a nicking agent, such as the nbonucleases
  • scissile probes made entirely of RNA do not rely on a scissile linkage since the scissile linkage is inherent in the probe
  • the methods of the invention may be used to detect mismatches, as is generally described in U S. Patent Nos 5,660,988, and WO 95/14106, hereby expressly incorporated by reference These mismatch detection methods are based on the fact that RNAseH may not bind to and/or cleave an RNA DNA duplex if there are mismatches present in the sequence
  • NA, and NA 2 are non-RNA nucleic acids, preferably DNA
  • the mismatch is within the RNA DNA duplex, but in some embodiments the mismatch is present in an adjacent sequence very close to the desired sequence, close enough to affect the RNAseH (generally within one or two bases)
  • the nucleic acid scissile linkage is designed such that the sequence of the scissile linkage reflects the particular sequence to be detected, i e the area of the putative
  • the rate of generation of cleaved fragments, and/or the final amount of cleaved fragments, is quantified to indicate the presence or absence of the target
  • the use of secondary and tertiary scissile probes may be particularly useful in this embodiment, as this can amplify the differences between a perfect match and a mismatch
  • the scissile linkage is between 3 to 5 nucleotides in length, such that a suspected nucleotide difference from 1 nucleotide to 3 nucleotides is encompassed by the scissile linkage, and 0, 1 or 2 nucleotides are on either side of the difference
  • the scissile linkage is nucleic acid
  • preferred embodiments utilize from 1 to about 100 nucleotides, with from about 2 to about 20 being preferred and from about 5 to about 10 being particularly preferred
  • CPT may be done enzymatically or chemically That is, in addition to RNAseH, there are several other cleaving agents which may be useful in cleaving RNA (or other nucleic acid) scissile bonds
  • RNAseH there are several other cleaving agents which may be useful in cleaving RNA (or other nucleic acid) scissile bonds
  • chemical nucleases have been reported, see for example Sigman et al , Annu Rev Biochem 1990, 59, 207-236, Sigman et al , Chem Rev 1993, 93, 2295-2316, Bashkin et al , J Org Chem 1990, 55, 5125-5132, and Sigman et al , Nucleic Acids and Molecular Biology, vol 3, F Eckstein and D M J Lilley (Eds), Spnnger-Verlag, Heidelberg 1989, pp 13-27, all of which are hereby expressly incorporated by reference
  • RNA hydrolysis is also an active area, see for example Chin, Ace Chem Res 1991 , 24, 145- 152, Breslow et al , Tetrahedron, 1991 , 47, 2365-2376, Anslyn et al , Angew Chem Int Ed Engl , 1997, 36, 432-450, and references therein, all of which are expressly incorporated by reference
  • Reactive phosphate centers are also of interest in developing scissile linkages, see Hendry et al , Prog Inorg Chem Bioinorganic Chem 1990, 31 , 201-258 also expressly incorporated by reference
  • RNA hydrolysis Current approaches to site-directed RNA hydrolysis include the conjugation of a reactive moiety capable of cleaving phosphodiester bonds to a recognition element capable of sequence-specifically hybridizing to RNA
  • a metal complex is covalently attached to a DNA strand which forms a stable heteroduplex
  • a Lewis acid is placed in close proximity to the RNA backbone to effect hydrolysis, see Magda et al , J Am Chem Soc 1994, 116, 7439, Hall et al , Chem Biology 1994, 1, 185-190, Bashkin et al , J Am Chem Soc 1994, 116, 5981-5982, Hall et al , Nucleic Acids Res 1996, 24, 3522, Magda et al , J Am Chem Soc 1997, 119, 2293, and Magda et al , J Am Chem Soc 1997, 119, 6947, all of which are expressly incorporated by reference
  • the scissile linkage is not necessarily RNA
  • chemical cleavage moieties may be used to cleave basic sites in nucleic acids, see Belmont, et al ,New J Chem 1997, 21, 47-54, and references therein, all of which are expressly incorporated herein by reference
  • photocleavable moieties for example, using transition metals, may be used, see Moucheron, et al , Inorg Chem 1997, 36, 584-592, hereby expressly by reference
  • the first step of the CPT method requires hybridizing a primary scissile primer (also called a primary scissile probe) obe to the target This is preferably done at a temperature that allows both the binding of the longer primary probe and disassociation of the shorter cleaved portions of the primary probe, as will be appreciated by those in the art As outlined herein, this may be done in solution, or either the target or one or more of the scissile probes may be attached to a solid support
  • anchor probes on a solid support or the electrode which are substantially complementary to a portion of the target sequence, preferably a sequence that is not the same sequence to which a scissile probe will bind
  • a preferred embodiment has one or more of the scissile probes attached to a solid support such as a bead
  • the soluble target diffuses to allow the formation of the hybridization complex between the soluble target sequence and the support-bound scissile probe In this embodiment, it
  • preferred methods utilize cutting or shearing techniques to cut the nucleic acid sample containing the target sequence into a size that will allow sufficient diffusion of the target sequence to the surface of a bead
  • This may be accomplished by shearing the nucleic acid through mechanical forces (e g sonication) or by cleaving the nucleic acid using restriction endonucleases
  • a fragment containing the target may be generated using polymerase, primers and the sample as a template, as in polymerase chain reaction (PCR)
  • PCR polymerase chain reaction
  • amplification of the target using PCR or LCR or related methods may also be done, this may be particularly useful when the target sequence is present in the sample at extremely low copy numbers
  • numerous techniques are known in the art to increase the rate of mixing and hybridization including agitation, heating, techniques that increase the overall concentration such as precipitation, drying, dialysis, centrifugation, electrophoresis magnetic bead concentration, etc
  • the scissile probes are introduced in a molar excess to their targets (including both the target sequence or other scissile probes, for example when secondary or tertiary scissile probes are used), with ratios of scissile probe target of at least about 100 1 being preferred, at least about 1000 1 being particularly preferred, and at least about 10,000 1 being especially preferred In some embodiments the excess of probe target will be much greater In addition, ratios such as these may be used for all the amplification techniques outlined herein
  • the complex is subjected to cleavage conditions As will be appreciated, this depends on the composition of the scissile probe, if it is RNA, RNAseH is introduced It should be noted that under certain circumstances, such as is generally outlined in WO 95/00666 and WO 95/00667, hereby incorporated by reference, the use of a double-stranded binding agent such as RNAseH may allow the reaction to proceed even at temperatures above the Tm of the primary probe target hybridization complex Accordingly, the addition of scissile probe to the target can oe ⁇ one either first, ana then tne cleavage agent or cieavage conditions introduced, or the probes may be added in the presence or the cleavage agent or conditions The cleavage conditions result in the separation of the two (or more) probe sequences of the primary scissile probe As a result, the shorter probe sequences will no longer remain hybridized to the target sequence and
  • RNAseH RNAseH
  • each molecule of the target sequence will turnover between 100 and 1000 times in this period, depending on the length and sequence of the probe, the specific reaction conditions, and the cleavage method For example, for each copy of the target sequence present in the test sample 100 to 1000 molecules will be cleaved by RNAseH Higher levels of amplification can be obtained by allowing the reaction to proceed longer, or using secondary, tertiary, or quaternary probes, as is outlined herein
  • the uncleaved scissile probes Upon completion of the reaction, generally determined by time or amount of cleavage, the uncleaved scissile probes must be removed or neutralized prior to detection, such that the uncleaved probe does not bind to a detection probe, causing false positive signals This may be done in a variety of ways, as is generally described below
  • the separation is facilitated by the use of beads containing the primary probe
  • beads containing the primary probe When the scissile probes are attached to beads, removal of the beads by filtration, centrifugation, the application of a magnetic field, electrostatic interactions for charged beads, adhesion, etc , results in the removal of the uncleaved probes
  • the separation is based on gel electrophoresis of the reaction products to separate the longer uncleaved probe from the shorter cleaved probe sequences as is known in the art
  • the separation is based on strong acid precipitation This is useful to separate long (generally greater than 50 nucleotides) from smaller fragments (generally about 10 nucleotides)
  • a strong acid such as t ⁇ chloroacetic acid
  • the introduction of a strong acid such as t ⁇ chloroacetic acid into the solution causes the longer probe to precipitate, while the smaller cleaved fragments remain in solution
  • the solution can be centrifuged or filtered to remove the precipitate, and the cleaved probe sequences can be quantitated
  • the scissile probe contains both an ETM and an affinity binding ligand or moiety, such that an affinity support is used to carry out the separation
  • the ETM used for detection is not on the same probe sequence that contains the affinity moiety, such that removal of the uncleaved probe, and the cleaved probe containing the affinity moiety, does not remove ail the detectable ETMs
  • the scissile probe may not contain a covalently attached ETM, but just an affinity label Suitable affinity moieties include, but are not limited to, biotin, avidin streptavidin, lectins, haptens, antibodies, etc
  • the binding partner of the affinity moiety is attached to a solid support such as glass beads, latex beads, dextrans etc and used to pull out the uncleaved probes, as is known in the art
  • the cleaved probe sequences, which do not contain the affinity moiety remain in solution and then can be detected as outlined below
  • a separation sequence of nucleic acid is included in the scissile probe, which is not cleaved during the reaction
  • a nucleic acid complementary to the separation sequence is attached to a solid support such as a bead and serves as a catcher sequence
  • the separation sequence is added to the scissile probes, and is not recognized by the target sequence, such that a generalized catcher sequence may be utilized in a variety of assays
  • the uncleaved probe is neutralized by the addition of a substantially complementary neutralization nucleic acid, as is generally depicted in Figure 32
  • a substantially complementary neutralization nucleic acid as is generally depicted in Figure 32
  • the neutralization nucleic acid is a detection probe on the surface of the electrode, at a separate "address", such that the signal from the neutralization hybridization complex does not contribute to the signal of the cleaved fragments
  • the neutralization nucleic acid may be attached to a bead, the neutralization beads are
  • the cleaved probe sequences hybridize to a first detection single-stranded probe covalently attached via a conductive oligomer to an electrode, that thus forms a second hybridization complex
  • the second hybridization complex, comprising detection probe probe sequence contains at least a first ETM
  • this ETM may be covalently attached to either the probe (primer) sequence or the detection probe, or it may be added non-covalently as a hybridization indicator, or both
  • preferred embodiments utilize more than one ETM per hybridization complex for detection
  • the electrode comprises at least a first detection probe which is substantially complementary to all or part of a cleaved portion of the primary scissile probe
  • only one type of detection probe is utilized, which can be substantially complementary to all or part of any probe sequence of the primary probe
  • more than one type of detection probe is utilized, with each detection probe being substantially complementary to all or part of each probe sequence of the primary probe.
  • the detection probes are mixed on the surface of the electrode, such that the signal from each is combined This may be particularly preferred when the target sequence is present in low copy number Alternatively, the detection probes may each be at a different "address" on the surface While this reduces the possible signal from the system, it serves as an internal control in that the signal from each should be equal, all other parameters being equal.
  • different addresses can have different densit'es of probes creating addresses with various sensitivities to target sequences
  • At least one, and preferably more, secondary probes are used.
  • the secondary scissile probes may be added to the reaction in several ways It is important that the secondary scissile probes be prevented from hybridizing to the uncleaved primary probes, as this results in the generation of false positive signal These methods may be described in several ways, depending on whether bead-bound probes are used
  • the primary and secondary probes are bound to solid supports
  • the primary and secondary probes are added together, since generally the support-bound secondary probes will be unable to bind to the uncleaved primary probes on the surface of a bead It is only upon hybridization of the primary probes with the target, resulting in cleavage and release of primary probe sequences from the bead, that the now diffusible primary probe sequences may bind to the secondary probes
  • the primary probe sequences serve as targets for the secondary scissile probes, resulting in cleavage and release of secondary probe sequences
  • the beads containing the primary probes are added, the reaction is allowed to proceed for some period of time, and then the beads containing the secondary probes are added, either with removal of the primary beads or not Alternatively, the beads containing the primary probes are removed and soluble secondary scissile probes are added
  • the complete reaction is done in solution
  • the primary probes are added, the reaction is allowed to proceed for some period of time, and the uncleaved primary scissile probes are removed, as outlined above
  • the secondary probes are then added, and the reaction proceeds
  • the secondary uncleaved probes are then removed, and the cleaved sequences are detected as is generally outlined herein
  • the primary probe sequences may be additionally detected as well
  • preferred embodiments utilize detection probes that are substantially complementary to all or part of each probe sequence of a scissile probe Alternatively, only detection probes for "higher order" probe sequences are used Furthermore, in some embodiments, detection probes for only one of the probe sequences of any scissile probe may be used Furthermore, as outlined above, in these embodiments, as for the others, the detection probes may be separated by sequence, or mixed, depending on the desired results In a preferred embodiment, at least one, and preferably more, tertiary probes are used The tertiary scissile probes may be added to the reaction in several ways It is important that the tertiary scissile probes be prevented from hybridizing to the uncleaved secondary probes, as this results in the generation of false positive signal These methods may be described in several ways, depending on whether bead-bound probes are used
  • the primary, secondary and tertiary probes are bound to solid supports
  • the primary, secondary and tertiary probes are added together, since generally the support-bound secondary probes will be unable to bind to the uncleaved primary probes on the surface of a bead and the support-bound tertiary probes will be unable to bind to the uncleaved secondary probes on the surface of a bead It is only upon hybridization of the scissile probe with its target (i e either the target sequences of the sample for the primary probes, or probe sequences for each of the secondary and tertiary probes), that results in cleavage and release of probe sequences from the bead, that the now diffusable probe sequences may bind to the higher order probes
  • combinations of beads and solution probes are used, with any combination being possible primary probe beads, soluble secondary probes, tertiary beads, soluble primary probes, soluble secondary probes, tertiary beads, primary probe beads, secondary probe beads, soluble tertiary probes, etc What is important is that if soluble probes are used, they must be removed prior to the addition of the next higher order probe
  • the complete reaction is done in solution
  • the primary probes are added, the reaction is allowed to proceed for some period of time, and the uncleaved primary scissile probes are removed, as outlined above
  • the secondary probes are then added, and the reaction proceeds
  • the secondary uncleaved probes are then removed, and the tertiary probes are added, and the reaction proceeds
  • the uncleaved tertiary probes are then removed and the cleaved sequences are detected as is generally outlined herein
  • preferred embodiments utilize detection probes that are substantially complementary to all or part of each probe sequence of a scissile probe Again, the detection sequences may be separated on the electrode, or mixed, to allow the greatest signal amplification
  • CPT requires, again in no particular order, a first CPT primer comprising a first probe sequence, a scissile linkage and a second probe sequence, and a cleavage agent
  • CPT results in the generation of a large amount of cleaved primers, which then can be detected as outlined below
  • the signal amplification technique is a "sandwich" assay, as is generally described in U S S N 60/073,011 and in U S Patent Nos 5,681 ,702, 5,597,909, 5,545,730, 5,594,117, 5,591 ,584, 5,571 ,670, 5,580,731 , 5,571 ,670, 5,591 ,584, 5,624,802, 5,635,352, 5,594,118, 5,359,100, 5,124,246 and 5,681 ,697, all of which are hereby incorporated by reference
  • sandwich assays do not result in the alteration of primers, sandwich assays can be considered signal amplification techniques since multiple signals (i e label probes) are bound to a single target, resulting in the amplification of the signal Sandwich assays are used when the target sequence comprises little or no ETM labels, that is, when a secondary probe, comprising the ETM labels, is used to generate the signal
  • the sandwich assays can be used for the detection of primary target sequences (e g from a patient sample), or as a method to detect the product of an amplification reaction as outlined above, thus for example, any of the newly synthesized strands outlined above, for example using PCR, LCR, NASBA, SDA, etc , may be used as the "target sequence" in a sandwich assay
  • the target sequences are immobilized on the electrode surface This is preferably done using capture probes and optionally one or more capture extender probes, see Figure 15 When only capture probes are utilized, it is necessary to have unique capture probes for each target sequence, that is, the surface must be customized to contain unique capture probes Alternatively, capture extender probes may be used, that allow a "universal" surface, i e a surface containing a single type of capture probe that can be used to detect any target sequence
  • Capture extender probes are generally depicted in Figure 15, and other figures, and have a first portion that will hybridize to all or part of the capture probe, and a second portion that will hybridize to a first portion of the target sequence This then allows the generation of customized soluble probes, which as will be appreciated by those in the art is generally simpler and less costly
  • two capture extender probes may be used This has generally been done to stabilize assay complexes (for example when the target sequence is large, or when large amplifier probes (particularly branched or dendnmer amplifier probes) are used
  • the nucleic acids are added after the formation of the SAM, discussed below This may be done in a variety of ways, as will be appreciated by those in the art
  • conductive oligomers with terminal functional groups are made, with preferred embodiments utilizing activated carboxylates and isothiocyanates, that will react with primary amines that are put onto the nucleic acid, as is generally depicted in Figure 6 using an activated carb
  • binding partner pairs can be utilized, i e one binding partner is attached to the terminus of an attachment linker, described below, and the other to the end of the nucleic acid This may also be done without using a nucleic acid capture probe, that is, one binding partner serves as the capture probe and the other is attached to either the target sequence or a capture extender probe That is, either the target sequence comprises the binding partner, or a capture extender probe that will hybridize to the target sequence comprises the binding partner Suitable binding partner pairs include, but are not limited to, hapten pairs such as biotin/streptavidm, antigens/antibodies, NTA/histidine tags, etc In general, smaller binding partners are preferred, such that the electrons can pass from the nucleic acid into the conductive oligomer to allow detection
  • the binding partner when the target sequence itself is modified to contain a binding partner, the binding partner is attached via a modified nucleotide that can be enzymatically attached to the target sequence, for example during a PCR target amplification step Alternatively, the binding partner should be easily attached to the target sequence
  • a capture extender probe may be utilized that has a nucleic acid portion for hybridization to the target as well as a binding partner (for example, the capture extender probe may comprise a non-nucleic acid portion such as an alkyl linker that is used to attach a binding partner)
  • the capture extender probe may comprise a non-nucleic acid portion such as an alkyl linker that is used to attach a binding partner
  • the target is not bound to the electrode surface using capture probes
  • the assay complex comprising the ETMs may be present on beads that are added to the electrode comprising the monolayer, and then the beads brought into proximity of the electrode surface using techniques well known in the art, including gravity settling of the beads on the surface, electrostatic or magnetic interactions between bead components and the surface, using binding partner attachment as outlined above
  • the assay complex may be driven down to the surface, for example by pulsing the system with a voltage sufficient to drive the assay complex to the surface
  • preferred embodiments utilize assay complexes attached via nucleic acid capture probes
  • an amplifier probe is hybridized to the target sequence, either directly, or through the use of one or more label extender probes, which serves to allow generic" amplifier probes to be made
  • the amplifier probe contains a multiplicity of amplification sequences, although in some embodiments, as described below, the amplifier probe may contain only a single amplification sequence, or at least two amplification sequences
  • the amplifier probe may take on a number of different forms, either a branched conformation, a dendnmer conformation, or a linear "string" of amplification sequences
  • Label probes comprising ETMs then hybridize to the amplification sequences (or in some cases the label probes hybridize directly to the target sequence), and the ETMs are detected using the electrode, as is more fully outlined below
  • the systems of the invention may take on a large number of different configurations, as is generally depicted in Figures 15, 16, 27, etc
  • there are three types of systems that can be used (1) “non-sandwich” systems (also referred to herein as “direct” detection) in which the target sequence itself is labeled with ETMs (again, either because the primers comprise ETMs or due to the incorporation of ETMs into the newly synthesized strand), (2) systems in which label probes directly bind to the target analytes, and (3) systems in which label probes are indirectly bound to the target sequences, for example through the use of amplifier probes
  • compositions comprising an amplifier probe
  • amplifier probe or “nucleic acid multimer” or “amplification multimer” or grammatical equivalents herein is meant a nucleic acid probe that is used to facilitate signal amplification
  • Amplifier probes comprise at least a first single-stranded nucleic acid probe sequence, as defined below, and at least one single- stranded nucleic acid amplification sequence, with a multiplicity of amplification sequences being preferred
  • Amplifier probes comprise a first probe sequence that is used, either directly or indirectly, to hybridize to the target sequence That is, the amplifier probe itself may have a first probe sequence that is substantially complementary to the target sequence, or it has a first probe sequence that is substantially complementary to a portion of an additional probe, in this case called a label extender probe, that has a first portion that is substantially complementary to the target sequence in a preferred embodiment, the first probe sequence of the amplifier probe is substantially complementary to the target sequence
  • the first probe sequence is of a length sufficient to give specificity and stability
  • the probe sequences of the invention that are designed to hybridize to another nucleic acid are at least about 5 nucleosides long, with at least about 10 being preferred and at least about 15 being especially preferred
  • the amplifier probes may form hairpin stem-loop structures in the absence of their target
  • the length of the stem double-stranded sequence will be selected such that the hairpin structure is not favored in the presence of target
  • the use of these type of probes, in the systems of the invention or in any nucleic acid detection systems, can result in a significant decrease in non-specific binding and thus an increase in the signal to noise ratio
  • these hairpin structures comprise four components
  • the first component is a target binding sequence, i e a region complementary to the target (which may be the sample target sequence or another probe sequence to which binding is desired), that is about 10 nucleosides long, with about 15 being preferred
  • the second component is a loop sequence, that can facilitate the formation of nucleic acid loops Particularly preferred in this regard are repeats of GTC, which has been identified in Fragile X Syndrome as forming turns (When PNA analogs are used, turns comprising proiine residues may be preferred) Generally, from three to five repeats are used, with four to five being preferred
  • the third component is a self-complementary region, which has a first portion that is complementary to a portion of the target sequence region and a second portion that comprises a first portion of the label probe binding sequence
  • the fourth component is substantially complementary to a label probe (or other probe, as the case may be)
  • the fourth component further comprises a "sticky end", that is, a portion that does not hybridize to
  • the amplifier probe does not hybridize to the sample target sequence directly, but instead hybridizes to a first portion of a label extender probe
  • a label extender probe This is particularly useful to allow the use of "generic" amplifier probes, that is, amplifier probes that can be used with a variety of different targets This may be desirable since several of the amplifier probes require special synthesis techniques Thus, the addition of a relatively short probe as a label extender probe is preferred
  • the first probe sequence of the amplifier probe is substantially complementary to a first portion or domain of a first label extender single-stranded nucleic acid probe
  • the label extender probe also contains a second portion or domain that is substantially complementary to a portion of the target sequence Both of these portions are preferably at least about 10 to about 50 nucleotides in length, with a range of about 15 to about 30 being preferred
  • first and second are not meant to confer an orientation of the sequences with respect to the 5'-3' orientation of the target or probe sequences For example, assuming a 5'-3' orientation of the complementary
  • more than one label extender probe-amplifier probe pair may be used, that is, n is more than 1 That is, a plurality of label extender probes may be used, each with a portion that is substantially complementary to a different portion of the target sequence, this can serve as another level of amplification
  • a preferred embodiment utilizes pools of at least two label extender probes, with the upper limit being set by the length of the target sequence
  • more than one label extender probe is used with a single amplifier probe to reduce non-specific binding, as is generally outlined in U S Patent No 5,681 ,697, incorporated by reference herein
  • a first portion of the first label extender probe hybridizes to a first portion of the target sequence
  • the second portion of the first label extender probe hybridizes to a first probe sequence of the amplifier probe
  • a first portion of the second label extender probe hybridizes to a second portion of the target sequence
  • the second portion of the second label extender probe hybridizes to a second probe sequence of the amplifier probe
  • the label extender probes may interact with a preamplifier probe, described below, rather than the amplifier probe directly
  • a preferred embodiment utilizes several different amplifier probes, each with first probe sequences that will hybridize to a different portion of the label extender probe
  • the different amplifier probes contain different amplification sequences, although this is generally not preferred
  • the amplifier probe also comprises at least one amplification sequence
  • amplification sequence or “amplification segment” or grammatical equivalents herein is meant a sequence that is used, either directly or indirectly, to bind to a first portion of a label probe as is more fully described below (although in some cases the amplification sequence may bind to a detection probe, see Figure 27C)
  • the amplifier probe comprises a multiplicity of amplification sequences, with from about 3 to about 1000 being preferred, from about 10 to about 100 being particularly preferred, and about 50 being especially preferred In some cases, for example when linear amplifier probes are used, from 1 to about 20 is preferred with from about 5 to about 10 being particularly preferred
  • the amplification sequences may be linked to each other in a variety of ways, as will be appreciated by those in the art They may be covalently linked directly to each other, or to intervening sequences or chemical moieties, through nucleic acid linkages such as phosphodiester bonds, PNA bonds, etc , or through interposed linking agents such ammo acid, carbohydrate or polyol bridges, or through other cross-linking agents or binding partners
  • the s ⁇ te(s) of linkage may be at the ends of a segment, and/or at one or more internal nucleotides in the strand
  • the amplification sequences are attached via nucleic acid linkages
  • branched amplifier probes are used, as are generally described in U S Patent No 5,124,246, hereby incorporated by reference Branched amplifier probes may take on "fork-like” or “comb-like” conformations "Fork-like” branched amplifier probes generally have three or more oligonucleotide segments emanating from a point of origin to form a branched structure The point of origin may be another nucleotide segment or a multifunctional molecule to whcih at least three segments can be covalently or tightly bound "Comb-like" branched amplifier probes have a linear backbone with a multiplicity of sidecha ohgonucleotides extending from the backbone In either conformation, the pendant segments will normally depend from a modified nucleotide or other organic moiety having the appropriate functional groups for attachment of ohgonucleotides Furthermore, in either conformation, a large number of amplification sequences are available for binding, either directly or indirectly, to detection probes In general, these
  • dendnmer amplifier probes are used, as are generally described in U.S. Patent No 5,175,270, hereby expressly incorporated by reference
  • Dend ⁇ me ⁇ c amplifier probes have amplification sequences that are attached via hybridization, and thus have portions of double-stranded nucleic acid as a component of their structure
  • the outer surface of the dendnmer amplifier probe has a multiplicity of amplification sequences
  • linear amplifier probes are used, that have individual amplification sequences linked end-to-end either directly or with short intervening sequences to form a polymer
  • linear amplification probes may form hairpin stem-loop structures, as is depicted in Figure 18
  • the linear amplifier probe has a single amplification sequence This may be useful when cycles of hyb ⁇ dization/disassociation occurs, forming a pool of amplifier probe that was hybridized to the target and then removed to allow more probes to bind, or when large numbers of ETMs are used for each label probe
  • linear amplifier probes comprise a multiplicity of amplification sequences
  • the amplifier probe may be totally linear, totally branched, totally dend ⁇ me ⁇ c, or any combination thereof
  • the amplification sequences of the amplifier probe are used, either directly or indirectly, to bind to a label probe to allow detection
  • the amplification sequences of the amplifier probe are substantially complementary to a first portion of a label probe
  • amplifier extender probes are used, that have a first portion that binds to the amplification sequence and a second portion that binds to the first portion of the label probe
  • compositions of the invention may include "preamplifier” molecules, which serves a bridging moiety between the label extender molecules and the amplifier probes In this way, more amplifier and thus more ETMs are ultimately bound to the detection probes
  • Preamplifier molecules may be either linear or branched, and typically contain in the range of about 30-3000 nucleotides
  • label probes are either substantially complementary to an amplification sequence or to a portion of the target sequence Accordingly, the label probes can be configured in a variety of ways, as is generally described herein, depending on whether a "mechan ⁇ sm-1" or “mechan ⁇ sm-2" detection system is utilized, as described below
  • Detection of the amplification reactions of the invention is done by detecting assay complexes comprising ETMs, which can be attached to the assay complex in a variety of ways, as is more fully described below
  • ETMs electroactive polymer
  • detection of an ETM is based on electron transfer through the stacked ⁇ - orbitals of double stranded nucleic acid
  • This basic mechanism is described in U S Patent Nos 5,591 ,578, 5,770,369, 5,705,348, 5,824,473 and 5,780,234 and WO98/20162, all of which are expressly incorporated by reference, and is termed "mechan ⁇ sm-1" herein Briefly, previous work has shown that electron transfer can proceed rapidly through the stacked ⁇ -orbitals of double stranded nucleic acid, and significantly more slowly through single-stranded nucleic acid Accordingly, this can serve as the basis of an as
  • the ETM can be detected, not necessarily via electron transfer through nucleic acid, but rather can be directly detected using conductive oligomers, that is, the electrons from the ETMs need not travel through the stacked ⁇ orbitals in order to generate a signal
  • the presence of ETMs on the surface of a self-assembled monolayer (SAM), that comprises conductive oligomers can be directly detected
  • SAM self-assembled monolayer
  • mechan ⁇ sm-2 herein
  • a label probe comprising an ETM is brought to the surface, and detection of the ETM can proceed, putatively through the conductive oligomer to the electrode (alternatively, the target sequence comprises the ETMs)
  • the role of the SAM comprising the conductive oligomers is to "raise" the electronic surface of the electrode, while still providing the benefits of shielding the electrode from solution components and reducing the amount of non-specific binding to the electrodes
  • the role of the target sequence is to provide specificity for
  • the assay complexes comprise at least one ETM, which can either be covalently attached to a component of the assay complex as described herein or a "hybridization indicator", described below
  • ETM electrospray donor moiety
  • ETMs electrospray acceptor moiety
  • grammatical equivalents herein refers to molecules capable of electron transfer under certain conditions It is to be understood that electron donor and acceptor capabilities are relative, that is, a molecule which can lose an electron under certain experimental conditions will be able to accept an electron under different experimental conditions It is to be understood that the number of possible electron donor moieties and electron acceptor moieties is very large, and that one skilled in the art of electron transfer compounds will be able to utilize a number of compounds in the present invention
  • Preferred ETMs include, but are not limited to, transition metal complexes, organic ETMs, and electrodes
  • the ETMs are transition metal complexes
  • Transition metals are those whose atoms have a partial or complete d shell of electrons
  • Suitable transition metals for use in the invention include, but are not limited to, cadmium (Cd), copper (Cu), cobalt (Co), palladium (Pd), zinc (Zn), iron (Fe), ruthenium (Ru), rhodium (Rh), osmium (Os), rhenium (Re), platinium (Pt), scandium (Sc), titanium (Ti), Vanadium (V), chromium (Cr), manganese (Mn), nickel (Ni), Molybdenum (Mo), technetium (Tc), tungsten (W), and indium (Ir) That is, the first series of transition metals, the platinum metals (Ru, Rh, Pd, Os, Ir and Pt), along with Fe, Re, W, Mo and Tc, are preferred Particularly preferred are ruthenium, rhenium
  • the transition metals are complexed with a variety of ligands, to form suitable transition metal complexes, as is well known in the art
  • L are the co-ligands, that provide the coordination atoms for the binding of the metal ion
  • the number and nature of the co-ligands will depend on the coordination number of the metal ion
  • Mono-, di- or polydentate co- ligands may be used at any position
  • the co-ligands can be the same or different Suitable ligands fall into two categories ligands which use nitrogen, oxygen, sulfur, carbon or phosphorus atoms (depending on the metal ion) as the coordination atoms (generally referred to in the literature as sigma ( ⁇ ) donors) and organometallic ligands such as metallocene ligands (generally referred to in the literature as pi ( ⁇ ) donors, and depicted herein as L Suitable nitrogen donating ligands are well known in the art
  • Suitable sigma donating ligands using carbon, oxygen, sulfur and phosphorus are known in the art
  • suitable sigma carbon donors are found in Cotton and Wilkenson, Advanced Organic Chemistry, 5th Edition, John Wiley & Sons, 1988, hereby incorporated by reference, see page 38, for example
  • suitable oxygen ligands include crown ethers, water and others known in the art
  • Phosphmes and substituted phosphines are also suitable, see page 38 of Cotton and Wlkenson
  • oxygen, sulfur, phosphorus and nitrogen-donating ligands are attached in such a manner as to allow the heteroatoms to serve as coordination atoms
  • organometallic ligands are used in addition to purely organic compounds for use as redox moieties, and various transition metal coordination complexes with ⁇ -bonded organic ligand with donor atoms as heterocychc or exocyclic substituents, there is available a wide variety of transition metal organometallic compounds with ⁇ -bonded organic ligands (see Advanced Inorganic Chemistry, 5th Ed , Cotton & Wilkinson, John Wiley & Sons, 1988, chapter 26, Organometallics, A Concise Introduction, Elschenbroich et al , 2nd Ed , 1992, VCH, and Comprehensive Organometallic Chemistry II, A Review of the Literature 1982-1994, Abel et al Ed , Vol 7, chapters 7, 8, 10 & 11 ,
  • Such organometallic ligands include cyclic aromatic compounds such as the cyclopentadienide ion [C 5 H 5 (-1)] and various ring substituted and ring fused derivatives, such as the mdenylide (-1) ion, that yield a class of b ⁇ s(cyclopentad ⁇ eyl) metal compounds, (i e the metallocenes), see for example Robins et al , J Am Chem Soc 104 1882-1893 (1982), and Gassman et al , J Am Chem Soc 108 4228-4229 (1986), incorporated by reference Of these, ferrocene [(C 5 H 5 ) 2 Fe] and its derivatives are prototypical examples which have been used in a wide variety of chemical (Connelly et al , Chem Rev 96 877- 910 (1996), incorporated by reference) and electrochemical (Geiger et al , Advances in
  • the ligand is generally attached via one of the carbon atoms of the organometallic ligand, although attachment may be via other atoms for heterocyclic ligands
  • Preferred organometallic ligands include metallocene ligands, including substituted derivatives and the metalloceneophanes (see page 1174 of Cotton and Wilkenson, supra)
  • metallocene ligands such as methylcyclopentadienyl, with multiple methyl groups being preferred, such as pentamethylcyclopentadienyl, can be used to increase the stability of the metallocene
  • methylcyclopentadienyl with multiple methyl groups being preferred, such as pentamethylcyclopentadienyl
  • pentamethylcyclopentadienyl can be used to increase the stability of the metallocene
  • only one of the two metallocene ligands of a metallocene are derivatized
  • any combination of ligands may be used Preferred combinations include a) all ligands are nitrogen donating ligands, b) all ligands are organometallic ligands, and c) one ligand is a metallocene ligand and another is a nitrogen donating ligand, with the other ligands, if needed, are either nitrogen donating ligands or metallocene ligands, or a mixture
  • organic electron donors and acceptors may be covalently attached to the nucleic acid for use in the invention
  • organic molecules include, but are not limited to, riboflavin, xanthene dyes, azme dyes, acndine orange, ⁇ /,/V-d ⁇ methyl-2,7- diazapyrenium dichlonde (DAP 2+ ), methylviologen, ethidium bromide, quinones such as N,N'- d ⁇ methylanthra(2,1 ,9-def6,5,10-d'e'Od ⁇ soqu ⁇ nol ⁇ ne dichlonde (ADIQ 2+ ), porphynns ([meso-tetrak ⁇ s(N- methyl-x-pyr ⁇ d ⁇ n ⁇ um)porphyr ⁇ n tetrachlonde], varlamme blue B hydrochloride, B dschedler's green, 2,6-d ⁇ chloro ⁇ ndophenol
  • the electron donors and acceptors are redox proteins as are known in the art However, redox proteins in many embodiments are not preferred
  • ETMs are metallocenes, with ferrocene being particularly preferred
  • a plurality of ETMs are used The use of multiple ETMs provides signal amplification and thus allows more sensitive detection limits While the use of multiple ETMs on nucleic acids that hybridize to complementary strands (i e mechan ⁇ sm-1 systems) can cause decreases in T m s of the hybridization complexes depending on the number, site of attachment and spacing between the multiple ETMs, this is not a factor when the ETMs are on the recruitment linker, since this does not hybridize to a complementary sequence Accordingly, pluralities of ETMs are preferred, with at least about 2 ETMs per assay complex being preferred, and at least about 10 being particularly preferred, and at least about 20 to 50 being especially preferred In some instances, very large numbers of ETMs (100 to 10000 or greater) can be used
  • Attachment of the ETM to the assay complex can be done in a wide variety of ways, and depends on the mechanism of detection and whether direct or indirect detection is done In general, methods and compositions outlined in WO98/20162, expressly incorporated by reference in its entirety, can be used
  • the label probe is a label probe that comprises the ETMs
  • the label probe is used in a mechan ⁇ sm-2 detection system
  • the portion of the label probe (or target, in some embodiments) that comprises the ETMs can be nucleic acid, or it can be a non-nucleic acid linker that links the first hyb ⁇ dizable portion of the label probe to the ETMs That is, since this portion of the label probe is not required for hybridization if a mechan ⁇ sm-2 system is used, it need not be nucleic acid although this may be done for ease of synthesis
  • the recruitment linker may comprise double-stranded portions
  • the recruitment linker is nucleic acid (including analogs), and attachment of the ETMs can be via (1 ) a base, (2) the backbone, including the nbose, the phosphate, or comparable structures in nucleic acid analogs, (3) nucleoside replacement, described below, or (4) metallocene polymers, as described below
  • the recruitment linker is non-nucleic acid, and can be either a metallocene polymer or an alkyl-type polymer (including heteroalkyl, as is more fully described below) containing ETM substitution groups
  • the ETMs are generally attached via either (1 ) or (2) above, since hybridization of the label probe to a detection probe, as outlined herein, requires the formation of a hybridization complex
  • the recruitment linker is a nucleic acid, and comprises covalently attached ETMs
  • the ETMs may be attached to nucleosides within the nucleic acid in a variety of positions
  • Preferred embodiments include, but are not limited to, (1 ) attachment to the base of the nucleoside, (2) attachment of the ETM as a base replacement, (3) attachment to the backbone of the nucleic acid, including either to a nbose of the ⁇ bose-phosphate backbone or to a phosphate moiety, or to analogous structures in nucleic acid analogs, and (4) attachment via metallocene polymers, with the latter being preferred
  • the recruitment linker is nucleic acid
  • secondary label probes that have a first portion that will hybridize to a portion of the primary label probes and a second portion comprising a recruitment linker as is defined herein This is generally depicted in Figure 16H, this is similar to the use of an amplifier probe, except that both the primary and the secondary label probes comprise ETMs
  • the ETM is attached to the base of a nucleoside as is generally outlined in WO 98/20162, incorporated by reference, for attachment of conductive oligomers Attachment can be to an internal nucleoside or a terminal nucleoside
  • the covalent attachment to the base will depend in part on the ETM chosen, but in general is similar to the attachment of conductive oligomers to bases, as outlined in WO 98/20162 Attachment may generally be done to any position of the base
  • the ETM is a transition metal complex, and thus attachment of a suitable metal ligand to the base leads to the covalent attachment of the ETM
  • similar types of linkages may be used for the attachment of organic ETMs, as will be appreciated by those in the art
  • the C4 attached ammo group of cytosine, the C6 attached ammo group of adenme, or the C2 attached ammo group of guanine may be used as a transition metal ligand
  • Structure 1 depicts a representative structure in the presence of the metal ion and any other necessary ligands, Structure 1 depicts undine, although as for all the structures herein, any other base may also be used
  • L a is a ligand, which may include nitrogen, oxygen, sulfur or phosphorus donating ligands or organometallic ligands such as metallocene ligands
  • Suitable L a ligands include, but not limited to, phenanthroline, imidazole, bpy and terpy L r and M are as defined above
  • a linker (“Z") may be included between the nucleoside and the ETM
  • the linkage may be done using a linker, which may utilize an amide linkage (see generally Telser et al , J Am Chem Soc 111 7221-7226 (1989), Telser et al , J Am Chem. Soc 111 7226-7232 (1989), both of which are expressly incorporated by reference)
  • a linker which may utilize an amide linkage (see generally Telser et al , J Am Chem Soc 111 7221-7226 (1989), Telser et al , J Am Chem. Soc 111 7226-7232 (1989), both of which are expressly incorporated by reference)
  • L is a ligand as defined above, with L r and M as defined above as well
  • L is ammo, phen, byp and terpy
  • the ETM attached to a nucleoside is a metallocene, i e the L and L r of Structure 2 are both metallocene ligands, L m , as described above Structure 3 depicts a preferred embodiment wherein the metallocene is ferrocene, and the base is undine, although other bases may be used
  • Preferred metallocenes include ferrocene, cobaltocene and osmiumocene
  • the ETM is attached to a nbose at any position of the ⁇ bose-phosphate backbone of the nucleic acid, i e either the 5' or 3' terminus or any internal nucleoside Ribose in this case can include ribose analogs
  • nucleosides that are modified at either the 2' or 3' position of the ribose can be made, with nitrogen, oxygen, sulfur and phosphorus-containing modifications possible Ammo-modified and oxygen-modified ribose is preferred See generally WO 95/15971 and WO 98/20162, incorporated herein by reference
  • modification groups may be used as a transition metal ligand, or as a chemically functional moiety for attachment of other transition metal ligands and organometallic ligands, or organic electron donor moieties as will be appreciated by those in the art
  • a linker such as depicted herein for "Z" may be used as well, or
  • a metallocene serves as the ETM, and is attached via an amide bond as depicted below in Structure 4
  • the examples outline the synthesis of a preferred compound when the metallocene is ferrocene
  • amine linkages are used, as is generally depicted in Structure 5
  • Z is a linker, as defined herein, with 1-16 atoms being preferred and 2-4 atoms being particularly preferred, and t is either one or zero
  • oxo linkages are used, as is generally depicted in Structure 6
  • an ETM is attached to a phosphate at any position of the ⁇ bose-phosphate backbone of the nucleic acid
  • phosphodiester bond analogs such as phosphoramide or phosphoramidite linkages may be incorporated into a nucleic acid, where the heteroatom (i e nitrogen) serves as a transition metal ligand (see PCT publication WO 95/15971 and WO 98/20162, incorporated by reference)
  • the conductive oligomers depicted in Structures 23 and 24 of WO98/20162 may be replaced by ETMs
  • the composition has the structure shown in Structure 7
  • alkyl-based linkers can be used to create multiple branching structures comprising one or more ETMs at the terminus of each branch Generally, this is done by creating branch points containing multiple hydroxy groups, which optionally can then be used to add additional branch points
  • terminal hydroxy groups can then be used in phosphoramidite reactions to add ETMs, as is generally done below for the nucleoside replacement and metallocene polymer reactions
  • an ETM such as a metallocene is used as a "nucleoside replacement", serving as an ETM
  • the distance between the two cyclopentadiene rings of ferrocene is similar to the orthongonal distance between two bases in a double stranded nucleic acid
  • Other metallocenes in addition to ferrocene may be used, for example, air stable metallocenes such as those containing cobalt or ruthenium
  • metallocene moieties may be incorporated into the backbone of a nucleic acid, as is generally depicted in Structure 8 (nucleic acid with a ⁇ bose-phosphate backbone) and Structure 9 (peptide nucleic acid backbone) Structures 8 and 9 depict ferrocene, although as will be appreciated by those in the art, other metallocenes may be used as well
  • air stable metallocenes are preferred, including metallocenes utilizing ruthenium and cobalt as the metal
  • Z is a linker as defined above, with generally short, alkyl groups, including heteroatoms such as oxygen being preferred Generally, what is important is the length of the linker, such that minimal perturbations of a double stranded nucleic acid is effected, as is more fully described below Thus, methylene, ethylene, ethylene glycols, propylene and butylene are all preferred, with ethylene and ethylene glycol being particularly preferred.
  • each Z linker may be the same or different Structure 8 depicts a ⁇ bose-phosphate backbone, although as will be appreciated by those in the art, nucleic acid analogs may also be used, including ribose analogs and phosphate bond analogs
  • ETMs in addition to metallocenes, as nucleoside replacements or in polymer embodiments, described below
  • the ETM is a transition metal complex other than a metallocene, comprising one, two or three (or more) ligands
  • the ligands can be functionalized as depicted for the ferrocene to allow the addition of phosphoramidite groups
  • Particularly preferred in this embodiment are complexes comprising at least two ring (for example, aryl and substituted aryl) ligands, where each of the ligands comprises functional groups for attachment via phosphoramidite chemistry
  • this type of reaction creating polymers of ETMs either as a portion of the backbone of the nucleic acid or as "side groups" of the nucleic acids, to allow amplification of the signals generated herein, can be done
  • nucleic acid analogs are made, that is, the invention provides nucleic acids having a backbone comprising at least one metallocene
  • a metallocene such as ferrocene (or other ETM)
  • nucleic acids having a backbone comprising at least one metallocene
  • two nucleic acids each made up of a traditional nucleic acid or analog may be covalently attached to each other via a metallocene
  • a metallocene derivative or substituted metallocene is provided, wherein each of the two aromatic rings of the metallocene has a nucleic acid substitutent group
  • nucleic acid substitutent groups it is also desirable in some instances to add additional substituent groups to one or both of the aromatic rings of the metallocene (or ETM)
  • additional substituent groups to one or both of the aromatic rings of the metallocene (or ETM)
  • these nucleoside replacements are generally part of probe sequences to be hybridized with a substantially complementary nucleic acid, for example a target sequence or another probe sequence
  • substitutent groups to the metallocene rings to facilitate hydrogen bonding to the base or bases on the opposite strand
  • substitutent groups include, but are not limited to, amide groups, amine groups, carboxylic acids, and alcohols, including substituted alcohols
  • these substitutent groups can be attached via linkers as well, although in general this is not preferred
  • substituent groups on an ETM may be added to alter the redox properties of the ETM
  • substituent groups on an ETM may be added to alter the redox properties of the ETM
  • substituent groups on the metallocene may allow two different ETMs to be distinguished
  • the intermediate components are also provided.
  • the invention provides phosphoramidite metallocenes, as generally depicted in Structure 10
  • PG is a protecting group, generally suitable for use in nucleic acid synthesis, with DMT, MMT and TMT all being preferred
  • the aromatic rings can either be the rings of the metallocene, or aromatic rings of ligands for transition metal complexes or other organic ETMs
  • the aromatic rings may be the same or different, and may be substituted as discussed herein
  • Structure 11 depicts the ferrocene derivative
  • Structure 12 depicts the ferrocene peptide nucleic acid (PNA) monomer, that can be added to PNA synthesis as is known in the art and depicted within the Figures and Examples
  • the PG protecting group is suitable for use in peptide nucleic acid synthesis, with MMT, boc and Fmoc being preferred
  • ETM or metallocene polymers which are added to the nucleic acids, rather than as backbone replacements, as is more fully described below
  • the ETMs are attached as polymers, for example as metallocene polymers, in a "branched" configuration similar to the "branched DNA” embodiments herein and as outlined in U S Patent No 5,124,246, using modified functionalized nucleotides
  • the general idea is as follows A modified phosphoramidite nucleotide is generated that can ultimately contain a free hydroxy group that can be used in the attachment of phosphoramidite ETMs such as metallocenes
  • This free hydroxy group could be on the base or the backbone, such as the ribose or the phosphate (although as will be appreciated by those in the art, nucleic acid analogs containing other structures can also be used)
  • the modified nucleotide is incorporated into a nucleic acid, and any hydroxy protecting groups are removed, thus leaving the free hydroxyl
  • a phosphoramidite ETM such as a metallocene, as described above in structures 10 and 1
  • ETMs such as metallocene ETMs
  • Additional phosphoramidite ETMs such as metallocenes can be added, to form "ETM polymers", including "metallocene polymers" as depicted herein, particularly for ferrocene
  • it is desirable to increase the solubility of the polymers by adding a 'capping" group to the terminal ETM in the polymer, for example a final phosphate group to the metallocene as is generally depicted in Figure 12
  • a preferred embodiment of this general idea is outlined in the Figures
  • the 2' position of a ribose of a phosphoramidite nucleotide is first functionalized to contain a protected hydroxy group, in this case via an oxo-lmkage, although any number of linkers can be used, as is generally described herein for Z linkers
  • the protected modified nucleotide is then incorporated via standard phosphoramidite chemistry into a growing nucleic acid
  • the protecting group is removed, and the free hydroxy group is used, again using standard phosphoramidite chemistry to add a phosphoramidite metallocene such as ferrocene
  • a similar reaction is possible for nucleic acid analogs
  • nucleic acid analogs For example, using peptide nucleic acids and the metallocene monomer shown in Structure 12, peptide nucleic acid structures containing metallocene polymers could be generated
  • the present invention provides recruitment linkers of nucleic acids comprising "branches" of metallocene polymers as is generally depicted in Figures 12 and 13 Preferred embodiments also utilize metallocene polymers from one to about 50 metallocenes in length, with from about 5 to about
  • the recruitment linker is nucleic acid
  • any combination of ETM attachments may be done
  • the recruitment linker is not nucleic acid, and instead may be any sort of linker or polymer
  • any linker or polymer that can be modified to contain ETMs can be used
  • the polymers or linkers should be reasonably soluble and contain suitable functional groups for the addition of ETMs
  • a "recruitment polymer” comprises at least two or three subunits, which are covalently attached At least some portion of the monome ⁇ c subunits contain functional groups for the covalent attachment of ETMs
  • coupling moieties are used to covalently link the subunits with the ETMs
  • Preferred functional groups for attachment are ammo groups, carboxy groups, oxo groups and thiol groups, with ammo groups being particularly preferred
  • Suitable linkers include, but are not limited to, alkyl linkers (including heteroalkyl (including (poly)ethylene glycol-type structures), substituted alkyl, aryalkyl linkers, etc As above for the polymers, the linkers will comprise one or more functional groups for the attachment of ETMs, which will be done as will be appreciated by those in the art, for example through the use homo-or hetero- bifunctional linkers as are well known (see 1994 Pierce Chemical Company catalog, technical section on cross-linkers, pages 155-200, incorporated herein by reference)
  • Suitable recruitment polymers include, but are not limited to, functionalized styrenes, such as ammo styrene, functionalized dextrans, and polyamino acids
  • Preferred polymers are polyamino acids (both poly-D-ammo acids and poly-L-amino acids), such as polylysme, and polymers containing lysme and other ammo acids being particularly preferred
  • Other suitable polyamino acids are polyglutamic acid, polyaspartic acid, co-polymers of lysme and glutamic or aspartic acid, co-polymers of lysme with alanme, tyrosine, phenylalanme, se ⁇ ne, tryptophan, and/or prolme
  • the recruitment linker comprises a metallocene polymer, as is described above
  • the attachment of the recruitment linkers to the first portion of the label probe will depend on the composition of the recruitment linker, as will be appreciated by those in the art
  • the recruitment linker is nucleic acid
  • it is generally formed during the synthesis of the first portion of the label probe, with incorporation of nucleosides containing ETMs as required
  • the first portion of the label probe and the recruitment linker may be made separately, and then attached
  • attachment of the linker/polymer of the recruitment linker will be done generally using standard chemical techniques, such as will be appreciated by those in the art
  • attachment can be similar to the attachment of insulators to nucleic acids
  • recruitment linkers that are mixtures of nucleic acids and non-nucleic acids, either in a linear form (i e nucleic acid segments linked together with alkyl linkers) or in branched forms (nucleic acids with alkyl "branches" that may contain ETMs and may be additionally branched)
  • the ETM is attached to the target sequence, either by incorporation into a primer, or by incorporation into the newly synthesized portion of the target sequence
  • Target sequences comprising covalently attached ETMs can be directly detected using either a mechan ⁇ sm-1 or mechan ⁇ sm-2 system, as is shown in the figures
  • the target sequence itself that carries the ETMs, rather than the recruitment linker of a label probe
  • this may be done using target sequences that have ETMs incorporated at any number of positions, including either within a primer or within the newly synthesized strand, and can be attached to the nucleic acid in a variety of positions, as outlined herein
  • the 3'-5' orientation of the probes and targets is chosen to get the ETM-contaming structures (i e label probes, recruitment linkers or target sequences) as close to the surface of the monolayer as possible, and in the correct orientation This may be done using attachment via insulators or conductive oligomers as is generally shown in the
  • multiple capture probes can be utilized, either in a configuration wherein the 5'-3' orientation of the capture probes is different, or where "loops" of target form when multiples of capture probes are used
  • t ⁇ phosphate nucleotides comprising the ETMs of the invention to a growing nucleic acid, for example during the previously described amplification techniques
  • some of the modified nucleotides of the invention for example the "nucleoside replacement" embodiments and putatively some of the phosphate attachments, may or may not be recognized by the enzymes to allow incorporation into a growing nucleic acid Therefore, preferred attachments in this embodiment are to the base or ribose of the nucleotide
  • nucleotides comprising ETMs to the terminus of a nucleic acid, for example a target nucleic acid, as is more fully outlined below
  • an effective "recruitment linker" is added to the terminus of the target sequence, that can then be used for detection
  • ETMs may be connected to probe sequences, i e sequences designed to hybridize to complementary sequences
  • ETMs may be added to non-recruitment linkers as well
  • ETMs may be added to sections of label probes that do hybridize to components of the assay complex, for example the first portion, or to the target sequence as outlined above
  • These ETMs may be used for electron transfer detection in some embodiments, or they may not, depending on the location and system
  • the target sequence containing randomly incorporated ETMs is hybridized directly to the capture probe, as is depicted in
  • ETMs there may be ETMs in the portion hybridizing to the capture probe If the capture probe is attached to the electrode using a conductive oligomer, these ETMs can be used to detect electron transfer as has been previously described Alternatively, these ETMs may not be specifically detected
  • the recruitment linker when the recruitment linker is nucleic acid, it may be desirable in some instances to have some or all of the recruitment linker be double stranded
  • the first recruitment linker comprises the covalently attached ETMs
  • the second recruitment linker contains the ETMs, and the first recruitment linker does not, and the ETMs are recruited to the surface by hybridization of the second recruitment linker to the first
  • both the first and second recruitment linkers comprise ETMs It should be noted, as discussed above, that nucleic acids comprising a large number of ETMs may not hybridize as well, i e the T m may be decreased, depending on the site of attachment and the characteristics of the ETM Thus, in general, when multiple ETMs are used on hybridizing strands, generally there are less than about 5, with less than about 3 being preferred, or alternatively the ETM
  • Hybridization indicators include mtercalators and minor and/or major groove binding moieties
  • mtercalators may be used, since intercalation generally only occurs in the presence of double stranded nucleic acid, only in the presence of double stranded nucleic acid will the
  • the systems of the invention may utilize non-covalently attached ETMs, as is generally described in Napier et al , Bioconj Chem 8 906 (1997), hereby expressly incorporated by reference
  • ETMs non-covalently attached ETMs
  • DNA i e guanine oxidation by ruthenium complexes
  • SAMs comprising conductive oligomers
  • FIG. 16 A va ⁇ ety of mechan ⁇ sm-2 systems are depicted in Figure 16, again showing direct detection (i e target sequence comprising the ETM), and indirect detection (using label probes)
  • the label probes directly hybridize to the target sequences, as is generally depicted in the figures
  • the target sequence is preferably, but not required to be, immobilized on the surface using capture probes, including capture extender probes
  • Label probes are then used to bring the ETMs into proximity of the surface of the monolayer comprising conductive oligomers
  • multiple label probes are used, that is, label probes are designed such that the portion that hybridizes to the target sequence can be different for a number of different label probes, such that amplification of the signal occurs, since multiple label probes can bind for every target sequence
  • n is an integer of at least one
  • n is from 1 to 50, with from about 1 to about 20 being particularly preferred, and from about 2 to about 5 being especially preferred.
  • label extender probes can be used as generally described below for use with amplifier probes
  • the configuration of the system and the label probes are designed to recruit the ETMs as close as possible to the monolayer surface
  • the label probes are hybridized to the target sequence indirectly That is, the present invention finds use in novel combinations of signal amplification technologies and electron transfer detection on electrodes, which may be particularly useful in sandwich hybridization assays, as generally depicted in the Figures
  • the amplifier probes of the invention are bound to the target sequence in a sample either directly or indirectly Since the amplifier probes preferably contain a relatively large number of amplification sequences that are available for binding of label probes, the detectable signal is significantly increased, and allows the detection limits of the target to be significantly improved
  • These label and amplifier probes, and the detection methods described herein may be used in essentially any known nucleic acid hybridization formats, such as those in which the target is bound directly to a solid phase or in sandwich hybridization assays in which the target is bound to one or more nucleic acids that are in turn bound to the solid phase
  • the assay complexes of the invention are detected using electrodes
  • an electrode herein is meant a composition, which, when connected to an electronic device, is able to sense a current or charge and convert it to a signal
  • an electrode can be defined as a composition which can apply a potential to and/or pass electrons to or from species in the solution
  • an electrode is an ETM as described herein
  • Preferred electodes include but are not limited to, certain metals and their oxides, including gold, platinum, palladium, silicon, aluminum, metal oxide electrodes including platinum oxide, titanium oxide, tin oxide, indium tin oxide, palladium oxide, silicon oxide, aluminum oxide, molybdenum oxide (Mo 2 0 6 ), tungsten oxide (W0 3 ) and ruthenium oxides, and carbon (including glassy carbon electrodes, graphite and carbon paste)
  • Preferred electrodes include gold, silicon, platinum, carbon and metal oxide electrodes, with gold being particularly preferred
  • the electrodes described herein are depicted as a flat surface, which is only one of the possible conformations of the electrode and is for schematic purposes only
  • the conformation of the electrode will vary with the detection method used
  • flat planar electrodes may be preferred for optical detection methods, or when arrays of nucleic acids are made, thus requiring addressable locations for both synthesis and detection
  • the electrode may be in the form of a tube, with the SAMs comprising conductive oligomers and nucleic acids bound to the inner surface
  • Electrode coils may be preferred in some embodiments as well This allows a maximum of surface area containing the nucleic acids to be exposed to a small volume of sample
  • the detection electrode comprises a self-assembled monolayer (SAM) comprising conductive oligomers
  • SAM self-assembled monolayer
  • monolayer or “self-assembled monolayer” or “SAM” herein is meant a relatively ordered assembly of molecules spontaneously chemisorbed on a surface, in which the molecules are oriented approximately parallel to each other and roughly perpendicular to the surface Each of the molecules includes a functional group that adheres to the surface, and a portion that interacts with neighboring molecules in the monolayer to form the relatively ordered array
  • a "mixed" monolayer comprises a heterogeneous monolayer, that is, where at least two different molecules make up the monolayer
  • the SAM may comprise conductive oligomers alone, or a mixture of conductive oligomers and insulators As outlined herein, the efficiency of oligonucleotide hybridization may increase when the analyte is at a distance from the electrode Similarly, non-specific binding of biomolecules, including the target analytes,
  • the monolayer comprises conductive oligomers
  • conductive oligomer herein is meant a substantially conducting oligomer, preferably linear, some embodiments of which are referred to in the literature as ' molecular wires"
  • substantially conducting herein is meant that the oligomer is capable of transfe ⁇ ng electrons at 100 Hz
  • the conductive oligomer has substantially overlapping ⁇ -orbitals, i e conjugated ⁇ -orbitals, as between the monomenc units of the conductive oligomer, although the conductive oligomer may also contain one or more sigma ( ⁇ ) bonds
  • a conductive oligomer may be defined functionally by its ability to inject or receive electrons into or from an associated ETM
  • the conductive oligomer is more conductive than the insulators as defined herein
  • the conductive oligomers of the invention are to be distinguished from electroactive polymers, that themselves may donate or accept electrons
  • the conductive oligomers have a conductivity, S, of from between about 10 "6 to about 10 4 ⁇ 1 cm 1 , with from about 10 5 to about 10 3 ⁇ 1 cm 1 being preferred, with these S values being calculated for molecules ranging from about 20A to about 200A
  • insulators have a conductivity S of about 10 7 ⁇ 1 cm 1 or lower, with less than about 10 8 ⁇ 1 cm 1 being preferred See generally Gardner et al , Sensors and Actuators A 51 (1995) 57-66, incorporated herein by reference
  • Desired characteristics of a conductive oligomer include high conductivity, sufficient solubility in organic solvents and/or water for synthesis and use of the compositions of the invention, and preferably chemical resistance to reactions that occur i) during binding ligand synthesis (i e nucleic acid synthesis, such that nucleosides containing the conductive oligomers may be added to a nucleic acid synthesizer during the synthesis of the compositions of the invention, n) during the attachment of the conductive oligomer to an electrode, or in) during binding assays
  • conductive oligomers that will promote the formation of self-assembled monolayers are preferred
  • oligomers of the invention comprise at least two monome ⁇ c subunits, as described herein As is described more fully below, oligomers include homo- and hetero-o gomers, and include polymers
  • the conductive oligomer has the structure depicted in Structure 13
  • the conductive oligomer of Structure 1 may be attached to ETMs, such as electrodes, transition metal complexes, organic ETMs, and metallocenes, and to binding ligands such as nucleic acids, or to several of these Unless otherwise noted, the conductive oligomers depicted herein will be attached at the left side to an electrode, that is, as depicted in Structure 1 , the left "Y" is connected to the electrode as described herein If the conductive oligomer is to be attached to a binding ligand, the right "Y", if present, is attached to the binding ligand such as a nucleic acid, either directly or through the use of a linker, as is described herein
  • Y is an aromatic group
  • n is an integer from 1 to 50
  • g is either 1 or zero
  • e is an integer from zero to 10
  • m is zero or 1
  • D is preferably carbonyl, or a heteroatom moiety, wherein the heteroatom is selected from oxygen, sulfur, nitrogen, silicon or phosphorus
  • suitable heteroatom moieties include, but are not limited to, -NH and -
  • aromatic group or grammatical equivalents herein is meant an aromatic monocyclic or polycyclic hydrocarbon moiety generally containing 5 to 14 carbon atoms (although larger polycyclic rings structures may be made) and any carbocy c ketone or thioketone derivative thereof, wherein the carbon atom with the free valence is a member of an aromatic ring
  • Aromatic groups include arylene groups and aromatic groups with more than two atoms removed
  • aromatic includes heterocycle
  • Heterocycle or “heteroaryl” means an aromatic group wherein 1 to 5 of the indicated carbon atoms are replaced by a heteroatom chosen from nitrogen, oxygen, sulfur, phosphorus, boron and silicon wherein the atom with the free valence is a member of an aromatic ring, and any heterocyclic ketone and thioketone derivative thereof
  • heterocycle includes thienyl, furyl, pyrrolyl, py ⁇ midinyl, oxalyl, mdolyl
  • the Y aromatic groups of the conductive oligomer may be different, i e the conductive oligomer may be a heterooiigomer That is, a conductive oligomer may comprise a oligomer of a single type of Y groups, or of multiple types of Y groups
  • the aromatic group may be substituted with a substitution group, generally depicted herein as R R groups may be added as necessary to affect the packing of the conductive oligomers, i e R groups may be used to alter the association of the oligomers in the monolayer R groups may also be added to 1) alter the solubility of the oligomer or of compositions containing the oligomers, 2) alter the conjugation or electrochemical potential of the system, and 3) alter the charge or characteristics at the surface of the monolayer
  • R groups are preferred to increase solubility when solution synthesis is done
  • the R groups, and their positions are chosen to minimally effect the packing of the conductive oligomers on a surface, particularly within a monolayer, as described below
  • the R groups are chosen to minimally effect the packing of the conductive oligomers on a surface, particularly within a monolayer, as described below
  • only small R groups are used within the monolayer, with larger R groups generally above the surface of the monolayer
  • attachment of methyl groups to the portion of the conductive oligomer within the monolayer to increase solubility is preferred, with attachment of longer alkoxy groups, for example, C3 to C10, is preferably done above the monolayer surface
  • this generally means that attachment of ste ⁇ cally significant R groups is not done on any of the first two or three oligomer subunits, depending on the average length of the molecules making up the monolayer
  • Suitable R groups include, but are not limited to, hydrogen, alkyl, alcohol, aromatic, ammo, amido, nitro
  • alkyl group or grammatical equivalents herein is meant a straight or branched chain alkyl group, with straight chain alkyl groups being preferred If branched, it may be branched at one or more positions, and unless specified, at any position
  • the alkyl group may range from about 1 to about 30 carbon atoms (C1 -C30), with a preferred embodiment utilizing from about 1 to about 20 carbon atoms (C1 -C20), with about C1 through about C12 to about C15 being preferred, and C1 to C5 being particularly preferred, although in some embodiments the alkyl group may be much larger
  • cycloalkyl groups such as C5 and C6 rings, and heterocyclic rings with nitrogen, oxygen, sulfur or phosphorus
  • Alkyl also includes heteroalkyl, with heteroatoms of sulfur, oxygen, nitrogen, and silicone being preferred
  • Alkyl includes substituted alkyl groups
  • substituted alkyl group herein is meant an alkyl group further comprising
  • nitro group herein is meant an -N0 2 group
  • sulfur containing moieties herein is meant compounds containing sulfur atoms, including but not limited to thia-, thio- and sulfo- compounds, thiols (-SH and -SR), and sulfides (-RSR-)
  • phosphorus containing moieties herein is meant compounds containing phosphorus, including, but not limited to, phosphmes and phosphates
  • silicon containing moieties herein is meant compounds containing silicon
  • ether herein is meant an -O-R group
  • Preferred ethers include alkoxy groups, with -0-(CH 2 ) 2 CH 3 and -0-(CH 2 ) 4 CH 3 being preferred
  • esters herein is meant a -COOR group
  • halogen herein is meant bromine, iodine, chlorine, or fluorine
  • Preferred substituted alkyls are partially or fully halogenated alkyls such as CF 3 , etc
  • aldehyde herein is meant -RCHO groups
  • alcohol herein is meant -OH groups, and alkyl alcohols -ROH
  • ethylene glycol or "(poly)ethylene glycol” herein is meant a -(0-CH 2 -CH 2 ) n - group, although each carbon atom of the ethylene group may also be singly or doubly substituted, i e -(0-CR 2 -CR 2 ) n -, with
  • substitution groups include, but are not limited to, methyl, ethyl, propyl, alkoxy groups such as -0-(CH 2 ) 2 CH 3 and -0-(CH 2 ) 4 CH 3 and ethylene glycol and derivatives thereof
  • Preferred aromatic groups include, but are not limited to, phenyl, naphthyl, naphthalene, anthracene, phenanthrolme, pyrole, py ⁇ dine, thiophene, porphy ⁇ ns, and substituted derivatives of each of these, included fused ring derivatives
  • B-D is a bond linking two atoms or chemical moieties
  • B-D is a conjugated bond, containing overlapping or conjugated ⁇ -orbitals
  • B-D bonds are acetylene, alkene, amide, and substituted derivatives of these three, and azo Especially preferred B-D bonds are acetylene, alkene and amide
  • B or D may include carbon, nitrogen or silicon
  • substitution groups are as defined as above for R
  • the D moiety may be carbonyl or a heteroatom moiety as defined above
  • the terminal B-D bond may be an amide bond
  • the rest of the B-D bonds may be acetylene bonds
  • amide bonds when amide bonds are present, as few amide bonds as possible are preferable, but in some embodiments all the B-D bonds are amide bonds
  • B-D bond may be present in the conductive oligomer within a monolayer as described below, and another type above the monolayer level, for example to give greater flexibility for nucleic acid hybridization when the nucleic acid is attached via a conductive oligomer
  • n is an integer from 1 to 50, although longer oligomers may also be used (see for example Schumm et al , Angew Chem Int Ed Engl 1994 33(13) 1360) Wthout being bound by theory, it appears that for efficient hybridization of nucleic acids on a surface, the hybridization should occur at a distance from the surface, i e the kinetics of hybridization increase as a function of the distance from the surface, particularly for long ohgonucleotides of 200 to 300 basepairs Accordingly, when a nucleic acid is attached via a conductive oligomer, as is more fully described below, the length of the conductive oligomer is such that the closest nucleotide of the nucleic acid is positioned from about 6A to about 100A (although distances of up to 500A may be used) from the electrode surface, with from about 15A to about 60A being preferred and from about 25A to about 60A also being preferred Accordingly, n will depend on
  • m is either 0 or 1 That is, when m is 0, the conductive oligomer may terminate in the B-D bond or D moiety, i e the D atom is attached to the nucleic acid either directly or via a linker
  • the conductive oligomer may terminate in the B-D bond or D moiety, i e the D atom is attached to the nucleic acid either directly or via a linker
  • the conductive oligomer may terminate in the B-D bond or D moiety, i e the D atom is attached to the nucleic acid either directly or via a linker
  • the conductive oligomer may terminate in Y, an aromatic group, i e the aromatic group is attached to the nucleic acid or linker
  • conductive oligomers falling withm the Structure 1 and Structure 8 formulas, as well as other conductive oligomers, as are generally known in the art, including for example, compounds comprising fused aromatic rings or Teflon®-hke oligomers, such as -(CF 2 ) n -, -(CHF) n - and -(CFR) n - See for example, Schumm et al , Angew Chem Intl Ed Engl 33 1361 (1994), Grosshenny et al , Platinum Metals Rev 40(1) 26-35 (1996), Tour, Chem Rev 96 537-553 (1996), Hsung et al , Organometallics 14 4808-4815 (1995, and references cited therein, all of which are expressly incorporated by reference
  • Structure 14 is Structure 13 when g is 1 Preferred embodiments of Structure 14 include e is zero, Y is pyrole or substituted pyrole, e is zero, Y is thiophene or substituted thiophene, e is zero, Y is furan or substituted furan, e is zero, Y is phenyl or substituted phenyl, e is zero, Y is pyndme or substituted pyndme, e is 1 , B-D is acetylene and Y is phenyl or substituted phenyl (see Structure 16 below) A preferred embodiment of Structure 14 is also when e is one, depicted as Structure 15 below Structure 15
  • Preferred embodiments of Structure 15 are Y is phenyl or substituted phenyl and B-D is azo, Y is phenyl or substituted phenyl and B-D is acetylene, Y is phenyl or substituted phenyl and B-D is alkene, Y is pyndme or substituted pyndme and B-D is acetylene, Y is thiophene or substituted thiophene and B-D is acetylene, Y is furan or substituted furan and B-D is acetylene, Y is thiophene or furan (or substituted thiophene or furan) and B-D are alternating alkene and acetylene bonds
  • any Structure 15 oligomers may be substituted with any of the other structures depicted herein, i e Structure 13 or 20 oligomer, or other conducting oligomer, and the use of such Structure 15 depiction is not meant to limit the scope of the invention
  • Structure 15 includes Structures 16, 17, 18 and 19, depicted below
  • Structure 16 Particularly preferred embodiments of Structure 16 include n is two, m is one, and R is hydrogen, n is three, m is zero, and R is hydrogen, and the use of R groups to increase solubility Structure 17
  • the conductive oligomers are pseudopeptide oligomers
  • the amide bond in Structure 17 is depicted with the carbonyl to the left, i e - CONH-, the reverse may also be used, i e -NHCO-
  • Particularly preferred embodiments of Structure 17 include n is two, m is one, and R is hydrogen, n is three, m is zero, and R is hydrogen (in this embodiment, the terminal nitrogen (the D atom) may be the nitrogen of the ammo-modified ribose), and the use of R groups to increase solubility
  • Preferred embodiments of Structure 18 include the first n is two, second n is one, m is zero, and all R groups are hydrogen, or the use of R groups to increase solubility
  • Preferred embodiments of Structure 19 include the first n is three, the second n is from 1-3, with m being either 0 or 1, and the use of R groups to increase solubility
  • the conductive oligomer has the structure depicted in Structure 20 Structure 20
  • C are carbon atoms
  • n is an integer from 1 to 50
  • m is 0 or 1
  • J is a heteroatom selected from the group consisting of oxygen, nitrogen, silicon, phosphorus, sulfur, carbonyl or sulfoxide
  • the G bond of each subunit may be the same or different than the G bonds of other subunits, that is, alternating oligomers of alkene and acetylene bonds could be used, etc However, when G is an alkane bond, the number of alkane bonds in the
  • the m of Structure 20 is zero In a particularly preferred embodiment, m is zero and G is an alkene bond, as is depicted in Structure 21 Structure 21
  • alkene oligomer of structure 21 are generally depicted in the preferred trans configuration, although oligomers of s or mixtures of trans and cis may also be used As above, R groups may be added to alter the packing of the compositions on an electrode, the hydrophihcity or hydrophobicity of the oligomer, and the flexibility, i e the rotational, torsional or longitudinal flexibility of the oligomer n is as defined above
  • R is hydrogen, although R may be also alkyl groups and polyethylene glycols or derivatives
  • the conductive oligomer may be a mixture of different types of oligomers, for example of structures 13 and 20
  • the monolayer comprises conductive oligomers, and the terminus of at least some of the conductive oligomers in the monolayer are electronically exposed
  • electroconductive oligomers may or may not have terminal groups
  • there is no additional terminal group and the conductive oligomer terminates with one of the groups depicted in the structures, for example, a B-D bond such as an acetylene bond
  • a terminal group is added, sometimes depicted herein as "Q"
  • a terminal group may be used for several reasons, for example, to contribute to the electronic availability of the conductive oligomer for detection of ETMs, or to alter the surface of the SAM for other reasons, for example to prevent non-specific binding
  • Q A terminal group may be used for several reasons, for example, to contribute to the electronic availability of the conductive oligomer for detection of ETMs, or to alter the surface of the SAM for other reasons, for example to prevent non-specific binding
  • terminal groups may facilitate detection, and some may prevent non-specific binding
  • the monolayer may comprise different conductive oligomer species, although preferably the different species are chosen such that a reasonably uniform SAM can be formed
  • the monolayer may comprise different conductive oligomer species, although preferably the different species are chosen such that a reasonably uniform SAM can be formed
  • capture binding ligands such as nucleic acids are covalently attached to the electrode using conductive oligomers
  • preferred embodiments utilize conductive oligomers that terminate below the surface of the rest of the monolayer, i e below the insulator layer, if used, or below some fraction of the other conductive oligomers
  • the use of different conductive oligomers may be done to facilitate monolayer formation, or to make monolayers with altered properties
  • the monolayer may further comprise insulator moieties
  • insulator herein is meant a substantially nonconducting oligomer, preferably linear
  • substantially nonconducting herein is meant that the insulator will not transfer electrons at 100 Hz The rate of electron transfer through the insulator is preferrably slower than the rate through the conductive oligomers described herein
  • the insulators have a conductivity, S, of about 10 7 ⁇ 1 cm 1 or lower, with less than about 10 8 ⁇ 1 cm 1 being preferred See generally Gardner et al , supra
  • insulators are alkyl or heteroalkyl oligomers or moieties with sigma bonds, although any particular insulator molecule may contain aromatic groups or one or more conjugated bonds
  • heteroalkyl herein is meant an alkyl group that has at least one heteroatom, i e nitrogen, oxygen, sulfur, phosphorus, silicon or boron included in the chain
  • the insulator may be quite similar to a conductive oligomer with the addition of one or more heteroatoms or bonds that serve to inhibit or slow, preferably substantially, electron transfer
  • Suitable insulators include, but are not limited to, -(CH 2 ) n -, -(CRH) ⁇ -, and - (CR 2 ) n -, ethylene glycol or derivatives using other heteroatoms in place of oxygen, i e nitrogen or sulfur (sulfur derivatives are not preferred when the electrode is gold)
  • the insulators may be substituted with R groups as defined herein to alter the packing of the moieties or conductive oligomers on an electrode, the hydrophihcity or hydrophobicity of the insulator, and the flexibility, i e the rotational, torsional or longitudinal flexibility of the insulator
  • R groups as defined herein to alter the packing of the moieties or conductive oligomers on an electrode, the hydrophihcity or hydrophobicity of the insulator, and the flexibility, i e the rotational, torsional or longitudinal flexibility of the insulator
  • branched alkyl groups may be used
  • the insulators may contain terminal groups, as outlined above, particularly to influence the surface of the monolayer
  • the length of the species making up the monolayer will vary as needed As outlined above, it appears that binding of target analytes (for example, hybridization of nucleic acids) is more efficient at a distance from the surface
  • the species to which capture binding ligands are attached (as outlined below, these can be either insulators or conductive oligomers) may be basically the same length as the monolayer forming species or longer than them, resulting in the capture binding ligands being more accessible to the solvent for hybridization
  • the conductive oligomers to which the capture binding ligands are attached may be shorter than the monolayer
  • the actual combinations and ratios of the different species making up the monolayer can vary widely, and will depend on whether mechantsm-1 or -2 is used Generally, three component systems are preferred for mechan ⁇ sm-2 systems, with the first species comprising a capture binding ligand containing species (termed a capture probe when the target analyte is a nucleic acid), attached to the electrode via either an insulator or a conductive oligomer
  • the second species are the conductive oligomers
  • the third species are insulators
  • the first species can comprise from about 90% to about 1%, with from about 20% to about 40% being preferred
  • the target analytes are nucleic acids
  • from about 30% to about 40% is especially preferred for short oligonucleotide targets and from about 10% to about 20% is preferred for longer targets
  • the second species can comprise from about 1% to about 90%, with from about 20% to about 90% being preferred, and from about 40% to about 60% being especially preferred
  • the third species can comprise from about 1% to about 90%
  • the covalent attachment of the conductive oligomers and insulators to the electrode may be accomplished in a variety of ways, depending on the electrode and the composition of the insulators and conductive oligomers used
  • the attachment linkers (which can comp ⁇ se insulators and conductive oligomers), which are used to covalently attach nucleic acid species (capture and detection probes) to the electrode, are attached in a similar manner
  • one end or terminus of the attachment linker is attached to the nucleoside or nucleic acid, and the other is attached to an electrode
  • the attachment linker may be attached at two sites to the electrode, as is generally depicted in Structures 23-25 Generally, some type of linker is used, as depicted below as "A" in Structure
  • A is a linker or atom
  • A may be a sulfur moiety when a gold electrode is used
  • A may be a silicon (silane) moiety attached to the oxygen of the oxide (see for example Chen et al , Langmuir 10 3332-3337 (1994), Lenhard et al , J Electroanal Chem 78 195-201 (1977), both of which are expressly incorporated by reference)
  • A may be an ammo moiety (preferably a primary amine, see for example Deinhammer et al , Langmuir 10 1306-1313 (1994))
  • preferred A moieties include, but are not limited to, silane moieties, sulfur moieties (including alkyl sulfur moieties), and ammo moieties
  • epoxide type linkages with redox polymers such
  • the insulators and conductive oligomers may be attached to the electrode with more than one "A" moiety, the "A" moieties may be the same or different
  • the electrode is a gold electrode
  • "A" is a sulfur atom or moiety
  • multiple sulfur atoms may be used to attach the conductive oligomer to the electrode, such as is generally depicted below in Structures 23, 24 and 25
  • the A moiety is just a sulfur atom, but substituted sulfur moieties may also be used
  • a conductive oligomer terminating in a single carbon atom with three sulfur moities attached to the electrode may also comprise a "Q" terminal group
  • the electrode is a gold electrode, and attachment is via a sulfur linkage as is well known in the art, i e the A moiety is a sulfur atom or moiety Although the exact characteristics of the gold-sulfur attachment are not known, this linkage is considered covalent for the purposes of this invention
  • a representative structure is depicted in Structure 26, using the Structure 15 conductive oligomer, although as for all the structures depicted herein, any of the conductive oligomers, or combinations of conductive oligomers, may be used Similarly, any of the conductive oligomers or insulators may also comprise terminal groups as described herein Structure 26 depicts the "A" linker as comprising just a sulfur atom, although additional atoms may be present (i e linkers from the sulfur to the conductive oligomer or substitution groups) In addition, Structure 26 shows the sulfur atom attached to the Y aromatic group, but as will be appreciated by those in the art, it may be attached to the B-D group (i e an acety
  • thiol linkages are preferred when either two sets of electrodes are used (i e the detection electrodes comprising the SAMs are not used at high electrophoretic voltages (i e greater than 800 or 900 mV), that can cause oxidation of the thiol linkage and thus loss of the SAM), or, if one set of electrodes is used, lower electrophoretic voltages are used as is generally described below
  • the electrode is a carbon electrode, i e a glassy carbon electrode, and attachment is via a nitrogen of an amine group
  • a representative structure is depicted in Structure 27 Again, additional atoms may be present, i e Z type linkers and/or terminal groups
  • the oxygen atom is from the oxide of the metal oxide electrode
  • the Si atom may also contain other atoms, i e be a silicon moiety containing substitution groups
  • Other attachments for SAMs to other electrodes are known in the art, see for example Napier et al , Langmuir, 1997, for attachment to indium tin oxide electrodes, and also the chemisorption of phosphates to an indium tin oxide electrode (talk by H Holden Thorpe, CHI conference, May 4-5, 1998)
  • the electrode comprises either capture probes to anchor the assay complexes to the electrode (used in either mechan ⁇ sm-1 or mechan ⁇ sm-2 systems), or detection probes (for mechan ⁇ sm-1 systems) Since the capture probes are not used for detection, the capture probes may be attached using attachment linkers, which may include either conductive oligomers or insulators, as described below Detection probes used in mechan ⁇ sm-1 systems are attached using conductive oligomers
  • the capture probe nucleic acid is covalently attached to the electrode, via an “attachment linker", that can be either a conductive oligomer (required for mechan ⁇ sm-1 systems) or an insulator
  • an “attachment linker” can be either a conductive oligomer (required for mechan ⁇ sm-1 systems) or an insulator
  • covalently attached herein is meant that two moieties are attached by at least one bond, including sigma bonds, pi bonds and coordination bonds
  • nucleic acid or other binding ligand
  • the other end is attached to the electrode
  • any of structures depicted herein may further comprise a nucleic acid effectively as a terminal group
  • the present invention provides compositions comprising nucleic acids covalently attached to electrodes as is generally depicted below in Structure 29 Structure 29
  • F is a linkage that allows the covalent attachment of the electrode and the conductive oligomer or insulator, including bonds, atoms or linkers such as is described herein, for example as "A", defined below
  • F 2 is a linkage that allows the covalent attachment of the conductive oligomer or insulator to the nucleic acid, and may be a bond, an atom or a linkage as is herein described
  • F 2 may be part of the conductive oligomer, part of the insulator, part of the nucleic acid, or exogeneous to both, for example, as defined herein for "Z”
  • the capture probe nucleic acid is covalently attached to the electrode via a conductive oligomer
  • the covalent attachment of the nucleic acid and the conductive oligomer may be accomplished in several ways In a preferred embodiment, the attachment is via attachment to the
  • the conductive oligomer is attached to the base of a nucleoside of the nucleic acid This may be done in several ways, depending on the oligomer, as is described below In one embodiment, the oligomer is attached to a terminal nucleoside, i e either the 3' or 5' nucleoside of the nucleic acid Alternatively, the conductive oligomer is attached to an internal nucleoside
  • the point of attachment to the base will vary with the base Generally, attachment at any position is possible In some embodiments, for example when the probe containing the ETMs may be used for hybridization (i e mechan ⁇ sm-1 systems) , it is preferred to attach at positions not involved in hydrogen bonding to the complementary base Thus, for example, generally attachment is to the 5 or 6 position of py ⁇ midines such as undine, cytosme and thymine For pu ⁇ nes such as adenme and guanine, the linkage is preferably via the 8 position Attachment to non-standard bases is preferably done at the comparable positions
  • the attachment is direct, that is, there are no intervening atoms between the conductive oligomer and the base
  • conductive oligomers with terminal acetylene bonds are attached directly to the base Structure 30 is an example of this linkage, using a Structure 15 conductive oligomer and undine as the base, although other bases and conductive oligomers can be used as will be appreciated by those in the art Structure 30
  • the pentose structures depicted herein may have hydrogen, hydroxy, phosphates or other groups such as ammo groups attached in addition, the pentose and nucleoside structures depicted herein are depicted non-conventionally, as mirror images of the normal rendering In addition, the pentose and nucleoside structures may also contain additional groups, such as protecting groups, at any position, for example as needed during synthesis
  • the base may contain additional modifications as needed, i e the carbonyl or amine groups may be altered or protected
  • the attachment is any number of different Z linkers, including amide and amine linkages, as is generally depicted in Structure 31 using undine as the base and a Structure 15 oligomer
  • Z is a linker
  • Z is a short linker of about 1 to about 10 atoms, with from
  • Linkers are known in the art, for example, homo-or hetero-bifunctional linkers as are well known (see 1994 Pierce Chemical Company catalog, technical section on cross-linkers, pages 155-200, incorporated herein by reference)
  • Preferred Z linkers include, but are not limited to, alkyl groups (including substituted alkyl groups and alkyl groups containing heteroatom moieties), with short alkyl groups, esters, amide, amine, epoxy groups and ethylene glycol and derivatives being preferred, with propyl, acetylene, and C 2 alkene being especially preferred Z may also be a sulfone group, forming sulfonamide linkages as discussed below
  • the attachment of the nucleic acid and the conductive oligomer is done via attachment to the backbone of the nucleic acid This may be done in a number of ways, including attachment to a ribose of the ⁇ bose-phosphate backbone, or to the phosphate of the backbone, or other groups of analogous backbones
  • the site of attachment in this embodiment may be to a 3' or 5' terminal nucleotide, or to an internal nucleotide, as is more fully described below
  • the conductive oligomer is attached to the ribose of the ⁇ bose-phosphate backbone This may be done in several ways As is known in the art, nucleosides that are modified at either the 2' or 3' position of the ribose with ammo groups, sulfur groups, silicone groups, phosphorus groups, or oxo groups can be made (Imazawa et al , J Org Chem , 44 2039 (1979), Hobbs et al , J Org Chem 42(4) 714 (1977), Verheyden et al , J Orrg Chem 36(2) 250 (1971), McGee et al , J
  • a preferred embodiment utilizes ammo-modified nucleosides These ammo-modified ⁇ boses can then be used to form either amide or amine linkages to the conductive oligomers
  • the ammo group is attached directly to the ribose, although as will be appreciated by those in the art, short linkers such as those described herein for "Z" may be present between the ammo group and the ribose
  • an amide linkage is used for attachment to the ribose
  • m is zero and thus the conductive oligomer terminates in the amide bond
  • the nitrogen of the ammo group of the amino- modified ribose is the "D" atom of the conductive oligomer
  • Structure 32 has the terminal bond fixed as an amide bond
  • a heteroatom linkage is used, i e oxo, amine, sulfur, etc
  • a preferred embodiment utilizes an amine linkage
  • the nitrogen of the ammo-modified ribose may be the "D" atom of the conductive oligomer when the Structure 3 conductive oligomer is used
  • Structures 33 and 34 depict nucleosides with the Structures 13 and 21 conductive oligomers, respectively, using the nitrogen as the heteroatom, athough other heteroatoms can be used
  • both m and t are not zero
  • a preferred Z here is a methylene group, or other aliphatic alkyl linkers One, two or three carbons in this position are particularly useful for synthetic reasons
  • Suitable linkers include methylene and ethylene
  • the conductive oligomer is covalently attached to the nucleic acid via the phosphate of the ⁇ bose-phosphate backbone (or analog) of a nucleic acid
  • the attachment is direct, utilizes a linker or via an amide bond
  • Structure 35 depicts a direct linkage
  • Structure 36 depicts linkage via an amide bond (both utilize the Structure 13 conductive oligomer, although Structure 20 conductive oligomers are also possible)
  • Structures 35 and 36 depict the conductive oligomer in the 3' position, although the 5' position is also possible
  • both Structures 35 and 36 depict naturally occurring phosphodiester bonds, although as those in the art will appreciate, non-standard analogs of phosphodiester bonds may also be used
  • Structure 36 depicts a preferred embodiment, wherein the terminal B-D bond is an amide bond, the terminal Y is not present, and Z is a linker, as defined herein Structure 36
  • the conductive oligomer is covalently attached to the nucleic acid via a transition metal ligand
  • the conductive oligomer is covalently attached to a ligand which provides one or more of the coordination atoms for a transition metal
  • the ligand to which the conductive oligomer is attached also has the nucleic acid attached, as is generally depicted below in Structure 37
  • the conductive oligomer is attached to one ligand, and the nucleic acid is attached to another ligand, as is generally depicted below in Structure 38
  • the conductive oligomer is covalently attached to the nucleic acid
  • Both of these structures depict Structure 13 conductive oligomers, although other oligomers may be utilized Structures 37 and 38 depict two representative structures
  • metal ions to connect the nucleic acids can serve as an internal control or calibration of the system, to evaluate the number of available nucleic acids on the surface
  • metal tons are used to connect the nucleic acids to the conductive oligomers
  • this metal ion complex has a different redox potential than that of the ETMs used in the rest of the system, as described below
  • the amount of capture probe on an electrode may be compared to the amount of hybridized double stranded nucleic acid to quantify the amount of target sequence in a sample
  • This is quite significant to serve as an internal control of the sensor or system This allows a measurement either prior to the addition of target or after, on the same molecules that will be used for detection, rather than rely on a similar but different control system
  • the actual molecules that will be used for the detection can be
  • the capture probe nucleic acids are covalently attached to the electrode via an insulator
  • insulators such as alkyl groups
  • the attachment of nucleic acids to insulators such as alkyl groups is well known, and can be done to the base or the backbone, including the ribose or phosphate for backbones containing these moieties, or to alternate backbones for nucleic acid analogs
  • there may be one or more different capture probe species on the surface there may be one type of capture probe, or one type of capture probe extender, as is more fully described below
  • different capture probes, or one capture probes with a multiplicity of different capture extender probes can be used
  • substrates comprising at least one detection electrode comprising monolayers and capture and/or detection probes, useful in target analyte detection systems
  • compositions of the invention are generally synthesized as outlined below, generally utilizing techniques well known in the art As will be appreciated by those in the art, many of the techniques outlined below are directed to nucleic acids containing a ⁇ bose-phosphate backbone However, as outlined above, many alternate nucleic acid analogs may be utilized, some of which may not contain either ribose or phosphate in the backbone In these embodiments, for attachment at positions other than the base, attachment is done as will be appreciated by those in the art, depending on the backbone Thus, for example, attachment can be made at the carbon atoms of the PNA backbone, as is described below, or at either terminus of the PNA
  • compositions may be made in several ways A preferred method first synthesizes a conductive oligomer attached to a nucleoside, with addition of additional nucleosides to form the capture probe followed by attachment to the electrode Alternatively, the whole capture probe may be made and then the completed conductive oligomer added, followed by attachment to the electrode Alternatively, a monolayer of conductive oligomer (some of which have functional groups for attachment of capture probes) is attached to the electrode first, followed by attachment of the capture probe The latter two methods may be preferred when conductive oligomers are used which are not stable in the solvents and under the conditions used in traditional nucleic acid synthesis
  • the compositions of the invention are made by first forming the conductive oligomer covalently attached to the nucleoside, followed by the addition of additional nucleosides to form a capture probe nucleic acid, with the last step comprising the addition of the conductive oligomer to the electrode
  • the attachment of the conductive oligomer to the nucleoside may be done in several ways In a preferred embodiment, all or part of the conductive oligomer is synthesized first (generally with a functional group on the end for attachment to the electrode), which is then attached to the nucleoside Additional nucleosides are then added as required, with the last step generally being attachment to the electrode Alternatively, oligomer units are added one at a time to the nucleoside with addition of additional nucleosides and attachment to the electrode A number of representative syntheses are shown in the Figures of WO98/20162, expressly incorporated herein by reference
  • the conductive oligomer is then attached to a nucleoside that may contain one (or more) of the oligomer units, attached as depicted herein
  • attachment is to a ribose of the ⁇ bose-phosphate backbone
  • attachment via amide and amine linkages are possible (see Figures 1 and 2 of WO98/20162)
  • there is at least a methylene group or other short aliphatic alkyl groups (as a Z group) between the nitrogen attached to the ribose and the aromatic ring of the conductive oligomer A representative synthesis is shown in Figure 16 of WO98/20162
  • attachment is via a phosphate of the ⁇ bose-phosphate backbone
  • Figure 4 shows attachment at the 3' position of the ribose
  • attachment can also be made via the 2' position
  • Z is an ethylene linker, although other linkers may be used as well, as will be appreciated by those in the art
  • attachment is via the base
  • a general scheme is depicted in Figure 3 of WO98/20162, using undine as the nucleoside and a phenylene-acetylene conductive oligomer
  • amide linkages are also possible, using techniques well known in the art
  • protecting groups may be added to the base prior to addition of the conductive oligomers, as is generally outlined in Figures 10 and 11 of WO98/20162
  • the palladium cross-coupling reactions may be altered to prevent dime ⁇ zation problems, i e two conductive oligomers dime ⁇ zing, rather than coupling to the base
  • attachment to the base may be done by making the nucleoside with one unit of the oligomer, followed by the addition of others
  • modified nucleosides Once the modified nucleosides are prepared, protected and activated, prior to attachment to the electrode, they may be incorporated into a growing oligonucleotide by standard synthetic techniques (Gait, Oligonucleotide Synthesis A Practical Approach, IRL Press, Oxford, UK 1984, Eckstein) in several ways
  • one or more modified nucleosides are converted to the t ⁇ phosphate form and incorporated into a growing oligonucleotide chain by using standard molecular biology techniques such as with the use of the enzyme DNA polymerase I, T4 DNA polymerase, T7 DNA polymerase, Taq DNA polymerase, reverse transc ⁇ ptase, and RNA polymerases
  • DNA polymerase I DNA polymerase I
  • T4 DNA polymerase T7 DNA polymerase
  • Taq DNA polymerase reverse transc ⁇ ptase
  • RNA polymerases for the incorporation of a 3' modified nucleoside to a nucleic acid, terminal deoxynucleotidyltransferase may be used (Rathff, Terminal deoxynucleotidyltransferase In The Enzymes, Vol 14A P D Boyer ed pp 105-118 Academic Press, San Diego, CA 1981)
  • ETM Preferred embodiments utilize ETM
  • nucleic acids comprising ETMs in situ
  • a target sequence can hybridize to a capture probe (for example on the surface) in such a way that the terminus of the target sequence is exposed, i e unhyb ⁇ dized
  • a capture probe for example on the surface
  • enzyme and t ⁇ phosphate nucleotides labelled with ETMs allows the in situ creation of the label
  • using labeled nucleotides recognized by polymerases can allow simultaneous amplification and detection, that is, the target sequences are generated in situ
  • the modified nucleoside is converted to the phosphoramidite or H- phosphonate form, which are then used in solid-phase or solution syntheses of ohgonucleotides
  • the modified nucleoside either for attachment at the ribose (i e ammo- or thiol-modified nucleosides) or the base, is incorporated into the oligonucleotide at either an internal position or the 5' terminus
  • DMT 4',4-d ⁇ methoxyt ⁇ tyl
  • a preferred method utilizes the attachment of the modified nucleoside (or the nucleoside replacement) to controlled pore glass (CPG) or other ohgome ⁇ c supports
  • CPG controlled pore glass
  • the modified nucleoside is protected at the 5' end with DMT, and then reacted with succmic anhyd ⁇ de with activation
  • the resulting succinyl compound is attached to CPG or other ohgome ⁇ c supports as is known in the art
  • Further phosphoramidite nucleosides are added, either modified or not, to the 5' end after deprotection
  • the present invention provides conductive oligomers or insulators covalently attached to nucleosides attached to solid oligome ⁇ c supports such as CPG, and phosphoramidite derivatives of the nucleosides of the invention
  • the invention further provides methods of making label probes with recruitment linkers comprising ETMs These synthetic reactions will depend on the character of the recruitment linker and the method of attachment of the ETM, as will be appreciated by those in the art
  • the label probes are generally made as outlined herein with the incorporation of
  • ETMs at one or more positions When a transition metal complex is used as the ETM, synthesis may occur in several ways
  • the hgand(s) are added to a nucleoside, followed by the transition metal ion, and then the nucleoside with the transition metal complex attached is added to an oligonucleotide, i e by addition to the nucleic acid synthesizer
  • the hgand(s) may be attached, followed by mcorportation into a growing oligonucleotide chain, followed by the addition of the metal ion
  • ETMs are attached to a ribose of the ⁇ bose-phosphate backbone This is generally done as is outlined herein for conductive oligomers, as described herein, and in PCT publication WO 95/15971 , using ammo-modified or oxo-modified nucleosides, at either the 2' or 3' position of the ribose
  • the ammo group may then be used either as a ligand, for example as a transition metal ligand for attachment of the metal ion, or as a chemically functional group that can be used for attachment of other ligands or organic ETMs, for example via amide linkages, as will be appreciated by those in the art
  • the examples describe the synthesis of nucleosides with a variety of ETMs attached via the ribose
  • ETMs are attached to a phosphate of the ⁇ bose-phosphate backbone
  • this may be done using phosphodiester analogs such as phosphoramidite bonds, see generally PCT publication WO 95/15971 , or can be done in a similar manner to that depicted in Figures 4 and 5 of PCT US97/20014, where the conductive oligomer is replaced by a transition metal ligand or complex or an organic ETM, as well as is outlined in the Examples
  • ETMs are attached to a base of the nucleoside
  • ammo groups of the base either naturally occurring or added as is described herein (see the fiigures, for example) are used either as ligands for transition metal complexes or as a chemically functional group that can be used to add other ligands, for example via an amide linkage, or organic ETMs
  • nucleosides containing halogen atoms attached to the heterocyclic ring are commercially available Acetylene linked ligands may be added using the halogenated bases, as is generally known, see for example, Tzahs et al , Tetrahedron Lett 36(34) 6017-6020 (1995), Tzahs et al , Tetrahedron Lett 36(2) 3489-3490 (1995), and Tzahs et al , Chem Communications (in press) 1996, all
  • the nucleosides are made with transition metal ligands, incorporated into a nucleic acid, and then the transition metal ion and any remaining necessary ligands are added as is known in the art In an alternative embodiment, the transition metal ion and additional ligands are added prior to incorporation into the nucleic acid
  • the attachment linker is attached to the electrode
  • the method will vary depending on the type of electrode used As is described herein, the attachment linkers are generally made with a terminal "A" linker to facilitate attachment to the electrode
  • a sulfur-gold attachment is considered a covalent attachment
  • conductive oligomers, insulators, and attachment linkers are covalently attached via sulfur linkages to the electrode
  • traditional protecting groups for use of attaching molecules to gold electrodes are generally not ideal for use in both synthesis of the compositions described herein and inclusion in oligonucleotide synthetic reactions
  • the present invention provides novel methods for the attachment of conductive oligomers to gold electrodes, utilizing unusual protecting groups, including ethylpy ⁇ dine, and t ⁇ methylsilylethyl as is depicted in the Figures
  • unusual protecting groups including ethylpy ⁇ dine, and t ⁇ methylsilylethyl as is depicted in the Figures
  • traditional protecting groups such as acetyl groups and others may be used See Greene et al , supra
  • the subunit of the conductive oligomer which contains the sulfur atom for attachment to the electrode is protected with an ethyl-py ⁇ dine or t ⁇ methylsilylethyl group
  • this is generally done by contacting the subunit containing the sulfur atom (preferably in the form of a sulfhydryl) with a vinyl pyndme group or vinyl t ⁇ methylsilylethyl group under conditions whereby an ethylpy ⁇ dine group or t ⁇ methylsilylethyl group is added to the sulfur atom
  • This subunit also generally contains a functional moiety for attachment of additional subunits, and thus additional subunits are attached to form the conductive oligomer
  • the conductive oligomer is then attached to a nucleoside, and additional nucleosides attached
  • the protecting group is then removed and the sulfur-gold covalent attachment is made Alternatively, all or part of the conductive oligomer is made, and then either a subunit containing a protected sulfur atom is added, or a sulfur atom is added and then protected
  • the conductive oligomer is then attached to a nucleoside, and additional nucleosides attached Alternatively, the conductive oligomer attached to a nucleic acid is made, and then either a subunit containing a protected sulfur atom is added, or a sulfur atom is added and then protected
  • the ethyl pyndme protecting group may be used as above, but removed after one or more steps and replaced with a standard protecting group like a disulfide
  • subunit of a conductive polymer herein is meant at least the moiety of the conductive oligomer to which the sulfur atom is attached, although additional atoms may be present, including either functional groups which allow the addition of additional components of the conductive oligomer, or additional components of the conductive oligomer
  • a subunit comprises at least the first Y group
  • a preferred method comprises 1 ) adding an ethyl pyndme or tnmethylsilylethyl protecting group to a sulfur atom attached to a first subunit of a conductive oligomer, generally done by adding a vinyl pyndme or tnmethylsilylethyl group to a sulfhydryl, 2) adding additional subunits to form the conductive oligomer, 3) adding at least a first nucleoside to the conductive oligomer, 4) adding additional nucleosides to the first nucleoside to form a nucleic acid, 5) attaching the conductive oligomer to the gold electrode This may also be done in the absence of nucleosides, as is described in the Examples
  • the above method may also be used to attach insulator molecules to a gold electrode
  • a monolayer comprising conductive oligomers (and optionally insulators) is added to the electrode.
  • the chemistry of addition is similar to or the same as the addition of conductive oligomers to the electrode, i e using a sulfur atom for attachment to a gold electrode, etc
  • Compositions comprising monolayers in addition to the conductive oligomers covalently attached to nucleic acids may be made in at least one of five ways (1) addition of the monolayer, followed by subsequent addition of the attachment linker-nucleic acid complex, (2) addition of theattachment linker-nucleic acid complex followed by addition of the monolayer, (3) simultaneous addition of the monolayer and attachment linker-nucleic acid complex, (4) formation of a monolayer (using any of 1 , 2 or 3) which includes attachment linkers which terminate in a functional moiety suitable for attachment of a completed nucleic acid, or (5) formation of a monolayer which includes attachment linkers which terminate in a functional moiety suitable for nucleic acid synthesis
  • the nucleic acid is a peptide nucleic acid or analog
  • the invention provides peptide nucleic acids with at least one covalently attached ETM or attachment linker
  • these moieties are covalently attached to an monome ⁇ c subunit of the PNA
  • monome ⁇ c subunit of PNA herein is meant the -NH-CH 2 CH 2 -N(COCH 2 -Base)-CH 2 -CO- monomer, or derivatives (herein included within the definition of "nucleoside") of PNA
  • the number of carbon atoms in the PNA backbone may be altered, see generally Nielsen et al , Chem Soc Rev 1997 page 73, which discloses a number of PNA derivatives, herein expressly incorporated by reference
  • the amide bond linking the base to the backbone may be altered, phosphoramide and sulfuramide bonds may be used Alternatively, the moieties are attached to an internal monomeric subunit
  • internal monomeric subunit By "internal
  • the moieties are covalently attached to the backbone of the PNA monomer
  • the attachment is generally to one of the unsubstituted carbon atoms of the monomeric subunit, preferably the ⁇ -carbon of the backbone, although attachment at either of the carbon 1 or 2 positions, or the ⁇ -carbon of the amide bond linking the base to the backbone may be done
  • moieties are added at the ⁇ -carbon atoms, either to a terminal monomeric subunit or an internal one
  • a modified monomeric subunit is synthesized with an ETM or an attachment linker, or a functional group for its attachment, and then the base is added and the modified monomer can be incorporated into a growing PNA chain
  • Figure 31 of WO98/20162 depicts the synthesis of a conductive oligomer covalently attached to the backbone of a PNA monomeric subunit
  • Figure 32 of WO98/20162 depicts the synthesis of a ferrocene attached to the backbone of a monomeric subunit
  • compositions of the invention may additionally contain one or more labels at any position
  • label herein is meant an element (e g an isotope) or chemical compound that is attached to enable the detection of the compound
  • Preferred labels are radioactive isotopic labels, and colored or fluorescent dyes
  • the labels may be incorporated into the compound at any position
  • the compositions of the invention may also contain other moieties such as cross-linking agents to facilitate cross-linking of the target-probe complex See for example, Lukhtanov et al , Nucl Acids Res 24(4) 683 (1996) and Tabone et al , Biochem. 33 375 (1994), both of which are expressly incorporated by reference
  • detection probes are covalently attached to the electrode, as above for capture probes
  • the detection probes are either substantially complementary to a portion of the target sequence (direct detection), or to a portion of a label probe (sandwich assay), as is depicted in the Figures
  • the first probe sequence may comprise a separation tag (e g biotin) or sequence (e g a unique sequence), that allow the binding of the unreacted primers and the cleaved first probe sequences, the use of labels in the second probe sequence (for direct detection) or the use of the second probe sequence for the basis of the capture onto an electrode or binding to a detection probe ensures that unreacted
  • compositions find use in a number of applications, as described herein
  • compositions of the invention find use in hybridization assays
  • ' electrodes can be made that have a single species of nucleic acid, i e a single nucleic acid sequence, or multiple nucleic acid species
  • oligonucleotide arrays are well known in the art
  • techniques are known for "addressing" locations within an electrode and for the surface modification of electrodes
  • arrays of different nucleic acids are laid down on the electrode, each of which are covalently attached to the electrode via a conductive linker
  • the number of different probe species of ohgonucleotides may vary widely, from one to thousands, with from about 4 to about 100,000 being preferred, and from about 10 to about 10,000 being particularly preferred
  • detection proceeds with electronic initiation Without being limited by the mechanism or theory, detection is based on the transfer of electrons from the ETM to the electrode
  • Detection of electron transfer, i e the presence of the ETMs is generally initiated electronically, with voltage being preferred
  • a potential is applied to the assay complex
  • Precise control and variations in the applied potential can be via a potentiostat and either a three electrode system (one reference, one sample (or working) and one counter electrode) or a two electrode system (one sample and one counter electrode)
  • This allows matching of applied potential to peak potential of the system which depends in part on the choice of ETMc and in part on the conductive oligomer used, the composition and integrity of the monolayer, and what type of reference electrode is used
  • ferrocene is a preferred ETM
  • a co-reductant or co-oxidant (collectively, co-redoxant) is used, as an additional electron source or sink
  • co-redoxant is used, as an additional electron source or sink
  • an input electron source in solution is used in the initiation of electron transfer, preferably when initiation and detection are being done using DC current or at AC frequencies where diffusion is not limiting
  • preferred embodiments utilize monolayers that contain a minimum of "holes", such that short-circuiting of the system is avoided This may be done in several general ways
  • an input electron source is used that has a lower or similar redox potential than the ETM of the label probe
  • both the ETM and the input electron source are oxidized and can thus donate electrons, the ETM donates an electron to the electrode and the input source donates to the ETM
  • ferrocene as a ETM attached to the compositions of the invention as described in the examples, has a redox potential of roughly 200 mV in aqueous solution (which can change significantly depending on what the ferrocene is bound to, the manner of the linkage and
  • input electron sources that have lower redox potentials than the ETM are used At voltages less than the redox potential of the ETM, but higher than the redox potential of the electron source, the input source such as ferrocyanide is unable to be oxided and thus is unable to donate an electron to the ETM, i e no electron transfer occurs Once fenocene is oxidized, then there is a pathway foi electron transfer
  • an input electron source is used that has a higher redox potential than the ETM of the label probe
  • luminol an electron source
  • the ETM is unable to accept any electrons from the luminol electron source, since the voltages are less than the redox potential of the luminol
  • the luminol then transfers an electron to the ETM, allowing rapid and repeated electron transfer
  • the electron source (or co-reductant) serves to amplify the signal generated in the system, as the electron source • Tiolecules rapidly and repeatedly donate electrons to the ETM of the label probe
  • Luminol has the added benefit of becoming a chemiluminiscent species upon oxidation (see Jirka et al , Analytica Chimica Acta 284 345 (1993)), thus allowing photo-detection of electron transfer from the ETM to the electrode
  • luminol can only be oxidized by transferring an electron to the ETM on the label probe
  • the ETM is not present, i e when the target sequence is not hybridized to the composition of the invention, luminol is not significantly oxidized, resulting in a low photon emission and thus a low (if any) signal from the luminol In the presence of the target, a much larger signal is generated
  • the measure of luminol oxidation by photon emission is an indirect measurement of the ability of the ETM to donate electrons to the electrode
  • photon detection is generally
  • ETM such as a metallocene receiving an electron from the electrode, converting it to the metalhcenium, with the output electron acceptor then accepting the electron rapidly and repeatedly
  • cobalticenium is the preferred ETM
  • the presence of the ETMs at the surface of the monolayer can be detected in a variety of ways
  • a variety of detection methods may be used, including, but not limited to, optical detection (as a result of spectral changes upon changes in redox states), which includes fluorescence, phosphorescence, lummiscence, chemiluminescence, electrochemiluminescence, and refractive index, and electronic detection, including, but not limited to, amperommetry, voltammetry, capacitance and impedence
  • optical detection as a result of spectral changes upon changes in redox states
  • electronic detection including, but not limited to, amperommetry, voltammetry, capacitance and impedence
  • These methods include time or frequency dependent methods based on AC or DC currents, pulsed methods, lock-in techniques, filtering (high pass, low pass, band pass), and time-resolved techniques including time-resolved fluoroscence
  • the efficient transfer of electrons from the ETM to the electrode results in stereotyped changes in the redox state of the ETM
  • ETMs including the complexes of ruthenium containing bipyndine, pyndme and imidazole rings
  • these changes in redox state are associated with changes in spectral properties
  • Significant differences in absorbance are observed between reduced and oxidized states for these molecules See for example Fabb ⁇ zzi et al , Chem Soc Rev 1995 pp197-202) These differences can be monitored using a spectrophotometer or simple photomultip er tube device
  • possible electron donors and acceptors include all the derivatives listed above for photoactivation or initiation Preferred electron donors and acceptors have characteristically large spectral changes upon oxidation and reduction resulting in highly sensitive monitoring of electron transfer Such examples include Ru(NH 3 ) 4 py and Ru(bpy) 2 ⁇ m as preferred examples It should be understood that only the donor or acceptor that is being monitored by absorbance need have ideal spectral characteristics
  • the electron transfer is detected fluoromet ⁇ cally Numerous transition metal complexes, including those of ruthenium, have distinct fluorescence properties Therefore, the change in redox state of the electron donors and electron acceptors attached to the nucleic acid can be monitored very sensitively using fluorescence, for example with Ru(4,7-b ⁇ phenyl 2 -phenanthrol ⁇ ne) 3 +
  • fluorescence for example with Ru(4,7-b ⁇ phenyl 2 -phenanthrol ⁇ ne) 3 +
  • the production of this compound can be easily measured using standard fluorescence assay techniques For example, laser induced fluorescence can be recorded in a standard single cell fluo ⁇ meter, a flow through "on-line” fluo ⁇ meter (such as those attached to a chromatography system) or a multi-sample "plate-reader” similar to those marketed for 96-well immuno assays
  • fluorescence can be measured using fiber optic sensors with nucleic acid probes in solution or attached to the fiber optic Fluorescence is monitored using a photomultipher tube or other light detection instrument attached to the fiber optic The advantage of this system is the extremely small volumes of sample that can be assayed
  • scanning fluorescence detectors such as the Fluorlmager sold by Molecular Dynamics are ideally suited to monitoring the fluorescence of modified nucleic acid molecules arrayed on solid surfaces
  • Fluorlmager sold by Molecular Dynamics
  • transition metal complexes display fluorescence with large Stokes shifts
  • Suitable examples include bis- and trisphenanthrolme complexes and bis- and t ⁇ sbipy ⁇ dyl complexes of transition metals such as ruthenium (see Juris, A , Balzani, V , et al Coord Chem Rev , V 84, p 85-277, 1988)
  • Preferred examples display efficient fluorescence (reasonably high quantum yields) as well as low reorganization energies These include Ru(4,7-b ⁇ phenyl 2 -phenanthrohne) 3 2+ , Ru(4,4'-d ⁇ phenyl-2,2'- b ⁇ py ⁇ d ⁇ ne) 3 2+ and platinum complexes (see Cummmgs et al , J Am Chem Soc 118 1949-1960 (1996), incorporated by reference) Alternatively, a reduction in fluorescence associated with hybridization can be measured using these systems
  • electrochemiluminescence is used as the basis of the electron transfer detection
  • ETMs such as Ru 2t (bpy) 3
  • direct luminescence accompanies excited state decay Changes in this property are associated with nucleic acid hybridization and can be monitored with a simple photomultipher tube arrangement (see Blackburn, G F Cltn Chem 37 1534-1539 (1991 ), and Juris et al , supra
  • electronic detection is used, including amperommetry, voltammetry, capacitance, and impedence
  • Suitable techniques include, but are not limited to, electrogravimetry, coulometry (including controlled potential coulometry and constant current coulometry), voltametry (cyclic voltametry, pulse voltametry (normal pulse voltametry, square wave voltametry, differential pulse voltametry, Osteryoung square wave voltametry, and coulostatic pulse techniques), stripping analysis (aniodic stripping analysis, cathiodic stripping analysis, square wave stripping voltammetry), conductance measurements (electrolytic conductance, direct analysis), time-dependent electrochemical analyses (chronoamperometry, chronopotentiometry, cyclic chronopotentiometry and amperometry, AC polography, chronogalvametry, and chronocoulometry), AC impedance measurement, capacitance measurement, AC voltametry, and photoelectrochemistry
  • monitoring electron transfer is via amperomet ⁇ c detection
  • This method of detection involves applying a potential (as compared to a separate reference electrode) between the nucleic acid-conjugated electrode and a reference (counter) electrode in the sample containing target genes of interest Electron transfer of differing efficiencies is induced in samples in the presence or absence of target nucleic acid, that is, the presence or absence of the target nucleic acid, and thus the label probe, can result in different currents
  • the device for measuring electron transfer amperomet ⁇ cally involves sensitive current detection and includes a means of controlling the voltage potential, usually a potentiostat This voltage is optimized with reference to the potential of the electron donating complex on the label probe Possible electron donating complexes include those previously mentioned with complexes of iron, osmium, platinum, cobalt, rhenium and ruthenium being preferred and complexes of iron being most preferred
  • potentiomet ⁇ c (ornostiammet ⁇ c) measurements involve non-faradaic (no net current flow) processes and are utilized traditionally in pH and other ion detectors Similar sensors are used to monitor electron transfer between the ETM and the electrode.
  • other properties of insulators (such as resistance) and of conductors (such as conductivity, impedance and capicitance) could be used to monitor electron transfer between ETM and the electrode
  • any system that generates a current (such as electron transfer) also generates a small magnetic field, which may be monitored in some embodiments
  • one benefit of the fast rates of electron transfer observed in the compositions of the invention is that time resolution can greatly enhance the signal-to-noise results of monitors based on absorbance, fluorescence and electronic current
  • the fast rates of electron transfer of the present invention result both in high signals and stereotyped delays between electron transfer initiation and completion
  • amplifying signals of particular delays such as through the use of pulsed initiation of electron transfer and "lock-in" amplifiers of detection, and Fourier transforms
  • ETMs alternating current
  • ETMs bound to an electrode
  • traditional electrochemical theory such as exemplified in Laviron et al , J Electroanal Chem 97 135 (1979) and Laviron et al , J Electroanal Chem 105 35 (1979), both of which are incorporated by reference, do not accurately model the systems described herein, except for very small E AC (less than 10 mV) and relatively large numbers of molecules That is, the AC current (I) is not accurately described by Laviron's equation This may be due in part to the fact that this theory assumes an unlimited source and sink of electrons, which is not true in the present systems
  • E DC is the electrode potential
  • E 0 is the formal potential of the metal complex
  • R is the gas constant
  • T is the temperature in degrees Kelvin
  • n is the number of electrons transferred
  • F is faraday's constant
  • [O] is the concentration of oxidized molecules
  • [R] is the concentration of reduced molecules
  • Equation 2 The Nernst equation can be rearranged as shown in Equations 2 and 3
  • E DC is the DC component of the potential
  • Equation 11 the total AC current will be the number of redox molecules C), times faraday's constant (F), times the AC frequency ( ⁇ ), times 0 5 (to take into account the AC amplitude), times the ratios derived above in Equation 7
  • the AC voltage is approximated by the average, E AC 2/ ⁇ Equation 11
  • Equation 11 simulations were generated using increasing overpotential (AC voltage)
  • Figure 22A of WO98/20162 shows one of these simulations
  • Figure 22B depicts a simulation based on traditional theory
  • Figures 23A and 23B depicts actual experimental data using the Fc-wire of Example 7 of WO98/20162 plotted with the simulation, and shows that the model fits the experimental data very well
  • the current is smaller than predicted, however this has been shown to be caused by ferrocene degradation which may be remedied in a number of ways
  • Equation 11 does not incorporate the effect of electron transfer rate nor of instrument factors Electron transfer rate is important when the rate is close to or lower than the applied frequency
  • the true ⁇ AC should be a function of all three, as depicted in Equation 12
  • non-specifically bound label probes/ETMs show differences in impedance (i e higher impedances) than when the label probes containing the ETMs are specifically bound in the correct orientation
  • the non-specifically bound material is washed away, resulting in an effective impedance of infinity
  • AC detection gives several advantages as is generally discussed below, including an increase in sensitivity, and the ability to "filter out" background noise
  • changes in impedance including, for example, bulk impedance
  • frequency response when using AC initiation and detection methods, the frequency response of the system changes as a result of the presence of the ETM
  • frequency response herein is meant a modification of signals as a result of electron transfer between the electrode and the ETM This modification is different depending on signal frequency
  • a frequency response includes AC currents at one or more frequencies, phase shifts, DC offset voltages, faradaic impedance, etc
  • the first input signal comprises a DC component and an AC component That is, a DC offset voltage between the sample and counter electrodes is swept through the electrochemical potential of the ETM (for example, when ferrocene is used, the sweep is generally from 0 to 500 mV) (or alternatively, the working electrode is grounded and the reference electrode is swept from 0 to -500 mV)
  • the sweep is used to identify the DC voltage at which the maximum response of the system is seen This is generally at or about the electrochemical potential of the ETM
  • DC offset voltages of from about -1 V to about +1 1 V are preferred, with from about -500 mV to about +800 mV being especially preferred, and from about -300 mV to about 500 mV being particularly preferred
  • the DC offset voltage is not zero
  • an AC signal component of variable amplitude and frequency is applied If the ETM is present, and can
  • a single input signal may be applied to differentiate between the presence and absence of the ETM (i e the presence of the target sequence) nucleic acid
  • a plurality of input signals are applied as outlined herein, this may take a variety of forms, including using multiple frequencies, multiple DC offset voltages, or multiple AC amplitudes, or combinations of any or all of these
  • DC offset voltages are used, although as outlined above, DC voltage sweeps are preferred This may be done at a single frequency, or at two or more frequencies
  • the AC amplitude is varied Without being bound by theory, it appears that increasing the amplitude increases the driving force Thus, higher amplitudes, which result in higher overpotentials give faster rates of electron transfer
  • the same system gives an improved response (i e higher output signals) at any single frequency through the use of higher overpotentials at that frequency
  • the amplitude may be increased at high frequencies to increase the rate of electron transfer through the system, resulting in greater sensitivity
  • this may be used, for example, to induce responses in slower systems such as those that do not possess optimal spacing configurations
  • measurements of the system are taken at at least two separate amplitudes or overpotentials, with measurements at a plurality of amplitudes being preferred.
  • changes in response as a result of changes in amplitude may form the basis of identification, calibration and quantification of the system
  • one or more AC frequencies can be used as well
  • the AC frequency is varied At different frequencies, different molecules respond in different ways As will be appreciated by those in the art, increasing the frequency generally increases the output current However, when the frequency is greater than the rate at which electrons may travel between the electrode and the ETM, higher frequencies result in a loss or decrease of output signal At some point, the frequency will be greater than the rate of electron transfer between the ETM and the electrode, and then the output signal will also drop
  • detection utilizes a single measurement of output signal at a single frequency
  • the frequency response of the system in the absence of target sequence, and thus the absence of label probe containing ETMs can be previously determined to be very low at a particular high frequency Using this information, any response at a particular frequency, will show the presence of the assay complex That is, any response at a particular frequency is characteristic of the assay complex Thus, it may only be necessary to use a single input high frequency, and any changes in frequency response is an indication that the ETM is present, and thus that the target sequence is present
  • measurements of the system are taken at at least two separate frequencies, with measurements at a plurality of frequencies being preferred
  • a plurality of frequencies includes a scan For example, measuring the output signal, e g , the AC current, at a low input frequency such as 1 - 20 Hz, and comparing the response to the output signal at high frequency such as 10 - 100 kHz will show a frequency response difference between the presence and absence of the ETM
  • the frequency response is determined at at least two, preferably at least about five, and more preferably at least about ten frequencies
  • an output signal After transmitting the input signal to initiate electron transfer, an output signal is received or detected
  • the presence and magnitude of the output signal will depend on a number of factors, including the overpotential/amplitude of the input signal, the frequency of the input AC signal, the composition of the intervening medium, the DC offset, the environment of the system, the nature of the ETM, the solvent, and the type and concentration of salt
  • the presence and magnitude of the output signal will depend in general on the presence or absence of the ETM, the placement and distance of the ETM from the surface of the monolayer and the character of the input signal
  • the output signal comprises an AC current
  • the magnitude of the output current will depend on a number of parameters By varying these parameters, the system may be optimized in a number of ways
  • AC currents generated in the present invention range from about 1 femptoamp to about 1 milhamp, with currents from about 50 femptoamps to about 100 microamps being preferred, and from about 1 picoamp to about 1 microamp being especially preferred
  • the output signal is phase shifted in the AC component relative to the input signal
  • the systems of the present invention may be nn ⁇ .- O ⁇ n
  • phase-shifting based detection the complex biomolecules of the invention through which electron transfer occurs react to the AC input in a homogeneous manner, similar to standard electronic components, such that a phase shift can be determined This may serve as the basis of detection between the presence and absence of the ETM, and/or differences between the presence of target-specific assay complexes comprising label probes and non-specific binding of the label probes to the system components
  • the output signal is characteristic of the presence of the ETM, that is, the output signal is characteristic of the presence of the target-specific assay complex comprising label probes and ETMs
  • the basis of the detection is a difference in the faradaic impedance of the system as a result of the formation of the assay complex Faradaic impedance is the impedance of the system between the electrode and the ETM Faradaic impedance is quite different from the bulk or dielectric impedance, which is the impedance of the bulk solution between the electrodes Many factors may change the faradaic impedance which may not effect the bulk impedance, and vice versa
  • the assay complexes comprising the nucleic acids in this system have a certain faradaic impedance, that will depend on the distance between the ETM and the electrode, their electronic properties, and the composition of the intervening medium, among other things Of importance in the methods of the invention is that the faradaic impedance between the ETM and the electrode is signficantly different depending on whether the
  • the present invention further provides apparatus for the detection of nucleic acids using
  • the apparatus includes a test chamber which has at least a first measuring or sample electrode, and a second measuring or counter electrode Three electrode systems are also useful The first and second measuring electrodes are in contact with a test sample receiving region, such that in the presence of a liquid test sample, the two electrodes may be in electrical contact
  • the first measuring electrode comprises a single stranded nucleic acid capture probe covalently attached via an attachment linker, and a monolayer comprising conductive oligomers, such as are described herein
  • the apparatus further comprises an AC voltage source electrically connected to the test chamber, that is, to the measuring electrodes
  • the AC voltage source is capable of delivering DC offset voltage as well
  • the apparatus further comprises a processor capable of comparing the input signal and the output signal The processor is coupled to the electrodes and configured to receive an output signal, and thus detect the presence of the target nucleic acid
  • compositions of the present invention may be used in a variety of research, clinical, quality control, or field testing settings
  • the probes are used in genetic diagnosis
  • probes can be made using the techniques disclosed herein to detect target sequences such as the gene for nonpolyposis colon cancer, the BRCA1 breast cancer gene, P53, which is a gene associated with a variety of cancers, the Apo E4 gene that indicates a greater risk of Alzheimer's disease, allowing for easy presymptomatic screening of patients, mutations in the cystic fibrosis gene, or any of the others well known in the art
  • viral and bacterial detection is done using the complexes of the invention
  • probes are designed to detect target sequences from a variety of bacteria and viruses
  • current blood-screening techniques rely on the detection of anti- HIV antibodies
  • the methods disclosed herein allow for direct screening of clinical samples to detect
  • HIV nucleic acid sequences particularly highly conserved HIV sequences
  • this allows direct monitoring of circulating virus within a patient as an improved method of assessing the efficacy of anti-viral therapies
  • viruses associated with leukemia HTLV-I and HTLV-II
  • Bacterial infections such as tuberculosis, clymidia and other sexually transmitted diseases, may also be detected, for example using ⁇ bosomal RNA (rRNA) as the target sequences
  • the nucleic acids of the invention find use as probes for toxic bacteria in the screening of water and food samples
  • samples may be treated to lyse the bacteria to release its nucleic acid (particularly rRNA), and then probes designed to recognize bacterial strains, including, but not limited to, such pathogenic strains as, Salmonella, Campylobacter, Vibrio cholerae, Leishmania, enterotoxic strains of E coli, and Legionnaire's disease bacteria
  • bioremediation strategies may be evaluated using the compositions of the invention
  • the probes are used for forensic "DNA fingerprinting" to match crime-scene DNA against samples taken from victims and suspects
  • the probes in an array are used for sequencing by hybridization
  • the present invention provides for extremely specific and sensitive probes, which may, in some embodiments, detect target sequences without removal of unhyb ⁇ dized probe This will be useful in the generation of automated gene probe assays
  • compositions of the invention are useful to detect successful gene amplification in PCR, thus allowing successful PCR reactions to be an indication of the presence or absence of a target sequence PCR may be used in this manner in several ways
  • the PCR reaction is done as is known in the art, and then added to a composition of the invention comprising the target nucleic acid with a ETM, covalently attached to an electrode via a conductive oligomer with subsequent detection of the target sequence
  • PCR is done using nucleotides labelled with a ETM, either in the presence of, or with subsequent addition to, an electrode with a conductive oligomer and a target nucleic acid Binding of the PCR product containing ETMs to the electrode composition will allow detection via electron transfer
  • the nucleic acid attached to the electrode via a conductive polymer may be one PCR primer, with addition of a second primer labelled with an ETM Elongation results in double stranded nucleic acid with a ETM and electrode
  • the arrays are used for mRNA detection
  • a preferred embodiment utilizes either capture probes or capture extender probes that hybridize close to the 3' polyadenylation tail of the mRNAs This allows the use of one species of target binding probe for detection, i e the probe contains a poly-T portion that will bind to the poly-A tail of the mRNA target Generally, the probe will contain a second portion, preferably non-poly-T, that will bind to the detection probe (or other probe) This allows one target-binding probe to be made, and thus decreases the amount of different probe synthesis that is done
  • the use of restriction enzymes and ligation methods allows the creation of "universal" arrays
  • monolayers comprising capture probes that comprise restriction endonuclease ends as is generally depicted in Figure 7
  • an array comprising any number of restriction endonuclease sites is made
  • Treating a target sample with one or more of these restriction endonucleases allows the targets to bind to the array This can be done without knowing the sequence of the target
  • the target sequences can be ligated, as desired, using standard methods such as hgases, and the target sequence detected, using either standard labels or the methods of the invention
  • the present invention provides methods which can result in sensitive detection of nucleic acids In a preferred embodiment, less than about 10 X 10 6 molecules are detected, with less than about 10 X 10 5 being preferred, less than 10 X 10" being particularly preferred, less than about 10 X 10 3 being especially preferred, and less than about 10 X 10 2 being most
  • kits useful in the practice of the invention
  • the kits include the compositions including the primers and enzymes, along with any number of reagents or buffers, including additional enzymes and primers, dNTPs and/or NTPs (including substituted nucleotides), buffers, salts, inhibitors, etc
  • the kits can optionally include instructions for the use of the kits
  • Electrodes containing the different compositions of the invention were made and used in AC detection methods The experiments were run as follows A DC offset voltage between the working (sample) electrode and the reference electrode was swept through the electrochemical potential of the ferrocene, typically from 0 to 500 mV On top of the DC offset, an AC signal of variable amplitude and frequency was applied The AC current at the excitation frequency was plotted versus the DC offset
  • a capture probe D112 comprising a 25 base sequence
  • a capture extender probe D179 comprising a 24 base sequence perfectly complementary to the D112 capture probe, and a 24 base sequence perfectly complementary to the 2tar target, separated by a single base, was added, with the 2tar target
  • the D179 molecule carries a ferrocene (using a C15 linkage to the base) at the end that is closest to the electrode
  • the attachment linkers are conductive oligomers
  • the use of an ETM at or near this position allows verification that the D179 molecule is present
  • a ferrocene at this position has a different redox potential than the ETMs used for detection
  • a label probe D309 (dendnmer) was added, comprising a 18 base sequence perfectly complementary to a portion of
  • Example A A capture probe D94 was added with the Y5 and M44 conductive oligomer at a 22 1 ratio with the total thiol concentration being 833 ⁇ M on the electrode surface, as outlined above
  • a target sequence (D336) comprising a 15 base sequence perfectly complementary to the D94 capture probe, a 14 base linker sequence, and 6 ferrocenes linked via the N6 compound was used
  • a representative scan is shown in Figure 20C
  • Example B A capture probe D94 was added with the Y5 and M44 conductive oligomer at a 2 2 1 ratio with the total thiol concentration being 833 ⁇ M on the electrode surface, as outlined above
  • a target sequence (D429) comprising a 15 base sequence perfectly complementary to the D94 capture probe, a C131 ethylene glycol linker hooked to 6 ferrocenes linked via the N6 compound was used
  • a representative scan is shown in Figure 20E
  • the capture probe D112, Y5 conductive oligomer, the M44 insulator, and capture extender probe D179 were as outlined above
  • Two label probes were added D295 comprising an 18 base sequence perfectly complementary to a portion of the target sequence, a 15 base sequence linker and six ferrocenes attached using the N6 linkage depicted in Figure 23 D297 is the same, except that it's 18 base sequence hybridizes to a different portion of the target sequence
  • a representative scan is shown in Figure 20G When the 2tar target was not added, a representative scan is shown in Figure 20H
  • the capture probe D112, Y5 conductive oligomer, the M44 insulator, and capture extender probe D179 were as outlined above
  • Two label probes were added D296 comprising an 18 base sequence perfectly complementary to a portion of the target sequence, a 5 base sequence linker and six ferrocenes attached using the N6 linkage depicted in Figure 23 D298 is the same, except that it's 18 base sequence hybridizes to a different portion of the target sequence
  • a representative scan is shown in Figure 20I When the 2tar target was not added, a representative scan is shown in Figure 20J
  • Example A A capture probe D112, Y5 conductive oligomer and the M44 insulator were put on the electrode at 2 2 1 ratio with the total thiol concentration being 833 ⁇ M
  • a target sequence MT1 was added, that comprises a sequence complementary to D112 and a 20 base sequence complementary to the label probe D358 were combined, in this case, the label probe D358 was added to the target sequence prior to the introduction to the electrode
  • the label probe contains six ferrocenes attached using the N6 linkages depicted in Figure 23
  • a representative scan is shown in Figure 20L
  • the replacment of MT1 with NC112 which is not complementary to the capture probe resulted in no signal, similarly, the removal of MT1 resulted in no signal
  • Example B A capture probe D334, Y5 conductive oligomer and the M44 insulator were put on the electrode at
  • a target sequence LP280 was added, that comprises a sequence complementary to the capture probe and a 20 base sequence complementary to the label probe D335 were combined, in this case, the label probe D335 was added to the target prior to introduction to the electrode
  • the label probe contains six ferrocenes attached using the N6 linkages depicted in Figure 23
  • a representative scan is shown in Figure 20M Replacing LP280 with the LN280 probe (which is complementary to the label probe but not the capture probe) resulted in no signal
  • Example 9 Monitoring of PCR reactions using the invention Monitoring of PCR reactions was done using an HIV sequence as the target sequence Multiple reactions were run and stopped at 0 to 30 or 50 cycles
  • the sense primer contained the ETMs (using the N6 linkage described herein), although as will be appreciated by those in the art, t ⁇ phosphate nucleotides containing ETMs could be used to label non-primer sequences
  • the surface probe was designed to hybridize to 16 nucleotides of non-primer sequences, immediately adjacent to the primer sequence, that is, the labeled primer sequence will not bind to the surface probe Thus, only if amplification has occured, such that the amplified sequence will bind to the surface probe, will the detection of the adjacent ETMs proceed
  • the target sequence in this case was the plasmid pBKBHIOS (NIH AIDS Research and Reference Reagent program - McKesson Bioservices, Rockville MD) which contains an 8 9 kb Sstl fragment of pBH10-R3 dervied from the HXB2 clone which contains the entire HIV-1 genome and has the Genbank accession code K03455 or M38432) inserted into the Sstl site on pBluesc ⁇ pt ll-KS(+) The insert is oriented such that transcription from the T7 promoter produces sense RNA
  • the sense primer, D353 was as follows 5'-(N6)A(N6)AGGGCTGTTGGAAATGTGG-3'
  • the "antisense” primer, D351 was as follows 5'-TGTTGGCTCTGGTCTGCTCTGA-3'
  • the following is the expected PCR product of the reaction, comprising 140 bp
  • the surface capture probe (without any overlap to the sense primer) D459 was as follows 5'- TTGGTGTCCTTCCTTU-4 unit w ⁇ re(C11 )-3'
  • PCR reaction conditions were standard TAQ polymerase at TAQ 10X buffer 1 ⁇ M of the primers was added to either 6 X 10 3 , 6X 10 6 or 6 X 10 7 molecules of template The reaction conditions were 90°C for 30 sec, 57°C for 30 sec, and 70°C for 1 minute
  • the electrodes were prepared by melting 0 127 mm diamter pure gold wire on one end to form a ball The electrodes were dipped in aqua regia for 20 seconds and tehn rinse with water The SAM was deposited by dipping the electrode into a deposition solution of 1 3 4 0 7 D459 H6 M44 in 37 39 24 THF ACN water at 1 mM total thiol which was heated at 50°C for five minutes prior to the introduction of the electrodes The electrodes were added and then removed immediately to room temperature to sit for 15 minutes Electrodes were then transferred to M44 (in 37 39 24 THF ACN water at 400 ⁇ M total thiol concentration) The electrodes sat in M44 at room tern for 5 minutes, then the following heat cycling was applied 70°C for 1 minute, followed by 55 C C for 30 sec, repeating this cycle 2 more times followed by a 0 3 °C ramp down to RT with soaking at RT for 10 minutes The electrodes were taken out of M44 solution, rinsed in 2XS
  • the PCR products were adjusted to 6XSSC (no FCS)
  • the control was also adjusted to 6XSSC Hybridization was carried out at RT after rinsing twice in 6XSSC for at least 1 5 hours.
  • ACV conditions were as follows Ag/AgCI reference electrode and Pt auxiliary electrodes were used, and NaCI0 4 was used as the electrolyte solution
  • a surface probe D368 (5'-(H2)CCTTCCTTTCCACAU-4 un ⁇ tw ⁇ re(C11)-3') was attached to an electrode comprising M44 and H6 (H6 is a two unit wire terminating in an acetylene bond) at a ratio of D368 H6:M44 of 1 4 1 with a total thiol concentration of 833 ⁇ M
  • a ligation probe HIVLIG (5'-CCACCAGATCTTCCCTAA AAAATTAGCCTGTCTCTCAGTACAATCTTTCATTTGGTGT-3') and the target sequence HIVCOMP (5 - ATGTGGAAAGAAAGGACACCAATTGAAAGATTGTACTGAGAGACAGGCTAATTTTTTAGGGAAGATCTGG- 3') was added, with ligase and the reaction allowed to proceed
  • the reaction conditions were as follows 10 ⁇ M of HIVLIG annealed to HIVCOMP were hybridized to the electrode surface
  • the capture probe for a rRNA assay containing 0, 4 and 8 ethylene glycol units was tested on four separate electrode surfaces
  • Surface 1 contained 2 1 ratio of H6 M44, with a total thiol concentration of 500 ⁇ M
  • Hybridization solutions were annealed by heating at 70°C for 30 seconds and then cooling to 22°C over - 38 seconds
  • the molecules were all in 4X SSC at twice the targeted concentrations, with the rRNA at 35 U S C ⁇ ⁇ M, the capture sequence at 1 0 ⁇ M, and the label probes at 3 ⁇ M
  • the solution was diluted 1 1 with fetal calf serum, halving the concentrations and changing the solvent to 2X SSC with 50% FCS
  • FCS FCS
  • Hybridization was done as follows After the 2X SSC dip described above, the derivatized electrode was placed into an eppendorf tube with 20 ⁇ L hybridization solution It was allowed to hybridize at room temperature for 10 minutes
  • the electrode was briefly dipped in room temperature 2X SSC It was then transferred into the 1 M NaCI0 4 electrolyte and an alternating current voltammogram was taken with an applied alternating current of 10 Hz frequency and a 25 mV center-to-peak amplitude
  • System 2 rRNA is tacked down at two points System 3 two point tack down plus two label probes comprising 20 ferrocenes each directed to a flanking region of the second tack down point
  • the D550 structure was as follows 5'-(N38)(N38)(N38) (N38) AT CTG TGT CCA TGG T-3' On each N38 was a 5'-(H2)(C23)(C23)-3'
  • the D551 structure was as follows 5'-(n38)(N38)(N38) (N38)ATCTG TGT CAA TGG T-3' On each N38 was a 5'-(H2)(C23)(C23)(C23)(C23)-3'
  • a 5' N38 has two sites for secondary modification
  • a representative schematic is shown in Figure 23E
  • D405 has the structure 5'-(C23)(C23)(C23) (C23)(C23)(C23)(C23) (C23)(C23) (C23)AT CTG TGT CCA TGG T-3'
  • the system was run with two surfaces the "+” surface was a 2 2 1 ratio of D94:H6:M44, with a total thiol concentration of 833 ⁇ M
  • the "-" surface was a 2 2 1 ratio of D109:H6:M44 with a total thiol concentration of 833 ⁇ M
  • the results, shown in Figure 25B show that the system gave a good signal in the presence of a complementary capture probe
PCT/US1999/001705 1998-01-27 1999-01-27 Amplification of nucleic acids with electronic detection WO1999037819A2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
AU24737/99A AU764926B2 (en) 1998-01-27 1999-01-27 Amplification of nucleic acids with electronic detection
CA002319170A CA2319170A1 (en) 1998-01-27 1999-01-27 Amplification of nucleic acids with electronic detection
JP2000528725A JP2002500897A (ja) 1998-01-27 1999-01-27 電子的核酸検出の増幅
EP99904316A EP1051517A2 (en) 1998-01-27 1999-01-27 Amplification of nucleic acids with electronic detection

Applications Claiming Priority (12)

Application Number Priority Date Filing Date Title
US09/014,304 US6063573A (en) 1998-01-27 1998-01-27 Cycling probe technology using electron transfer detection
US09/014,304 1998-01-27
US7301198P 1998-01-29 1998-01-29
US60/073,011 1998-01-29
US7810298P 1998-03-16 1998-03-16
US60/078,102 1998-03-16
US8442598P 1998-05-06 1998-05-06
US8450998P 1998-05-06 1998-05-06
US60/084,425 1998-05-06
US60/084,509 1998-05-06
US13518398A 1998-08-17 1998-08-17
US09/135,183 1998-08-17

Publications (2)

Publication Number Publication Date
WO1999037819A2 true WO1999037819A2 (en) 1999-07-29
WO1999037819A3 WO1999037819A3 (en) 1999-10-14

Family

ID=27555780

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/001705 WO1999037819A2 (en) 1998-01-27 1999-01-27 Amplification of nucleic acids with electronic detection

Country Status (6)

Country Link
US (1) US7090804B2 (US07090804-20060815-C00017.png)
EP (1) EP1051517A2 (US07090804-20060815-C00017.png)
JP (1) JP2002500897A (US07090804-20060815-C00017.png)
AU (1) AU764926B2 (US07090804-20060815-C00017.png)
CA (1) CA2319170A1 (US07090804-20060815-C00017.png)
WO (1) WO1999037819A2 (US07090804-20060815-C00017.png)

Cited By (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001006016A2 (en) * 1999-07-20 2001-01-25 Clinical Micro Sensors, Inc. Amplification of nucleic acids with electronic detection
WO2001059154A2 (en) * 2000-02-08 2001-08-16 Molecular Sensing Plc Process for characterising nucleic acids in solution
WO2001073429A2 (en) * 2000-03-27 2001-10-04 Clemson University Detection of redox-active molecules in solution
WO2001040511A3 (en) * 1999-12-01 2002-05-10 Secr Defence Detection system
US6495323B1 (en) 1996-11-05 2002-12-17 Clinical Micro Sensors, Inc. AC methods for the detection of nucleic acids
US6518024B2 (en) 1999-12-13 2003-02-11 Motorola, Inc. Electrochemical detection of single base extension
US6528266B2 (en) 1993-12-10 2003-03-04 California Institute Of Technology Nucleic acid mediated electron transfer
JP2003514227A (ja) * 1999-11-12 2003-04-15 クリニカル・マイクロ・センサーズ・インコーポレイテッド 被検体検出のための結合促進法
US6602400B1 (en) 2000-06-15 2003-08-05 Motorola, Inc. Method for enhanced bio-conjugation events
US6686150B1 (en) 1998-01-27 2004-02-03 Clinical Micro Sensors, Inc. Amplification of nucleic acids with electronic detection
US6740518B1 (en) 1998-09-17 2004-05-25 Clinical Micro Sensors, Inc. Signal detection techniques for the detection of analytes
US6761816B1 (en) 1998-06-23 2004-07-13 Clinical Micro Systems, Inc. Printed circuit boards with monolayers and capture ligands
US6875619B2 (en) 1999-11-12 2005-04-05 Motorola, Inc. Microfluidic devices comprising biochannels
US7033760B2 (en) 1995-06-07 2006-04-25 California Institute Of Technology Metallic solid supports modified with nucleic acids
US7097974B1 (en) 1998-08-28 2006-08-29 Febit Biotech Gmbh Support for a method for determining an analyte and a method for producing the support
US7470540B2 (en) 2000-10-17 2008-12-30 Febit Ag Method and device for the integrated synthesis and analysis of analytes on a support
AU2004269412B2 (en) * 2003-09-02 2009-02-19 Restalyst Pte Ltd Soluble analyte detection and amplification
WO2010115100A1 (en) 2009-04-03 2010-10-07 L&C Diagment, Inc. Multiplex nucleic acid detection methods and systems
US7935481B1 (en) 1999-07-26 2011-05-03 Osmetech Technology Inc. Sequence determination of nucleic acids using electronic detection
US8012743B2 (en) 1998-10-27 2011-09-06 Osmetech Technology Inc. Detection of target analytes using particles and electrodes
WO2014066704A1 (en) 2012-10-24 2014-05-01 Genmark Diagnostics, Inc. Integrated multiplex target analysis
US20140202883A1 (en) * 2009-05-29 2014-07-24 Life Technologies Corporation Apparatus and methods for performing electrochemical reactions
US9222623B2 (en) 2013-03-15 2015-12-29 Genmark Diagnostics, Inc. Devices and methods for manipulating deformable fluid vessels
WO2016077341A2 (en) 2014-11-11 2016-05-19 Genmark Diagnostics, Inc. Instrument and cartridge for performing assays in a closed sample preparation and reaction system employing electrowetting fluid manipulation
WO2016077364A2 (en) 2014-11-11 2016-05-19 Genmark Diagnostics, Inc. Instrument and cartridge for performing assays in a closed sample preparation and reaction system
US9745616B2 (en) 2011-05-17 2017-08-29 Dxterity Diagnostics Incorporated Methods and compositions for detecting target nucleic acids
US9757095B2 (en) 2014-06-10 2017-09-12 Dxterity Diagnostics Incorporated Devices and methods for collecting and stabilizing biological samples
WO2018053501A1 (en) 2016-09-19 2018-03-22 Genmark Diagnostics, Inc. Instrument for processing cartridge for performing assays in a closed sample preparation and reaction system
US9976177B2 (en) 2009-04-01 2018-05-22 Dxterity Diagnostics Incorporated Chemical ligation dependent probe amplification (CLPA)
US10495656B2 (en) 2012-10-24 2019-12-03 Genmark Diagnostics, Inc. Integrated multiplex target analysis
US10605767B2 (en) 2014-12-18 2020-03-31 Life Technologies Corporation High data rate integrated circuit with transmitter configuration
US10829803B2 (en) 2006-05-10 2020-11-10 Dxterity Diagnostics Incorporated Detection of nucleic acid targets using chemically reactive oligonucleotide probes
US10864522B2 (en) 2014-11-11 2020-12-15 Genmark Diagnostics, Inc. Processing cartridge and method for detecting a pathogen in a sample

Families Citing this family (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7014992B1 (en) * 1996-11-05 2006-03-21 Clinical Micro Sensors, Inc. Conductive oligomers attached to electrodes and nucleoside analogs
US7560237B2 (en) * 1997-06-12 2009-07-14 Osmetech Technology Inc. Electronics method for the detection of analytes
US20030087228A1 (en) * 1998-05-06 2003-05-08 Cynthia Bamdad Electronic detection of nucleic acids using monolayers
US20050244954A1 (en) * 1998-06-23 2005-11-03 Blackburn Gary F Binding acceleration techniques for the detection of analytes
US20040053290A1 (en) * 2000-01-11 2004-03-18 Terbrueggen Robert Henry Devices and methods for biochip multiplexing
US7312087B2 (en) * 2000-01-11 2007-12-25 Clinical Micro Sensors, Inc. Devices and methods for biochip multiplexing
US6942771B1 (en) * 1999-04-21 2005-09-13 Clinical Micro Sensors, Inc. Microfluidic systems in the electrochemical detection of target analytes
US6361958B1 (en) * 1999-11-12 2002-03-26 Motorola, Inc. Biochannel assay for hybridization with biomaterial
US7615340B2 (en) 2000-10-03 2009-11-10 Minerva Biotechnologies Corporation Electronic detection of interaction and detection of interaction based on the interruption of flow
US20050009101A1 (en) * 2001-05-17 2005-01-13 Motorola, Inc. Microfluidic devices comprising biochannels
WO2003008642A2 (en) * 2001-07-15 2003-01-30 Keck Graduate Institute Amplification of nucleic acid fragments using nicking agents
AU2002313683A1 (en) * 2001-07-15 2003-03-03 Keck Graduate Institute Nucleic acid amplification using nicking agents
WO2004027384A2 (en) * 2002-09-17 2004-04-01 Perkinelmer Life Sciences, Inc. Real-time detection of nucleic acid reactions
US8394944B2 (en) * 2002-09-20 2013-03-12 Siemens Healthcare Diagnostics Inc. Dual-purpose primers and probes for providing enhanced hybridization assays by disruption of secondary structure formation
US7521261B2 (en) * 2002-09-26 2009-04-21 Vanderbilt University Method for screening molecular interactions
US8277762B2 (en) * 2003-08-01 2012-10-02 Tioga Research, Inc. Apparatus and methods for evaluating the barrier properties of a membrane
EP1893774A2 (en) * 2005-06-09 2008-03-05 Koninklijke Philips Electronics N.V. Amplification of nucleic acids with magnetic detection
US20070190560A1 (en) * 2006-02-13 2007-08-16 Olga Ornatsky Element-tagged olignucleotide gene expression analysis
EP2395113A1 (en) 2007-06-29 2011-12-14 Population Genetics Technologies Ltd. Methods and compositions for isolating nucleic acid sequence variants
US7820391B2 (en) 2007-11-06 2010-10-26 Osmetech Molecular Diagnostics Baseless nucleotide analogues and uses thereof
CN102159722B (zh) 2008-08-22 2014-09-03 桑格摩生物科学股份有限公司 用于靶向单链切割和靶向整合的方法和组合物
EP2642291B1 (en) * 2009-08-07 2015-10-07 Ohmx Corporation Enzyme triggered redox altering chemical elimination (E-trace) immunoassay
USD881409S1 (en) 2013-10-24 2020-04-14 Genmark Diagnostics, Inc. Biochip cartridge
US9598722B2 (en) 2014-11-11 2017-03-21 Genmark Diagnostics, Inc. Cartridge for performing assays in a closed sample preparation and reaction system
WO2016160877A1 (en) * 2015-03-31 2016-10-06 Rapid Pathogen Screening, Inc. Non-enzymatic nucleic acid detection using an oligonucleotide linker with a large cell gap
US20190062809A1 (en) 2017-08-24 2019-02-28 Clinical Micro Sensors, Inc. (dba GenMark Diagnostics, Inc.) Electrochemical detection of bacterial and/or fungal infections
EP3673086A1 (en) 2017-08-24 2020-07-01 Clinical Micro Sensors, Inc. (DBA GenMark Diagnostics, Inc.) Electrochemical detection of bacterial and/or fungal infections
CN110565100B (zh) * 2019-07-12 2021-05-07 西北工业大学 一种二茂钴阳离子基缓蚀剂及制备方法和使用方法

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996040712A1 (en) * 1995-06-07 1996-12-19 California Institute Of Technology Nucleic acid mediated electron transfer
WO1997009337A1 (de) * 1995-09-07 1997-03-13 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Metallocen-phosphoramidit-konjugate, verfahren zu ihrer herstellung sowie deren verwendung
WO1998020162A2 (en) * 1996-11-05 1998-05-14 Clinical Micro Sensors Electrodes linked via conductive oligomers to nucleic acids
WO1998057159A1 (en) * 1997-06-12 1998-12-17 Clinical Micro Sensors, Inc. Electronic methods for the detection of analytes

Family Cites Families (86)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA1219824A (en) 1981-04-17 1987-03-31 David C. Ward Modified nucleotides and methods of preparing and using same
US4711955A (en) 1981-04-17 1987-12-08 Yale University Modified nucleotides and methods of preparing and using same
US5241060A (en) 1982-06-23 1993-08-31 Enzo Diagnostics, Inc. Base moiety-labeled detectable nucleatide
US4994373A (en) 1983-01-27 1991-02-19 Enzo Biochem, Inc. Method and structures employing chemically-labelled polynucleotide probes
WO1985002627A1 (en) 1983-12-16 1985-06-20 Genetics International, Inc. Assay for nucleic acids
US4849513A (en) 1983-12-20 1989-07-18 California Institute Of Technology Deoxyribonucleoside phosphoramidites in which an aliphatic amino group is attached to the sugar ring and their use for the preparation of oligonucleotides containing aliphatic amino groups
US4943523A (en) 1984-01-30 1990-07-24 Enzo Biochem, Inc. Detectable molecules, method of preparation and use
US4707352A (en) 1984-01-30 1987-11-17 Enzo Biochem, Inc. Method of radioactively labeling diagnostic and therapeutic agents containing a chelating group
US5002885A (en) 1984-01-30 1991-03-26 Enzo Biochem, Inc. Detectable molecules, method preparation and use
US4952685A (en) 1984-01-30 1990-08-28 Enzo Biochem, Inc. Detectable molecules, method of preparation and use
US5013831A (en) 1984-01-30 1991-05-07 Enzo Biochem, Inc. Detectable molecules, method of preparation and use
US4707440A (en) 1984-01-30 1987-11-17 Enzo Biochem, Inc. Nucleic acid hybridization assay and detectable molecules useful in such assay
US5175269A (en) 1984-01-30 1992-12-29 Enzo Diagnostics, Inc. Compound and detectable molecules having an oligo- or polynucleotide with modifiable reactive group
CA1260372A (en) 1984-04-27 1989-09-26 Elazar Rabbani Hybridization method for the detection of genetic materials
GB8417301D0 (en) * 1984-07-06 1984-08-08 Serono Diagnostics Ltd Assay
US4755458A (en) 1984-08-30 1988-07-05 Enzo Biochem, Inc. Composition and method for the detection of the presence of a polynucleotide sequence of interest
US5112974A (en) 1985-01-18 1992-05-12 The Trustees Of Columbia University In The City Of New York Mixed ligand complexes and uses thereof as binding agents to DNA
GB8507706D0 (en) 1985-03-25 1985-05-01 Genetics Int Inc Magnetic nucleic acid sequences
US4683195A (en) * 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US5595908A (en) 1985-09-26 1997-01-21 University Of Southern Mississipi Piezoelectric device for detection of polynucleotide hybridization
CA1273552A (en) 1985-12-23 1990-09-04 Michael J. Heller Fluorescent stokes shift probes for polynucleotide hybridization assays
US4868103A (en) 1986-02-19 1989-09-19 Enzo Biochem, Inc. Analyte detection by means of energy transfer
CA1254945A (en) 1986-02-27 1989-05-30 Marco F. Cardosi Application of tetrathiafulvalenes in bioelectrochemical processes
US4704193A (en) 1986-05-14 1987-11-03 Gte Laboratories Incorporated Covalently coupled cofactor modified electrodes and methods of synthesis and use
US5175270A (en) 1986-09-10 1992-12-29 Polyprobe, Inc. Reagents for detecting and assaying nucleic acid sequences
ZA877772B (en) 1986-10-23 1988-04-20 Amoco Corporation Target and background capture methods and apparatus for affinity assays
JPS63238166A (ja) 1987-03-26 1988-10-04 Mitsubishi Electric Corp 有機電子素子材料
US4787963A (en) 1987-05-04 1988-11-29 Syntro Corporation Method and means for annealing complementary nucleic acid molecules at an accelerated rate
CA1340807C (en) 1988-02-24 1999-11-02 Lawrence T. Malek Nucleic acid amplification process
US5082830A (en) 1988-02-26 1992-01-21 Enzo Biochem, Inc. End labeled nucleotide probe
US5130238A (en) * 1988-06-24 1992-07-14 Cangene Corporation Enhanced nucleic acid amplification process
SE462454B (sv) 1988-11-10 1990-06-25 Pharmacia Ab Maetyta foer anvaendning i biosensorer
US5089112A (en) 1989-03-20 1992-02-18 Associated Universities, Inc. Electrochemical biosensor based on immobilized enzymes and redox polymers
US5156810A (en) 1989-06-15 1992-10-20 Biocircuits Corporation Biosensors employing electrical, optical and mechanical signals
US5491097A (en) 1989-06-15 1996-02-13 Biocircuits Corporation Analyte detection with multilayered bioelectronic conductivity sensors
CA2033692A1 (en) 1990-01-25 1991-07-26 Wilhelm Bannwarth Energy transfer systems
US5494810A (en) * 1990-05-03 1996-02-27 Cornell Research Foundation, Inc. Thermostable ligase-mediated DNA amplifications system for the detection of genetic disease
US5776672A (en) 1990-09-28 1998-07-07 Kabushiki Kaisha Toshiba Gene detection method
DE4039677A1 (de) 1990-12-12 1992-06-17 Boehringer Mannheim Gmbh Universalbindefilm
US5455166A (en) * 1991-01-31 1995-10-03 Becton, Dickinson And Company Strand displacement amplification
US5180968A (en) 1991-03-01 1993-01-19 Research Foundation Of State University Of New York Method and apparatus for compensation of double layer charging current in electrochemical cells
CA2050057A1 (en) 1991-03-04 1992-09-05 Adam Heller Interferant eliminating biosensors
RU1794088C (ru) 1991-03-18 1993-02-07 Институт Молекулярной Биологии Ан@ Ссср Способ определени нуклеотидной последовательности ДНК и устройство дл его осуществлени
US5846717A (en) 1996-01-24 1998-12-08 Third Wave Technologies, Inc. Detection of nucleic acid sequences by invader-directed cleavage
US5849486A (en) 1993-11-01 1998-12-15 Nanogen, Inc. Methods for hybridization analysis utilizing electrically controlled hybridization
US5632957A (en) 1993-11-01 1997-05-27 Nanogen Molecular biological diagnostic systems including electrodes
ES2146215T3 (es) 1991-11-15 2000-08-01 Igen Int Inc Ensayos rapidos para productos de amplificacion.
US5846708A (en) 1991-11-19 1998-12-08 Massachusetts Institiute Of Technology Optical and electrical methods and apparatus for molecule detection
US5565552A (en) 1992-01-21 1996-10-15 Pharmacyclics, Inc. Method of expanded porphyrin-oligonucleotide conjugate synthesis
US5391272A (en) 1992-03-06 1995-02-21 Andcare, Inc. Electrochemical immunoassay methods
ES2082256T3 (es) 1992-03-23 1996-03-16 Hoffmann La Roche Metodo de deteccion del adn.
US5587128A (en) * 1992-05-01 1996-12-24 The Trustees Of The University Of Pennsylvania Mesoscale polynucleotide amplification devices
CA2094785A1 (en) 1992-05-08 1993-11-09 Jean Gariepy Metal chelating peptide
JPH0641183A (ja) 1992-07-23 1994-02-15 Mitsubishi Kasei Corp オリゴヌクレオチド単分子膜
IL102930A (en) 1992-08-25 1997-03-18 Yissum Res Dev Co Electrobiochemical analytical method and electrodes
US5312527A (en) 1992-10-06 1994-05-17 Concordia University Voltammetric sequence-selective sensor for target polynucleotide sequences
US5472881A (en) 1992-11-12 1995-12-05 University Of Utah Research Foundation Thiol labeling of DNA for attachment to gold surfaces
JPH06153997A (ja) 1992-11-27 1994-06-03 Canon Inc 検出信号増幅による標的核酸の検出方法
DE69333991T2 (de) 1992-11-27 2006-12-14 Canon K.K. Verfahren und Sonde zum Nachweis von Nukleinsäuren
CA2157503A1 (en) 1993-03-05 1994-09-15 John M. Riviello Pulsed electrochemical detection using polymer electroactive electrodes
FR2703359B1 (fr) 1993-03-31 1995-06-23 Cis Bio Int Copolymère nucléotide(s)/polymère conducteur électronique ; son procédé de préparation et son utilisation .
US5767259A (en) 1994-12-27 1998-06-16 Naxcor Oligonucleotides containing base-free linking groups with photoactivatable side chains
US5616464A (en) 1994-12-27 1997-04-01 Naxcor Nucleic acid sequence detection employing amplification probes
RU2041261C1 (ru) 1993-08-11 1995-08-09 Институт молекулярной биологии им.В.А.Энгельгардта РАН Способ изготовления матрицы для детектирования мисматчей
RU2041262C1 (ru) 1993-08-11 1995-08-09 Институт молекулярной биологии им.В.А.Энгельгардта РАН Способ иммобилизации водорастворимых биоорганических соединений на капиллярно-пористый носитель
RU2041263C1 (ru) 1993-08-11 1995-08-09 Геннадий Моисеевич Ершов Способ микродозирования водных растворов веществ на носитель и устройство для его осуществления
CA2169837A1 (en) 1993-08-18 1995-02-23 Peter D. Duck Compositions and methods for detecting target nucleic acid sequences utilizing adjacent sequence-enzyme molecules
WO1995008626A1 (en) 1993-09-20 1995-03-30 The Regents Of The University Of Colorado Strategy for the production of rna from immobilized templates
US5952172A (en) 1993-12-10 1999-09-14 California Institute Of Technology Nucleic acid mediated electron transfer
US5591578A (en) 1993-12-10 1997-01-07 California Institute Of Technology Nucleic acid mediated electron transfer
US6071699A (en) 1996-06-07 2000-06-06 California Institute Of Technology Nucleic acid mediated electron transfer
FR2720832A1 (fr) 1994-04-22 1995-12-08 Francis Garnier Electrodes et membranes électroactives à base de peptides bioactifs, pour la reconnaissance, l'extraction ou le relargage d'espèces biologiquement actives.
US5681702A (en) 1994-08-30 1997-10-28 Chiron Corporation Reduction of nonspecific hybridization by using novel base-pairing schemes
US5620850A (en) 1994-09-26 1997-04-15 President And Fellows Of Harvard College Molecular recognition at surfaces derivatized with self-assembled monolayers
US5601982A (en) 1995-02-07 1997-02-11 Sargent; Jeannine P. Method and apparatus for determining the sequence of polynucleotides
US6207369B1 (en) 1995-03-10 2001-03-27 Meso Scale Technologies, Llc Multi-array, multi-specific electrochemiluminescence testing
DE19515552A1 (de) 1995-04-27 1996-10-31 Europ Lab Molekularbiolog Simultane Sequenzierung von Nukleinsäuren
US5854033A (en) 1995-11-21 1998-12-29 Yale University Rolling circle replication reporter systems
US5795453A (en) 1996-01-23 1998-08-18 Gilmartin; Markas A. T. Electrodes and metallo isoindole ringed compounds
US5851772A (en) 1996-01-29 1998-12-22 University Of Chicago Microchip method for the enrichment of specific DNA sequences
US6107080A (en) 1996-04-25 2000-08-22 Mcgill University Biosensor device and method
US6096273A (en) 1996-11-05 2000-08-01 Clinical Micro Sensors Electrodes linked via conductive oligomers to nucleic acids
US6060327A (en) 1997-05-14 2000-05-09 Keensense, Inc. Molecular wire injection sensors
US6203758B1 (en) 1997-11-10 2001-03-20 Bio-Pixel Ltd. Micro-circuit system with array of functionalized micro-electrodes
US6060023A (en) 1998-03-31 2000-05-09 Motorola, Inc. Molecular sensing apparatus

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996040712A1 (en) * 1995-06-07 1996-12-19 California Institute Of Technology Nucleic acid mediated electron transfer
WO1997009337A1 (de) * 1995-09-07 1997-03-13 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Metallocen-phosphoramidit-konjugate, verfahren zu ihrer herstellung sowie deren verwendung
WO1998020162A2 (en) * 1996-11-05 1998-05-14 Clinical Micro Sensors Electrodes linked via conductive oligomers to nucleic acids
WO1998057159A1 (en) * 1997-06-12 1998-12-17 Clinical Micro Sensors, Inc. Electronic methods for the detection of analytes

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
UTO Y ET AL: "Electrochemical analysis of DNA amplified by the polymerase chain reaction with a ferrocenylated oligonucleotide" ANALYTICAL BIOCHEMISTRY, vol. 250, no. 250, 1997, pages 122-124 124, XP002106964 ISSN: 0003-2697 *

Cited By (58)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6528266B2 (en) 1993-12-10 2003-03-04 California Institute Of Technology Nucleic acid mediated electron transfer
US7033760B2 (en) 1995-06-07 2006-04-25 California Institute Of Technology Metallic solid supports modified with nucleic acids
US6495323B1 (en) 1996-11-05 2002-12-17 Clinical Micro Sensors, Inc. AC methods for the detection of nucleic acids
US6686150B1 (en) 1998-01-27 2004-02-03 Clinical Micro Sensors, Inc. Amplification of nucleic acids with electronic detection
US7655129B2 (en) 1998-06-23 2010-02-02 Osmetech Technology Inc. Binding acceleration techniques for the detection of analytes
US6761816B1 (en) 1998-06-23 2004-07-13 Clinical Micro Systems, Inc. Printed circuit boards with monolayers and capture ligands
US7737088B1 (en) 1998-08-28 2010-06-15 Febit Holding Gmbh Method and device for producing biochemical reaction supporting materials
US7097974B1 (en) 1998-08-28 2006-08-29 Febit Biotech Gmbh Support for a method for determining an analyte and a method for producing the support
US6740518B1 (en) 1998-09-17 2004-05-25 Clinical Micro Sensors, Inc. Signal detection techniques for the detection of analytes
US9874542B2 (en) 1998-09-17 2018-01-23 Clinical Micro Sensors, Inc. Signal detection techniques for the detection of analytes
US8012743B2 (en) 1998-10-27 2011-09-06 Osmetech Technology Inc. Detection of target analytes using particles and electrodes
WO2001006016A2 (en) * 1999-07-20 2001-01-25 Clinical Micro Sensors, Inc. Amplification of nucleic acids with electronic detection
WO2001006016A3 (en) * 1999-07-20 2001-08-23 Clinical Micro Sensors Inc Amplification of nucleic acids with electronic detection
US7935481B1 (en) 1999-07-26 2011-05-03 Osmetech Technology Inc. Sequence determination of nucleic acids using electronic detection
US6875619B2 (en) 1999-11-12 2005-04-05 Motorola, Inc. Microfluidic devices comprising biochannels
JP2003514227A (ja) * 1999-11-12 2003-04-15 クリニカル・マイクロ・センサーズ・インコーポレイテッド 被検体検出のための結合促進法
WO2001040511A3 (en) * 1999-12-01 2002-05-10 Secr Defence Detection system
US6518024B2 (en) 1999-12-13 2003-02-11 Motorola, Inc. Electrochemical detection of single base extension
WO2001059154A3 (en) * 2000-02-08 2002-03-21 Molecular Sensing Plc Process for characterising nucleic acids in solution
WO2001059154A2 (en) * 2000-02-08 2001-08-16 Molecular Sensing Plc Process for characterising nucleic acids in solution
WO2001073429A3 (en) * 2000-03-27 2002-04-25 Univ Clemson Detection of redox-active molecules in solution
WO2001073429A2 (en) * 2000-03-27 2001-10-04 Clemson University Detection of redox-active molecules in solution
US6602400B1 (en) 2000-06-15 2003-08-05 Motorola, Inc. Method for enhanced bio-conjugation events
US7470540B2 (en) 2000-10-17 2008-12-30 Febit Ag Method and device for the integrated synthesis and analysis of analytes on a support
US20100184076A1 (en) * 2003-09-02 2010-07-22 Restalyst Pte Ltd Soluble analyte detection and amplification
US9181579B2 (en) 2003-09-02 2015-11-10 Restalyst Pte Ltd Soluble analyte detection and amplification
AU2004269412B2 (en) * 2003-09-02 2009-02-19 Restalyst Pte Ltd Soluble analyte detection and amplification
US10829803B2 (en) 2006-05-10 2020-11-10 Dxterity Diagnostics Incorporated Detection of nucleic acid targets using chemically reactive oligonucleotide probes
US9976177B2 (en) 2009-04-01 2018-05-22 Dxterity Diagnostics Incorporated Chemical ligation dependent probe amplification (CLPA)
US9534257B2 (en) 2009-04-03 2017-01-03 Lifeos Genomics Corporation Multiplex nucleic acid detection methods and systems
US8603743B2 (en) 2009-04-03 2013-12-10 Timothy Z. Liu Multiplex nucleic acid detection methods and systems
WO2010115100A1 (en) 2009-04-03 2010-10-07 L&C Diagment, Inc. Multiplex nucleic acid detection methods and systems
US10280469B2 (en) 2009-04-03 2019-05-07 Lifeos Genomics Corporation Multiplex nucleic acid detection methods and systems
US20140202883A1 (en) * 2009-05-29 2014-07-24 Life Technologies Corporation Apparatus and methods for performing electrochemical reactions
US11567029B2 (en) * 2009-05-29 2023-01-31 Life Technologies Corporation Apparatus and methods for performing electrochemical reactions
US10066257B2 (en) 2010-03-29 2018-09-04 Dxterity Diagnostics Incorporated Methods and compositions for detecting target nucleic acids
US9745616B2 (en) 2011-05-17 2017-08-29 Dxterity Diagnostics Incorporated Methods and compositions for detecting target nucleic acids
WO2014066704A1 (en) 2012-10-24 2014-05-01 Genmark Diagnostics, Inc. Integrated multiplex target analysis
US10495656B2 (en) 2012-10-24 2019-12-03 Genmark Diagnostics, Inc. Integrated multiplex target analysis
EP3919174A2 (en) 2012-10-24 2021-12-08 Genmark Diagnostics Inc. Integrated multiplex target analysis
EP3427830A1 (en) 2012-10-24 2019-01-16 Genmark Diagnostics Inc. Integrated multiplex target analysis
US9957553B2 (en) 2012-10-24 2018-05-01 Genmark Diagnostics, Inc. Integrated multiplex target analysis
EP2965817A1 (en) 2012-10-24 2016-01-13 Genmark Diagnostics Inc. Integrated multiplex target analysis
US10391489B2 (en) 2013-03-15 2019-08-27 Genmark Diagnostics, Inc. Apparatus and methods for manipulating deformable fluid vessels
US9410663B2 (en) 2013-03-15 2016-08-09 Genmark Diagnostics, Inc. Apparatus and methods for manipulating deformable fluid vessels
US9222623B2 (en) 2013-03-15 2015-12-29 Genmark Diagnostics, Inc. Devices and methods for manipulating deformable fluid vessels
US10807090B2 (en) 2013-03-15 2020-10-20 Genmark Diagnostics, Inc. Apparatus, devices, and methods for manipulating deformable fluid vessels
US9453613B2 (en) 2013-03-15 2016-09-27 Genmark Diagnostics, Inc. Apparatus, devices, and methods for manipulating deformable fluid vessels
US10463347B2 (en) 2014-06-10 2019-11-05 Dxterity Diagnostics Incorporated Devices and methods for collecting and stabilizing biological samples
US9757095B2 (en) 2014-06-10 2017-09-12 Dxterity Diagnostics Incorporated Devices and methods for collecting and stabilizing biological samples
US10864522B2 (en) 2014-11-11 2020-12-15 Genmark Diagnostics, Inc. Processing cartridge and method for detecting a pathogen in a sample
EP3831481A1 (en) 2014-11-11 2021-06-09 Genmark Diagnostics Inc. Instrument and cartridge for performing assays in a closed sample preparation and reaction system
WO2016077341A2 (en) 2014-11-11 2016-05-19 Genmark Diagnostics, Inc. Instrument and cartridge for performing assays in a closed sample preparation and reaction system employing electrowetting fluid manipulation
WO2016077364A2 (en) 2014-11-11 2016-05-19 Genmark Diagnostics, Inc. Instrument and cartridge for performing assays in a closed sample preparation and reaction system
US10605767B2 (en) 2014-12-18 2020-03-31 Life Technologies Corporation High data rate integrated circuit with transmitter configuration
US11536688B2 (en) 2014-12-18 2022-12-27 Life Technologies Corporation High data rate integrated circuit with transmitter configuration
WO2018053501A1 (en) 2016-09-19 2018-03-22 Genmark Diagnostics, Inc. Instrument for processing cartridge for performing assays in a closed sample preparation and reaction system
US11300578B2 (en) 2016-09-19 2022-04-12 Roche Molecular Systems, Inc. Instrument for processing cartridge for performing assays in a closed sample preparation and reaction system

Also Published As

Publication number Publication date
EP1051517A2 (en) 2000-11-15
AU764926B2 (en) 2003-09-04
WO1999037819A3 (en) 1999-10-14
US7090804B2 (en) 2006-08-15
JP2002500897A (ja) 2002-01-15
US20020006643A1 (en) 2002-01-17
AU2473799A (en) 1999-08-09
CA2319170A1 (en) 1999-07-29

Similar Documents

Publication Publication Date Title
AU764926B2 (en) Amplification of nucleic acids with electronic detection
US6686150B1 (en) Amplification of nucleic acids with electronic detection
AU763494B2 (en) Electronic methods for the detection of analytes utilizing monolayers
AU765597B2 (en) Electronic detection of nucleic acids using monolayers
US6063573A (en) Cycling probe technology using electron transfer detection
EP1218541B1 (en) Sequence determination of nucleic acids using electronic detection
US6753143B2 (en) Target analyte detection using asymmetrical self-assembled monolayers
US7393645B2 (en) Compositions for the electronic detection of analytes utilizing monolayers
US7160678B1 (en) Compositions for the electronic detection of analytes utilizing monolayers
US6290839B1 (en) Systems for electrophoretic transport and detection of analytes
US6090933A (en) Methods of attaching conductive oligomers to electrodes
US20030087228A1 (en) Electronic detection of nucleic acids using monolayers
EP0939762A2 (en) Electrodes linked via conductive oligomers to nucleic acids
WO2001006016A9 (en) Amplification of nucleic acids with electronic detection
US20050053962A1 (en) Amplification of nucleic acids with electronic detection
AU2003271352A1 (en) Electronic detection of nucleic acids using monolayers
AU780739B2 (en) Electrodes linked via conductive oligomers to nucleic acids

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref document number: 2319170

Country of ref document: CA

Ref country code: CA

Ref document number: 2319170

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 528725

Kind code of ref document: A

Format of ref document f/p: F

NENP Non-entry into the national phase

Ref country code: KR

WWE Wipo information: entry into national phase

Ref document number: 24737/99

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 1999904316

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1999904316

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWG Wipo information: grant in national office

Ref document number: 24737/99

Country of ref document: AU

WWW Wipo information: withdrawn in national office

Ref document number: 1999904316

Country of ref document: EP