WO1999020779A1 - Cassettes d'encapsidation de virus adeno-associe (aav) amplifiable pour la production de vecteurs de aav recombines - Google Patents

Cassettes d'encapsidation de virus adeno-associe (aav) amplifiable pour la production de vecteurs de aav recombines Download PDF

Info

Publication number
WO1999020779A1
WO1999020779A1 PCT/US1998/021938 US9821938W WO9920779A1 WO 1999020779 A1 WO1999020779 A1 WO 1999020779A1 US 9821938 W US9821938 W US 9821938W WO 9920779 A1 WO9920779 A1 WO 9920779A1
Authority
WO
WIPO (PCT)
Prior art keywords
aav
packaging
rep
gene
vector
Prior art date
Application number
PCT/US1998/021938
Other languages
English (en)
Inventor
Carmel M. Lynch
Haim Burstein
Anthony M. Stepan
Dara H. Lockert
Original Assignee
Targeted Genetics Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Targeted Genetics Corporation filed Critical Targeted Genetics Corporation
Priority to US09/180,114 priority Critical patent/US6642051B1/en
Priority to EP98953640A priority patent/EP1025251A1/fr
Priority to JP2000517099A priority patent/JP2001520051A/ja
Priority to AU10967/99A priority patent/AU758541B2/en
Priority to CA002308008A priority patent/CA2308008A1/fr
Publication of WO1999020779A1 publication Critical patent/WO1999020779A1/fr
Priority to US11/341,249 priority patent/US20060205079A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14151—Methods of production or purification of viral material
    • C12N2750/14152—Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles

Definitions

  • This invention is in the field of viral constructs for gene delivery. More specifically, the invention is in the field of recombinant DNA constructs for use in the production of adeno-associated virus (AAV) vectors for gene delivery.
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV vectors and then describes a number of novel improvements according to the present invention that are useful for efficiently generating high titer recombinant AAV vector (rAAV) preparations suitable for use in gene therapy.
  • rAAV recombinant AAV vector
  • Adeno-associated virus is a defective parvovirus that grows only in cells in which certain functions are provided by a co-infecting helper virus.
  • General reviews of AAV may be found in, for example, Carter, 1989, Handbook of Parvoviruses, Vol. I, pp. 169- 228, and Berns, 1990, Virology, pp. 1743-1764, Raven Press, (New York).
  • co-infecting viruses that provide helper functions for AAV growth and replication are adenoviruses, herpesvirases and, in some cases, poxviruses such as vaccinia.
  • the nature of the helper function is not entirely known but it appears that the helper virus indirectly renders the cell permissive for AAV replication. This belief is supported by the observation that AAV replication may occur at low efficiency in the absence of helper virus co-infection if the cells are treated with agents that are either genotoxic or that disrupt the cell cycle.
  • AAV may replicate to a limited extent in the absence of helper virus, under such conditions as noted above, more generally infection of cells with AAV in the absence of helper functions results in the proviral AAV genome integrating into the host cell genome.
  • viruses such as many retro viruses
  • AAV generally integrates into a unique position in the human genome.
  • AAV integration site a unique position which is located on chromosome 19. See, e.g., Weitzman et al. (1994) Proc. Nat'l. Acad. Sci. USA 91 : 5808-5812. If host cells having an integrated AAV are subsequently superinfected with a helper virus such as adenoviras, the integrated AAV genome can be rescued and replicated to yield a burst of infectious progeny AAV particles.
  • helper virus such as adenoviras
  • a sequence at the AAV integration site shares homology with the AAV inverted terminal repeat (ITR) sequence, exhibits activity in a cell-free replication system, and is believed to be involved in both the integration and rescue of AAV. See, e.g., Weitzman et al., id., Kotin et al. (1992) EMBO J. 11 :5071-5078, and Urcelay et al., J. Virol. 69: 2038-2046.
  • ITR A sequence at the AAV integration site
  • AAV has a very broad host range without any obvious species or tissue specificity and can replicate in virtually any cell line of human, simian or rodent origin provided that an appropriate helper is present.
  • AAV is also relatively ubiquitous and has been isolated from a wide variety of animal species including most mammalian and several avian species.
  • AAV is not associated with the cause of any disease.
  • AAV a transforming or oncogenic viras, and integration of AAV into the genetic material of hum ⁇ tn cells generally does not cause significant alteration of the growth properties or morphological characteristics of the host cells.
  • These properties of AAV also recommend it as a potentially useful human gene therapy vector because most of the other viral systems proposed for this application, such as retroviruses, adenoviruses, herpesvirases, or poxviruses, are disease-causing.
  • Virology 3: 1-61 For example, all AAV serotypes apparently exhibit very similar replication properties mediated by homologous rep genes; and all bear three related capsid proteins such as those expressed in AAV2. The degree of relatedness is further suggested by heteroduplex analysis which reveals extensive cross-hybridization between serotypes along the length of the genome; and the presence of analogous self-annealing segments at the termini that correspond to inverted terminal repeats (ITRs). The similar infectivity patterns also suggest that the replication functions in each serotype are under simile regulatory control.
  • AAV2 serotype was used in various illustrations of the present invention that are set forth in the Examples, general reference to AAV herein encompasses all AAV serotypes, and it is fully expected that the methods and compositions disclosed herein will be applicable to all AAV serotypes.
  • AAV particles are comprised of a proteinaceous capsid having three capsid proteins, VP1, VP2 and VP3, which enclose a DNA genome.
  • the AAV2 DNA genome for example, is a linear single-stranded DNA molecule having a molecular weight of about 1.5 x 10 6 daltons and a length of about 5 kb. Individual particles package only one DNA molecule strand, but this may be either the "plus” or "minus" strand. Particles containing either strand are infectious and replication occurs by conversion of the parental infecting single strand to a duplex form and subsequent amplification of a large pool of duplex molecules from which progeny single strands are displaced and packaged into capsids.
  • Duplex or single-strand copies of AAV genomes can be inserted into bacterial plasmids or phagemids and transfected into adenovirus-infected cells; these techniques have facilitated the study of AAV genetics and the development of AAV vectors.
  • the AAV genome which encodes proteins mediating replication and encapsidation of the viral DNA, is generally flanked by two copies of inverted terminal repeats (ITRs).
  • ITRs inverted terminal repeats
  • the ITRs are each 145 nucleotides in length, flanking a unique sequence region of about 4470 nucleotides that contains two main open reading frames for the rep and cap genes (Srivastiva et al., 1983, J. Virol., 45:555-564; Hermonat et al., J. Virol. 51 :329-339; Tratschin et al., 1984a, J. Virol, 51:611-619).
  • the AAV2 unique region contains three transcription promoters p5, pl9, and p40 (Laughlin et al., 1979, Proc. Natl. Acad. Sci. USA, 76:5567-5571) that are used to express the rep .and cap genes.
  • the ITR sequences are required in cis and are sufficient to provide a functional origin of replication (ori), signals required for integration into the cell genome, and efficient excision and rescue from host cell chromosomes or recombinant plasmids. It has also been shown that the ITR can function directly as a transcription promoter in an AAV vector. See Flotte et al., 1993, supra; and Carter et al., U.S. Patent No. 5,587,308.
  • the rep .and cap gene products are required in trans to provide functions for replication and encapsidation of viral genome, respectively.
  • the rep gene is expressed from two promoters, p5 and pi 9, and produces four proteins. Transcription from p5 yields an unspliced 4.2 kb mRNA encoding a first Rep protein (Rep78), and a spliced 3.9 kb mRNA encoding a second Rep protein (Rep68). Transcription from pl9 yields an unspliced mRNA encoding a third Rep protein (Rep52), and a spliced 3.3 kb mRNA encoding a fourth Rep protein (Rep40).
  • Rep proteins all comprise a common internal region sequence but differ in their amino and carboxyl terminal regions. Only the large Rep proteins (i.e. Rep78 and Rep68) are required for AAV duplex DNA replication, but the small Rep proteins (i.e. Rep52 and Rep40) appear to be needed for progeny, single-strand DNA accumulation (Chejanovsky & Carter, 1989, Virology 173:120-128). Rep68 and Rep78 bind specifically to the hairpin conformation of the AAV ITR and possess several enzyme activities required for resolving replication at the AAV termini. Rep52 and Rep40 have none of these properties. Reports by C. H ⁇ lscher et al. (1994, J. Virol. 68:7169-7177; and 1995, J. Virol. 69:6880-6885) have suggested that expression of Rep78 or Rep 68 may in some circumstances be sufficient for infectious particle formation.
  • the Rep proteins primarily Rep78 and Rep68, also exhibit pleiotropic regulatory activities including positive and negative regulation of AAV genes and expression from some heterologous promoters, as well as inhibitory effects on cell growth (Tratschin et al., 1986, Mol. Cell. Biol. 6:2884-2894; Labow et al., 1987, Mol. Cell. Biol, 7:1320-1325; Khleif et al, 1991, Virology, 181:738-741).
  • the AAV p5 promoter is negatively auto- regulated by Rep78 or Rep68 (Tratschin et al, 1986, Mol. Cell. Biol. 6:2884-2894).
  • the capsid proteins VP1, VP2, and VP3 share a common overlapping sequence, but VP1 and VP2 contain additional amino terminal sequences. All three proteins are encoded by the. same cap gene reading frame typically expressed from a spliced 2.3 kb mRNA transcribed from the p40 promoter. VP2 and VP3 can be generated from this mRNA by use of alternate initiation codons. Generally, transcription from p40 yields a 2.6 kb precursor mRNA which can be spliced at alternative sites to yield two different transcripts of about 2.3 kb. VP2 and VP3 can be encoded by either transcript (using either of the two initiation sites), whereas VP1 is encoded by only one of the transcripts.
  • VP3 is the major capsid protein, typically accounting for about 90% of total virion protein.
  • VP1 is coded from a minor mRNA using a 3' donor site that is 30 nucleotides upstream from the 3' donor used for the major mRNA that encodes VP2 and VP3. All three proteins are required for effective capsid production. Mutations which eliminate all three proteins
  • AAV recombinant plasmids Transfection of such AAV recombinant plasmids into mammalian cells that were also infected with an appropriate helper virus, such as adenovirus, resulted in rescue and excision of the AAV genome free of any plasmid sequence, replication of the rescued genome and generation of progeny infectious AAV particles.
  • helper virus such as adenovirus
  • rAAV vector or "pro-vector".
  • ITR terminal
  • rAAV vector or "pro-vector”.
  • the terminal (ITR) portions of the AAV sequence must generally be retained intact because these regions are generally required in cis for several functions, including excision from the plasmid after transfection, replication of the vector genome and integration and rescue from a host cell genome.
  • providing a single ITR may be sufficient to carry out the functions normally associated with two wild-type ITRs (see, e.g., Samulski et al., WO 94/13788, published 23 June 1994).
  • the vector can then be packaged into an AAV particle to generate an AAV transducing viras by transfection of the vector into cells that are infected by an appropriate helper viras such as adenovirus or herpesvirus; provided that, in order to achieve replication and encapsidation of the vector genome into AAV particles, the vector must generally be complemented for any AAV functions required in trans, particularly rep and cap, that were deleted in construction of the vector.
  • helper viras such as adenovirus or herpesvirus
  • AAV vectors are among a small number of recombinant viras vector systems which have been shown to have utility as in vivo gene transfer agents (reviewed in Carter,
  • AAV vectors are capable of high-frequency transduction and expression in a variety of cells including cystic fibrosis (CF) bronchial and nasal epithelial cells (see, e.g., Flotte et al, 1992a, Am. J. Respir. Cell Mol. Biol. 7:349-356; Egan et al., 1992, Nature,
  • CF cystic fibrosis
  • AAV may not require active cell division for transduction and expression which would be another clear advantage over retro viruses, especially in tissues such as the human airway epithelium where most cells are terminally differentiated and non-dividing.
  • the transducing vector be generated at titers sufficiently high to be practicable as a delivery system. This is especially important for gene therapy stratagems aimed at in vivo delivery of the vector. For example, it is likely that for many desirable applications of AAV vectors, such as treatment of cystic fibrosis by direct in vivo delivery to the airway, the desired dose of transducing vector may be from 10 8 to 10 10 , or, in some cases, in excess of 10 10 particles.
  • the vector preparations are preferably essentially free of wild-type AAV viras (or any replication-competent AAV).
  • AAV vectors The attainment of high titers of AAV vectors has been difficult for several reasons including preferential encapsidation of wild-type AAV genomes (if they are present or generated by recombination), and the difficulty in generating sufficient complementing functions such as those provided by the wild-type rep and cap genes.
  • Useful cell lines expressing such complementing functions have been especially difficult to generate, in part because of pleiotropic inhibitory functions associated with the rep gene products.
  • cell lines in which the rep gene is integrated and expressed may grow slowly or express rep at very low levels.
  • the first AAV vectors described contained foreign reporter genes such as neo, cat or dhfr expressed from AAV transcription promoters or an SV40 promoter (Tratschin et al., 1984b, Mol. Cell. Biol. 4:2072-2081; Hermonat & Muzyczka, 1984, Proc. Natl. Acad. Sci. USA, 81 :6466-6470; Tratschin et al., 1985, Mol. Cell. Biol. 5:3251-3260; McLaughlin et al., 1988, J. Virol., 62:1963-1973; Lebkowski et al., 1988 Mol. Cell. Biol., 7:349-356).
  • foreign reporter genes such as neo, cat or dhfr expressed from AAV transcription promoters or an SV40 promoter
  • Lebkowski et al., (1988) did not report the actual vector titers in a meaningful way but the biological assays, showing not more than 1% transduction frequency when 5 x 10 6 cells were exposed to three ml of vector preparation, indicate that the titer was less than 2 x 10" geneticin resistant units per ml. Also, the pBal A packaging plasmid contains overlapping homology with the ITR sequence in the vector and can lead to generation of replication- competent AAV by homologous recombination.
  • Laface et al. (1988) used the same vector as that used by Hermonat & Muzyczka (1984) prepared in the same way and obtained a transduction frequency of 1.5% in murine bone marrow cultures, again showing very low titer.
  • Samulski et al. (1987, J. Virol., 61:3096-3101) constructed a plasmid called pSub201 which contained an intact AAV genome in a bacterial plasmid but which had a deletion of 13 nucleotides at the extremity of each ITR and thus was rescued and replicated less efficiently than other AAV plasmids that contained the entire AAV genome.
  • Samulski et al. (1989, J. Virol., 63:3822-3828) constructed AAV vectors based on pSub201 but deleted for rep and cap and containing either a hyg or neo gene expressed from an SV40 early gene promoter.
  • pAAV/Ad packaged these vectors by co-transfection with a packaging plasmid called pAAV/Ad which consisted of the entire AAV nucleotide sequence from nucleotide 190 to 4490 enclosed at either end with one copy of the adenovirus ITR.
  • pAAV/Ad a packaging plasmid which consisted of the entire AAV nucleotide sequence from nucleotide 190 to 4490 enclosed at either end with one copy of the adenovirus ITR.
  • the AAV rep and cap genes were expressed from their native AAV promoters (i.e. p5, pl9 and p40, as discussed above).
  • the function of the adenovirus ITR in pAAV/Ad was thought to enhance the expression level of AAV capsid proteins.
  • the low titer produced in this system thus appears to have been due in part to the defect in the ITR sequences of the basic pSub201 plasmid used for vector construction and in part due to limiting expression of AAV genes from pAAV/Ad.
  • Samulski et al. generated vector stocks by transfecting, in bulk, thirty 10-cm dishes of 293 cells and concentrating the vector stock by banding in CsCl. This produced an AAVneo vector stock containing a total of 10 8 particles as measured by a DNA dot-blot hybridization assay. When this vector stock was used at multiplicities of up to 1,000 particles per cell, a transduction frequency of 70% was obtained. This suggests that the particle-to-transducing ratio is about 500 to 1,000 particles since at the ratio of one transducing unit per cell the expected proportion of cells that should be transduced is 63% according to the Poisson distribution.
  • AAV vectors For example, Srivastiva et al., (1989, Proc. Natl. Acad. Sci. USA, 86:8078-8082) described an AAV vector based on the pSub201 plasmid of Samulski et al. (1987), in which the coding sequences of AAV were replaced with the coding sequences of another parvo viras, B19. This vector was packaged into AAV particles using the pAAV/Ad packaging plasmid to generate a functional vector, but titers were not reported. This system was based on pSub201 and thus suffers from the defect described above for this plasmid.
  • the vector and the packaging plasmid contained overlapping AAV sequences (the ITR regions) and thus recombination yielding contaminating wild-type viras is highly likely. Chatterjee et al. (1991, Vaccines 91, Cold Spring Harbor Laboratory Press, pp. 85-
  • Chatterjee et al., and Wong et al. used a packaging system known to give only low titer and which can lead to generation of replication-competent AAV genomes because of the overlapping homology in the vector and packaging sequences.
  • AAV vectors have potential utility as vectors for treatment of human disease by gene therapy.
  • the difficulty in generating sufficient amounts of AAV vectors has been a severe limitation on the development of human gene therapy using AAV vectors.
  • One aspect of this limitation is that there have been very few studies using AAV vectors in in vivo animal models (see, e.g., Flotte et al.,
  • Lebkowski et al. suggest introducing rep and cap genes into the cell genome but the method again requires the use of episomal AAV transducing vectors comprising an Epstein-Barr viras nuclear antigen (EBNA) gene and an Epstein-Barr virus latent origin of replication; and, again, the only information relative to titer indicated that it was fairly low.
  • Kotin et al. (WO95/14771, published 01 June 1995) suggested a system employing "first" and "second" vectors to provide a source of an rAAV vector and AAV rep-cap genes, respectively. The proposed system involves a series of sequential transfections/infections of the host cells, in a transient transfection system. No data were provided regarding rAAV viral titers obtained and, indeed, it is not apparent that any rAAV virus was actually produced according to the suggested system, much less at high titer).
  • AAV Rep proteins down-regulate their own expression from the AAV-p5 promoter which has been used in the various previously described packaging constracts such as pAAV/Ad (Samulski et al., 1989) or pBal A (Lebkowski et al., 1988, 1992).
  • the present invention provides additional improvements in the production of high-titer rAAV vector preparations.
  • the present invention provides compositions and methods that provide amplifiable expression of the AAV rep and/or cap genes (also referred to herein as "AAV packaging genes") which can be employed in the generation of recombinant AAV (rAAV) vectors.
  • AAV packaging genes also referred to herein as "AAV packaging genes”
  • the inventors have found that by removing the AAV rep and/or cap genes from their normal environment (i.e. flanked by the AAV ITRs) and placing them in amplifiable linkage with one or more activating elements (exemplified by the "PI" sequence of human chromosome 19, or analogous elements), it is possible to obtain controlled but highly amplifiable expression of the AAV packaging genes in cells to be used for the preparation of rAAV vectors.
  • packaging cassettes comprising rep and/or cap sequences in amplifiable linkage to PI or a PI -like element can be integrated into the chromosome of a host cell or can be maintained extrachromosomally as an episome.
  • the methods and compositions of the present invention can be used to generate stable AAV producer cells that are capable of supporting production of a very large burst of rAAV particles upon infection with a suitable helper viras (such as adenovirus) or provision of helper functions.
  • the invention provides a recombinant polynucleotide sequence encoding an adeno-associated viras (AAV) packaging cassette comprising at least one AAV packaging gene amplifiably linked to a PI sequence, or an equivalent activating element.
  • AAV adeno-associated viras
  • the invention provides methods for producing high-titer stocks of rAAV vectors containing a foreign gene of interest, by co-expressing an rAAV vector containing a gene of interest along with an AAV packaging cassette comprising at least one AAV packaging gene amplifiably linked to an activating element.
  • the invention also provides compositions and methods for producing cell lines comprising an AAV packaging cassette of the invention together with an rAAV vector containing a gene of interest; cell lines produced thereby; compositions and methods for high-efficiency packaging of an rAAV vector containing a gene of interest; and rAAV vectors packaged according to the method of the invention.
  • AAV packaging cassettes comprising one or more activating elements and one or more AAV packaging genes can be introduced into a host cell and propagated episomally or they can be integrated into a chromosome of a mammalian host cell.
  • the invention provides AAV packaging cassettes comprising AAV packaging genes and an activating element that are capable of integrating into the genome of a host cell (such as a mammalian cell); as well as packaging cells comprising such stably-integrated integrated cassettes.
  • the invention provides episomal packaging cassettes comprising one or more AAV packaging genes and one or more activating elements, present within a host cell as a freely- replicating episome (or capable of being introduced into a host cell such that, after introduction into the host cell, the packaging cassette will exist as a freely-replicating episomal element); as well as packaging cells comprising such episomally-maintained packaging cassettes.
  • episomal packaging cassettes comprising one or more AAV packaging genes and one or more activating elements, present within a host cell as a freely- replicating episome (or capable of being introduced into a host cell such that, after introduction into the host cell, the packaging cassette will exist as a freely-replicating episomal element); as well as packaging cells comprising such episomally-maintained packaging cassettes.
  • Figure 1 shows a map of the p5repcapDHFR plasmid.
  • Figure 2 shows a map of the P1RCD plasmid.
  • FIG. 3 shows a map of the episomal packaging plasmid Pl/p5repcap/Rep8.
  • the concatameric PI elements (at "12 o'clock" on the circle) are indicated.
  • Each PI element comprises a terminal resolution site (TRS) and a Rep-binding site (RBS, also known as a Rep-binding motif or RB Motif).
  • TRS terminal resolution site
  • RBS Rep-binding site
  • the p5repcap(-Pl)/Rep8 construct is identical except that it does not contain the concatameric PI elements.
  • Figure 4 shows phosphorimaging analysis of a Southern blot to assay levels of the episomal PI -containing packaging plasmid in the presence (+) or absence (-) of Ad5 infection.
  • Lanes 1 and 2 - HeLa cells containing the episomal packaging plasmid p5repcap(-Pl)/Rep8.
  • Figure 5 shows phosphorimaging analysis of a Southern blot to assay rAAV-CFTR production in cells containing the episomal packaging plasmids p5repcap(-Pl)/Rep8 and Pl/p5repcap/Rep8, in the presence (+) or absence (-) of Ad5 infection.
  • a basic challenge in the area of gene therapy is the development of strategies for efficient gene delivery to cells and tissues in vivo.
  • One strategy involves the use of adeno- associated viras (AAV) vectors.
  • AAV vectors are recombinant constracts of the AAV genome comprising sequences required in cis for vector packaging (typically AAV ITR sequences), along with heterologous polynucleotide(s) encoding a protein or function of interest.
  • Recombinant AAV vectors are potentially powerful tools for human gene therapy.
  • rAAV vectors are capable of in vivo gene delivery, for example in the respiratory tract, high titers of such vectors are necessary to allow the delivery of a sufficiently high multiplicity of vector in a minimal volume. Consequently, optimal packaging methodology is of central importance for AAV-mediated gene therapy approaches.
  • Packaging of rAAV vectors is mediated by the products of two AAV genes: rep (replication proteins) and cap (capsid proteins), which can be provided separately in trans.
  • a sequence comprising AAV packaging genes to be provided in trans is often referred to herein as a "packaging cassette". It is thus desirable to construct packaging cell lines containing both the AAV packaging genes (e.g., in a packaging cassette) and an rAAV vector.
  • stable, helper-free AAV packaging cell lines have been difficult to obtain, primarily due to the activities of Rep and Cap proteins, for which low-level expression can impose a severe constraint on packaging, while high-level expression
  • the present invention provides controlled but amplifiable expression of the rep and cap genes, to thereby provide Rep and capsid proteins at levels sufficient for production of high-titer vector stocks, while avoiding any effects of cell toxicity (as can occur if the rep gene is placed under the control of regulatory elements that exhibit some constitutive activity or are not tightly regulated).
  • compositions of the present invention which allow for controlled, amplifiable expression of AAV packaging genes, even when the packaging genes are expressed from their native promoters (such as the rep gene p5 promoter, which is a relatively weak promoter), provide substantial improvements in packaging efficiency.
  • AAV packaging genes in a recombinant DNA constract wherein they are amplifiably linked to an activating element.
  • the activating element is directly or indirectly triggered by the user when it is desired to initiate vector production, preferably by infection with helper viras or provision of helper function.
  • the use of the PI sequence of human chromosome 19 is exemplary in these respects.
  • the activating element exemplified by- PI, can thus promote amplification of AAV packaging genes to which it is linked.
  • the resulting elevation in template levels would allow the gene products (like Rep and Cap proteins) to be produced in much higher amounts, particularly in view of the fact that their promoters can also be transcriptionally activated to thereby provide efficient packaging functions.
  • Inclusion of an activating element in an AAV packaging cassette, along with AAV packaging genes, thus provides a new type of AAV packaging cassette which is particularly useful in the production of high-titer stocks of rAAV vectors, as described and exemplified herein.
  • the AAV packaging cassettes of the present invention can also be used to effectively provide a baseline level of Rep proteins that is very low (if present at all) and is therefore not detrimental to the growth of the host cell, but can be amplified when required (for example by helper viras infection or provision of helper function) to a level that promotes efficient production of rAAV vectors.
  • amplification results in increased levels of templates comprising AAV packaging genes, which collectively allow high levels of expression of packaging gene products (e.g., Rep and Cap proteins), which in turn facilitates production of high titers of rAAV genomes.
  • the native promoter for Rep protein expression (p5) is relatively weak and consequently that synthesis of native Rep proteins does not occur to any substantial degree in the absence of stimulatory factors such as the El A proteins provided by adenoviras as a helper viras, or equivalent helper functions.
  • human 293 cells contain portions of the human adenovirus genome, in particular the El region, that appear to stimulate the p5 promoter.
  • AAV Rep proteins can effectively modulate their own expression. Both of these phenomena tend to prevent replication from occurring when the viras is in the latent proviral state.
  • AAV packaging genes can be operably linked to relatively weak promoters and nevertheless be capable of providing acceptable levels of packaging proteins upon activation.
  • AAV packaging genes are operably linked to their native promoters (i.e., p5, pl9 and p40, in the case of AAV2 as described above).
  • an AAV packaging cassette wherein packaging gene expression is controlled by p5 is not likely to have any Rep-dependent cytostatic effect on the host cell prior to activation and amplification.
  • the packaging cassette template is amplified, leading to a greater number of templates for transcription of AAV packaging proteins.
  • helper viras infection or provision of helper function is believed also to stimulate transcription from the p5 promoter (which regulates synthesis of mRNA encoding Rep proteins).
  • expression of AAV packaging genes is preferably not triggered until provision of helper function (i.e., at the time the host cells are to be used for packaging of rAAV particles), thereby avoiding the accumulation of high (and potentially cytostatic or cytotoxic) levels of AAV packaging proteins prior to the time they are required for packaging.
  • helper function i.e., at the time the host cells are to be used for packaging of rAAV particles
  • helper function i.e., at the time the host cells are to be used for packaging of rAAV particles
  • AAV packaging cassettes comprising activating elements (as exemplified by the PI sequence element) can be used to generate dramatic increases in the levels of vector production.
  • the use of PI sequences as activating elements for the AAV packaging cassettes of the present invention is believed to be particularly convenient since the same event that is required to trigger the productive generation of AAV particles (i.e. provision of helper viras or helper functions) is believed to also trigger amplification of a constract containing an activating element such as PI
  • the coupling of activating elements, such as PI, with AAV packaging genes can provide a combination of advantages including control of packaging gene product levels (in the "pre-activated” state) and, upon activation, amplification of template levels and stimulation of transcription. It is also noted that, in many cases, the activation of replication origins is, or can be, subject to strict control.
  • replication origins such as those present in eukaryotic or prokaryotic chromosomes, viral genomes, organelle genomes, and bacteriophage genomes, for example, and other origin-like or "or/ ' -like" sequences can be used in the practice of the invention (e.g., as alternatives or additions to the use of PI).
  • origin-like or "or/ ' -like" sequences can be used in the practice of the invention (e.g., as alternatives or additions to the use of PI).
  • activatable origins are those that are not constitutive, but rather require a signal before replication initiation and subsequent amplification of linked sequences will occur.
  • polypeptide refers to polymers of amino acids of any length. These terms also include proteins that are post- translationally modified through reactions that include, but are not limited to, glycosylation, acetylation and phosphorylation.
  • Polynucleotide refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides, or analogs thereof. This term refers only to the primary structure of the molecule. Thus, double- and single-stranded DNA, as well as double- and single-stranded RNA are included.
  • a "gene” refers to a polynucleotide containing at least one open reading frame that is capable of encoding a particular protein after being transcribed and translated.
  • transcriptional regulatory sequence refers to a nucleotide sequence that controls the transcription of a gene or coding sequence to which it is operably linked.
  • Transcriptional regulatory sequences of use in the present invention generally include at least one transcriptional promoter and may also include one or more enhancers and/or terminators of transcription.
  • promoter refers to a nucleotide sequence that directs the transcription of a gene or coding sequence to which it is operably linked.
  • “Operably linked” refers to an arrangement of two or more components, wherein the components so described are in a relationship permitting them to function in a coordinated manner.
  • a transcriptional regulatory sequence or a promoter is operably linked to a coding sequence if the transcriptional regulatory sequence or promoter promotes transcription of the coding sequence.
  • An operably linked transcriptional regulatory sequence is generally joined in cis with the coding sequence, but it is not necessarily directly adjacent to it.
  • Recombinant refers to a genetic entity distinct from that generally found in nature. As applied to a polynucleotide or gene, this means that the polynucleotide is the product of various combinations of cloning, restriction and/or ligation steps, and other procedures that result in a construct that is distinct from a polynucleotide found in nature. "Heterologous” means derived from a genotypically distinct entity from that of the rest of the entity to which it is compared. For example, a polynucleotide introduced by genetic engineering techniques into a different cell type is a heterologous polynucleotide
  • a "vector”, as used herein, refers to a recombinant plasmid or viras that comprises a polynucleotide to be delivered into a host cell, either in vitro or in vivo.
  • the polynucleotide to be delivered may comprise a coding sequence of interest in gene therapy (such as a gene encoding a protein of therapeutic interest) and/or a selectable or detectable marker.
  • a “replicon” refers to a polynucleotide comprising an origin of replication which allows for replication of the polynucleotide in an appropriate host cell.
  • replicons include episomes (including plasmids), as well as chromosomes (such as the nuclear or mitochondrial chromosomes).
  • An "origin,” “replication origin,” “on-like sequence” or “ori element” is a nucleotide sequence involved in one or more aspects of initiation of DNA replication, such as, for example, binding of replication initiation factors, unwinding of the DNA duplex, primer formation, and/or template-directed synthesis of a complementary strand.
  • on ' -like sequences can generally be found in any polynucleotide that is naturally replicated, including plasmids and viruses, as well as prokaryotic, mitochondrial and chloroplast genomes and eukaryotic chromosomes.
  • Such on-like sequences can be identified genetically (i.e., replication-defective mutants, ars sequences) or functionally (i.e., through biochemical assay, electron microscopy, etc.), as is known in the art.
  • "Stable integration" of a polynucleotide into a cell means that the polynucleotide has been integrated into a replicon that tends to be stably maintained in the cell.
  • episomes such as plasmids can sometimes be maintained for many generations
  • genetic material carried episomally is generally more susceptible to loss than chromosomally- integrated material.
  • maintenance of a polynucleotide can often be effected by incorporating a selectable marker into or adjacent to a polynucleotide, and then maintaining cells carrying the polynucleotide under selective pressure.
  • sequences cannot be effectively maintained stably unless they have become integrated into a chromosome; and, therefore, selection for retention of a sequence comprising a selectable marker can result in the selection of cells in which the marker has become stably-integrated into a chromosome.
  • Antibiotic resistance genes can be conveniently employed as such selectable markers, as is well known in the art.
  • stably- integrated polynucleotides would be expected to be maintained on average for at least about twenty generations, preferably at least about one hundred generations, still more preferably they would be maintained permanently.
  • the chromatin structure of eukaryotic chromosomes can also influence the level of expression of an integrated polynucleotide. Having the genes carried on stably-maintained episomes can be particularly useful where it is desired to have multiple stably-maintained copies of a particular gene. The selection of stable cell lines having properties that are particularly desirable in the context of the present invention are described and illustrated below.
  • AAV is adeno-associated viras.
  • Adeno-associated viras is a defective parvoviras that grows only in cells in which certain functions are provided by a co- infecting helper viras.
  • General reviews of AAV may be found in, for example, Carter,
  • AAV serotypes apparently exhibit very similar replication properties mediated by homologous rep genes; and all bear three related capsid proteins such as those expressed in AAV2.
  • the degree of relatedness is further suggested by heteroduplex analysis which reveals extensive cross-hybridization between serotypes along the length of the genome; and the presence of analogous self-annealing segments at the termini that correspond to inverted terminal repeats (ITRs).
  • ITRs inverted terminal repeats
  • a “recombinant AAV vector” refers to a vector comprising one or more polynucleotide sequences of interest, genes of interest or “transgenes” that are flanked by AAV inverted terminal repeat sequences (ITRs).
  • ITRs AAV inverted terminal repeat sequences
  • Such rAAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that has been infected with a suitable helper virus and that is expressing AAV rep and cap gene products (i.e. AAV Rep and Cap proteins).
  • AAV Rep and Cap proteins i.e. AAV Rep and Cap proteins
  • the rAAV vector in a chromosome or in another vector such as a plasmid used for cloning or transfection), then the rAAV vector is typically referred to as a "pro- vector" which can be "rescued” by replication and encapsidation in the presence of AAV packaging functions and necessary helper functions.
  • a "helper virus” for AAV refers to a viras that allows AAV (which is a “defective” parvovirus) to be replicated and packaged by a host cell.
  • helper virases include adenovirases, herpesvirases and poxviruses such as vaccinia.
  • the adenoviruses encompass a number of different subgroups, although Adenoviras type 5 of subgroup C (Ad5) is most commonly used.
  • Ad5 Adenoviras type 5 of subgroup C
  • Numerous adenovirases of human, non-human mammalian and avian origin are known and available from depositories such as the ATCC.
  • Virases of the herpes family include, for example, herpes simplex viruses (HSV) and Epstein-Barr virases (EBV), as well as cytomegalovirases (CMV) and pseudorabies virases (PRV); which are also available from depositories such as ATCC.
  • HSV herpes simplex viruses
  • EBV Epstein-Barr virases
  • CMV cytomegalovirases
  • PRV pseudorabies virases
  • Helper function refers to the activity provided by the helper virus that allows replication and packaging of an AAV genome, or any equivalent activity. Helper functions are also believed to stimulate transcription of some AAV promoters, including p5, and may enhance processivity of replication in cells in which helper functions are expressed.
  • Packaging refers to a series of subcellular events that results in the assembly and encapsidation of a viral vector, particularly an rAAV vector.
  • a suitable vector when introduced into a packaging cell line under appropriate conditions, it can be assembled into a viral particle.
  • Functions associated with packaging of viral vectors, particularly rAAV vectors, are described herein and in the art.
  • AAV "rep” and “cap” genes are genes encoding replication and encapsidation proteins, respectively.
  • AAV rep and cap genes have been found in all AAV serotypes examined, and are described herein and in the references cited. In wild-type AAV, the rep and cap genes are generally found adjacent to each other in the viral genome (i.e.
  • AAV packaging genes are also individually and collectively referred to herein as "AAV packaging genes.” AAV packaging genes that have been modified by deletion or point mutation, or which have been subdivided into components which can be rejoined by recombination (e.g., as described in co-owned U.S. Patent Application Serial No. 60/041,609, filed 18 December
  • AAV packaging genes can also be operably linked to other transcriptional regulatory sequences, including promoters, enhancers and polyadenylation ("poly A") sequences (which additional transcriptional regulatory sequences can also be heterologous).
  • An "AAV packaging cassette” is a recombinant constract which includes one or more AAV packaging genes.
  • Effective when used in describing a cell line refers to certain useful attributes of the line; in particular, the growth rate, and (for packaging cell lines) the number of viras particles produced per cell.
  • "Efficient growth” of a packaging cell line refers to the effective growth rate of the packaging cell, related to a comparable parental-type cell (i.e., a cell that does not carry an introduced AAV packaging gene)
  • the relative growth rate is at least 20% of the parental type, more preferably, 40%, more preferably, 80%), still more preferably, 90% and, most preferably, 100%.
  • “High efficiency packaging” indicates production of at least about 100 viral particles per cell, more preferably at least about 1,000 viral particles per cell, still more preferably at least about
  • High safety packaging indicates that, of the recombinant AAV viral particles produced, fewer than about 1 in 10 6 are replication-competent AAV viral particles, preferably fewer than about 1 in 10 8 are replication-competent, more preferably fewer than about 1 in 10 10 are replication-competent, still more preferably fewer than about 1 in 10 12 are replication-competent, most preferably none are replication- competent.
  • Preferred packaging cells of the present invention exhibit combinations of such high efficiency and high safety.
  • "Host cells”, “cell lines”, “cell cultures”, “packaging cell line” and other such terms denote higher eukaryotic cells, preferably mammalian cells, most preferably human cells, useful in the present invention.
  • These cells can be used as recipients for recombinant vectors, virases or other transfer polynucleotides, and include the progeny of the original cell that was transduced. It is understood that the progeny of a single cell may not necessarily be completely identical (in morphology or in genomic complement) to the original parent cell.
  • a “therapeutic gene”, “target polynucleotide”, “transgene”, “gene of interest” and the like generally refer to a gene or genes to be transferred using a vector. Typically, in the context of the present invention, such genes are located within the rAAV vector
  • Target polynucleotides can be used in this invention to generate rAAV vectors for a number of different applications.
  • polynucleotides include, but are not limited to: (i) polynucleotides encoding proteins useful in other forms of gene therapy to relieve deficiencies caused by missing, defective or sub-optimal levels of a structural protein or enzyme; (ii) polynucleotides that are transcribed into anti-sense molecules; (iii) polynucleotides that are transcribed into decoys that bind transcription or translation factors; (iv) polynucleotides that encode cellular modulators such as cytokines; (v) polynucleotides that can make recipient cells susceptible to specific drags, such as the herpes viras thymidine kinase gene; (vi) polynucleotides for cancer therapy, such as El A tumor suppressor genes or p53 tumor suppressor genes for the treatment of various cancers and (vii) polynucleotides that encode antigens or antibodies.
  • the transgene is preferably operably linked to a promoter or other such transcriptional regulatory sequence, either its own or a heterologous promoter.
  • a promoter or other such transcriptional regulatory sequence either its own or a heterologous promoter.
  • suitable promoters are known in the art, the choice of which depends on the desired level of expression of the target polynucleotide; whether one wants constitutive expression, inducible expression, cell-specific or tissue-specific expression, etc.
  • the rAAV vector may also contain a selectable marker.
  • An "activating element” is a sequence that responds to the presence of an activation signal by amplifying (i.e., replicating the sequences) to which it is amplifiably linked.
  • a preferred activating element is the PI element and preferred activation signals include AAV helper functions (as exemplified by adenovirus El A function) or their equivalents.
  • AAV helper functions as exemplified by adenovirus El A function
  • two sequences, one of which is an activating element are "amplifiably linked" when they are in sufficient proximity to each other that replication initiating from the activating element results in amplification (i.e., increased copy number) of the other sequence.
  • the copy number of the amplified sequence is amplified 2-fold or greater, more preferably, 10-fold or greater, still more preferably, 20-fold or greater.
  • an activating element to amplify an amplifiably-linked sequence will be influenced by the degree of processivity of replication initiating from the activating element. Thus, factors that enhance processivity of replication will tend to increase the effective level of amplification of a sequence that is amplifiably linked to an activating element.
  • infection with adenoviras, or provision of equivalent helper function may enhance processivity of replication as well as initiating amplification.
  • activating elements such as the PI sequence (normally found on human chromosome 19), when amplifiably linked to AAV packaging genes, can provide controlled, amplifiable expression of the linked packaging genes and or a dramatic increase in the ability of such genes to support the production of high titers of rAAV vectors.
  • an AAV packaging cassette of the present invention is co-expressed in host cells with an rAAV vector (containing one or more genes of interest flanked by AAV ITR sequences) under suitable conditions including the provision of helper viras or helper function, high titers of AAV virus containing the rAAV vector are produced by the host cells.
  • PI exemplifies a class of activating elements possessing, among other properties, activatable replication function, that is useful in the construction of AAV packaging cassettes to promote production of high-titer stocks of rAAV vectors.
  • the methods and compositions of the invention will therefore utilize recombinant DNA constracts wherein AAV packaging genes are amplifiably linked to one or more activating elements.
  • the presently preferred activating elements are exemplified by PI and PI -like elements that exhibit structural and functional properties related to initiation of replication. Most preferred are elements that act as helper function-inducible origins of replication. Other sequences that can be directly or indirectly induced to initiate replication in response to helper function will also be useful in the practice of the invention. In addition, sequences that are not inducible by helper function, but which can be induced to initiate DNA replication by other stimuli (provided and/or controlled by the user), are also useful as activating elements in the practice of the invention.
  • inducible activating elements examples include, by way of illustration, a sequence at which replication is initiated in the presence of a replication protein that is itself inducible (e.g., a temperature-sensitive replication protein that can be activated by a shift to permissive temperature, or a replication protein whose gene is placed under the control of an inducible promoter).
  • a replication protein that is itself inducible e.g., a temperature-sensitive replication protein that can be activated by a shift to permissive temperature, or a replication protein whose gene is placed under the control of an inducible promoter.
  • Naturally-occurring activating elements having the desired properties can be isolated; alternatively, synthetic sequences can be designed based, in whole or in part, on the observed relationships between structure and function found in naturally-occurring activating elements.
  • the PI element contains at least two distinct sequence motifs, a site at which Rep proteins can bind, known as the "Rep-binding motif (or "Rep-binding site") and a terminal resolution site, at which bound Rep protein can nick the DNA (see Example A 1).
  • Rep protein binds within the AAV inverted terminal repeat and catalyzes the formation of a nick (at the terminal resolution site), resulting in covalent attachment of Rep protein to the newly generated 5' end.
  • the 3' end of the nick serves as a primer for AAV DNA synthesis. Consequently, the Rep binding motif and/or the terminal resolution sequence, alone or in combination, may form all or part of an activating element for expression of AAV packaging genes.
  • binding and cleavage of a sequence by Rep proteins can be used as an assay to identify additional activating elements.
  • origin sequences in eukaryotes are generally associated with several characteristic functions including, but not limited to, protein binding, DNA unwinding and template-directed chain elongation. See, for example, Kornberg and Baker (1992) DNA REPLICATION, Second Edition, W.H. Freeman & Co., New York; Boulikas (1996) J. Cell Biochem. 60:297-316; and Diffley (1996) Genes & Devel. 10:2819-2830. Accordingly, sequences having one or any combination of these properties can find use as activating elements in the practice of the present invention.
  • various initiator proteins bind at or near the ori sequence to facilitate initiation of DNA replication. Accordingly, sequences capable of binding such initiator proteins, and the initiator proteins themselves (and their encoding genes) can find use in the practice of the invention. Determination of the ability of a particular protein to bind to an ori sequence can be assayed by several methods that are well-known in the art, including, but not limited to, sedimentation, nuclease protection, filter binding, gel mobility-shift, and various affinity techniques, including, but not limited to, DNA affinity matrices. Assays for origin function are well-known in the art and include electron microscopy, genetic analysis and template-directed incorporation of labeled nucleoside triphosphate, to name just a few.
  • origin function can be detected as an increase in level of replication as determined by the above-mentioned origin assays.
  • origin sequences can be identified, proteins that interact with a particular origin can also be identified, and the ability of an on-binding protein to activate a particular origin can be determined by methods that are well-known in the art.
  • activating elements can take the form of inducible replication origins, such as mammalian, viral, mitochondrial, chloroplast, plasmid or bacteriophage replication origins, for example.
  • an inducible origin can be amplifiably linked to AAV packaging genes in an AAV packaging cassette and the packaging cassette can be introduced into suitable host cells containing an rAAV vector (or to which an rAAV vector is added simultaneously or subsequently).
  • the host cells are provided with a molecule, such as a protein, which activates the inducible origin, along with a helper function.
  • the activating molecule can be provided directly.
  • the activating molecule is a protein
  • a gene (or genes) encoding the protein, under the transcriptional control of an inducible promoter can be present in the host cells.
  • stimulation of transcription of the gene(s) encoding the activating protein can be achieved by provision of the appropriate inducing molecule, or the gene(s) encoding the activating protein can be placed under the control of a promoter that is activated by a helper function, such as adenovirus infection.
  • helper function can be responsible for transcriptional stimulation of both the gene(s) encoding the inducing molecule(s) and AAV packaging genes (since, for instance, transcription from the p5 promoter is thought to be stimulated by helper function, such as adenovirus infection).
  • helper function such as adenovirus infection
  • inducible promoters include, but are not limited to, the MMTV LTR promoter, which is inducible by glucocorticoids, and the metallothionein promoter, which is inducible by heavy metals. Many other inducible promoters are known in the art and can be used in this aspect of the invention.
  • sequences that are commonly associated with origins of replication are palindromic sequences, sequences having the potential to form cruciform structures, DNA unwinding elements, sequences involved in synthesis or recruitment of replication primers, bent or curved DNA (which can be detected by its altered electrophoretic mobility), nuclease sensitive sequences, and nuclear matrix attachment sites. See, for example,
  • DHFR dihydrofolate reductase
  • Sequences possessing origin activity can also be identified by electron microscopic analysis of replicating DNA molecules. See, for example, Fareed et al. (1980) Me ⁇ h. Enzymology, vol. 65 (eds. L. Grossman and K. Moldave), Academic Press, New York, pp. 709-717. Assays for on-like sequences that can serve as activating elements in the present invention have been described above and are well-known to those of skill in the art. In addition, proteins, such as Rep, which interact with particular activating elements, can be identified by methods well-known in the art, including those described above, and used for the identification of additional activating elements. ORIENTATION AND SPACING OF ACTIVATING ELEMENTS WITH RESPECT TO AAV
  • AAV vectors a PI element placed more than 4 kb downstream of the rep gene transcriptional start site in an integrated AAV packaging cassette resulted in approximately a 14-fold amplification of the packaging cassette (see Example A l l below) and close to a 1, 000-fold increase in rAAV viras titer (see Example A 12 below), compared to cells containing a packaging cassette lacking a PI element.
  • placing an activating element further away from an AAV packaging gene e.g.
  • PI is used as an activating element, it can be desirable to have at least some spacer sequence (e.g. about 0.5 to 1 kb) between the PI sequence and the AAV packaging genes in order to reduce or eliminate the possibility that recombination between PI and an ITR sequence could regenerate a replication-competent AAV genome that would be of a size that could be efficiently packaged.
  • the PI element appears to direct amplification unidirectionally. Without wishing to be bound by theory, it is believed that interaction of Rep with a Rep-binding motif may be followed by nicking between the two T residues in a Terminal Resolution Site (TRS), as illustrated below. Subsequently, replication may initiate from the 3' hydroxyl end of the nick and proceed toward the Rep-binding motif. Accordingly, it is presently preferred that a unidirectional activating element as in the case of PI be oriented such that unidirectional replication proceeds from the activating element toward the associated AAV packaging gene(s). Alternatively, AAV packaging genes can be flanked by activating elements that are oriented so that replication initiated at each element proceeds "inward" toward the
  • bidirectional activating elements are also useful in the practice of the invention, since, in these cases, one of the two directions of replication will proceed toward the associated AAV packaging genes.
  • a unidirectional activating element wherein replication is oriented away from associated AAV packaging genes can also be useful, since replication will proceed around the circular episomal genome and eventually encounter the associated AAV packaging gene sequences.
  • Addition of multiple activating elements to an AAV packaging cassette would be expected to provide further degrees of amplification.
  • two PI elements that are oriented such that replication initiated from each progresses in opposite directions would provide correspondingly higher levels of amplification of linked sequences.
  • insertion of a second PI element into a construct such as P1RCD in such an orientation as to amplify the opposite strand of an integrated packaging constract should increase amplification, Rep and Cap levels and rAAV viras production.
  • addition of multiple activating elements to the AAV packaging cassettes of the invention should increase amplification and therefore should increase levels of AAV packaging gene products. Consequently, production of rAAV vectors and viras production should also be increased under these conditions, compared to situations in which a single activating element is present in a packaging cassette.
  • the packaging cell line is generally supplied with a recombinant AAV vector comprising AAV inverted terminal repeat (ITR) regions surrounding one or more polynucleotides of interest (or "target" polynucleotides).
  • ITR inverted terminal repeat
  • the target polynucleotide if it is intended to be expressed, is generally operably linked to a promoter, either its own or a heterologous promoter.
  • a promoter either its own or a heterologous promoter.
  • suitable promoters are known in the art, the choice of which depends on the desired level of expression of the target polynucleotide; whether one wants constitutive expression, inducible expression, cell-specific or tissue-specific expression, etc.
  • the rAAV vector can also contain a positive selectable marker in order to allow for selection of cells that have been infected by the rAAV vector; and/or a negative selectable marker (as a means of selecting against those same cells should that become necessary or desirable); see, e.g., S.D. Lupton, PCT/US91/08442 and PCT/US94/05601.
  • rAAV vectors containing polynucleotides that encode a functional cystic fibrosis transmembrane conductance regulator polypeptide (CFTR) operably linked to a promoter.
  • CFTR cystic fibrosis transmembrane conductance regulator polypeptide
  • CFTR polypeptides that are capable of reconstituting CFTR activity in cells derived from cystic fibrosis patients.
  • Carter et al. have described truncated variants of CFTR genes that encode functional CFTR proteins (see, e.g., USSN 08/455,552, filed 31 May 1995, now proceeding to issuance).
  • Rich et al. (1991, Science, 253: 205-207) who have described a CFTR derivative missing amino acid residues 708-835, that was capable of transporting chloride and capable of correcting a naturally occurring CFTR defect, and Egan et al.
  • polynucleotides include, but are not limited to: (i) polynucleotides encoding proteins useful in other forms of gene therapy to relieve deficiencies caused by missing, defective or sub-optimal levels of a structural protein or enzyme; (ii) polynucleotides that are transcribed into anti-sense molecules; (iii) polynucleotides that are transcribed into decoys that bind transcription or translation factors; (iv) polynucleotides that encode cellular modulators such as cytokines; (v) polynucleotides that can make recipient cells susceptible to specific drags, such as the herpes viras thymidine kinase gene; and (vi) polynucleotides for cancer therapy, such as the wild-type p53 tumor suppressor cDNA for replacement of the missing or damaged p53 gene associated with over
  • the same packaging cell line can be used for any of these applications.
  • the plasmid comprising the specific target polynucleotide is introduced into the packaging cell for production of the AAV vector by one of several possible methods; including, for example, electroporation.
  • Helper viras can be introduced before, during or after introduction of the rAAV vector.
  • the plasmid can be co-infected into the culture along with the helper viras.
  • the cells are then cultured for a suitable period, typically 2-5 days, in conditions suitable for replication and packaging as known in the art (see references above and examples below). Ly sates are prepared, and the recombinant AAV vector particles are purified by techniques known in the art.
  • the recombinant AAV vector is itself stably integrated into a packaging cell line.
  • Such stable, vector- containing packaging lines can also optionally contain stable chromosomal or episomal packaging cassettes.
  • Cell lines such as those described above can be grown and stored until ready for use.
  • the user simply infects the cells with helper viras and cultures the cells under conditions suitable for replication and packaging of AAV (as described below).
  • Recombinant AAV vectors prepared using the methods and compositions of the present invention can be purified according to techniques known in the art, see, e.g., the various AAV references cited above.
  • improved purification techniques can be employed, such as those described by Atkinson et al. in a commonly-owned U.S. application entitled Methods for Generating High Titer Helper-Free Preparations of
  • the rAAV vectors can be used to deliver polynucleotides to target cells either in vitro or in vivo, as described in the references cited herein and in the art.
  • the rAAV vectors will typically be contained in a physiological suitable buffered solution that can optionally comprise one or more components that promote sterility, stability and/or activity. Any means convenient for introducing the vector preparation to a desired location within the body can be employed, including, for example, by intravenous or localized injection, by infusion from a catheter or by aerosol delivery.
  • a 1 sequence as found within a region believed to be an AAV integration locus on human chromosome 19, can be used as an activating element within the context of the present invention.
  • the exemplary PI sequence we used comprises nucleotides 354-468 of the AAV SI locus (Kelman et al (1994) Curr. Opin. Genet. Dev. 4:185-195 also Weitzman et al (1994) Proc. Natl. Acad. Sci. 91:5808-5817). Shown below is the nucleotide sequence of PI (SEQ ID NOs.
  • TRS terminal resolution site
  • RB Motif also known as a Rep-binding site or RBS
  • RBS Rep-binding site
  • an AAV packaging cassette comprising the AAV rep and cap encoding sequences transcriptionally linked to the native p5, pi 9 and p40 promoters and followed by the AAV2 polyadenylation signal, was constracted as follows. Briefly, a fragment from pAV2 comprising nucleotides 193 to 379 (Srivastiva et al. (1983) J. Virol. 45:555-564) was obtained by PCR amplification.
  • the design of the PCR primers resulted in addition of a Bglll site at the 5' end of the amplified fragment and encompassed the PpuMI site (at AAV-2 nucleotide 350) close to the 3' end.
  • the PCR-amplified DNA was digested with Bglll and PpuMI to generate a restriction fragment comprising AAV-2 nucleotides 193-350.
  • a restriction fragment comprising nucleotides 351 -4498 of p AV2 was isolated from pAV2 by digestion with PpuMI and
  • a Bglll - Clal fragment from tgLS(+)HyTK-repcap including AAV rep and cap genes transcriptionally linked to the native p5, pi 9 and p40 promoters and followed by the AAV2 polyadenylation signal, was isolated and cloned into the BamHI and Clal sites of ⁇ SP72 (Promega).
  • An AAV packaging expression plasmid, p5repcapDHFR was constructed for the purpose of producing an integrated packaging line including the constract p5repcap (Example A 2) and a modified dihydrofolate reductase gene (DHFR) as a selectable marker.
  • p5repcap (Example A 2) was linearized at a PvuII site located just upstream of the rep gene, and blunt-end ligated to a 1.8 kb fragment of pFR400 (Simonsen et al. (1983) Proc. Natl. Acad. Sci. USA 80:2495-2499).
  • This pFR400 fragment was comprised of a modified DHFR gene, with a reduced affinity for methotrexate (Mtx), transcriptionally linked to the SV40 early promoter and followed by the polyadenylation site from the Hepatitis B viras (HBV) surface antigen gene.
  • the pFR400 fragment was prepared by first digesting with Sail, followed by a four base pair fill-in (to generate a blunt end) and subsequent PvuII digestion and gel purification.
  • the resulting construct, p5repcapDHFR ( Figure 1), contains a DHFR gene whose transcription is regulated by an upstream SV40 early promoter and a downstream Hepatitis B Viras polyadenylation site. Immediately downstream of this DHFR transcriptional cassette lie the AAV rep and cap genes, followed by an AAV polyadenylation site.
  • An exemplary AAV packaging cassette was then generated by incorporating a PI element (Example A 1) into expression plasmid p5repcapDHFR (Example A 3).
  • a PI element Example A 1
  • expression plasmid p5repcapDHFR Example A 3
  • the PI element was inserted downstream of the AAV polyadenylation signal in p5repcapDHFR in an orientation such that replication initiating from the PI element proceeds first into the cap gene and then into the rep gene (i.e., replication initiates at the 3' -OH of the TRS on the anti-sense strand and proceeds in a 5'-to-3' direction towards the cap gene).
  • a pair of oligonucleotides were synthesized which include the PI sequence flanked by ends compatible with a Bglll restriction site (see sequences below, SEQ ID NOs. 3 and 4). The pair were annealed, then ligated to p5repcapDHFR previously linearized at a Bglll site located just downstream of the AAV polyadenylation site (Example A 3, nucleotide 6217).
  • a clone named PIRCD was selected, containing a PI insert in an orientation such that replication initiated at PI proceeds in the direction of the cap and rep genes ( Figure 2).
  • P1(5')RCD contained a single PI element upstream of the rep and cap genes at a distance of 1.5 kilobases from the rep translation initiation site.
  • the constract 2P1RCD contained two PI elements: the first located immediately downstream of cap as in PIRCD (see above) and the second inserted 1.5 kb upstream of rep as in P 1 (5')RCD described above.
  • the new oligo pair was annealed and ligated into p5repcapDHFR and PIRCD previously linearized at the Pvu II site located 1.5 kilobases upstream of the rep translation initiation codon. Clones were selected such that the orientation of the PI insert resulted in DNA replication proceeding first into the rep gene and then into cap.
  • TRS 5 • CCCOGGCGGGTGGTGGCGGCGGTTGGGGCTCGGCGCTCGCTCGCTCGCTCGCTGGGCGGGCGGGCGGTCAG 3 '
  • Constract P1(5')RC contained a single
  • PI element immediately upstream of the rep and cap genes P1RC contained a single PI element immediately downstream from the rep and cap genes; and 2P1RC contained two PI elements flanking rep-cap.
  • the constracts were produced as described above in this example except that AAV packaging construct p5repcap (Example A2) was used in place of AAV packaging constract p5repcapDHFR.
  • the PI sequence was inserted as described above in this example using both of the oligo pairs described above, as appropriate.
  • Virus was produced by co-transfection of either p5repcap, P1RC, P1(5')RC, or 2P1RC along with rAAV vector ACAPSN according to the method of Example A6, infra. Viras titer was measured for each using the method of Example A7, infra.
  • the plasmid ACAPSN was constracted according to Lynch et al. (1997) Circ. Res. 80: 497-505 and PCT Publication WO 97/32990, as follows.
  • the ITR sequences and plasmid backbone were derived from AAV-CFTR. Afione et al. (1996) J. Virol. 70:3235- 3241. Briefly, the AAV-CFTR vector was digested with Xhol and SnaBI and the ITRs and plasmid backbone were gel isolated.
  • An Xhol to SnaBI fragment containing a portion of the CMV promoter (nucleotides -671 to -464) [See, e.g., Boshart, et al., Cell, 41: 521-530 (1985)] was gel isolated and ligated to the ITR plasmid backbone fragment derived from AAV-CFTR to generate "pAAV-CMV (SnaBI)."
  • an Spel to SnaBI fragment containing the synthetic polyadenylation signal was inserted into Spel/SnaBI digested pAAV-CMV (SnaBI) to generate "pAAV-CMV (Spe ⁇ )-spA.”
  • the pAAV-CMV (Spel)- spA vector contains nucleotides -671 to -584 of the CMV promoter.
  • Packaging of rAAV particles was performed as previously described. See, e.g., Flotte et al, J. Biol. Chem. 268 (5): 3781-3790 (1993); Flotte et al, Proc. Natl. Acad. Sci. USA, 93: 10163-10167 (1993); and Flotte et al. (1995) Gene Ther. 2:29-37. According to these protocols, equal amounts of packaging plasmids (either p5repcapDHFR or P 1 RCD) and the rAAV vector ACAPSN were co-transfected into HeLa cells which had been infected with helper Ad 5 at a MOI of 5.
  • the titer of viras produced by the method in Example A 6 from co- transfection of ACAPSN and either the p5repcapDHFR or P 1 RCD AAV packaging plasmid was determined by the measurement of geneticin (G418) resistance.
  • the protocol includes seeding 5 x 10 4 HeLa cells per well in a 6 well dish (Costar) in Dulbecco's Modified Eagles medium, 10% fetal bovine serum, with penicillin and streptomycin (DMEM complete).
  • viras-containing cleared ly sates (Example A 6) were exposed to serial dilutions (in DMEM) of viras-containing cleared ly sates (Example A 6) for 24 hours at 37°C in a total volume of 1 ml (the maximal amount of cleared lysate that is assayable being 0.1 ml).
  • Viras-containing medium was then removed and fresh DMEM, containing 1 mg/ml G418, was added to the cells.
  • Cells were cultured for 10 days under selective conditions, medium was then removed, and the cells were washed once in methanol and stained with methylene blue. Colonies on each well were then counted and results expressed as G418-resistant colony forming units per milliliter (G418 r cfu/ml).
  • the packaging plasmids P 1 (5')RCD, P 1 RCD and 2P 1 RCD were assayed for their ability to produce viras in a co-transfection with rAAV vector ACAPSN. Co-transfection, helper viras infection and preparation of cleared lysates were performed as described in Example A6.
  • the constract containing a single PI element downstream of cap (PIRCD) produced four-fold more virus than the non-Pi containing construct, p5repcapDHFR (1900+/-1400 cfu/mL vs. 490 +/- 58 cfu/mL, respectively).
  • the AAV packaging constracts lacking a DHFR marker containing a single PI element either immediately upstream or downstream of the rep and cap genes (P1(5')RC or
  • Polyclonal cell lines with an integrated AAV packaging cassette either containing (PIRCD) or lacking (p5repcapDHFR) the PI element were produced by electroporation of HeLa cells. Specifically, 4 x 10 6 HeLa cells were electroporated with 12 ⁇ g DNA (p5repcapDHFR or PIRCD) that had been linearized with PvuII restriction endonuclease, which cleaves just upstream of the SV40 promoter-DHFR gene cassette. The cells were electroporated in serum free DMEM using a BioRad Gene Pulser at 0.25 Volts and 960 ⁇ F.
  • DMEM complete After electroporation, cells were resuspended in DMEM complete (see Example A 7) and allowed to recover at 37°C in a humidified atmosphere of 10% CO 2 . After 24 hours, cells were subjected to selection in complete medium containing 500 nM methotrexate.
  • Clonal cell lines were derived from the PIRCD polyclonal population by limiting dilution. Producer lines are generated by introduction of an rAAV vector constract into a clonal PI RCD-containing packaging line .
  • the constructs p5repcap, P1RC, P1(5')RC, and 2P1RC were modified for the purpose of producing stable cell lines by following the procedure described in Example A 3, using a puromycin resistance gene in place of the modified DHFR gene.
  • the four resulting AAV packaging constracts were named p5RC-Pur, P1RC- Pur, P1(5')RC-Pur, and 2P1RC-Pur.
  • Polyclonal cell lines were produced from these four constracts as described above in this example, except the methotrexate selection was replaced with drag selection by puromycin at a concentration of 1 ⁇ g/mL.
  • Example A 9 Isolation of total genomic DNA from packaging cells rAAV genomes were packaged according to Example A 6 in polyclonal cell lines containing either p5repcapDHFR or PIRCD (Example A 8) by transfection with ACAPSN in the presence or absence of adenoviras. At 65 hours after transfection with ACAPSN, cells were harvested and centrifuged at 3000 xg for 5 minutes. Total genomic DNA was isolated according to the method previously reported (Sambrook et al., supra). Specifically, cells were washed once with TBS (150 mM Trizma base, 300 mM NaCl, pH
  • TNE Buffer (10 mM Tris-Cl pH 8, 100 mM NaCl and 25 mM EDTA pH 8). Proteinase K was added to a final concentration of 100 ⁇ g/ml and SDS was added to a final percentage of 0.5% (w/v). After mixing, cells were incubated at 50°C for 3 hours. Samples were then extracted once with phenol (pH 8), once with phenol:chloroform:isoamyl alcohol (24:24:1), and once with chloroform. DNA, present in the aqueous phase, was then precipitated with 100% ethanol and centrifuged at 12,000 xg for 30 minutes. The pellets, containing genomic DNA, were washed once with 70% ethanol, air dried, and resuspended in TE buffer (10 mM Tris, 1 mM EDTA pH 8).
  • Example A 10 Southern blotting analysis Total genomic DNA isolated by the method of Example A 9 was examined for the amplification of rep and cap genes in the presence and absence of adenovirus. Specifically, 10 ⁇ g of DNA was digested with restriction endonuclease Bgll thereby releasing a 3.8 kb fragment comprising rep and cap genes (AAV-2 nucleotides 543-4,380) from p5repcapDHFR or PIRCD. Digested DNA samples were then fractionated by agarose gel electrophoresis and transferred to UV-Duralon membrane (Stratagene) by capillary action, overnight, in lOx SSC (1.5 M NaCl, 0.15M Sodium Citrate).
  • lOx SSC 1.5 M NaCl, 0.15M Sodium Citrate
  • Nucleic acid was cross-linked to the membrane by exposure to ultraviolet light, and the membranes were rinsed in 2x SSC and probed with a P labeled 1.9 kb Xhol-Bglll fragment from pAV2, random-prime labeled using prime-it, Stratagene. After washing, the membranes were visualized by phosphorimaging and the .amount of the 3.8 kb band was quantified.
  • Example A 8 Total genomic DNA prepared and digested according to Example A 9 for polyclonal samples PIRCD and p5repcapDHFR (Example A 8) was analyzed by the Southern blotting method of Example A 10. Degree of amplification was measured by relative photon intensity of the 3.8 kb band determined from phosphorimaging according to Example A 10. DNA from PIRCD-containing cells gave a value of 406,725 intensity units for the 3.8 kb band, while DNA from cells containing p5repcapDHFR gave a value of 30,211. Thus the presence of PI, in the PIRCD polyclonal line, is responsible for a 13.5- fold amplification of rep and cap genes, in the presence of adenoviras.
  • Polyclonal cell lines containing either PIRCD or p5repcapDHFR, were transiently transfected with ACAPSN in the presence of adenovirus, rAAV genomes were packaged, and cleared ly sates were produced according to the method of Example A 6. Cleared lysates were assayed for viral titer (Example A 7), which was determined from triplicate transfections.
  • a polyclonal cell line containing p5repcapDHFR yielded 0 G418 r cfu/ml
  • a polyclonal cell line containing PIRCD yielded 957 G418 r cfu/ml.
  • Viras production by clonal lines ranged from 0.8 x 10 2 - 1.5 x 10 4 G418 r cfu/ml.
  • Stable cell lines containing integrated P 1 -containing packaging plasmids expressing puromycin resistance were tested for viras production.
  • a stable cell line containing a single PI element downstream from the cap gene (PIRC-Pur) increased viras titer 4 fold over the non-Pl containing cell line, p5RC-Pur (216 +/- 67 Cfu/ml vs. 51.1 +/- 30 Cfu/ml).
  • PIRC-Pur a stable cell line containing a single PI element downstream from the cap gene
  • p5repcap/Rep8 plasmid that did not contain a PI element was constructed by isolating a 4355 bp PvuII/Bglll fragment from the p5repcap vector. This fragment was inserted into NruI/BamHI digested Rep8. The resulting plasmid was designated p5repcap(-Pl)/Rep8.
  • the rAAVCFTR or ACAPSN vector was transfected into HeLa cells via electroporation. Individual clones were isolated and screened for an intact, stably integrated rAAV vector.
  • the Pl/p5repcap/Rep8 packaging cassette was then transfected into HeE AAV-CFTR cells via Ca ⁇ PO 4 -mediated transfection and stable transfectants were selected using 2.5 mM L-histidinol.
  • a Hei ⁇ AAV-CFTR cell line containing a p5repcap(-Pl)/Rep8 packaging cassette was generated in similar fashion.
  • the stable HeZ ⁇ AAV-CFTR cell line from Example B 2 were seeded in duplicate at 2.5x10 5 cells/plate. After 24 hrs one plate for each cell line was infected with Ad5 at a multiplicity of 10. After 48 hrs. infected and uninfected cells were harvested. The genomic DNA was isolated, digested with Bglll and Xbal restriction enzymes, and the resultant fragments were separated by electrophoresis and transferred to a membrane.
  • Hel AAV-CFTR cells containing either a Pl/p5repcap/Rep8 or a p5repcap(-Pl)/Rep8 episomal packaging cassette were seeded at 2.5 x 10 6 cells/plate and infected with Ad5 at a MOI of 10. After 48 hrs., the cells were harvested, resuspended in TMEG buffer, and sonicated in 15-second bursts for 2 min. to release rAAV.
  • a second generation Pl/p5repcap/Rep8 packaging cassette was constracted that contains a nonessential 1300 bp DNA stuffer fragment between the PI elements and the p5repcap sequences.
  • a 4355 bp PvuII/EcoRV fragment containing p5repcap sequences was isolated from the p5repcap vector (Example A 2). This fragment was inserted at the EcoRV site of pAdBn (Quantum Biotechnologies). The resulting plasmid was digested with Bglll and NotI and a 4485 bp p5repcap fragment was isolated. This Bglll/NotI fragment was inserted into Bam ⁇ I/Notl-digested pRep ⁇ (Invitrogen).
  • the Pl/p5repcap/Rep8 packaging cassette (see Example B 1) was digested with PstI to remove the p5repcap sequences.
  • the resulting plasmid was digested with PvuII and NotI, and a 138 bp fragment, containing concatameric PI sites, was isolated.
  • This PI dimer was then inserted into Pl/p5repcap/Rep8 that had been digested with Nral and NotI.
  • a 1300 bp Haelll fragment from ⁇ X174 was ligated into the Snal site of Pl/p5repcap/Rep8.
  • the resulting plasmid is used as an AAV packaging cassette to stimulate replication and packaging of rAAV vectors.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne des constructions d'encapsidation d'AAV de haute efficacité ainsi que leurs méthodes d'utilisation. Ces constructions d'encapsidation de haute efficacité comprennent un élément d'activation (tel que la séquence P1 située à l'intérieur du site d'intégration AAV-S1 du chromosome humain 19), lié de manière amplifiable à un ou à un plusieurs gènes d'encapsidation d'AAV. Les constructions peuvent être soit intégrées dans le génome d'une cellule mammifère soit maintenues de manière épisomique. L'utilisation des vecteurs d'encapsidation d'AAV de haute efficacité de l'invention permet la production amplifiable et régulée de constructions de vecteurs de AAVr.
PCT/US1998/021938 1997-10-21 1998-10-20 Cassettes d'encapsidation de virus adeno-associe (aav) amplifiable pour la production de vecteurs de aav recombines WO1999020779A1 (fr)

Priority Applications (6)

Application Number Priority Date Filing Date Title
US09/180,114 US6642051B1 (en) 1997-10-21 1998-10-20 Amplifiable adeno-associated virus(AAV) packaging cassettes for the production of recombinant AAV vectors
EP98953640A EP1025251A1 (fr) 1997-10-21 1998-10-20 Cassettes d'encapsidation de virus adeno-associe (aav) amplifiable pour la production de vecteurs de aav recombines
JP2000517099A JP2001520051A (ja) 1997-10-21 1998-10-20 組換えａａｖベクターの産生のための増幅可能アデノ随伴ウイルス（ａａｖ）パッケージングカセット
AU10967/99A AU758541B2 (en) 1997-10-21 1998-10-20 Amplifiable adeno-associated virus (AAV) packaging cassettes for the production of recombinant AAV vectors
CA002308008A CA2308008A1 (fr) 1997-10-21 1998-10-20 Cassettes d'encapsidation de virus adeno-associe (aav) amplifiable pour la production de vecteurs de aav recombines
US11/341,249 US20060205079A1 (en) 1997-10-21 2006-01-26 Amplifiable adeno-associated virus (AAV) packaging cassettes for the production of recombinant AAV vectors

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US95523297A 1997-10-21 1997-10-21
US08/955,232 1997-10-21

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US10/615,119 Continuation US20050032220A1 (en) 1997-10-21 2003-07-07 Amplifiable adeno-associated virus (AAV) packaging cassettes for the production of recombinant AAV vectors

Publications (1)

Publication Number Publication Date
WO1999020779A1 true WO1999020779A1 (fr) 1999-04-29

Family

ID=25496565

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1998/021938 WO1999020779A1 (fr) 1997-10-21 1998-10-20 Cassettes d'encapsidation de virus adeno-associe (aav) amplifiable pour la production de vecteurs de aav recombines

Country Status (5)

Country Link
EP (1) EP1025251A1 (fr)
JP (1) JP2001520051A (fr)
AU (1) AU758541B2 (fr)
CA (1) CA2308008A1 (fr)
WO (1) WO1999020779A1 (fr)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000009693A2 (fr) 1998-08-11 2000-02-24 Darwin Discovery Ltd. Identification du gene responsable du phenotype de la souris 'scurfy' et de son orthologue humain
EP1173596A2 (fr) * 1999-04-28 2002-01-23 Targeted Genetics Corporation Procedes, compositions et cellules servant a encapsider des vecteurs de recombinaison dans des particules de virus adeno-associes
WO2002020748A2 (fr) * 2000-09-08 2002-03-14 Medigene Aktiengesellschaft Cellules hotes pour empaqueter un virus adeno-associe recombine (raav), leur procede de preparation et leur utilisation
US6537540B1 (en) 1999-05-28 2003-03-25 Targeted Genetics Corporation Methods and composition for lowering the level of tumor necrosis factor (TNF) in TNF-associated disorders
US6596535B1 (en) 1999-08-09 2003-07-22 Targeted Genetics Corporation Metabolically activated recombinant viral vectors and methods for the preparation and use
US6924128B2 (en) 1994-12-06 2005-08-02 Targeted Genetics Corporation Packaging cell lines for generation of high titers of recombinant AAV vectors
US6989264B2 (en) 1997-09-05 2006-01-24 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of released recombinant AAV vectors
EP1916258A2 (fr) 1999-08-09 2008-04-30 Targeted Genetics Corporation Améliorations de l'expression d'une séquence de nucléotides hétérologues à brin unique à partir de vecteurs viraux recombinants par la désignation de la séquence de manière à ce qu'elle forme des paires de bases intrabrins
EP1939300A1 (fr) 1999-05-28 2008-07-02 Targeted Genetics Corporation Procédés et compositions pour diminuer le niveau de facteur de nécrose de tumeur (TNF) pour des troubles associés au TNF
EP1967525A2 (fr) 2001-05-08 2008-09-10 Darwin Molecular Corporation Méthode de régulation de la fonction immune chez les primates à l'aide de la protéine foxp3
US9415119B2 (en) 2009-05-02 2016-08-16 Genzyme Corporation Gene therapy for neurodegenerative disorders

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP6093358B2 (ja) * 2012-07-06 2017-03-08 タカラバイオ株式会社 アデノ随伴ウイルスベクターの産生細胞

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0488528A1 (fr) * 1990-10-30 1992-06-03 Applied Immune Sciences, Inc. Vecteurs recombinants issus de virus associés à l'adénovirus (AAV)
WO1995013365A1 (fr) * 1993-11-09 1995-05-18 Targeted Genetics Corporation Production de titres eleves de vecteurs d'aav recombinants
WO1997009442A1 (fr) * 1995-09-08 1997-03-13 Avigen, Inc. Systeme d'apport et d'integration cible de sequences nucleotidiques
WO1997009441A2 (fr) * 1995-09-08 1997-03-13 Genzyme Corporation Vecteurs aav ameliores pour la therapie genique
WO1997032990A1 (fr) * 1996-03-04 1997-09-12 Targeted Genetics Corporation Procede de transduction de cellules dans des vaisseaux sanguins a l'aide de vecteurs de virus adeno-associes (vaa) recombinants

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0488528A1 (fr) * 1990-10-30 1992-06-03 Applied Immune Sciences, Inc. Vecteurs recombinants issus de virus associés à l'adénovirus (AAV)
WO1995013365A1 (fr) * 1993-11-09 1995-05-18 Targeted Genetics Corporation Production de titres eleves de vecteurs d'aav recombinants
WO1997009442A1 (fr) * 1995-09-08 1997-03-13 Avigen, Inc. Systeme d'apport et d'integration cible de sequences nucleotidiques
WO1997009441A2 (fr) * 1995-09-08 1997-03-13 Genzyme Corporation Vecteurs aav ameliores pour la therapie genique
WO1997032990A1 (fr) * 1996-03-04 1997-09-12 Targeted Genetics Corporation Procede de transduction de cellules dans des vaisseaux sanguins a l'aide de vecteurs de virus adeno-associes (vaa) recombinants

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
C. GIRAUD ET AL.: "Site-specific integration by adeno-associated virus is directed by a cellular DNA sequence", PROC. NATL. ACAD. SCI., vol. 91, October 1994 (1994-10-01), NATL. ACAD. SCI.,WASHINGTON,DC,US;, pages 1039 - 1043, XP002094852 *
GIRAUD C ET AL: "RECOMBINANT JUNCTIONS FORMED BY SITE-SPECIFIC INTEGRATION OF ADENO-ASSOCIATED VIRUS INTO AN EPISOME", JOURNAL OF VIROLOGY, vol. 69, no. 11, November 1995 (1995-11-01), pages 6917 - 6924, XP000608414 *
R.M. LINDEN ET AL.: "Site-specific integration by adeno-associated virus", PROC. NATL. ACAD. SCI., vol. 93, October 1996 (1996-10-01), NATL. ACAD. SCI.,WASHINGTON,DC,US;, pages 11288 - 11294, XP002094853 *
URCELAY E ET AL: "ASYMMETRIC REPLICATION IN VITRO FROM A HUMAN SEQUENCE ELEMENT IS DEPENDENT ON ADENO-ASSOCIATED VIRUS REP PROTEIN", JOURNAL OF VIROLOGY, vol. 69, no. 4, April 1995 (1995-04-01), pages 2038 - 2046, XP000608412 *

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6924128B2 (en) 1994-12-06 2005-08-02 Targeted Genetics Corporation Packaging cell lines for generation of high titers of recombinant AAV vectors
US6989264B2 (en) 1997-09-05 2006-01-24 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of released recombinant AAV vectors
US6995006B2 (en) 1997-09-05 2006-02-07 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of released recombinant AAV vectors
WO2000009693A2 (fr) 1998-08-11 2000-02-24 Darwin Discovery Ltd. Identification du gene responsable du phenotype de la souris 'scurfy' et de son orthologue humain
EP1173596A2 (fr) * 1999-04-28 2002-01-23 Targeted Genetics Corporation Procedes, compositions et cellules servant a encapsider des vecteurs de recombinaison dans des particules de virus adeno-associes
EP1939300A1 (fr) 1999-05-28 2008-07-02 Targeted Genetics Corporation Procédés et compositions pour diminuer le niveau de facteur de nécrose de tumeur (TNF) pour des troubles associés au TNF
US6537540B1 (en) 1999-05-28 2003-03-25 Targeted Genetics Corporation Methods and composition for lowering the level of tumor necrosis factor (TNF) in TNF-associated disorders
EP1916258A2 (fr) 1999-08-09 2008-04-30 Targeted Genetics Corporation Améliorations de l'expression d'une séquence de nucléotides hétérologues à brin unique à partir de vecteurs viraux recombinants par la désignation de la séquence de manière à ce qu'elle forme des paires de bases intrabrins
US7846729B2 (en) 1999-08-09 2010-12-07 Genzyme Corporation Metabolically activated recombinant viral vectors and methods for their preparation and use
US7125717B2 (en) 1999-08-09 2006-10-24 Targeted Genetics Corporation Metabolically activated recombinant viral vectors and methods for their preparation and use
US8093054B2 (en) 1999-08-09 2012-01-10 Genzyme Corporation Metabolically activated recombinant viral vectors and methods for their preparation and use
US6596535B1 (en) 1999-08-09 2003-07-22 Targeted Genetics Corporation Metabolically activated recombinant viral vectors and methods for the preparation and use
EP2369002A1 (fr) 1999-08-09 2011-09-28 Targeted Genetics Corporation Améliorations de l'expression d'une séquence de nucléotides hétérologues à brin unique à partir de vecteurs viraux recombinants par la désignation de la séquence de manière à ce qu'elle forme des paires de bases intrabrins
US7785888B2 (en) 1999-08-09 2010-08-31 Genzyme Corporation Metabolically activated recombinant viral vectors and methods for their preparation and use
WO2002020748A2 (fr) * 2000-09-08 2002-03-14 Medigene Aktiengesellschaft Cellules hotes pour empaqueter un virus adeno-associe recombine (raav), leur procede de preparation et leur utilisation
WO2002020748A3 (fr) * 2000-09-08 2003-03-20 Medigene Ag Cellules hotes pour empaqueter un virus adeno-associe recombine (raav), leur procede de preparation et leur utilisation
EP1967525A2 (fr) 2001-05-08 2008-09-10 Darwin Molecular Corporation Méthode de régulation de la fonction immune chez les primates à l'aide de la protéine foxp3
US9415119B2 (en) 2009-05-02 2016-08-16 Genzyme Corporation Gene therapy for neurodegenerative disorders
US10369193B2 (en) 2009-05-02 2019-08-06 Genzyme Corporation Gene therapy for neurodegenerative disorders
US11911440B2 (en) 2009-05-02 2024-02-27 Genzyme Corporation Gene therapy for neurodegenerative disorders
US11975043B2 (en) 2009-05-02 2024-05-07 Genzyme Corporation Gene therapy for neurodegenerative disorders

Also Published As

Publication number Publication date
EP1025251A1 (fr) 2000-08-09
AU1096799A (en) 1999-05-10
CA2308008A1 (fr) 1999-04-29
AU758541B2 (en) 2003-03-27
JP2001520051A (ja) 2001-10-30

Similar Documents

Publication Publication Date Title
US6642051B1 (en) Amplifiable adeno-associated virus(AAV) packaging cassettes for the production of recombinant AAV vectors
US6541258B2 (en) AAV split-packaging genes and cell lines comprising such genes for use in the production of recombinant AAV vectors
US6893865B1 (en) Methods, compositions, and cells for encapsidating recombinant vectors in AAV particles
AU707866B2 (en) Packaging cell lines for generation of high titers of recombinant AAV vectors
US6924128B2 (en) Packaging cell lines for generation of high titers of recombinant AAV vectors
US6936466B2 (en) Transcriptionally-activated AAV inverted terminal repeats (ITRs) for use with recombinant AAV vectors
WO1998027204A9 (fr) Genes d'encapsidation fractionnes de virus adeno-associe (aav) et lignees cellulaires comprenant ces genes utilises pour la production de vecteurs d'aav de recombinaison
AU5603998A (en) Recombinase-activatable AAV packaging cassettes for use in the production of AV vectors
WO1996017947A9 (fr) Lignees cellulaires d'encapsidation utilisees pour la generation de titres hauts de vecteurs aav recombinants
AU758541B2 (en) Amplifiable adeno-associated virus (AAV) packaging cassettes for the production of recombinant AAV vectors
AU749352B2 (en) A conditional replication and expression system
WO1999020773A2 (fr) Sequences terminales repetees inverses (itr) d'aav a action transcriptionnelle, a utiliser avec des vecteurs d'aav recombines
US20040248288A1 (en) Compositions and methods for efficient aav vector production

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 09180114

Country of ref document: US

AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

ENP Entry into the national phase

Ref document number: 2308008

Country of ref document: CA

Ref country code: CA

Ref document number: 2308008

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 517099

Kind code of ref document: A

Format of ref document f/p: F

NENP Non-entry into the national phase

Ref country code: KR

WWE Wipo information: entry into national phase

Ref document number: 10967/99

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 1998953640

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1998953640

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 10967/99

Country of ref document: AU

WWW Wipo information: withdrawn in national office

Ref document number: 1998953640

Country of ref document: EP