Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
  • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

• This invention relates to unique nucleic acid sequences corresponding to neutrophil mRNA species which are differentially expressed in response to the exposure of a neutrophil population to virulent and avirulent bacteria.
• Granulocytes i.e., neutrophils, eosinophils and basophils
• neutrophils i.e., neutrophils, eosinophils and basophils
• basophils i.e., neutrophils, eosinophils and basophils
• Inflammation is a localized protective response elicited by injury or destruction of tissues which serves to destroy, dilute or wall off both the injurious agent and the injured tissue. It is characterized by fenestration of the microvasculature, leakage of the elements of blood into the interstitial spaces, and migration of leukocytes into the inflamed tissue. On a macroscopic level, inflammation is usually accompanied by the familiar clinical signs of erythema, edema, tenderness (hyperalgesia), and pain. During this complex response, chemical mediators such as histamine, 5-hydroxytryptamine, various chemotactic factors, bradykinin, leukotrienes, and prostaglandins are released locally. Phagocytic cells migrate into the area, and cellular lysosomal membranes may be ruptured, releasing lytic enzymes. All of these events may contribute to the inflammatory response.
• Inflammation is initiated by, among other things, trauma, tissue necrosis, infection or immune reactions.
• the immediate response is temporary vasoconstriction.
• Vasoconstriction is followed within seconds by the acute vascular response resulting in increased blood flow (hyperemia) and edema.
• the acute phase is also characterized by the margination of polymorphonuclear white blood cells (neutrophils) next to endothelial cells, followed by emigration of neutrophils into the adjacent tissue.
• Margination is recognized by the lining up of neutrophils along the endothelium of vessels. Emigration occurs by passage of the inflammatory cells between endothelial cells.
• Neutrophils are the first wave of cellular attack on invading organisms and are the characteristic cells of acute inflammation. The appearance of neutrophils in areas of inflammation may be caused by chemicals released from bacteria, factors produced nonspecifically from necrotic tissue or antibody reacting with antigen. Neutrophils use an actin-rich cytoskeleton to move in a directed manner along a chemotactic gradient from the bloodstream to an inflammatory site where they ingest particles (e.g,. bacteria) and immune complexes bearing IgG (via FcR) and/or breakdown products of the complement component C3.
• particles e.g,. bacteria
• IgG via FcR
• Neutrophils belong to a category of white blood cells known as polymorphonuclear white blood cells.
• the blood cells with single nuclei form the white blood cell population that includes macrophages, T and B cells.
• White blood cells that contain segmented nuclei are broadly classified as polymorphonuclear.
• Polymorphonuclear white blood cells (or "granulocytes") are further subdivided into three major populations on the basis of the staining properties of their cytoplasmic granules in standard hematologic smears or tissue preparations: neutrophils staining pink, eosinophils staining red and basophils staining blue.
• Neutrophils also referred to as polymorphonuclear neutrophils-PMNs
• WBCs white blood cells
• neutrophils are produced from precursor cells intfie bone marrow and released into the blood when mature. After entering the circulation, neutrophils are thought to last only 1 or 2 days.
• Neutrophils are characterized by numerous cytoplasmic granules that contain highly destructive enzymes that must be kept isolated from the cytoplasm. These granules contain a number of oxygen-independent enzymes as well as oxygen- dependent mechanisms of killing. Upon attraction to sites of inflammation, neutrophils attempt to engulf and digest bacteria coated with antibody and complement.
• Phagocytosis by neutrophils is also usually accompanied by release of the lysosomal enzymes into the tissue spaces, particularly if the organism is difficult for the neutrophil to digest
• At least three cytoplasmic granules are identifiable in neutrophils: specific granules containing lactoferrin, B cytochrome, the complement receptor CR3 and ⁇ 2 - integrin; azurophilic granules containing acid hydrolases and other enzymes; and a third granule containing gelatinase.
• neutrophils and other granulocytic cells play in immune response to pathogens, including bacterial infection
• neutrophils and other granulocytic cells play an unwanted role in many chronic inflammatory diseases.
• diseases are characterized by massive neutrophil infiltration, such as psoriasis, inflammatory bowel disease, Crohn's disease, asthma, cardiac and renal reperfusion injury, adult respiratory distress syndrome, rheumatoid arthritis, thrombosis and glomerulonephritis.
• neutrophils synthesize de novo important macromolecules including, but not limited to interleukin (IL) 1, 11-6, 11-8, tumor necrosis factor (TNF ), granulocyte and macrophage colony-stimulating factors, interferon ⁇ (LFN ⁇ ), intercellular adhesion molecule (ICAM-1) and membrane and cystoskeletal molecules, such as major histocompatibility class I antigens and actin (Beaulieu et al (1992) J. Biolog. Chem. 267(l):426-432; Arnold et al. (1993) Infect. Immun. 61(6):2545-2552; and Eisner et al. (1995) Immunobiol 193:456-464).
• IL interleukin
• TNF tumor necrosis factor
• LFN ⁇ interferon ⁇
• IAM-1 intercellular adhesion molecule
• membrane and cystoskeletal molecules such as major histocompatibility class I antigens and actin
• neutrophils and other granulocytic cells in inflammation and/or the immunological response to infection has been the subject of intense study, little is known about the global transcriptional response of neutrophils during cell activation.
• the present inventors have discovered unique nucleic acid sequences which correspond to mRNA species, and therefore neutrophil genes, which are differentially expressed upon exposure of a neutrophil population to virulent or avirulent bacteria.
• the present invention includes isolated nucleic acid fragments selected from the group consisting of a nucleic acid fragment comprising the sequence of any one of SEQ ID NOS: 1-86, a nucleic acid fragment which specifically hybridizes to any one the of the sequences of SEQ ID NOS: 1-86 and a nucleic acid fragment comprising a part of the sequence of any one of SEQ ID NOS: 1-86.
• the present invention also includes isolated nucleic acid fragments comprising the following structure: R-X-R' wherein X is: a sequence of one of SEQ ID NOS: 1-86; and wherein R and R' are sequences contiguous with X in nucleic acid fragments which specifically hybridize with X.
• FIG. 1 is an autoradiogram of the expression profile generated from cDNAs made with RNA isolated from neutrophils exposed to avirulent Escherichia coli and virulent and avirulent Yersinia pestis.
• FIG. 2 Figure 2 is an autoradiogram of the expression profile generated from cDNAs made with RNA isolated from neutrophils exposed to virulent and avirulent E. coli, virulent and avirulent Y. pestis, LPS, GM-CSF, TNF ⁇ , or ⁇ lFN.
• FIG. 3 is an autoradiogram of the expression profile generated from cDNAs made with RNA isolated from neutrophils exposed to avirulent E. coli and virulent and avirulent Y. pestis. All possible 12 anchoring oligo d(T)nl, n2 were used to generate a complete expression profile for the enzyme BglR.
• the response of neutrophils to pathogens is a subject of primary importance in view of the need to find ways to modulate the immune response to infection.
• One means of assessing the response of neutrophils to virulent and avirulent bacteria is to measure the ability of neutrophils to synthesize specific RNA de novo upon contact with the virulent or avirulent bacteria.
• Granulocytic cells also known as polymorphonuclear white blood cells
• neutrophils also known as polymorphonuclear neutrophils or peripheral blood neutrophils, eosinophils, and basophils, also referred to as mast cells.
• pathogen refers to any infectious organism including bacteria, viruses, parasites, mycoplasma, protozoans, and fungi (including molds and yeast).
• Pathogenic bacteria include, but are not limited to Staphylococci (e.g. aureus),
• Streptococci e.g. pneurnoniae
• Clostridia e.g. perfringens
• Neisseria e.g. gonorrhoeae
• Enterobacteriaceae e.g. coli as well as Klebsiella, Salmonella, Shigella,
• Yersinia and Proteus Yersinia and Proteus
• Helicobacter e.g. pylori
• Vibrio e.g. cholerae
• Campylobacter e.g. jejuni
• Pseudomonas e.g. aeruginosa
• Haemophilus e.g. influenzae
• Bordetella e.g. pertussis
• Mycoplasma e.g. pneurnoniae
• Ureaplasma e.g. pneurnoniae
• urealyticum Legionella
• Spirochetes e.g. Treponema, Leptospira and Borrelia
• Mycobacteria e.g. tuberculosis, smegmatis
• Actinomyces e.g. urealyticum
• Legionella e.g. pneumophila
• Spirochetes e.g. Treponema, Leptospira and Borrelia
• Mycobacteria e.g. tuberculosis, smegmatis
• Actinomyces Actinomyces
• solid support refers to any support to which nucleic acids can be bound or immobilized, including nitrocellulose, nylon, glass, other solid supports which are positively charged, silicon chips and nanochannel glass arrays disclosed by Beattie
• nucleic acids which hybridize under highly stringent or moderately stringent conditions to the nucleic acids containing at least one of the sequences of SEQ ID NOS: 1-86.
• isolated nucleic acid refers to nucleic acids that have been separated from contaminant nucleic acids encoding other polypeptides.
• Nucleic acids refers to all forms of DNA and RNA, including cDNA molecules and antisense RNA molecules.
• sequences contiguous with refers to sequences which are covalently linked to a given nucleic acid sequence or fragment at either the 5' or 3' end through phospho-diester bonds.
• gene expression profile also referred to as a “differential expression profile”, “expression profile” or “array” refers to any representation of the expression of at least one mRNA species in a cell sample or population.
• a gene expression profile can refer to an autoradiograph of labeled cDNA fragments produced from total cellular mRNA separated on the basis of size by known procedures. Such procedures include slab gel electrophoresis, capillary electrophoresis, high performance liquid chromatography, and the like.
• Digitized representations of scanned electrophoresis gels or the output of capillary electrophoresis are also included as are two and three dimensional representations of the digitized data.
• a gene expression profile encompasses a representation of the expression level of at least one mRNA species
• the typical gene expression profile represents the expression level of multiple mRNA species.
• a gene expression profile useful in the methods and compositions disclosed herein represents the expression levels of at least about 5, 10, 20, 50, 100, 150, 200, 300, 500, 1000 or more preferably, substantially all of the detectable mRNA species in a cell sample or population.
• gene expression profiles or arrays affixed to a solid support that contain a sufficient representative number of mRNA species whose expression levels are modulated under the relevant infection, disease, screening, treatment or other experimental conditions.
• a sufficient representative number of such mRNA species will be about 1, 2, 5, 10, 15, 20, 25, 30,
• Gene expression profiles can be produced by any means known in the art, including, but not limited to the methods disclosed by: Liang et al. (1992) Science 257:967-971; Ivanova et al. (1995) Nucleic Acids Res. 23:2954-2958; Guilfoyl et al.
• gene expression profiles are produced by the methods of Prashar et al. (WO 97/05286) and Prashar et al. (1996) Proc. Natl. Acad. Sci. USA 93:659-663.
• gene expression profiles as described herein are made to identify one or more genes whose expression levels are modulated in a granulocytic cell population exposed to a pathogen or isolated from a subject having a sterile inflammatory disease.
• the assaying of the modulation of gene expression via the production of a gene expression profile generally involves the production of cDNA from polyA RNA (mRNA) isolated from granulocytes as described below .
• the mRNAs are generally isolated from a population of neutrophils.
• the cells may be obtained from an in vivo source, such as peripheral blood.
• an in vivo source such as peripheral blood.
• any granulocytic cell type may be used, however, neutrophils are preferred.
• the peripheral blood cells that are initially obtained may be subjected to various separation techniques (e.g., flow cytometry, density gradients).
• mRNAs are isolated from cells by any one of a variety of techniques.
• RNAs are lysed in a Tris-buffered solution containing SDS. The lysate is extracted with phenol chloroform, and nucleic acids are precipitated. Purification of poly(A)- containing RNA is not a requirement. The mRNAs may, however, be purified from crude preparations of nucleic acids or from total RNA by chromatography, such as binding and elution from oligo(dT)-cellulose or poly(U)-Sepharose®. As stated above, other protocols and methods for isolation of RNAs may be substituted.
• RNA-directed DNA polymerase such as reverse transcriptase isolated from AMV, MoMuLV or recombinantly produced.
• RNA-directed DNA polymerase such as reverse transcriptase isolated from AMV, MoMuLV or recombinantly produced.
• Many commercial sources of enzyme are available (e.g., Pharmacia, New England Biolabs, Stratagene Cloning Systems). Suitable buffers., cofactors, and conditions are well known and supplied by manufacturers (see also, Sambrook et al., supra, Ausubel et al., supra).
• oligonucleotides are used in the production of cDNA.
• the methods utilize oligonucleotide primers for cDNA synthesis, adapters, and primers for amplification.
• Oligonucleotides are generally synthesized as single strands by standard chemistry techniques, including automated synthesis. Oligonucleotides are subsequently de-protected and may be purified by precipitation with ethanol, chromatographed using a sized or reversed-phase column, denaturing polyacrylamide gel electrophoresis, high-pressure liquid chromatography (HPLC), or other suitable method.
• HPLC high-pressure liquid chromatography
• a functional group such as biotin
• a functional group is incorporated preferably at the 5' or 3' terminal nucleotide.
• a biotinylated oligonucleotide may be synthesized using pre-coupled nucleotides, or alternatively, biotin may be conjugated to the oligonucleotide using standard chemical reactions.
• Other functional groups such as florescent dyes, radioactive molecules, digoxigenin, and the like, may also be incorporated.
• Partially-double stranded adaptors are formed from single stranded oligonucleotides by annealing complementary single-stranded oligonucleotides that are chemically synthesized or by enzymatic synthesis. Following synthesis of each strand, the two oligonucleotide strands are mixed together in a buffered salt solution (e.g., 1 M NaCl, 100 mM Tris-HCl pH.8.0, 10 mM EDTA) or in a buffered solution containing Mg 2 (e.g., 10 mM MgCl 2 ) and annealed by heating to high temperature and slow cooling to room temperature.
• a buffered salt solution e.g., 1 M NaCl, 100 mM Tris-HCl pH.8.0, 10 mM EDTA
• Mg 2 e.g., 10 mM MgCl 2
• the oligonucleotide primer that primes first strand DNA synthesis comprises a 5' sequence incapable of hybridizing to a poly A tail of the mRNAs, and a 3' sequence that hybridizes to a portion of the polyA tail of the mRNAs and at least one non-polyA nucleotide immediately upstream of the polyA tail.
• the 5' sequence is preferably a sufficient length that can serve as a primer for amplification.
• the 5' sequence also preferably has an average G+C content and does not contain large palindromic sequence; some palindromes, such as a recognition sequence for a restriction enzyme, may be acceptable. Examples of suitable 5' sequences are
• TAATACCGCGCCACATAGCA SEQ ID No. .
• the 5' sequence is joined to a 3' sequence comprising sequence that hybridizes to a portion of the polyA tail of mRNAs and at least one non-polyA nucleotide immediately upstream.
• the polyA-hybridizing sequence is typically a homopolymer of dT or dU, it need only contain a sufficient number of dT or dU bases to hybridize to polyA under the conditions employed. Both oligo-dT and oligo-dU primers have been used and give comparable results. Thus, other bases may be interspersed or concentrated, as long as hybridization is not impeded.
• the no-polyA nucleotide is A, C, or G, or a nucleotide derivative, such as inosinate. If one non- polyA nucleotide is used, then three oligonucleotide primers are needed to hybridize to all mRNAs. If two non-polyA nucleotides are used, then 12 primers are needed to hybridize to all mRNAs (AA, AC, AG, AT, CA, CC, CG, CT, GA, GC, GG, GT).
• the MRNAs are either subdivided into three (if one non-polyA nucleotide is used) or 12 (if two non-polyA nucleotides are used) fractions, each containing a single oligonucleotide primer, or the primers may be pooled and contacted with a mRNA preparation. Other subdivisions may alternatively be used.
• first strand cDNA is initiated from the oligonucleotide primer by reverse transcriptase (RTase).
• RTase reverse transcriptase
• Second strand synthesis may be performed by RTase (Gubler and Hoffman, Gene 25: 263, 1983), which also has a DNA-directed DNA polymerase activity, with or without a specific primer, by DNA polymerase 1 in conjunction with RNaseH and DNA ligase, or other equivalent methods.
• the double- stranded cDNA is generally treated by phenol: chloroform extraction and ethanol precipitation to remove protein and free nucleotides.
• Double-stranded cDNA is subsequently digested with an agent that cleaves in a sequence-specific manner.
• cleaving agents include restriction enzymes. Restriction enzyme digestion is preferred; enzymes that are relatively infrequent cutters (e.g., > 5 bp recognition site) are preferred and those that leave overhanging ends are especially preferred.
• a restriction enzyme with a six base pair recognition site cuts approximately 8% of cDNAs, so that approximately 12 such restriction enzymes should be needed to digest every cDNA at least once. By using 30 restriction enzymes, digestion of every cDNA is assured.
• the adapters for use in the present invention are designed such that the two strands are only partially complementary and only one of the nucleic acid strands that the adapter is ligated to can be amplified.
• the adapter is partially double- stranded (i.e., comprising two partially hybridized nucleic acid strands), wherein portions of the two strands are non-complementary to each other and portions of the two strands are complementary to each other.
• the adapter is "Y- shaped" or "bubble-shaped.” When the 5' region is non-paired, the 3 1 end of other strand cannot be extended by a polymerase to make a complementary copy.
• the ligated adapter can also be blocked at the 3' end to eliminate extension during subsequent amplifications.
• Blocking groups include dideoxynucleotides or any other agent capable of blocking the 3'-OH.
• the non- complementary portion of the upper strand of the adapters is preferably a length that can serve as a primer for amplification.
• the non-complementary portion of the lower strand need only be one base, however, a longer sequence is preferable (e.g., 3 to 20 bases; 3 to 15 bases; 5 to 15 bases; or 14 to 24 bases).
• the complementary portion of the adapter should be long enough to form a duplex under conditions of litigation.
• the non-complementary portion of the upper strands is preferably a length that can serve as a primer for amplification.
• this portion is preferably 15 to 30 bases.
• the adapter can have a structure similar to the Y-shaped adapter, but has a 3' end that contains a moiety that a DNA polymerase cannot extend from.
• Amplification primers are also used in the present invention. Two different amplification steps are performed in the preferred aspect. In the first, the 3' end (referenced to mRNA) of double stranded cDNA that has been cleaved and ligated with an adapter is amplified. For this amplification, either a single primer or a primer pair is used. The sequence of the single primer comprises at least a portion of the 5' sequence of the oligonucleotide primer used for first strand cDNA synthesis.
• the primer pair consists of a first primer whose sequence comprises at least a portion of the 5' sequence of the oligonucleotide primer as described above; and a second primer whose sequence comprises at least a portion of the sequence of one strand of the adapter in the non-complementary portion.
• the primer will generally contain all the sequence of the non-complementary potion, but may contain less of the sequence, especially when the non-complementary portion is very long, or more of the sequence, especially when the non-complementary portion is very short.
• the primer will contain sequence of the complementary portion, as long as that sequence does not appreciably hybridize to the other strand of the adapter under the amplification conditions employed.
• the primer sequence comprises four bases of the complementary region to yield a 19 base primer, and amplification cycles are performed at 56 °C (annealing temperature), 72 °C (extension temperature), and 94 °C (denaturation temperature).
• the primer is 25 bases long and has 10 bases of sequence in the complementary portion. Amplification cycles for this primer are performed at 68 °C (annealing and extension temperature) and 94 °C (denaturation temperature). By using these longer primers, the specificity of priming is increased.
• amplification primers will generally follow well-known guidelines, such as average G-C content, absence of hairpin structures, inability to form primer-dimers and the like. t times, however, it will be recognized that deviations from such guidelines may be appropriate or desirable.
• the lengths of the amplified fragments are determined. Any procedure that separates nucleic acids on the basis of size and allows detection or identification of the nucleic acids is acceptable. Such procedures include slap gel electrophoresis, capillary gel electrophoresis, high performance liquid chromatography, and the like.
• Electrophoresis is technique based on the mobility of DNA in an electric field. Negatively charged DNA migrates towards a positive electrode at a rate dependent on their total charge, size, and shape. Most often, DNA is electrophoresed in agarose or polyacrylamide gels. For maximal resolution, polyacrylamide is preferred and for maximal linearity, a denaturant, such as urea is present.
• a typical get setup uses a 19: 1 mixture of acryiamide:bisacrylamide and a Tris-borate buffer. DNA samples are denatured and applied to the gel, which is usually sandwiched between glass plates. A typical procedure can be found in Sambrook et al (Molecular Cloning: A Laboratory Approach, Cold Spring Harbor Press, NY, 1989) or Ausubel et al. (Current Protocols in Molecular Biology, Greene Publishing Co., NY, 1995). Variations may be substituted as long as sufficient resolution is obtained.
• Capillary electrophoresis in its various manifestations (free solution, isotachophoresis, isoelectric focusing, polyacrylamide get. micellar electrokinetic "chromatography") allows high resolution separation of very small sample volumes.
• a neutral coated capillary such as a 50 ⁇ m X 37 cm column (eCAP neutral, Beckman Instruments, CA)
• a linear polyacrylamide e.g. 0.2% polyacrylamide
• a sample is introduced by high-pressure injection followed by an injection of running buffer (e.g., IX TBE).
• running buffer e.g., IX TBE
• Capillaries may be used in parallel for increased throughput (Smith et al. (1990) Nwc. Acids. Res. 18:4417; Mathies and Huang (1992) Nature 359: 167). Because of the small sample volume that can be loaded onto a capillary, sample may be concentrated to increase level of detection.
• concentration is sample stacking (Chien and Burgi (1992) Anal. Chem 64:489A). In sample stacking, a large volume of sample in a low concentration buffer is introduced to the capillary column, the capillary is then filled with a buffer of the same composition, but at higher concentration, such that when the sample ions reach the capillary buffer with a lower electric field, they stack into a concentrated zone. Sample stacking can increase detection by one to three orders of magnitude. Other methods of concentration, such as isotachophoresis, may also be used.
• HPLC High-performance liquid chromatography
• HPLC instruments consist of a reservoir of mobile phase, a pump, an injector, a separation column, and a detector. Compounds are separated by injecting an aliquot of the sample mixture onto the column. The different components in the mixture pass through the column at different rates due to differences in their partitioning behavior between the mobile liquid phase and the stationary phase.
• IP-RO-HPLC on non-porous PS/DVB particles with chemically bonded alkyl chains can also be used to analyze nucleic acid molecules on the basis of size (Huber et al. (1993) Anal. Biochem. 121 :351; Huber et al. ( 1993 ) Nuc. Acids Res. 21:1061; Huber et al. ( 1993 ) Biotechniques 16:898).
• the amplified fragments are detected.
• labels can be used to assist in detection.
• Such labels include, but are not limited to, radioactive molecules (e.g., 35 S, 32 P, 33 P), fluorescent molecules, and mass spectrometric tags.
• the labels may be attached to the oligonucleotide primers or to nucleotides that are incorporated during D ⁇ A synthesis, including amplification.
• Radioactive nucleotides may be obtained from commercial sources; radioactive primers may be readily generated by transfer of label from ⁇ - 32 P-ATP to a 5'-OH group by a kinase (e.g., T4 polynucleotide kinase). Detection systems include autoradiography, phosphor image analysis and the like. Fluorescent nucleotides may be obtained from commercial sources (e.g., ABI, Foster city, CA) or generated by chemical reaction using appropriately derivatized dyes. Oligonucleotide primers can be labeled, for example, using succinimidyl esters to conjugate to amine-modified oligonucleotides.
• florescent dyes may be used, including 6 carboxyfluorescein, other carboxyfluorescein derivatives, carboxyrhodamine derivatives, Texas red derivatives, and the like. Detection systems include photomultiplier tubes with appropriate wave-length filters for the dyes used. DNA sequence analysis systems, such as produced by ABI (Foster City, CA), may be used. After separation of the amplified cDNA fragments, cDNA fragments which correspond to differentially expressed mRNA species are isolated, reamplified and sequenced according to standard procedures.
• bands corresponding the cDNA fragments are cut from the electrophoresis gel, reamplified and subcloned into any available vector, including pCRscript using the PCR script cloning kit (Stratagene). The insert is then sequenced using standard procedures, such as cycle sequencing on an ABI sequencer.
• An additional means of analysis comprises hybridization of the amplified fragments to one or more sets of oligonucleotides immobilized on a solid substrate.
• the solid substrate is a membrane, such as nitrocellulose or nylon. More recently, the substrate is a silicon wafer or a borosilicate slide.
• the substrate may be porous (Beattie et al. WO 95/11755) or solid.
• Oligonucleotides are synthesized in situ or synthesized prior to deposition on the substrate. Various chemistries are known for attaching oligonucleotide. Many of these attachment chemistries rely upon functionalizing oligonucleotides to contain a primary amine group.
• the oligonucleotides are arranged in an array form, such that the position of each oligonucleotide sequence can be determined.
• the amplified fragments which are generally labeled according to one of the methods described herein, are denatured and applied to the oligonucleotides on the substrate under appropriate salt and temperature conditions.
• the conditions are chosen to favor hybridization of exact complementary matches and disfavor hybridization of mismatches.
• Unhybridized nucleic acids are washed off and the hybridized molecules detected, generally both for position and quantity.
• the detection method will depend upon the label used. Radioactive labels, fluorescent labels and mass spectrometry label are among the suitable labels.
• Nucleic acids of the claimed invention include nucleic acids which specifically hybridize to nucleic acids comprising the sequences set forth in SEQ ID NOS: 1-86.
• a nucleic acid which specifically hybridizes to a nucleic acid comprising one of the sequences set forth in SEQ ID NOS: 1-86 remains stably bound to said nucleic acid under highly stringent or moderately stringent conditions.
• Stringent and moderately stringent conditions are those commonly defined and available, such as those defined by Sambrook et al (Molecular Cloning: A Laboratory Approach, Cold Spring Harbor Press, NY, 1989) or Ausubel et al. (Current Protocols in Molecular Biology, Greene Publishing Co., NY, 1995). The precise level of stringency is not important, rather, conditions should be selected that provide a clear, detectable signal when specific hybridization has occurred.
• Hybridization is a function of sequence identity (homology), G+C content of the sequence, buffer salt content, sequence length and duplex melt temperature (T[m]) among other variables.
• sequence identity identity
• the buffer salt concentration and temperature provide useful variables for assessing sequence identity (homology) by hybridization techniques. For example, where there is at least 90 percent homology, hybridization is commonly carried out at 68° C in a buffer salt such as 6XSCC diluted from 20XSSC. See Sambrook et al.
• the buffer salt utilized for final Southern blot washes can be used at a low concentration, e.g., 0.1XSSC and at a relatively high temperature, e.g. 68° C, and two sequences will form a hybrid duplex (hybridize).
• Use of the above hybridization and washing conditions together are defined as conditions of high stringency or highly stringent conditions.
• Moderately stringent conditions can be utilized for hybridization where two sequences share at least about 80 percent homology.
• hybridization is carried out using 6XSSC a temperature of about 50-55° C.
• a final wash salt concentration of about 1-3XSSC and at a temperature of about 60-68° C are used. These hybridization and washing conditions define moderately stringent conditions.
• specific hybridization refers to conditions in which a high degree of complementarity exists between a nucleic acid comprising the sequence of at least one of SEQ ID NOS: 1-86 and another nucleic acid.
• complementarity will generally be at least about 75%, 80%, 85%, preferably about 90- 100%), or most preferably about 95-100%.
• the nucleic acids of the present invention can be used in a variety of ways in accordance with the present invention. For example, they can be used as nucleic acid probes to screen other cDNA and genomic DNA libraries so as to select by hybridization, other DNA sequences that comprise similar sequences.
• the nucleic acid probe could be RNA or DNA labeled with radioactive nucleotides or by non-radioactive methods (i.e., biotin). Screening could be done at various stringencies (through manipulation of the hybridization Tm, usually using a combination of ionic strength, temperature and/or presence of formamide) to isolate close or distantly related homologs.
• the nucleic acids may also be used to generate primers to amplify cDNA or genomic DNA using polymerase chain reaction (PCR) techniques.
• PCR polymerase chain reaction
• the nucleic acid sequences of the present invention can also be used to identify adjacent sequences in the cDNA or genome, for example, flanking sequences and regulatory elements.
• the nucleic acid sequences of the present invention can also be used diagnostically to detect nucleic acid sequences which specifically hybridize to at least one of the sequences set forth in SEQ ID NOS: 1-86.
• the sequences of SEQ ID NOS: 1-86 can be used to detect activated neutrophils or neutrophils previously exposed to virulent or avirulent bacteria.
• the sequences of SEQ ID NOS: 1-86 are the partial sequences of cDNA species which correspond to neutrophil mRNA and therefor genes, which are differentially expressed during neutrophil contact with virulent or avirulent bacteria.
• nucleic acid fragments comprising these sequences can be used as diagnostic probes to identify neutrophil populations that have been activated or have been in contact with one or more bacterial species.
• nucleic acid fragments comprising at least one of the sequences or part of one of the sequences of SEQ ID NOS: 1-86 can be used as probes to screen nucleic acid samples from neutrophil populations in hybridization assays. Such assays can be used to detect activated neutrophils or neutrophils exposed to a pathogen.
• the stringency of the assay conditions determines the amount of complementarity which should exist between two nucleic acid strands in order to form a hybrid. Stringency should be chosen to maximize the difference in stability between the probe:target hybrid and potential probe: non-target hybrids.
• Probes may be designed from the sequences of SEQ ID NOS: 1-86 through methods known in the art. For instance, the G+C content of the probe and the probe length can affect probe binding to its target sequence. Methods to optimize probe specificity are commonly available in Sambrook et al. (Molecular Cloning: A Laboratory Approach, Cold Spring Harbor Press, NY, 1989) or Ausubel et al. (Current Protocols in Molecular Biology, Greene Publishing Co., NY, 1995).
• the nucleic acid sequences of the present invention can also be used as probes to monitor the expression of at least one differentially expressed neutrophil gene in a method to identify a therapeutic or prophylactic agent that modulates the response of a neutrophil population to a pathogen.
• the method to identify a therapeutic or prophylactic agent that modulates the response of a neutrophil population to a pathogen comprises the steps of determining the expression level of at least one RNA species that specifically hybridizes to a probe comprising all or part of at least of one of the sequences set forth in SEQ ID NOS: 1-86 in a quiescent granulocyte population.
• the expression level of the RNA species is then determined in a neutrophil or other granulocyte population exposed to either a virulent or avirulent bacterial strain and in a neutrophil population exposed to the bacteria and to the agent to be tested.
• Agents which modulate the expression level of a RNA species associated with neutrophil activation by a virulent or avirulent bacteria species are thereby identified by comparing the expression levels of the RNA species.
• Hybridization assays to determine the expression level of at least one RNA species are commonly available and include the detection of DNA:RNA and RNA:RNA hybrids. Northern blots of total cellular RNA or polyA purified RNA and hybridization assays wherein at least one or part of one of the sequences of the present invention are immobilized to a solid support are included.
• Solid supports can be prepared that comprise immobilized representative groupings of nucleic acids corresponding to the sequences or parts of the sequences of SEQ ID NOS: 1-86.
• representative nucleic acids can be immobilized to any solid support to which nucleic acids can be immobilized, such as positively charged nitrocellulose or nylon membranes (see Sambrook et al. (1989) Molecular Cloning: a laboratory manual 2nd., Cold Spring Harbor Laboratory) as well as porous glass wafers such as those disclosed by Beattie (WO 95/11755).
• Nucleic acids are immobilized to the solid support by well established techniques, including charge interactions as well as attachment of derivatized nucleic acids to silicon dioxide surfaces such as glass which bears a terminal epoxide moiety.
• a solid support comprising a representative grouping of nucleic acids can then be used in standard hybridization assays to detect the presence or quantity of one or more specific nucleic acid species in a sample (such as a total cellular mRNA sample or cDNA prepared from said mRNA) which hybridize to the nucleic acids attached to the solid support.
• a sample such as a total cellular mRNA sample or cDNA prepared from said mRNA
• Any hybridization methods, reactions, conditions and/or detection means can be used, such as those disclosed by Sambrook et al. (1989) Molecular Cloning: a laboratory manual 2nd., Cold Spring Harbor Laboratory , Ausbel et ⁇ /.(1987) Current Protocols in Molecular Biology, Greene Publishing and Wiley-Inter science or Beattie (WO 95/11755).
• nucleic acid species that must be represented by nucleic acid fragments immobilized on the solid support to effectively differentiate between samples, e.g., neutrophils exposed to various pathogens.
• samples e.g., neutrophils exposed to various pathogens.
• at least about 1, 5, 10, 20, 25, 50 or more nucleic acid fragments corresponding to at least one or part of one of the sequences of SEQ ID NOS: 1-86 are affixed to a solid support.
• the skilled artisan will be able to optimize the number and particular nucleic acids for a given purpose, i.e., screening for modulating agents, identifying activated neutrophils, etc.
• SEQ ID NOS: 1-86 The identification of the sequences of SEQ ID NOS: 1-86 as derived from neutrophil mRNA species (genes) that are differentially regulated in response to exposure of a neutrophil population to virulent or avirulent bacteria enables the isolation of full length cDNA molecules encoding proteins associated with the neutrophil response to bacterial infection, e.g. exposure to both virulent and avirulent bacteria.
• any method may be used to prepare a cDNA library from neutrophils.
• the cDNA library is produced from neutrophils exposed to virulent or avirulent bacteria.
• the cDNA library is prepared by extracting the mRNA from isolated neutrophils, using known methods, for example, isolation of polyadenylated (poly A+) RNA. Kits for isolating poly A+ RNA are commercially available, for example, PolyATract kits are available from Promega Corporation.
• the mRNA thus extracted may be enriched for mRNAs corresponding to genes differentially expressed by hybrid selection procedures, and the like.
• mRNA can be preamplified by PCR using known methods.
• the cDNAs corresponding to the mRNAs may be prepared using a reverse transcriptase for first strand synthesis and a DNA polymerase for second strand synthesis. Methods for using reverse transcriptase and DNA polymerase to make cDNA are well known in the art. Kits for performing these techniques are commercially available, for example, the Superscript IITM kit (Gibco-BRL), the Great Lengths cDNA Synthesis KitTM (Clontech), the cDNA Synthesis Kit (Stratagene), and the like.
• the cDNAs may then be ligated to linker DNA sequences containing suitable restriction enzyme recognition sites.
• linker DNAs are commercially available, for example, from Promega Corporation and from New England Biolabs and the particular linker used may be selected to conform to the protocol being used.
• the cDNAs may be subjected to restriction enzyme digestion, size fractionation, or any other suitable method, to enrich for full-length cDNAs within the library.
• the resultant cDNA library can be modified to select for rare transcripts or for transcripts corresponding to genes that are differentially expressed upon exposure to a virulent or avirulent bacterial strain. For instance, when using a sequence corresponding to a mRNA which is up- regulated in response to exposure of a neutrophil population to a virulent bacterial strain, a cDNA library is prepared from neutrophils exposed to the virulent bacteria and subtractively hybridized to cDNA or mRNA (polyA+ RNA) from a quiescent neutrophil population. Subtractive hybridization methods are available, for instance as taught by Davis et al. (1987) Cell 51 :987-1000; Hedrick et ⁇ /.
• the resultant cD ⁇ A library may also be normalized to obtain cD ⁇ As corresponding to rare or weakly expressed mR ⁇ A species.
• Many procedures are available including hybridization of the cD ⁇ A library to genomic D ⁇ A as taught by Weissman et al. (1987) Mol. Biol. Med., 4 : 133-143.
• Other available techniques include utilizing second order hybridization kinetics to select for rarer species as taught by Ko et al. (1990) Nuc. Acids. Res., 18:5709; Patanjali et al. (1991) Proc. Natl. Acad. Sci. USA, 88:1943-1947 or Soares et al. (U.S. Patent No. 5,637,685).
• the cDNA library is then screened from cDNA clones that specifically hybridize to a nucleic acid comprising at least one or part of one of the sequences set forth in SEQ ID NOS: 1-86. Such methods are widely available as set forth above. After isolation of cDNA clones which specifically hybridize to a nucleic acid comprising at least one or part of ⁇ ne of the sequences set forth in SEQ ID NOS: 1- 86, the inserts into the cDNA molecules can be further characterized by known methods including the sequencing of the cDNA insert.
• 5' RACE PCR amplification and other known procedures can be used to retrieve the 5' end of the cDNA.
• Such methods are known in the art and exemplified by Fang et al. (1997) Biotechniques, 23 (1):52, 54, 56, 58; Chen (1996) Trends Genet., 12 (3): 87-88; Lung et al. (1996) Trends Genet, 12 (10): 389-91; Bahring et ⁇ /., (1994) Biotechniques, 16 (5):807-8; and Borson et al. (1992) PCR Methods Appl., 2(2): 144-8.
• sequences flanking or contiguous with at least one of the sequences of SEQ ID NOS: 1-86 include: sequences remaining in the same open reading frame; sequences which do not include a stop codon; sequences which terminate at a stop codon; sequences which serve as a promoter, operator or other regulatory control sequence; or sequences which are derived from genomic DNA.
• the present invention comprises recombinant vectors containing and capable of replicating and directing the expression of nucleic acids comprising at least one, or part of one of the sequences of SEQ ID NOS: 1-86 in a compatible host cell.
• the insertion of a DNA in accordance with the present invention into a vector may be performed by any conventional means. Such an insertion is easily accomplished when both the DNA and the desired vector have been cut with the same restriction enzyme or enzymes, since complementary DNA termini are thereby produced. If this cannot be accomplished, it may be necessary to modify the cut ends that are produced by digesting back single-stranded DNA to produce blunt ends, or by achieving the same result by filling in the single-stranded termini with an appropriate DNA polymerase.
• any site desired may be produced by ligating nucleotide sequences (linkers) onto the DNA termini.
• linkers may comprise specific oligonucleotide sequences that encode restriction site recognition sequences.
• Any available vectors and the appropriate compatible host cells may be used such as those disclosed by Sambrook et al. , Molecular Cloning: A Laboratory Approach, Cold Spring Harbor Press, NY, 1987 and Ausubel et., Current Protocols in Molecular Biology, Greene Publishing Co. NY, 1995.
• Commercially available vectors for instance, those available from New England Biolabs Inc., Promega Corp., Stratagene Inc. or other commercial sources are included.
• Example 1 Production of gene expression profiles generated from cDNAs made with RNA isolated from neutrophils exposed to virulent and avirulent bacteria.
• RNA expression levels from neutrophils exposed to various bacteria offer a powerful means of identifying genes that are specifically regulated in response to bacterial infection.
• the production of expression profiles from neutrophils exposed to virulent and avirulent E. coli and Y. pestis allow the identification of neutrophil genes that are specifically regulated in response to bacterial infection.
• Neutrophils were isolated from normal donor peripheral blood following the LPS-free method.
• Peripheral blood was isolated using a butterfly needle and a syringe containing 5 cc ACD, 5 cc of 6% Dextran (in normal saline). After 30 minutes of settling, plasma was collected and HBSS (without Ca ++ or Mg ++ ) was added to a total volume of 40 ml. The plasma was centrifliged (1500 rpm, for 15 m at 4°C), the supernatant decanted and cold HBSS added to resuspend the cells. The cell suspension was then layered onto a cold Ficoll Hypaq, centrifliged at 500xg for 30m at 4°C.
• the pellet contains polymorphonuclear neutrophils.
• Neutrophils can also be isolated by other commonly used methods such as those disclosed in Current Protocols of Immunology (John Wiley & Sons, Inc.), Babior et al. (1981) In:Leokocyte Function, Cline, M. J. Ed., p.1-38 (Church Livingstone, NY), and Haslett et al. (1985) Am. J. Pathol. 119: 101-110.
• neutrophils were incubated with E. coli or Y. pestis. Before incubation, bacteria were harvested and washed in phosphate buffered saline and opsonized with either autologous human serum or complement factor C7 deficient human serum (SIGMA). Incubation was at a PMN:bacteria ratio of approximately 1 :20 in RPMI 1640 (HEPES buffered) with heat inactivated Fetal Bovine Serum at 37°C with gentle mixing in a rotary shaker bath.
• neutrophils were incubated with either bacterial lipopolysaccharide (LPS) or latex beads.
• LPS bacterial lipopolysaccharide
• RPMI phosphatidylcholine
• 6% autologous serum fetal calf serum
• Incubation proceeded for 30 or 120 minutes with gentle rotation in disposable polycarbonate Erlenmeyer flasks at 37°C. After incubation, the cells were spun down and washed once with HBSS.
• Total cellular RNA was prepared from untreated and treated neutrophils as described above using the procedure of Newburger et ⁇ /.(1981) J. Biol. Chem. 266(24): 16171-7 and Newburger et al. (1988) Proc. Natl. Acad. Sci. USA 85:5215- 5219. Ten micrograms of total RNA, the amount obtainable from about 3x10 6 neutrophils, is sufficient for a complete set of cDNA expression profiles.
• cDNA was synthesized according to the protocol described in the GIBCO/BRL kit for cDNA synthesis.
• the reaction mixture for first-strand synthesis included 6 ⁇ g of total RNA, and 200 ng of a mixture of 1-base anchored oligo(dT) primers with all three possible anchored bases
• the reaction mixture may include lO ⁇ g of total RNA, and 2 pmol of 1 of the 2-base anchored oligo(dT) primers with a heel such as RP5.0 (CTCTCAAGGATCTTACCGCTT 18 AT), or RP6.0 (TAATACCGCGCCACATAGCAT 18 CG), or RP9.2 (CAGGGTAGACGACGCTACGCT 18 GA) along with other components for first- strand synthesis reaction except reverse transcriptase.
• This mixture was then layered with mineral oil and incubated at 65 °C for 7 min followed by 50° C for another 7 min.
• the adapter oligonucleotide sequences were Al (TAGCGTCCGGCGCAGCGACGGCCAG) and A2 (GATCCTGGCCGTCGGCTGTCTGTCGGCGC).
• One microgram of oligonucleotide A2 was first phosphorylated at the 5 ' end using T4 polynucleotide kinase (PNK).
• PNK polynucleotide kinase
• PNK was heated denatured, and l ⁇ g of the oligonucleotide Al was added along with 10* annealing buffer (1 M NaCl/100 mM Tris-HCl, pH8.0/10 mM EDTA, pH8.0) in a final vol of 20 ⁇ l
• 10* annealing buffer (1 M NaCl/100 mM Tris-HCl, pH8.0/10 mM EDTA, pH8.0
• This mixture was then heated at 65°C for 10 min followed by slow cooling to room temperature for 30 min, resulting in formation of the Y adapter at a final concentration of 100 ng/ ⁇ l.
• About 20 ng of the cDNA was digested with 4 units of Bgl II in a final vol of 10 ⁇ l for 30 min at 37 °C.
• the labeled oligonucleotide was diluted to a final concentration of 2 ⁇ M in 80 ⁇ l with unlabeled oligonucleotide Al .1.
• the PCR mixture (20 ⁇ l) consisted of 2 ⁇ l ( « 100 pg) of the template, 2 ⁇ l of 10 ⁇ PCR buffer (100 mM Tris-HCl, pH 8.3/500 mM KCl), 2 ⁇ l of 15 mM MgCl 2 to yield 1.5 mM final Mg 2+ concentration optimum in the reaction mixture, 200 ⁇ M dNTPs, 200 nM each 5' and 3' PCR primers, and 1 unit of Amplitaq Gold. Primers and dNTPs were added after preheating the reaction mixture containing the rest of the components at 85 °C.
• PCR This "hot start” PCR was done to avoid artefactual amplification arising out of arbitrary annealing of PCR primers at lower temperature during transition from room temperature to 94 °C in the first PCR cycle.
• PCR consisted of 5 cycles of 94 °C for 30 sec, 55°C for 2 min, and 72°C for 60 sec followed by 25 cycles of 94°C for 30 sec, 60 °C for 2 min, and 72 °C for 60 sec. A higher number of cycles may result in smeary gel patterns.
• PCR products (2.5 ⁇ l) were analyzed on a 6% polyacrylamide sequencing gel.
• Figure 1 presents an autoradiogram of the expression profile generated from cDNAs made from RNA isolated from control (untreated) neutrophils (lanes 1, 5, 10, 13, 14 and 16), neutrophils incubated with avirulent E coli K12 (lanes 2 and 11), v_rulent Y. pestis (lane 3), avirulent Y. pestis (lane 4), Y pestis yopB (lane 6), Y. pestis yopE (lane 7), Y. pestis yop ⁇ (lane 8), latex beads (lanes 9 and 19), virulent ⁇ ntero Hemorrhagic E.
• the ancho ⁇ ng oligo d(T)18 nl, n2 has A and C at the nl and n2 positions, respectively
• the cDNAs were digested with
• Example 2 Production of gene expression profiles generated from cDNAs made with RNA isolated from neutrophils exposed to virulent and avirulent bacteria and neutrophils exposed to cytokines.
• Neutrophils were isolated from normal donor peripheral blood following the LPS- free method as set forth in Example 1 Neutrophils were incubated with avirulent E coli or virulent and avirulent Y. pestis, LPS at lng/ml, GM-CSF at 100 units/ml, TNF at 1000 units/ml, or ⁇ lFN at 100 units/ml
• the bacterial cells, LPS or cytokines were added to approximately 3 38 x 10 s cells in 100 ml of RPMI containing 6% HI autologous serum Incubation proceeded for 2 to 4 hours, preferably 2 hours, with gentle rotation m disposable polycarbonate Erlenmeyer flasks at 37°C After incubation, the cells were spun down and washed once with HBSS
• RNA was extracted and the cDNA profiles prepared as described in Example 1 Figure 2 is an autoradiogram of the expression profiles generated from cDNAs made with RNA isolated from control (untreated) neutrophils (lanes 1, 5, 10 and 14), neutrophils incubated with avirulent E. coli K12 (lanes 2 and 11), virulent Y. pestis (lanes 3 and 12) , avirulent Y.
• the anchoring oligo d(T)18nl, n2 has A and C at the nl and n2 positions for lanes 1-9 and G and G at the nl and n2 for lanes 10-18
• the cDNAs were digested with Bglil
• FIG. 1 is an autoradiogram of the expression profiles generated from cDNAs made with RNA isolated from control (untreated) neutrophils (lane 1), neutrophils incubated with avirulent E. coli K12 (lane 2), virulent Y. pestis (lane 3) or avirulent Y.
• Table 3 represents a summary of new unique sequences which correspond to mRNA species which are differentially expressed in neutrophils upon exposure to bacteria at different time points after exposure.
• Solid supports can be prepared that comprise immobilized representative groupings of nucleic acids corresponding to the genes or fragments of said genes from a neutrophil population whose expression levels are modulated in response to exposure to virulent or avirulent bacteria
• representative nucleic acids can be immobilized to any solid support to which nucleic acids can be immobilized, such as positively charged nitrocellulose or nylon membranes (see Sambrook et al.
• Nucleic acids are immobilized to the solid support by well established techniques, including charge interactions as well as attachment of derivatized nucleic acids to silicon dioxide surfaces such as glass which bears a terminal epoxide moiety
• a solid support comprising a representative grouping of nucleic acids can then be used in standard hybridization assays to detect the presence or quantity of one or more specific nucleic acid species in a sample (such as a total cellular mRNA sample or cDNA prepared from said mRNA) which hybridize to the nucleic acids attached to the solid support
• Any hybridization methods, reactions, conditions and/or detection means can be used, such as those disclosed by Sambrook et al.
• nucleic acid fragments corresponding to at least one or part of one of the sequences of SEQ ID NOS: 1-86 are affixed to a solid support.
• the skilled artisan will be able to optimize the number and particular nucleic acids for a given purpose, i.e., screening for modulating agents, identifying activated neutrophils, etc.
• Isolated nucleic acid fragments comprising at least one of the sequences of SEQ ID NOS: 1-86 offer a powerful means to diagnose exposure of a subject to a pathogen.
• the display patterns generated from cDNAs made with RNA isolated from neutrophils exposed to pathogenic and nonpathogenic E. coli and Y. pestis exhibit unique patterns of cDNA species corresponding to neutrophil mRNA species (genes) whose expression levels are modulated in response to contact of the neutrophils with the bacteria.
• the above Tables set forth the expression patterns of 86 unique cDNA bands corresponding to mRNA species which are differentially expressed upon contact with virulent and avirulent Y. pestis and avirulent E. coli.
• the contacting of neutrophils with different species of pathogens may result in the identification of unique cDNA bands in expression profiles that correspond to unique mRNA species that are differentially regulated upon exposure to each pathogen species or strain. These unique cDNA sequences are useful in diagnosing whether a subject has been exposed to or is infected with a given pathogen.
• probes comprising at least one, or part of one of the sequences of SEQ ID NOS: 1-86 are used to detect RNA species that specifically hybridize in neutrophil RNA samples isolated from the subject to be tested for exposure to a pathogen.
• Hybridization conditions are modified using known methods, such as those described by Sambrook et al. and Ausubel et al. as required for each probe.
• Hybridization of total cellular RNA or RNA enriched for polyA RNA can be accomplished in any available format
• total cellular RNA or RNA enriched for polyA RNA can be affixed to a solid support and the solid support exposed to at least one probe comprising at least one, or part of one of the sequences of SEQ ID NOS 1-86 under conditions in which the probe will specifically hybridize
• nucleic acid fragments comprising at least oner or part of one of the sequences of SEQ ID NOS.
• RNA 1- 86 can be affixed to a solid support, such as a silicon chip or porous glass wafer The chip or glass wafer can then be exposed to total cellular RNA or polyA RNA from a neutrophil sample under conditions in which the affixed sequences will specifically hybridize
• a solid support such as a silicon chip or porous glass wafer
• Such glass wafers and hybridization methods are widely available, such as those disclosed by Beattie (WO 95/11755)
• nucleic acids comprising the sequences of SEQ ID NOS 1 -86 also offers a powerful approach for identifying therapeutic or prophylactic agents that modulate the expression of neutrophils or other granulocytic cells to a pathogen
• probes comprising at least one, or part of one of the sequences of SEQ ID NOS 1 -86 are used to detect RNA species that specifically hybridize to RNA from an untreated neutrophil population, RNA from a neutrophil population exposed a pathogen of interest and RNA from a neutrophil population exposed to a pathogen of interest and an agent to be tested Hybridization conditions are modified using known methods, such as those described by Sambrook et al. and Ausubel et al.
• Hybridization of total cellular RNA or RNA enriched for polyA RNA can be accomplished in any available format
• total cellular RNA or RNA enriched for polyA RNA can be affixed to a solid support and the solid support exposed to at least one probe comprising at least one, or part of one of the sequences of SEQ ID NOS 1-86 under conditions in which the probe will specifically hybridize
• nucleic acid fragments comprising at least one, or part of one of the sequences of SEQ ID NOS 1-86 can be affixed to a solid support, such as a micro- array chip or porous glass wafer The glass wafer can then be exposed to total cellular RNA or polyA RNA from a neutrophil sample under conditions in which the affixed sequences will specifically hybridize.
• Such glass wafers and hybridization methods are widely available, for example, those disclosed by Beattie (WO 95/11755).
• Beattie WO 95/11755
• agents which up or down regulate the expression of at least one neutrophil gene can be identified.
• agents which up or down regulate the expression of a neutrophil gene comprising the sequence of SEQ ID NO: 78 can be identified by examining the differences in hybridization between a probe comprising at least part of the sequence of SEQ ID NO: 78 to RNA from an untreated neutrophil population, RNA from a neutrophil population exposed a pathogen of interest and RNA from a neutrophil population exposed to both the pathogen and an agent to be tested.
• a neutrophil RNA species comprising the sequence of SEQ ID NO: 78 is expressed at high levels when neutrophils are exposed to avirulent bacteria, including E. coli K12 and avirulent Y.
• RNA species expression as demonstrated by increased specific hybridization to a probe comprising at least part of the sequence of SEQ ID NO: 78 in neutrophils exposed to virulent Y. pestis in the presence of the agent may be useful in modulating the response of neutrophils to bacterial infection.

Landscapes

• Chemical & Material Sciences (AREA)
• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• Biochemistry (AREA)
• Gastroenterology & Hepatology (AREA)
• Zoology (AREA)
• Biophysics (AREA)
• General Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Medicinal Chemistry (AREA)
• Molecular Biology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Toxicology (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Priority Applications (1)

Applications Claiming Priority (2)

Publications (2)

Family

ID=22043315

Family Applications (1)

Country Status (2)

• 1998
  • 1998-10-21 WO PCT/US1998/022171 patent/WO1999020642A2/fr active Application Filing
  • 1998-10-21 AU AU11061/99A patent/AU1106199A/en not_active Abandoned

Also Published As

Similar Documents

Legal Events