Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
  • C07K14/70567—Nuclear receptors, e.g. retinoic acid receptor [RAR], RXR, nuclear orphan receptors
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
  • C07K14/39—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
  • C07K14/70578—NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

• the present invention provides: (i) a plasmid DNA containing a novel repo overnight gene DNA; (ii) a transformant transformed with the plasmid DNA and a DNA encoding a known effector protein;
• the present invention relates to a therapeutic agent for cancer or an autoimmune disease containing A as an active ingredient, and (iv) a method for detecting a ligand of a nuclear receptor using the transformant.
• a fusion protein comprising the above-described plasmid DNA and a known effector protein, that is, a fusion protein in which an amino acid sequence containing a ligand binding region of a nuclear receptor is bound to the C-terminal of an amino acid sequence containing a DNA binding region of Ga14 protein.
• the present invention relates to a method for detecting a ligand of a receptor.
• receptors for humoral factors having important biological activities such as cytokins and hormones
• many receptors have been isolated and identified.
• the receptors for liposoluble hormones collectively referred to as nuclear receptors.
• nuclear receptors As a result of analyzing the amino acid sequences of various nuclear receptors, These are ligand-dependent transcription factors with a common basic structure, and have been shown to form one gene family. That is, steroid receptors such as darcocorticoid receptor, progesterone receptor, mineralocorticoid receptor, andorogen receptor, estrogen receptor, retinoid receptor such as retinoid X receptor, retinoic acid receptor, and peroxisome.
• proliferator activated receptor is a family one consisting of vitamin D 3 receptor and thyroid hormone receptor. It is known that functional domains of these receptors, such as the ligand binding site and the site recognizing the sequence of the target DNA, are clearly separated [Science, 240, 889 (1988)]. Some receptors have been isolated from homology but have unknown ligands.
• PPAR receptors peroxisome proliferator-activated receptors
• cDNAs have been cloned from various animal species, and several isoform genes have been found.
• ⁇ , ⁇ , and ⁇ are known.
• type A is expressed in adipose tissue, immune cells, adrenal gland, spleen, and small intestine
• type is expressed in liver and retina
• type ⁇ is universally expressed without any tissue specificity. ing.
• the Fas antigen is a membrane protein that has been clearly shown to be involved in programmed cell death (apoptosis).
• Yonehara et al Produced monoclonal antibodies against human cell surface antigens and obtained anti-Fas antibodies that show lethal activity against various human cells [see L Exp. Med., 169, 1747 (1989)]. ].
• the cDNA of the cell surface molecule recognized by the anti-Fas antibody was isolated, and the structure of the human Fas antigen was determined [see Cell, 66, 233 (1991)].
• This Fas antigen is composed of 335 amino acids, and the N-terminal 16 amino acids are estimated to be signal peptides.
• the Fas antigen is similar to that of the tumor necrosis factor (TNF) receptor, apoptosis by the Fas antibody is presumed to occur by a mechanism similar to that of TNF.
• the functional region of the Fas antigen has also been gradually elucidated, and the region essential for apoptosis signal transduction (functional expression region) is known to be the amino acid sequence from the 175th to the 304th amino acid [J. Biol.
• the function expression region is considered to be an amino acid sequence from the 166th position to the 291st position corresponding to the region of the human Fas antigen.
• the receptor has a ligand binding domain and a signal transduction domain.
• a ligand binds to the ligand binding domain, the three-dimensional structure of the signal transduction domain changes, and the signal is transmitted to another protein or DNA.
• RM Evans and colleagues convert enzymes into chemiluminescent or visible dye products or introduce substituents downstream of the Ga14 response element (eg, luciferase, / 3-galactosida).
• substituents downstream of the Ga14 response element eg, luciferase, / 3-galactosida.
• a secretory alkaline phosphatase or chloramphenic acid acetyltransferase and a protein that fuses the DNA binding domain of Ga14 with the ligand binding region of the PPAR receptor.
• a method for repo-into-cell introduction into cells has been reported (see PCT International Application Publication No. WO 9640128).
• PPRE PPAR receptor response element
• the present inventors have repeatedly studied for the purpose of high-speed screening of a compound that binds to a ligand of a nuclear receptor, and as a result, achieved the objective by using a repo overnight expression system that expresses a Fas protein. I found that.
• the vector was stably transfected into mouse fibroblast L922 cells. The cells proliferated in a state where the ligand II compound did not bind to the amino acid sequence of the ligand binding region of the nuclear receptor. However, when the ligand II compound bound, the expression of the F s protein was induced and cell death occurred.
• the surviving cells After washing and separating the dead cells from the surviving cells, the surviving cells are stained with a dye, and the absorbance is measured to interact with the ligand-binding region of the nuclear receptor and functionally activate the transcription factor.
• the high-speed screening method of the present invention is a novel method that has never been known before.
• the method of the present invention uses the functional region of the Fas structural protein as a reporter, expresses the Fas protein, causes cell death, and measures the result. Chemiluminescence (particularly, luciferase) is used as the reporter. Alternatively, it is completely different from the method of RM Evans et al., Which measures the expression level (enzyme activity) of an enzyme using an enzyme that produces a visible dye (especially, 3-galactosidase).
• RM Evans et al Introduced DNA into cells on the first day, stimulated with serum, re-seed if necessary, The schedule is a minimum of 4 days in which the test compound is added 8 hours later (day 3), and luciferase activity is measured 24 hours later (last day).
• transient transfection when introducing DNA into cells poses a problem of stability and comparison between experiments. DNA encoding different enzymes to standardize each measurement May be co-introduced, but the operation becomes complicated.
• the method using Luciferase requires a large number of examples because the fluctuation of each value is large (usually n to 3 to 4).
• the test compound is added on the first day, and in the latter half of the next day (36 hours later), the schedule is a minimum of 2 days in which cells can be measured by dye staining. Also, since L922 cells (same clone) are used, comparison between experiments is easy. In addition, the method using the stably transfected cells does not require a large number of cases because the fluctuation of each value is small.
• a ligand compound capable of changing the function of a nuclear receptor can be rapidly evaluated, and the operation itself is simple.
• the fluctuation of each value is small, and comparison between experiments can be performed, and it is very stable.
• an automatic measuring instrument (mouth pot) that is actually widely used is provided with an absorbance measuring instrument as a standard specification, so it can be said that it is a compound evaluation system compatible with a mouth pot. This is completely unpredictable from the viewpoint of the prior art, and the present inventors have confirmed this through experiments for the first time.
• the method of the present invention does not require any enzyme substrate, so that significant cost reduction can be achieved.
• FIG. 1 is a graph showing a dose-dependent change in the number of viable cells after treatment with each compound by performing a cell killing assay using PPART ligand-responsive L922 cells.
• (A) shows the case of PPART "ligand-responsive cells
• (B) shows the case of normal cells.
• FIG. 2 is a graph showing a dose-dependent change in the number of viable cells after treatment with each compound by performing a cell killing assay using L929 cells responsive to a PPART ligand.
• Figure The middle (A) shows the case of the PPAR ligand-responsive cells, and the middle (B) shows the case of the normal cells.
• FIG. 3 is a graph showing a dose-dependent change in the number of viable cells after treatment with each compound by performing cell killing using PPARa ligand-responsive L929 cells.
• (A) shows the case of PPAR ⁇ ligand-responsive cells
• ( ⁇ ) shows the case of normal cells.
• FIG. 4 is a graph showing a dose-dependent change in the number of viable cells after treatment with each compound by performing a cell killing assay using P929 ligand-responsive L929 cells.
• ( ⁇ ) shows the case of PPAR ⁇ ligand-responsive cells
• (B) shows the case of normal cells.
• the present invention is a.
• Fas antigen and the nuclear receptor in the cell those derived from mammals, for example, those derived from humans, monkeys, dogs, cats, mice, rats, and guinea pigs are used.
• the Fas antigen and the nuclear receptor are preferably of the same species, but may be of different species. In the present invention, it has been confirmed that signal transmission can be performed using different species.
• a combination of human Fas antigen and human nuclear receptor a combination of mouse Fas antigen and human nuclear receptor, a combination of human Fas antigen and rat nuclear receptor, mouse Combination of Fas antigen and rat nuclear receptor, A combination of a mouse Fas antigen and a mouse nuclear receptor or a combination of a mouse Fas antigen and a mouse nuclear receptor is preferably used.
• amino acid sequence containing the transmembrane region and the function expression region of the Fas antigen used in the present invention and the amino acid sequence containing the ligand binding region of the nuclear receptor, only a portion corresponding to each region may be used.
• flanking regions regions that are not involved in functional regions, the number of amino acids is 10 or less, preferably 60 or less, at both ends (N-terminus and Z- or C-terminus) of the portion corresponding to each region.
• an amino acid sequence containing a signal peptide region may be bound to the N-terminus of the transmembrane region of the Fs antigen.
• the amino acid sequence corresponding to each region includes not only the natural amino acid sequence but also amino acid deletions and amino acids that do not impair the apoptotic function of the original Fas antigen or the ligand binding function of the nuclear receptor. Substitutions, additions and Z or insertions can be used.
• the amino acid sequence containing the transmembrane region and the function expression region of the human Fas antigen includes Ser from 145th to Va1 from 319th, and mouse For the Fas antigen, a sequence from Ser at position 136 to Leu at position 305 is suitably used.
• the amino acid sequence containing the signal peptide region is preferably a sequence from the 16th to the 23rd for the human Fas antigen, and a sequence from the 121st to the 14th for the mouse Fas antigen. Used for
• the nuclear receptor in the cell in the effector protein used in the present invention includes darcocorticoid receptor, progesterone receptor, mineralcorticoid receptor, androgen receptor, steroid receptor such as estrogen receptor, retinoid X receptor, retinoid receptors such as retinoic acid receptor, Peruokishisomu proliferator activated receptor, vitamin D 3 receptor, or thyroid hormone receptor are exemplified up.
• human or rat estrogen receptor human or mouse retinoid X receptor, retinoid X receptor / 3 or retinoid X receptor R or human or mouse retinoic acid receptor, retinoic acid receptor 3 or retinoic acid receptor a, human or mouse P PAR receptor, human or mouse P PAR delta receptor, human or mouse P The PARr receptor is used.
• each receptor The ligand binding region of each receptor is already known [Science, 240, 889 (1988), Mol. Endocrinology, 6, 1634 (1992), Biochem. Biophys. Res. Co bandad un., 224, 431 (1996) , 51, 157 (1994), Proc. Natl. Acad. Sci. USA, 9i, 7355 (1994)], for example, from the 528th to the 777th position of the human glucocorticoid receptor.
• Mouse retinoid X from 307 to 557 for rat estrogens, from 225 to 462 for human retinoid X receptor ⁇ , and from 297 to 526 for human retinoid X receptor] 3 Receptor From 230 to 467, from mouse retinoide X receptor i3 from 171 to 410, from mouse retinoide X receptor from 229 to 463, and from human retinoic acid receptor a from 198 to 462 From human retinoic acid receptor 13, from 191 to 448, human retinoic acid receptor from 200 to 454, mouse retinoic acid receptor alpha from 198 to 462, mouse retinoic acid from the receptor) 3, 19 0-th to 448 th, 200 th in mouse retinoic acid receptor ⁇ to 4
• amino acids 246 to 441 of the receptor or amino acids 245 to 440 of the mouse P PAR ⁇ receptor.
• the human estrogen receptor from 31 to 551 of the human estrogen receptor, from 307 to 557 of the rat estrogen receptor, from 225 to 462 of the human retinoid X receptor a, from the human retinoid X receptor 3 29 7th to 526th, mouse retinoid X receptor a 230th to 467th, mouse retinoid X receptor) 171st to 410th, mouse retinoid X receptor 229th to 463th, human retinoid 198th to 462th of human retinoic acid receptor a; 191st to 448th of human retinoic acid receptor; 200th to 454th of human retinoic acid receptor a; 198 of the mouse retinoic acid receptor (Mouse retinoic acid receptor from No.
• mice retinoic acid receptor No. 200 to 458 Until, from position 176 of the human PPAR ⁇ (human PPARr l sub-type) receptors to 478 th, a mouse? PAR r (mouse P PARr 1 subtype) 174th to 475th of the receptor, 167th to 468th of the human PPARa receptor, 167th to 468th of the mouse PPAR receptor, rat PPAR Sequences from positions 2167 to 468 of the a receptor, positions 139 to 441 of the human PPAR5 receptor, or positions 138 to 440 of the mouse PPAR ⁇ receptor are used.
• PAR r mouse P PARr 1 subtype
• the human estrogens receptor from 281 to 595
• the rat estrogens receptor from 286 to 600
• the human retinoic acid receptor a from 176 to 462
• the mouse retinoic acid receptor The human PPARr (human PPARr l Eve) 166th to 478th of the receptor (equivalent to 194th to 506th in the human PPAR T2 subtype), 164th of the mouse PPARr (mouse PPAR?
• “1 subtype) receptor To 475 (corresponding to positions 194 to 505 in the mouse PPAR Rr2 subtype), 157 to 468 of the human PPAR ⁇ receptor, 157 to 468 of the mouse PPAR receptor, Sequences from positions 157 to 468 of the rat PPARa receptor, positions 129 to 441 of the human PPAR ⁇ 5 receptor, or positions 128 to 440 of the mouse PPAR ⁇ receptor are used.
• More preferred effector proteins used in the present invention include: (i) at the C-terminus of the amino acid sequence from the 1st to the 147th amino acid sequence of the DNA binding region of the Ga14 protein, the 176th amino acid sequence of the human PPAR? 478th tyrosine from serine (Ser) Effek Yuichi protein with amino acid sequence up to (Tyr)
• the promoters of the present invention include SV40, HSV, LTR, metallothionein promoter, and thymidine kinase (TK) promoter.
• TK thymidine kinase
• it is TK Promo Yuichi. More specifically, as shown in the plasmid pTK / 3 (Klontech, Cat. No. 6179-1), the transcription initiation was carried out (corresponding to the 165th to 945th positions in the pTK3 map). Assuming that 1 is the point, the 727th to 56th positions of the mRNA of the TK promoter are preferred. More preferably, it is from position 105 to position 51 of mRNA of TK promoter.
• the present invention also includes a DNA encoding the repo overnight plasmid of the present invention.
• a DNA encoding the repo overnight plasmid of the present invention.
• codons encode one amino acid (for example, one type of methionine (Met) and six types of leucine (Le u)). Therefore, the base sequence of DNA can be changed without changing the amino acid sequence.
• the present invention includes the base sequence group of all DNA sequences which are the same as the Fas protein polypeptide in the DNA encoding the repo overnight plasmid of the present invention. Changing the nucleotide sequence may improve the productivity of the fusion protein.
• DNA encoding the repo overnight plasmid of the present invention can be prepared according to the following method.
• Step (i) is a step of amplifying parts required for fusion by the PCR method.
• a nucleotide sequence encoding an amino acid sequence containing a transmembrane region and a function expression region is chemically synthesized and used as a primer.
• a nucleotide sequence encoding an amino acid sequence including a ligand binding region is chemically synthesized and used as a primer.
• a specific restriction enzyme site is provided at the 5 'end of the obtained primer.
• mRNA isolated and purified from a corresponding mammal for example, a cell or cell line such as a human or mouse, can be used.
• the PCR method is performed by a known method. Recently, PCR automation equipment has become popular. Therefore, the device is preferably used.
• Step (ii) is a step of fusing DNA binding region of Ga14 with DNA corresponding to nuclear receptor ligand binding region in the expression vector.
• Many plasmid vectors used in this step are known to function in E. coli (for example, pBR322) and those that function in Bacillus subtilis (for example, pUB110). Used for It can also be directly incorporated into an expression vector.
• a suitable promoter for example, SV40 promoter, LTR promoter, etc.
• a suitable vector for example, retrovirus vector-1, papillomavirus vector, vaccinia virus vector, SV40 vector, etc.
• a DNA binding region of Gal4 and then the PCR product of a nuclear receptor are inserted downstream of (i.e., a meta-thickinin promoter) to produce an expression vector.
• pCMX described in Cell, 66.663 (1991)
• pSV described in Anal. Biochem., 188.245 (1990)
• step (iii) is a step for producing a reporter plasmid.
• the plasmid vector used in this step may be either one that functions in E. coli or one that functions in Bacillus subtilis. It can also be incorporated directly into the expression vector. From the 5 'upstream, the repeat structure of the Ga14 response element, a simple herpesvirus thymidine kinase promoter overnight, and a DNA encoding the Fas structural protein are arranged in tandem in this order. The purpose depends on whether the origin is a vector that functions in Escherichia coli or a vector that functions in mammalian cells.
• it may include, for example, an ori region, a promoter, and one or more selectable marker genes.
• appropriate mammalian cells are transformed with a plasmid that functions in the aforementioned mammalian cells, and cultured in an appropriate medium, whereby these cells are transformed into Fas.
• Assay for protein expression-dependent killing Become a cell.
• PCR product of a nucleotide sequence encoding the signal peptide region of the Fs antigen can be inserted immediately downstream of the promoter, if desired.
• Examples of the replication or expression vector comprising the DNA of the present invention include, for example, a plasmid, a virus or a phage vector comprising an ori region and, if necessary, a promoter for the expression of the DNA, a regulator of a promoter, and the like.
• the vector may contain one or more selectable marker genes (eg, a neomycin resistance gene, a blasticidin S resistance gene).
• the protein expression system of the present invention includes a mammalian cell suitable for the expression vector that functions in the mammalian cell (for example, monkey COS-7 cell, Chinese hamster CHO cell, mouse L cell, mouse fibroblast). , A human cancer cell, etc.), and culturing the transformant in an appropriate medium, thereby producing the desired fusion protein.
• the polypeptide obtained as described above can be isolated and purified by a general biochemical method.
• the present invention includes a host cell transformed with a replication or expression vector comprising the DNA of the present invention.
• the thus obtained plasmid DNA of the present invention can be used as a therapeutic agent for cancer or autoimmune diseases. That is, an expression vector containing the plasmid DNA of the present invention is locally administered to a cancer lesion or an autoimmune disease lesion by a targeting method (for example, by enclosing it in a ribosome). This vector penetrates into cancer cells in the lesion and enters the gene.
• a targeting method for example, by enclosing it in a ribosome
• a ligand corresponding to a nuclear receptor constituting a part of the effector protein of the present invention for example, 9-cis-retinoic acid, retinoic acid when a retinoid X receptor is used as the receptor
• vitamin A is administered and effe
• the Fas protein is expressed.
• the apo! -Cis signal is transmitted by the Fas protein produced in the cancer cells, and the cancer cells die.
• the plasmid DNA of the present invention can be widely used as a screening method for agonists or gonists for nuclear receptors. That is, a DNA encoding the effector protein (expression vector DNA containing DNA encoding various ligand binding regions of nuclear receptors downstream of the DNA binding region of Ga14) used in the present invention. Add the sample to the cells into which the expression vector containing the DNA and the repo DNA has been introduced. If the cells die, this indicates that the sample has agonist activity, and if the cells survive in the presence of agonist, the sample is known to have agonist activity.
• a DNA encoding the effector protein expression vector DNA containing DNA encoding various ligand binding regions of nuclear receptors downstream of the DNA binding region of Ga14
• the screening method of the present invention it is possible to rapidly evaluate a ligand II compound that can change the function of a nuclear receptor, and the effect (result) is expressed as cell death.
• the operation itself is simple.
• DNAs encoding ligand binding regions of various nuclear receptors downstream of the DNA binding region of Ga14 as an effector protein nuclear receptors including orphan receptors with unknown ligands can be obtained. This is a general method that allows you to search for compounds that act on. Of course, it is also possible to search for a physiological ligand of the orphan nuclear receptor.
• a candidate for a physiological ligand or a partial fraction of serum that can be expected can be added to the above-mentioned cells, and the cell can be used for identification of a ligand depending on the presence or absence of cell death and purification of a fraction responsible for ligand activity.
• the method of the present invention has small fluctuations in individual values, enables comparison between experiments, and is very stable. The above is especially effective in high-speed multi-sample evaluation.
• an automatic measuring device mouth pot
• an absorbance measuring device attached as a standard specification, so it can be said that it is a compound evaluation system compatible with a mouth pot.
• the screening method of the present invention does not require any enzyme substrate, the cost can be significantly reduced.
• Example 1 Preparation of PCR product of mouse Fas antigen
• F1 13 Amino acid sequence from the 1st to the 143rd: Pro CysThrA1 aThrSe rAs nThrAs nCy sAr gLy s Gln, corresponding to a part of the 5 'side Sense primer with restriction enzyme Hindile site
• CAGGAAAC-3 ′ (SEQ ID NO: 1) was synthesized.
• R 1 298 Amino acid sequence from 8th to 306th (C-terminal): A snGluAsnGlnGlyGlnCysLeeuGlu and a part of the 3 'untranslated region, In addition, anti-sense with BamHI site
• TTTCATT—3 ′ (SEQ ID NO: 2) was synthesized.
• MFas a fragment of about 520 bp
• pBluescript trade name, Promega
• pBSMFas multiple cloning site HindllkBamHI restriction enzyme site
• F 2 'sense primer corresponds to the untranslated region and N-terminal amino acids M et 1 -V a 1 2: 5' 5 human PPARa - AACCAGCACCATCTGGTC GCGATGGT- 3 '(SEQ ID NO: 3) was synthesized.
• R2 An antiserum containing the 3 'untranslated region of human PPARo; and an amino acid stop codon.
• CA-3 ′ (SEQ ID NO: 4) was synthesized.
• R3 Antibody corresponding to the 3 'untranslated region of human PPARr ( ⁇ 1 subtype)
• TCT-3 ′ (SEQ ID NO: 6) was synthesized.
• R4 An antisense primer corresponding to the 3 'untranslated region of human PPAR ⁇ 5: No. 8) was synthesized.
• Gibco BRL Superscript Human Liver cDNA Library, trade name, Cat. No. Using 10422-012 as a cDNA library and F2 and R2, F3 and R3 or F4 and R4 as PCR primers, use a polymerase (Perkin Elmer GeneArap PCR System 9600).
• Toka Ink's Pica Gene Basic Vector 2 (Pica Gene Basic Vector 2 (registered trademark), PGBV 2, Cat. No. 309-04821) as a basic vector, and a Ga 14 chimeric receptor protein as a structural gene Constructed a vector that is expressed under the control of the SV40 promoter. That is, the luciferase structural gene of PGBV2 was excised with restriction enzymes NcoI and Xbal, and completed by inserting the cDNA encoding the Ga14 chimera receptor protein prepared as follows.
• F5 DNA binding region of Ga14 N-terminal 1st to 8th amino acid and Kozak (Kozak) for efficient expression of proteins in mammalian cells at Hindill site and part of 5 'side )
• Sense primer with sequence: 5 '— GCA 3 ′ (SEQ ID NO: 9) was synthesized.
• R5 DNA binding region of Ga14 C-terminal side 14 Amino acids from 1st to 147th and antisense ply with NcoI site attached to part of 5 'side
• TTTG-3 ′ (SEQ ID NO: 10) was synthesized, and PCR was amplified under the same reaction conditions as in Example 2. As a result, the entire DNA sequence of the amplified DNA fragment of about 465 bp was confirmed and recombined with the Hindlll / Ncol site in the PGBV2 vector (hereinafter abbreviated as pGVgal).
• Example 2 Using the full-length human PPAR ⁇ cDNA isolated from the human liver cDNA library according to Example 2 as type I, a DNA fragment encoding Ty was synthesized from Ser 176 containing the human PPART ligand binding region with the following primers. PCR amplification was performed under the same reaction conditions as in Example 1.
• F 6 Ser 176 to Ser t 185 , N col site on 5 'side, nuclear translocation signal derived from SV40T antigen (AlaProLysLysLysArgLysVa1G1y) , And B amHI sites in order: 5 '— GC
• R 6 Ty from G 1 u 472 r478, S a 1 I site followed by Maguruchininepi for detection of expressed protein Epitopu to evening Infuruenza to as grayed Sequence Tope (Ty r P r oTy rA s pVa l P r oA s pTy rA la), translation stop codon and antisense primer sequenced with XbaI site: 5 ' -3 '(SEQ ID NO: 12) was synthesized.
• the luciferase structural gene is excised from the XbaI site downstream of the Nco IZ luciferase structural gene downstream of the DNA encoding the Ga14 DNA binding region of pGVgal, and the human PPART ligand binding region is encoded.
• the A fragment was replaced to obtain an expression vector for the desired effector protein (hereinafter abbreviated as pGVgalZTLBD).
• the following primer containing a human PPAR-ligand binding region was synthesized, and PCR-amplified under the same reaction conditions as in Example 2 to synthesize a PPARa ligand-binding region structural gene.
• the PPAR ⁇ ligand binding region structural gene thus obtained was digested with both restriction enzymes at the BamHI and Sail sites of the pGVgalZr LBD vector synthesized above. Only the offspring were inserted and inserted to construct a Ga14-human PPAR / chimeric receptor protein expression vector (hereinafter abbreviated as pGVgalZaLBD).
• F 7 corresponds to Ar g 17 5 from S er 167 human PPARa amino, 'sense primer one having a B BamHI site side: 5' Part 5 was synthesized -CACGGATCC.
• R 7 Human P PAR alpha corresponds to a Ty r 468 from G 1 ⁇ 4 6 ⁇ amino acids, 'antisense primer one having a S a 1 I site side: 5' Part 5 one ATGGTCG
• pGVgalZS LBD Ga14-human PPAR ⁇ chimeric receptor protein expression vector
• F 8 Sense primer corresponding to Ar gl47 from Seri39 of human PPAR ⁇ 5 amino acids and having a BamHI site on its 5 ′ side: 5′—CACGGATCC was synthesized.
• R 8 Antisense primer corresponding to Ty from G 1 ⁇ 434 of human P PAR ⁇ amino acid and having a Sa 1 I site on its 5 ′ side: 5′-ATGGTCG ACGTACATGTCCTTGTAGATCTCCTG—3 ′ (SEQ ID NO: 16) was synthesized.
• Example 4 Reporter gene: Construction of a repo overnight plasmid in which a TK promoter and an MFas structural gene are arranged under a Ga14 transcription factor response element
• the expression vector pTK3 (Clontech, Cat. No. 6179-1) under the control of the simple virus virus thymidine kinase (TK) promoter was used. NotI sites upstream and downstream of the / 3 galactosidase structural gene of pTK3 were digested and smoothed.
• DNA encoding the MFas protein which is a DNA fragment to be inserted, was digested from pBSMFas with both HindIII and BamHI restriction enzymes, cut out, and then blunted. Both DNA fragments were ligated, and a clone in which the MFas structural gene was ligated in the forward direction downstream of the TK promoter was selected.
• the resulting plasmid of about 4400 bp, pTK-MFas carries DNA encoding the M fas protein under the control of the TK promoter overnight.
• the basic unit (UAS) is repeated four times, and G a 14 response element having Sa 1 I site and ZS ac I site at both ends: 5 '— T (CGACGGAGTACTGTC CTCCG) X 4 AGCT-3' (SEQ ID NO: 18)
• An enhancer region was obtained by insertion into the Sail-SacI site in the pTK-MFas-ML1 multicloning site.
• p4XUAS-TK-MFas (about 4600 bp) was constructed, in which the MF promoter structural gene was placed one after another at 4TK.
• Obtained expression vector PS Vgal / ⁇ LBD, pS Vgal / ⁇ LBD or pS Vgal / ⁇ LBD and repo overnight plasmid and pS V2bsr was subjected to linearization by Aatil treatment, linearization by NotI treatment, and untreated (as it was in a non-linear state).
• the cells were introduced into mouse fibroblast L929 using Lipofect AMINE (GIBC0, Cat. No. 18324-012). Cells stably transfected were selected by the method described in Exp. Cell Res., 197, 229 (1991) (Blasticidin S selection).
• Example 5 Selection of ligand-responsive clones
• Example 6 Plasmid stably transfected plasmids of PPARa, H and ⁇ 5 ligand Cell killing using L929 cells
• Example 5 The clone having the highest responsiveness obtained in Example 5 is cultured by the above-mentioned method. Using the cultured cells, the above compound is caused to undergo cell death by the above-mentioned method, and the surviving cells are stained. Was measured. Cell death appears significantly after 24 hours, 36-
• Figure 1 (A) shows the dose-dependent change in the number of viable cells after treatment for 0 hours, and similarly, the dose-dependent change in the number of viable cells when the control cells (L922) were treated with the compound. Is shown in Fig. 1 (B). Lubacycline and Py in Wy—14643
• FIG. 2 (A) shows the change in the number of living cells when the control cells (L929) were treated with the compound
• FIG. 2 (B) shows the dose-dependent changes.
• Fig. 3 (A) shows the dose-dependent changes in the number of viable cells when the PPAR ligand-responsive clones were treated with lectavacycline, ETYA, Wy-14643 and CS-405 for 40 hours.
• Figure 3 (B) shows the dose-dependent change in the number of viable cells when the control cells (L922) were treated with the compound.
• FIG. 4 ( ⁇ ) shows the dose-dependent change in the number of viable cells when the PPAR ⁇ ligand-responsive clone was treated with levavacycline, Merck compound, ETYA, and CS-045 for 40 hours.
• the dose-dependent change in the number of viable cells when the control cells (L922) were treated with the compound is shown in FIG. 4 ( ⁇ ).
• the ratio of the number of viable cells when only the solvent is added and the compound is not added is shown as 100%.
• each of the 10 M and 1 M non-toxic to Wy-14643 known as a calvacyclin ⁇ pp AR ⁇ receptor agonist known as P PAR o! No cell death is observed at a concentration of less than 00 iM.
• the PPAR ligand-responsive cells show no cell death.
• PAL Vacyclin, ETYA and Wy-14643 show dose-dependent cell death.
• it does not show cell toxicity at a concentration of 10 / zM or less, which shows no toxicity to CS-045 which is known as PPARagonist.
• PPAR ⁇ agonist a compound having a higher binding affinity to the PPAR ⁇ protein or a compound having a higher transcriptional activation ability showed a remarkable cell killing effect from a low concentration.
• FIG. 4 shows a dose-dependent cell death for calpacyclin and Merck compound known as PPAR ⁇ agonist.
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• Sequence type nucleic acid
• CACGGATCCC ACMCGCTAT CCGTTnGGT CGG SEQ ID NO: 16
• Sequence type nucleic acid
• Sequence type nucleic acid

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Genetics & Genomics (AREA)
• Molecular Biology (AREA)
• General Health & Medical Sciences (AREA)
• Biophysics (AREA)
• Biochemistry (AREA)
• Medicinal Chemistry (AREA)
• Zoology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Gastroenterology & Hepatology (AREA)
• Immunology (AREA)
• Mycology (AREA)
• Toxicology (AREA)
• Cell Biology (AREA)
• Engineering & Computer Science (AREA)
• Microbiology (AREA)
• Physics & Mathematics (AREA)
• Biotechnology (AREA)
• Biomedical Technology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• High Energy & Nuclear Physics (AREA)
• Wood Science & Technology (AREA)
• General Engineering & Computer Science (AREA)
• Plant Pathology (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Peptides Or Proteins (AREA)
• Saccharide Compounds (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Priority Applications (7)

Applications Claiming Priority (2)

Publications (1)

Family

ID=15923168

Family Applications (1)

Country Status (11)

Cited By (2)

Families Citing this family (1)

Citations (2)

Family Cites Families (6)

• 1998
  • 1998-06-23 DK DK98928625T patent/DK1016714T3/da active
  • 1998-06-23 DE DE69813845T patent/DE69813845T2/de not_active Expired - Fee Related
  • 1998-06-23 EP EP98928625A patent/EP1016714B1/en not_active Expired - Lifetime
  • 1998-06-23 US US09/446,634 patent/US6855543B1/en not_active Expired - Fee Related
  • 1998-06-23 AU AU80386/98A patent/AU8038698A/en not_active Abandoned
  • 1998-06-23 JP JP50542199A patent/JP4044969B2/ja not_active Expired - Fee Related
  • 1998-06-23 WO PCT/JP1998/002785 patent/WO1999000491A1/ja active IP Right Grant
  • 1998-06-23 PT PT98928625T patent/PT1016714E/pt unknown
  • 1998-06-23 KR KR1019997012303A patent/KR20010014218A/ko active IP Right Grant
  • 1998-06-23 AT AT98928625T patent/ATE238416T1/de not_active IP Right Cessation
  • 1998-06-23 ES ES98928625T patent/ES2197475T3/es not_active Expired - Lifetime
• 2004
  • 2004-12-29 US US11/023,449 patent/US20050158775A1/en not_active Abandoned

Patent Citations (2)

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events