WO1998051806A2 - Recuperation de vegetaux transformes sans marqueurs selectionnables par culture nodale et enrichissement des secteurs transgeniques - Google Patents

Recuperation de vegetaux transformes sans marqueurs selectionnables par culture nodale et enrichissement des secteurs transgeniques Download PDF

Info

Publication number
WO1998051806A2
WO1998051806A2 PCT/US1998/009558 US9809558W WO9851806A2 WO 1998051806 A2 WO1998051806 A2 WO 1998051806A2 US 9809558 W US9809558 W US 9809558W WO 9851806 A2 WO9851806 A2 WO 9851806A2
Authority
WO
WIPO (PCT)
Prior art keywords
transformed
plants
plant
assay
gene
Prior art date
Application number
PCT/US1998/009558
Other languages
English (en)
Inventor
Dennis L. Bidney
Christopher J. Scelonge
Lijuan Wang
Original Assignee
Pioneer Hi-Bred International, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pioneer Hi-Bred International, Inc. filed Critical Pioneer Hi-Bred International, Inc.
Priority to AU74792/98A priority Critical patent/AU7479298A/en
Publication of WO1998051806A2 publication Critical patent/WO1998051806A2/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/32—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
    • C07K14/325—Bacillus thuringiensis crystal protein (delta-endotoxin)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8209—Selection, visualisation of transformants, reporter constructs, e.g. antibiotic resistance markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)

Definitions

  • the present invention relates to the recovery of genetically transformed plants from tissue culture. More particularly, the present invention relates to the recovery of transformed plants from culture, without the use of selectable markers, using nodal culture and enrichment of transgenic sectors.
  • transformation methods include, for example, microprojectile bombardment, electroporation, direct uptake, and insertion via Agrobacterium tumefaciens. See generally, Miki et al, "Procedures for Introducing Foreign DNA into Plants", in Methods in Plant Molecular Biology and Biotechnology, Glick, B.R. and Thompson, J. E., Eds. (CRC Press, Inc., Boca Raton, 1993), pages 67-88. Also, expression vectors and in vitro culture methods for plant cell or tissue transformation and regeneration of plants are available.
  • selectable marker genes include the bar gene and the pat gene (which confer resistance to glufosinate herbicides) (see, e.g., DeBlock et al., EMBO J., 6:2513-2518, 1987), the NPTII gene
  • transgenic plants are chimeric for transgene expression.
  • the transgenic plants that are regenerated from culture following the insertion of the foreign DNA may not be uniformly transformed; instead, only one quarter, or one half, or three quarters, or some fraction of the plant may be transformed. This is most likely due to the fact that only some of the meristematic cells are actually transformed by the Agrobacterium, those meristematic cells that are transformed give rise to transgenic sectors that develop into the transgenic portions of the chimeric plants.
  • this process is complicated, and in some sense impaired, by the use of selectable markers for the identification of successfully transformed plant cells, plant tissue, or whole plants.
  • the selection process using selectable marker genes that are intended to impart resistance to a particular selective agent, involves the killing or retardation of growth of untransformed cells by the lethal, or at least strong, selective pressure applied by the use of the selective agent.
  • selective pressure can also, under certain circumstances, cause the loss of successfully transformed cells or plants as well.
  • a successfully transformed cell might not be expressing the selectable marker gene product at a level sufficient to resist the selective agent; or the transformed cell might be at a developmental stage during which, in spite of the presence of and expression of the marker gene, the cell is particularly sensitive to the selective pressure.
  • a non-selective system for recovery of transformed plants would be particularly advantageous, especially if the system involved the use of genes which would foster recovery and enrichment of transformed plant cells and tissues which might otherwise be lost using a selectable marker system. Such a non-selective system could enhance the overall efficiency of the production of transgenic plants for research or commercial use. In addition, such a non-selective system would be advantageous if it were to use genes which would be less likely to have an environmental impact.
  • non-selective markers for identification of transformed plants
  • the present invention provides important advantages over known systems, in that in its preferred embodiments it uses an agronomically useful gene as the non-selective gene, and further, in all embodiments, it provides for enrichment of transgenic sectors in chimeric plants, allowing for the development of uniform, or at least near-uniform, transgenic plants. This is in contrast to, for example, the method of Christou et al, as described in U.S.
  • Patent No. 5,015,580 which relies on lethal selection, or screening using either the ⁇ - glucuronidase (GUS) or the firefly luciferase gene. It is important to note specifically that the method of Christou et al, typically results in chimeric plants, even when screening is used, as discussed, for example, in Example 8, at column 20, line 4 of the Christou et al patent.
  • the present invention addresses the need for a non-selective system for regeneration of transformed plants from culture by providing a method for recovery of transgenic progeny using nodal culture and non-selective enrichment of transgenic sectors.
  • wounded, Agrobacterium-t ⁇ e&ted sunflower meristems produce sectors of plant tissue which express transgenes (Bidney et al, Plant Molec. Biol. 18:301-313, 1992).
  • the present invention takes advantage of the finding that nodal cultures from such regions of parental, TO shoots can produce plants that are enriched in what started out as a limited region of transgene expression. Stem segments with associated nodes from apparent regions of transformation are re-cultured to induce nodal meristem development.
  • Such shoots can be further enriched and recovered to the greenhouse, and can produce progeny. Nodal recovery and non-selective enrichment, following the use of appropriate transformation methods for transgene introduction, can allow recovery of transgenic progeny without the use of a selectable marker.
  • the present invention provides a method for recovering transformed plants from culture.
  • the first step of the method of the invention is to culture the transformed plant cells or tissue until nodes comprising meristematic tissue have developed. At this stage the plant tissue is assayed using the appropriate non-selective assay. Nodal explants are then prepared from the assay-positive tissue. The nodal explants are then cultured so that shoots form from the explants. The shoots are then cultured to provide for further shoot and leaf formation. The non-selective assay is then repeated, and assay-positive shoots are recovered. TO plants, with enriched transformed sectors, are then recovered from the assay-positive shoots.
  • the method is extended by perfo ⁇ ning further assays on the TO plants.
  • Non-transformed (assay-negative) sectors are removed, and shoots are recovered from assay-positive transgenic sectors. Uniform, or nearly uniform chimeric transformed TO plants are then produced from the recovered shoots.
  • seed is produced from the transformed TO plants, and transformed Tl plants are germinated from those seeds. Extending the invention further, seeds are produced from the transformed Tl plants, and transformed T2 plants are germinated therefrom.
  • FIGURE 1 shows the oxalate dependence on rate for Aspergillus decarboxylase (pH 5.0) and barley oxidase (pH 3.5).
  • FIGURE 2 shows a re-plotting of the data shown in FIGURE 1.
  • FIGURE 3 shows the pH range of oxalate oxidase and oxalate decarboxylase.
  • FIGURE 4 shows an oxalate oxidase assay performed on pooled meristem explant leaf tip from in vitro plantlets of Agrobacterium non-selection experiments.
  • FIGURE 5 shows a plasmid map of plasmid PHP9755.
  • FIGURE 6 shows a plasmid map of plasmid PHP 10521.
  • FIGURE 7 shows a plasmid map of plasmid PHP10092.
  • Nodal culture and enrichment of transgenic sectors of chimeric transformed plant tissue, using non-selective assays which allow for the recovery of transformed plants without the use of selectable markers, are provided.
  • an assay for transformed cells or tissue using a non-selective assay process is performed. Once this initial screen for positive transformants has been performed, assay-positive nodal explants containing meristematic tissue are prepared.
  • the nodal explants are allowed to develop in culture, and later in the development process plant tissue, typically shoot or leaf tissue, is subjected to further non- selective assays in a process for enrichment of transgenic sectors.
  • the enriched sectors are further enriched to obtain uniform, or near-uniform, transgenic plants.
  • the terms “meristem”, “axillary bud”, and “adventitious bud” refer to plant structures as defined by K. Esau in Plant Anatomy, John Wiley & Sons, Inc., New York, 2 nd Ed., 1965.
  • Esau defines "meristem” as “perpetually young tissues, primarily concerned with the formation of new cells.”
  • axillary buds Esau states, at pages 109-111, that in seed plants "branches commonly are formed in close association with the leaves and in their nascent state are referred to as axillary buds.
  • axillary bud develops into a shoot, its apical meristem is gradually organized - commonly duplicating the pattern found in the parent shoot apex - and proceeds with the formation of leaves.”
  • Esau defines adventitious buds as "buds that arise without connection with the apical meristem from more or less mature tissues....
  • Adventitious buds occur on stems, roots, and leaves on intact plants and on isolated cuttings or leaves. In cuttings the buds usually are initiated in callus tissue, which develops before the buds.” Esau at page 112.
  • nodal meristem refers to meristematic tissue located at a nodal region of a plantlet which will give rise to an axillary bud or an adventitious bud, and which in turn can give rise to a functional shoot.
  • Nodal explants are subdivisions of plantlets having expanded internodes, the subdivisions having been made by physically dividing the plantlet into “nodal segments.” See generally, Grout, B.W.W., "Meristem-Tip Culture", in Methods in Molecular Biology, vol. 6, Plant Cell and Tissue Culture, Pollard and Walker, Eds., The Humana Press, Clifton, N.J., 1990 (Chapter 9, page 82).
  • Nodal explants can be prepared from shoots generated from embryonic axis meristem, lateral or axillary meristem, or adventitious meristem. Thus, the nodal explants will comprise nodal meristematic tissue.
  • transformation methods are recognized to be useful for the introduction of transgenes into plants. See, e.g., Miki et al, "Procedures for introducing foreign DNA into plants", in Methods in Plant Molecular Biology and Biotechnology, Glick, B.R. and Thompson, J. E., Eds. (CRC Press, Inc., Boca Raton, 1993), pages 67-88.
  • the particular method selected will vary depending upon the type of plant to be transformed, the experience of the practitioner, and other factors.
  • the transformation method used to prepare the transformed plants to be recovered and enriched using the present invention is not critical to the present invention, since the present invention relates to a method for recovery of transformed plants post-DNA insertion.
  • the present method involves subjecting transformed plant cells/tissues, in culture, to non-selective assays that can determine the presence and/or expression of transgenes.
  • transgene means a gene or polynucleotide that has been inserted into a plant using a transformation method.
  • the transgene may be "foreign” in the sense that it was isolated for insertion into the plant from an entirely different organism (meaning any organism not of the same species as the plant being transformed); or the transgene may be "exogenous” in the sense that it is a synthetic gene or an additional copy of a gene that is already present in the plant being transformed.
  • non-selectively assayable transgenes in the practice of the invention.
  • the non- selectively assayable transgene is one which produces, upon expression, a product which can be assayed for using non-lethal methods. This will typically mean that there is some sort of chemical, biological, or physical assay available which will determine the presence or absence or change in amount of the expression product of the gene.
  • the assay may determine the presence or absence of, or a change in the amount of, a metabolite produced directly by the enzyme, or the presence or absence of, or a change in the amount of the final product of the metabolic pathway, rather than the presence or absence of the expression product (the enzyme) itself.
  • the enzyme might be involved in a metabolic pathway which produces oils having a particular fatty acid makeup. It will also be apparent to those of skill in the art that many forms of assay techniques will be available for the practice of the invention.
  • any expressed protein capable of detection by ELISA could be assayed by using the associated ELISA; or a modification in the amount of a specific fatty acid could be determined using the appropriate biochemical analytical technology (GCMS, for example); or a bioassay could be used (for example, expression of a crystal protein toxin from Bacillus thuringiensis (Bt) could be determined by screening for deleterious effects of transformed plant tissue on insects or insect larvae that are susceptible to the crystal protein toxin).
  • GCMS biochemical analytical technology
  • the presence of the non-selectively assayable transgene can be detected directly using DNA amplification techniques known in the art, including, but not limited to PCR, RT-PCR, or LCR, for example.
  • the non-selectively assayable transgene could be an embryo-specific gene such as a desaturase under the control of an embryo-specific promoter. Genetic modification using such a gene construct would be expected to modify seed oil profiles, without affecting expression in leaves. A properly performed PCR screen would detect the presence of the sequence in transformed plants, and the inventors have successfully screened for transgenics in Tl seed populations by PCR after transformant recovery.
  • the assayable gene will also constitute a gene that confers an agronomic trait of value to the plant.
  • non- selectively assayable transgenes include, but are not limited to, the oxalate oxidase gene which has been isolated from wheat (Dratewka-Kos et al, J. Biol. Chem.
  • oxalate decarboxylase gene which has been isolated from Aspergillus and Collybia [see WO 94/12622]
  • other enzymes that utilize oxalate the gene encoding the Green Fluorescent Protein (GFP) and variants thereof luciferase genes, anthocyanin markers, other oxidase enzymes such as polyphenol oxidase, glucose oxidase, monoamine oxidase, choline oxidase, galactose oxidase, 1-aspartate oxidase, and xanthine oxidase, and the like.
  • GFP Green Fluorescent Protein
  • the assay for the gene expression product will vary with the nature of the expression product; for example, an enzymatic assay can be used in those instances where the expression product is an enzyme, such as in the case of transformation with a gene encoding oxalate oxidase or oxalate decarboxylase.
  • a visual or colorimetric assay would be appropriate for plant cells or tissues transformed with a GFP gene.
  • an enzymatic assay is appropriate the existence of an assay in the art would be particularly useful.
  • the non-selective assay can involve a procedure which measures a loss of, or a decrease in the level of expression of, a measurable product which is normally present or which is normally expressed at higher levels.
  • antisense or co-suppression technology can be used to down- regulate the expression of a particular gene, and an appropriate assay which would detect the disappearance of or decrease in amount of the expression product or a metabolic product can be used.
  • the present invention in its preferred embodiments, utilizes repeated application of the appropriate non-selective assay at various stages of the development of the plants in culture. Initially, the assay is performed within a relatively short time after transformation. Those of skill in the art will recognize that this time will vary depending upon the plant species that has been transformed; however, the period will be at least as long as necessary for the development of shoots that are large enough for physical isolation of nodal explants.
  • the nodal explants are prepared from tissues that provide the appropriate "assay-positive" results upon performance of the non-selective assay used (in this specification the term “assay-positive” refers to non-selective assay results that indicate to the practitioner that the non-selectively assayable transgene has been stably inserted into the plant cells).
  • tissue that assayed positive for the transgene using PCR
  • transgene product using, for example, an oxalate oxidase enzyme assay.
  • enriched transgenic sunflower shoots can be rooted, or grafted to in v tro-grown sunflower seedling rootstock.
  • shoots recovered from culture can, in general, be rooted in vitro, without grafting, using standard techniques well known in the art.
  • specific techniques used for this manipulation will vary depending upon the plant species being recovered.
  • transformed sectors of the TO plants are then identified by another repetition of the appropriate assay. Following the assay, non- transformed sectors are trimmed off and axillary buds from the transgenic sectors are recovered so as to obtain uniform or near-uniform transformation events. Selfed seed, or outcrossed seed (or any seed from a TO plant pollinated by another plant source) from these TO plants is then collected, germinated, assayed again, and selfed. Seed from confirmed Tl transgenic plants (seed which will produce T2 plants) are then used in field trials.
  • the present invention is useful for the recovery of transformed plants of a variety of species. Indeed, the present method can be practiced for recovery of transgenic plants of any species amenable to nodal culture.
  • Such species include, but are not limited to, soybean, sunflower, corn, wheat, rice, barley, canola, alfalfa, and vegetable species.
  • This Example describes the results of oxalate oxidase and oxalate decarboxylase enzyme assays. These studies were performed using commercially available oxidase and decarboxylase enzymes. The studies were performed prior to obtaining transgenic plants expressing either enzyme, and were performed to gain some insight concerning the kinetic properties of the two oxalate degrading activities. The enzymes used were barley oxidase
  • Oxalate oxidase converts oxalate to CO 2 and H 2 O 2 .
  • the gene for this enzyme has been cloned from wheat (Dratewka-Kos et al, J. Biol. Chem. 264:4896-
  • the assay was adapted to megatiter plates so that a large number of samples could be screened.
  • Leaf tissue samples were collected and placed in megatiter tubes and homogenized in 400 ⁇ l of 0.1 M Na-succinate buffer (pH 3.5). Supematants were decanted and pellets were resuspended in 400 ul of the succinate buffer (pH 3.5).
  • An alternative oxalate oxidase assay useful in the practice of the present invention is as follows: Leaf tissue was lyophilized and ground to a fine powder. The powder was resuspended in sodium succinate buffer (0.1M, pH 3.5) plus a drop of lmg/ml Tween-20. Individual 1ml reaction tubes were set up by adding lOO ⁇ l of lOmM oxalate in 0.1M sodium succinate buffer (pH 3.5), and 800 ⁇ l of succinate buffer, and lOO ⁇ l of the resuspended leaf extract. The tissue extract was added last to start the reaction timing.
  • reaction was allowed to proceed for a defined time (1-30 minutes) with agitation, and lOO ⁇ l of the reaction mix was transferred to microtitre plate wells containing 17.5ul of 1M Tris free base.
  • 82.5 ⁇ l of peroxidase-linked color development solution (8mg 4- aminoantipyrine, 20 ⁇ l N,N-dimethylaniline, 400 ⁇ l peroxidase, all in 100ml of 0.2M Tris- HCl, pH7.0) was added, and absorbance was read at 550nm. For time course assays successive lOOul aliquots are removed at desired times. Values based on initial dry weights can be used to compare different samples and/or plants.
  • Example 3 This Example describes an assay for oxalate decarboxylase that can be used in the practice of the present invention.
  • Flammulina oxalate decarboxylase in transformed plant cells and tissues can be detected by the enzyme assay described by Labrou et al, "Biomimetic dye- liquids for oxalate-recognizing enzymes studies with oxalate oxidase and oxalate decarboxylase.” J. Biotech. 40:59-70, 1995.
  • Decarboxylase activity is linked to a second activity, that of formate dehydrogenase, that will oxidize the decarboxylase-generated formate, with the subsequent reduction of NAD to NADH (Johnson et al, Biochem. Biophys. Acta 89:351, 1964).
  • OD340 as NAD is reduced is used to generate an initial reaction rate that is linear with respect to formate concentration from 0.2 to 2.0 ⁇ mole.
  • the assay was adapted to megatiter plates (Continental Lab Products, San Diego, CA) so that a large number of samples could be screened.
  • Leaf tissue samples were prepared as in Example 2. After centrifugation at 4000 rpm for 20 minutes (as in Example 2), lOO ⁇ l of each supernatant were transferred to microtiter plate wells and 17.5 ⁇ l of 1M
  • Non-selection protocols have been conducted using the enzyme assays of oxalate oxidase and oxalate decarboxylase as screenable markers to identify transgenic sectors in TO plantlets.
  • the protocols of the oxalate oxidase assays are described in this example.
  • the decarboxylase methods were the same, aside from the use of the decarboxylase assay, described in Example 3 herein, for screening.
  • Plant Materials Mature seeds of Pioneer Sunflower line SMF-3 were used for the transformation. Mature seeds of Pioneer hybrid sunflower line 6440 were used as a rootstock for the grafting of transformed shoots.
  • Agrobacterium Strain and Plasmid The infection of the meristems was carried out
  • PHP9755 is an Agrobacterium binary plasmid that contains the
  • the super MAS: .oxalate oxidase cassette was first assembled in a pUC plasmid backbone by ligating an Ncol site flanking the 3' end of the Super MAS promoter to an Ncol site overlapping the start codon of oxalate oxidase.
  • the pinll terminator was blunt end ligated
  • the Super MAS promoter was oriented proximal to the left T-DNA border.
  • binary plasmid PHP 10521 ( Figure 6) was used in experiments in which the Flammulina oxalate decarboxylase (FVOXD) gene product was detected using the assay described in
  • Example 3 PHP 10521 is an Agrobacterium binary plasmid that carries a plant expression cassette consisting of the Super MAS promoter (Gelvin), germin signal sequence (Lane,
  • FVOXD had an amino terminus which was presumed to be a signal peptide.
  • a strategy was designed to remove the signal, leaving the mature FVOXD protein, and replace it with the germin signal sequence. Two PCR clones were generated, one representing the mature
  • FVOXD protein with an added Ncol restriction site at the 5' end and a second consisting of the germin signal sequence with a Bam ⁇ H site at the 5' end and an Ncol site at the 3' end.
  • Two oligomers (PH ⁇ 11260 5'GATCCATGGGTTACTCAAAGACCTTGGTTGCTGGTTTGTTCGCTATGTTGTTG
  • AACCAAGGTCTTTGAGTAACCCATG3' (SEQ ID NO: 2) were annealed to create a double stranded DNA fragment representing the germin PCR clone, the entire signal region and the initiating methionine, with the newly added restriction sites at the termini.
  • FVOXD PCR clone was generated by designing oligomers which annealed at the beginning of the mature protein sequence (FVOXD aa #26) and at a proximal downstream region with useful restriction sites.
  • 5'GGTCCATGGTGCCTTTGGCGTCCACCAC3' (SEQ ID NO: 3) includes an Ncol site added to the 5' terminus.
  • the 3' primer PH ⁇ 11271 (5'TGCCGCCGAGCCCAGCCAC3')
  • Plasmid PHP9755 was introduced into Agrobacterium strain EHA 105 (see above) via freeze-thawing as described by Holsters et al, Mol Gen Genet. 163:181-187 (1978). Agrobacteria were grown overnight at 28 C in a liquid "YEP” medium (lOg/1 yeast extract, lOg/1 Bactopeptone, and 5g l NaCl, pH7.0) in the presence of kanamycin.
  • YEP liquid "YEP” medium
  • a pellet of this Agrobacterium culture was suspended in an inoculation medium (12.5mM 2-(N- morpholino) ethanesulfonic acid, 1 g/1 NH4CL, and 0.3 g/l MgSO4, at pH 5.7), to a final calculated concentration of Agrobacteria of 4.0 at OD 600. Particle-bombarded explants were transferred to 374E medium, and a droplet of the Agrobacteria suspension was placed directly onto the top of the meristems.
  • an inoculation medium 12.5mM 2-(N- morpholino) ethanesulfonic acid, 1 g/1 NH4CL, and 0.3 g/l MgSO4, at pH 5.7
  • the explants were co-cultivated on the medium for 4 days, after which the explants were transferred to 374 C medium (GBA with 1% sucrose and with no BAP, IAA, or GA3, and supplemented with 250 ⁇ g ml cefotaxime). The explants were cultured on this medium for about 2 weeks under 16 hours of daylight, at 26 C.
  • 374 C medium GAA with 1% sucrose and with no BAP, IAA, or GA3
  • the explants were cultured on this medium for about 2 weeks under 16 hours of daylight, at 26 C.
  • Small plantlets were sterilely sectioned by cutting the stem into segments at approximately 1mm above and below all identifiable nodal junctions with a number 15 scalpel blade. These nodal explants, or nodal segments, were then cultured on 374E medium for three to four days to induce nodal meristem and shoot development. Developing shoots were separated, and the nodal explants were then transferred to 374C medium for an additional four week culture period to promote shoot/plantlet development. Following the four weeks of culture on 374C medium, leaf samples from each recovered shoot were again screened using the oxalate oxidase assay. At this time the enzyme positive shoots that were recovered from single nodes were generally found to have been enriched in the transgenic sector detected by the initial oxidase assay that was performed prior to nodal culture.
  • Recovered oxidase-positive shoots were grafted to any of Pioneer sunflower hybrids 6440, 6150, 6351, 6338, 6464, or 6482 in v/ ro-grown sunflower seedling rootstock.
  • the seeds were dehulled and surface-sterilized for 20 minutes in a 20% ChloroxTM bleach solution with two to three drops of Tween20 per 100 ml total volume, and were rinsed three times with distilled water.
  • the sterilized seeds were germinated for three days on filter paper moistened with water, then transferred into "48 Medium” (one- half strength MS salts, 0.5% sucrose, 0.3% gelrite, at pH 5.0) and grown at 26 C in the dark for 3 days, then incubated at 16 hour day culture conditions.
  • the upper portions of selected seedlings were removed, a vertical slice was made in each hypocotyl, and a transformed shoot was inserted into the vertical slice.
  • the cut area was wrapped with parafilm, and after one week culture on the medium, the grafted plants were transferred to soil. In the first two weeks they were maintained under high humidity conditions to acclimatize to the greenhouse environment.
  • Transformed sectors of TO plants were identified by additional oxalate oxidase assays of the in vitro positive grafted shoots. After assay, non-transformed sectors were trimmed off and auxiliary buds from transgenic sectors were recovered so as to obtain uniform or near uniform transformation events. Seed from TO plants were collected and germinated. The resultant Tl plants were then characterized for oxidase activity, and the transgenic plants were selfed. Seed from confirmed Tl transgenics (seed which would give rise to T2 plants) will be used in field evaluations. Good efficiency was achieved at the TO stage: Sixty-seven shoots were recovered from 1280 explants, and 28 shoots were oxalate oxidase positive, for an efficiency of 2.2%. Transgenic progeny have been recovered from these plants, and 60-70% of transgenic TO events are generally recovered to progeny.
  • Non-selection assays have been conducted using an ELISA specific for the Bt crystal protein toxin CrylF. Methods for the development of ELISA protocols for protein products are well known in the art. See, for example, Immunochemistry of Solid-Phase
  • the Agrobacterium strain EHA 105 (see Example 4, above) was used.
  • the binary vector PHP 10092 ( Figure 7) was constructed using methodology similar to that in Example 4, but contained only the CrylF gene under the direction of the Super MAS promoter. Plant material, explant preparation, Agrobacterium and plant transformation, recovery of nodal explants, shoots, and plants, and transgenic characterization were performed as described in Example 4, except that oxalate oxidase enzyme screening assays were replaced with CrylF ELISA protocols.
  • the data presented in Table 1 demonstrates that ELISA detection methods are usefiil in the practice of the present invention for identifying transgenic sectors in shoots.

Abstract

L'invention concerne une méthode qui permet de récupérer des végétaux transformés sans marqueurs sélectionnables par enrichissement des secteurs transgéniques au moyen d'une culture nodale et de criblages non sélectifs. L'enrichissement se fait par des criblages non sélectifs des explants nodaux et des tissus végétaux développés à partir desdits explants. Les tissus végétaux identifiés comme positifs en ce qui concerne l'existence de produits d'expression de transgènes pouvant être criblés de manière non sélective sont récupérés à partir de la culture afin de produire des végétaux transgéniques fertiles.
PCT/US1998/009558 1997-05-16 1998-05-11 Recuperation de vegetaux transformes sans marqueurs selectionnables par culture nodale et enrichissement des secteurs transgeniques WO1998051806A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU74792/98A AU7479298A (en) 1997-05-16 1998-05-11 Recovery of transformed plants without selectable markers by nodal culture and enrichment of transgenic sectors

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US85766497A 1997-05-16 1997-05-16
US08/857,664 1997-05-16

Publications (1)

Publication Number Publication Date
WO1998051806A2 true WO1998051806A2 (fr) 1998-11-19

Family

ID=25326475

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1998/009558 WO1998051806A2 (fr) 1997-05-16 1998-05-11 Recuperation de vegetaux transformes sans marqueurs selectionnables par culture nodale et enrichissement des secteurs transgeniques

Country Status (2)

Country Link
AU (1) AU7479298A (fr)
WO (1) WO1998051806A2 (fr)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2784393A1 (fr) * 1998-10-09 2000-04-14 Biogemma Fr Procede d'obtention de plantes transgeniques exprimant une proteine a activite productrice de peroxyde d'hydrogene par transformation par agrobacterium rhizogenes
DE10015458A1 (de) * 2000-03-29 2001-10-11 Inst Pflanzengenetik & Kultur Verfahren zur raschen Herstellung von transgenen, markergen-freien Pflanzen
WO2002037951A1 (fr) * 2000-11-10 2002-05-16 Sugar Research & Development Corporation Transformation de plante a monocotyledones
EP1279737A1 (fr) * 2001-07-27 2003-01-29 Coöperatieve Verkoop- en Productievereniging, van Aardappelmeel en Derivaten AVEBE B.A. Methode de transformation pour la génération des plants sans marqueurs selectionable
WO2003007698A2 (fr) * 2001-07-19 2003-01-30 Monsanto Technology Llc Nouveau procede de production de plantes transgeniques
WO2008028121A1 (fr) * 2006-08-31 2008-03-06 Monsanto Technology Llc Transformation de plantes sans sélection
WO2008091154A1 (fr) 2007-01-26 2008-07-31 Coöperatie Avebe U.A. Utilisation de gènes régulateurs comme marqueurs de sélection dans la transformation d'une plante et utilisation de gènes cis dans la transformation de plantes
US8507758B2 (en) 2003-03-07 2013-08-13 Seminis Vegetable Seeds, Inc. Markerless transformation

Cited By (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7094952B1 (en) 1998-10-09 2006-08-22 Biogemma Method for obtaining transgenic plants expressing a protein with activity producing hydrogen peroxide by transformation by agrobacterium rhizogenes
WO2000022148A1 (fr) * 1998-10-09 2000-04-20 Biogemma PROCEDE D'OBTENTION DE PLANTES TRANSGENIQUES EXPRIMANT UNE PROTEINE A ACTIVITE PRODUCTRICE DE PEROXYDE D'HYDROGENE PAR TRANSFORMATION PAR $i(AGROBACTERIUM RHIZOGENES)
FR2784393A1 (fr) * 1998-10-09 2000-04-14 Biogemma Fr Procede d'obtention de plantes transgeniques exprimant une proteine a activite productrice de peroxyde d'hydrogene par transformation par agrobacterium rhizogenes
DE10015458A1 (de) * 2000-03-29 2001-10-11 Inst Pflanzengenetik & Kultur Verfahren zur raschen Herstellung von transgenen, markergen-freien Pflanzen
WO2002037951A1 (fr) * 2000-11-10 2002-05-16 Sugar Research & Development Corporation Transformation de plante a monocotyledones
US9353377B2 (en) 2001-07-19 2016-05-31 Monsanto Technology Llc Method for the production of transgenic plants
WO2003007698A3 (fr) * 2001-07-19 2004-04-08 Monsanto Technology Llc Nouveau procede de production de plantes transgeniques
WO2003007698A2 (fr) * 2001-07-19 2003-01-30 Monsanto Technology Llc Nouveau procede de production de plantes transgeniques
US10253322B2 (en) 2001-07-19 2019-04-09 Monsanto Technology Llc Method for the production of transgenic plants
US8212109B2 (en) 2001-07-19 2012-07-03 Monsanto Technology Llc Method for the production of transgenic plants
WO2003010319A2 (fr) * 2001-07-27 2003-02-06 Coöperatieve Verkoop- En Productievereniging Van Aardappelmeel En Derivaten Avebe B.A. Procede de transformation permettant d'obtenir des plantes sans marqueur et plantes ainsi obtenues
WO2003010319A3 (fr) * 2001-07-27 2003-10-30 Avebe Coop Verkoop Prod Procede de transformation permettant d'obtenir des plantes sans marqueur et plantes ainsi obtenues
AU2002318072B2 (en) * 2001-07-27 2007-09-06 Cooperatie Avebe U.A. Transformation method for obtaining marker-free plants and plants obtained therewith
EP2366788A1 (fr) 2001-07-27 2011-09-21 Coöperatie Avebe U.A. Procédé de transformation pour l'obtention de plants dépourvus de marqueurs
EP1279737A1 (fr) * 2001-07-27 2003-01-29 Coöperatieve Verkoop- en Productievereniging, van Aardappelmeel en Derivaten AVEBE B.A. Methode de transformation pour la génération des plants sans marqueurs selectionable
US8507758B2 (en) 2003-03-07 2013-08-13 Seminis Vegetable Seeds, Inc. Markerless transformation
AU2007289111B2 (en) * 2006-08-31 2013-03-28 Monsanto Technology Llc Plant transformation without selection
US8962326B2 (en) 2006-08-31 2015-02-24 Monsanto Technology Llc Methods for producing transgenic plants
US8124411B2 (en) 2006-08-31 2012-02-28 Monsanto Technology Llc Methods for producing transgenic plants
EP2390337A1 (fr) * 2006-08-31 2011-11-30 Monsanto Technology LLC Transformation de plantes sans sélection
US8513016B2 (en) 2006-08-31 2013-08-20 Monsanto Technology Llc Methods for producing transgenic plants
US8581035B2 (en) 2006-08-31 2013-11-12 Monsanto Technology Llc Plant transformation without selection
US8847009B2 (en) 2006-08-31 2014-09-30 Monsanto Technology Llc Plant transformation without selection
US8853488B2 (en) 2006-08-31 2014-10-07 Monsanto Technology Llc Methods for rapidly transforming monocots
CN101528932B (zh) * 2006-08-31 2014-12-10 孟山都技术有限公司 植物无选择转化
US8395020B2 (en) 2006-08-31 2013-03-12 Monsanto Technology Llc Methods for rapidly transforming monocots
US11718855B2 (en) 2006-08-31 2023-08-08 Monsanto Technology, Llc Methods for producing transgenic plants
US9617552B2 (en) 2006-08-31 2017-04-11 Monsanto Technology Llc Plant transformation without selection
US9783813B2 (en) 2006-08-31 2017-10-10 Monsanto Technology Llc Methods for rapidly transforming monocots
EP3269818A1 (fr) * 2006-08-31 2018-01-17 Monsanto Technology LLC Transformation de plantes sans sélection
US10006036B2 (en) 2006-08-31 2018-06-26 Monsanto Technology Llc Methods for producing transgenic plants
US10233455B2 (en) 2006-08-31 2019-03-19 Monsanto Technology Llc Plant transformation without selection
WO2008028121A1 (fr) * 2006-08-31 2008-03-06 Monsanto Technology Llc Transformation de plantes sans sélection
US10941407B2 (en) 2006-08-31 2021-03-09 Monsanto Technology Llc Plant transformation without selection
US11091766B2 (en) 2006-08-31 2021-08-17 Monsanto Technology Llc Methods for producing transgenic plants
WO2008091154A1 (fr) 2007-01-26 2008-07-31 Coöperatie Avebe U.A. Utilisation de gènes régulateurs comme marqueurs de sélection dans la transformation d'une plante et utilisation de gènes cis dans la transformation de plantes

Also Published As

Publication number Publication date
AU7479298A (en) 1998-12-08

Similar Documents

Publication Publication Date Title
US6037522A (en) Agrobacterium-mediated transformation of monocots
Rohini et al. Transformation of peanut (Arachis hypogaea L.): a non-tissue culture based approach for generating transgenic plants
Rao et al. Agrobacterium-mediated Transformation of Sunflower (Helianthus annuusL.): A Simple Protocol
JP5329412B2 (ja) 選択を含まない植物形質転換
Atif et al. Gene transfer in legumes
Anuradha et al. Genetic transformation of peanut (Arachis hypogaea L.) using cotyledonary node as explant and a promoterless gus:: npt II fusion gene based vector
US20080229447A1 (en) Transformation of immature soybean seeds through organogenesis
JP2003527080A (ja) 除草剤耐性植物
JP2002533090A (ja) 植物形質転換法
Arrillaga et al. Expression of the yeast HAL2 gene in tomato increases the in vitro salt tolerance of transgenic progenies
WO2012138629A2 (fr) Transformation à médiation par agrobactrium de plantes dicotylédones
Aida et al. Efficient transgene expression in chrysanthemum, Dendranthema grandiflorum (Ramat.) Kitamura, by using the promoter of a gene for chrysanthemum chlorophyll-a/b-binding protein
WO1994008036A1 (fr) Procede de modulation de niveaux de lignification
WO2000012735A9 (fr) Dosage transgenique utilisant la transformation de la bacterie stable agrobacterium rhizogenes
WO2000037060A2 (fr) Plantes transgeniques et procedes de production de ces plantes
US20050172361A1 (en) Regulation of gene expression in plant cells
WO1998051806A2 (fr) Recuperation de vegetaux transformes sans marqueurs selectionnables par culture nodale et enrichissement des secteurs transgeniques
Scelonge et al. Transgenic Sclerotinia resistance in sunflower (Helianthus annuus L.)
CN112430684B (zh) 一种用于检测水稻植物h23的核酸序列及其检测方法
WO2007028979A1 (fr) Transformation de plantes
Kazan et al. Agrobacterium tumefaciens-mediated transformation of double haploid canola (Brassica napus) lines
US20020157130A1 (en) Trait-associated gene identification method
US7659447B2 (en) Increasing host plant susceptibility to agrobacterium infection by overexpression of the arabidopsis VIP1 gene
US6617494B2 (en) Methods for identifying transgenic plants using morphological markers
Kudo et al. TRANSFORMATION OF CHRYSANTHEMUM (DENDRANTHEMA GRANDI-FLORUM (RAMAT.) KITAMURA) VIA AGROBACTERIUM TUMEFACIENS

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM GW HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase in:

Ref country code: CA