WO1998040508A1 - Adenoviral vectors with modified tropism - Google Patents

Adenoviral vectors with modified tropism Download PDF

Info

Publication number
WO1998040508A1
WO1998040508A1 PCT/US1998/004964 US9804964W WO9840508A1 WO 1998040508 A1 WO1998040508 A1 WO 1998040508A1 US 9804964 W US9804964 W US 9804964W WO 9840508 A1 WO9840508 A1 WO 9840508A1
Authority
WO
WIPO (PCT)
Prior art keywords
fgf
receptor
vector
cells
fgf2
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1998/004964
Other languages
English (en)
French (fr)
Inventor
Barbara A. Sosnowski
Andrew Baird
Glenn F. Pierce
David T. Curiel
Joanne T. Douglas
Buck E. Rogers
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
UAB Research Foundation
Selective Genetics Inc
Original Assignee
UAB Research Foundation
Selective Genetics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by UAB Research Foundation, Selective Genetics Inc filed Critical UAB Research Foundation
Priority to EP98910375A priority Critical patent/EP0973926A1/en
Priority to CA002283461A priority patent/CA2283461A1/en
Priority to AU64629/98A priority patent/AU742365B2/en
Priority to JP53984898A priority patent/JP2001515493A/ja
Publication of WO1998040508A1 publication Critical patent/WO1998040508A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • C07K14/50Fibroblast growth factor [FGF]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/081DNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/74Inducing cell proliferation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341Use of virus, viral particle or viral elements as a vector
    • C12N2710/10345Special targeting system for viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00Vectors comprising a targeting moiety
    • C12N2810/50Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/80Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates
    • C12N2810/85Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian
    • C12N2810/851Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian from growth factors; from growth regulators
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00Vectors comprising a targeting moiety
    • C12N2810/50Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/80Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates
    • C12N2810/85Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian
    • C12N2810/859Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian from immunoglobulins

Definitions

  • the present invention relates to gene therapy.
  • therapeutic agents and methods useful in targeting and delivering genes more efficiently to particular cells are disclosed, wherein re-targeted, tropism-modified viral vectors presenting ligand on the surface and including a nucleotide sequence encoding a therapeutic gene product are used to facilitate targeting and delivery.
  • adenovirus a human DNA virus which readily infects various cell types (Horwitz, Adenoviridae and their replication, in Virology, Fields and Knipe, eds., Raven Press, NY (1990) pp. 1679-1740). Since adenovirus efficiently disrupts the membranes of endocytic vesicles, co-internalization of the virus with the DNA conjugate allows rapid transfer of the conjugate into the cell cytoplasm before it can be subjected to lysosomal degradation.
  • CFTR cystic fibrosis transmembrane conductance regulator
  • adenoviruses make very attractive for gene delivery applications.
  • Knowledge of the adenovirus genetic system is fairly extensive, including the viral life cycle, DNA replication, transcription and RNA processing, and regulation of virus gene expression.
  • the size of the adenovirus (Ad) genome allows relatively easy manipulation of the viral DNA while still having the capacity for insertion of most cDNAs into the viral genome. Additional advantages of adenovirus vectors include their ability to infect both dividing and nondividing cells efficiently, to induce high-level foreign protein expression without replication or integration of the viral genome, and to grow to high yields when propagated in an appropriate complementing cell line.
  • a target tissue lacks sufficient levels of adenovirus attachment receptors to mediate viral adsorption, however, this may also be a barrier to efficient gene transfer. Infection by most viruses requires viral attachment to its host cell receptor. Adenovirus attaches to its host cell receptor via its fiber protein (see, e.g. , Wickham et al., Cell 75:309-319 (1993)).
  • the Ad fiber protein is a long, trimeric protein that protrudes from the surface of the virion. At the distal end of the fiber protein is a knob-like C-terminus that interacts with an unidentified cellular receptor present on HeLa and other epithelial- derived carcinoma cell lines (see, e.g., Defer et al., J. Virol. 64:3661-3613 (1990)).
  • the receptor generally identified as FibR, is assumed to be expressed by cells that are the normal targets for adenovirus infection.
  • adenoviral vectors possess the capacity for in vivo gene transfer that are critical to effective gene therapy. Following administration of the adenovirus vector, three distinct, sequential steps are required for expression of the therapeutic gene in target cells: (1) attachment of the adenovirus vector to specific receptors on the surface of the target cell; (2) internalization of the virus; and (3) transfer of the gene to the nucleus where it can be expressed.
  • any attempt to modify the tropism of an adenovirus vector that is, its native ability to target its cognate receptor must reserve its ability to perform these three functions efficiently.
  • investigators have met with greater or lesser success in this regard. For example, the methodology proposed by Krasnykh et al. (J. Virol.
  • Ad vectors that rely upon Ad receptors for targeting are not able to target as wide a variety of cells as one might wish, and depending on the nature of the chimeric fiber, any alterations in its conformation may have a negative impact on targeting and/or delivery.
  • the modifications described in the aforementioned articles do not alter viral tropism in a manner that enhances viral targeting or increases trafficking to the nucleus, contrary to what is disclosed herein.
  • the art fails to disclose targeting and delivery constructs and systems that achieve the unexpectedly high level of "infectivity" and expression shown herein.
  • the constructs and methods of the present invention successfully achieved delivery of therapeutic agents to cells that are normally resistant to viral-mediated delivery.
  • the design and construction of the within-disclosed vectors and conjugates provides a novel and elegant solution, as described further herein.
  • the use of the recombinant sequences and vectors of this invention to mediate the transfer of foreign genes into recipient cells both in vitro and in vivo overcomes the limitations of the above-described gene transfer systems.
  • This invention utilizes recombinant constructs which confer the advantages of targeting via the fibroblast growth factor receptor upon adenovirus ⁇ in place of the adenovirus usual targeting via fiber protein — and thus represents an improved method for gene therapy as well as for therapeutic applications involving delivery of a gene.
  • adenoviral vectors having their native tropism modified or ablated which are then re-targeted via a targeting Iigand, are disclosed herein as advantageous for a variety of gene therapy applications.
  • the Ad-derived vectors of the present invention possesses all of the functional properties required for gene therapy including binding to specific cell receptors and penetration of endocytic vesicles.
  • the present invention provides a tropism- modified adenoviral vector system that specifically targets cells expressing a preselected receptor, comprising an antibody or fragment thereof that binds an adenoviral capsid protein; a targeting Iigand that binds the preselected receptor; and an adenovirus containing a nucleic acid molecule that encodes a therapeutic gene product under the control of a promoter; wherein the Iigand is conjugated to the antibody or fragment thereof and wherein the antibody or fragment thereof is bound to the adenovirus.
  • the Iigand is conjugated to the antibody or fragment thereof as a fusion, e.g., a fusion-sF v .
  • the promoter is a tissue-specific promoter.
  • a tropism-modified adenoviral vector wherein the targeting Iigand is a polypeptide reactive with an FGF receptor.
  • the polypeptide reactive with an FGF receptor is an antibody or fragment thereof.
  • the antibody is a single-chain antibody.
  • the antibody is 1 1 A8.
  • the polypeptide reactive with an FGF receptor is selected from the group consisting of FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9, FGF-1 1, FGF-13, FGF-14, FGF-15, and molecules having 20% or greater homology to any of the foregoing.
  • the polypeptide reactive with an FGF receptor is FGF-2.
  • the targeting Iigand is selected from the group consisting of a polypeptide reactive with a VEGF receptor, a polypeptide reactive with a PDGF receptor, and a polypeptide reactive with an EGF receptor.
  • the surface-presented Iigand is a polypeptide reactive with a cell-surface receptor; growth factor receptors are one class of receptors contemplated within the scope of the present invention.
  • Another class of receptors contemplated within the scope of the invention includes receptors for Her- 2/neu or erbB2.
  • a polypeptide reactive with a cell-surface receptor according to the present invention includes antibodies or fragments thereof, including single-chain antibodies, which react with receptors for Her-2/neu or erbB2.
  • the present invention also discloses embodiments wherein the native tropism of the viral vector is modified; in still other embodiments, the native tropism of the viral vector is ablated.
  • the vector is an adenoviral vector.
  • the adenoviral vector is readily selected from any of the adenovirus serotypes, as well.
  • a tropism-modified vector is disclosed wherein the therapeutic gene product is a cytocide or a prodrug.
  • the cytocide is a ribosome inactivating protein.
  • the gene product is thymidine kinase, cytosine deaminase, or nitroreductase.
  • the therapeutic gene product enhances cellular proliferation.
  • the therapeutic gene product is a biologically active protein or polypeptide that augments or complements an endogenous protein.
  • the therapeutic gene product enhances cellular differentiation.
  • the therapeutic gene product is a molecule which enhances tissue repair or regeneration.
  • the therapeutic gene product is a molecule which stimulates a protective immune response.
  • a pharmaceutical composition of the present invention comprises a physiologically acceptable buffer and a tropism-modified adenoviral vector presenting a Iigand on its surface, wherein the vector includes a nucleic acid molecule encoding a therapeutic gene product under the control of a promoter.
  • the Iigand is a polypeptide reactive with an FGF receptor.
  • the polypeptide reactive with an FGF receptor is selected from the group consisting of FGF-1 , FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9, FGF-1 1, FGF-13, FGF-14, and FGF-15.
  • the polypeptide reactive with an FGF receptor is FGF-2.
  • the polypeptide reactive with an FGF receptor is an antibody or fragment thereof.
  • the antibody is a single-chain antibody. In another variation, the antibody is 1 1 A8.
  • the surface-presented Iigand is a polypeptide reactive with a cell-surface receptor; growth factor receptors are one class of receptors contemplated within the scope of the present invention. Another class of receptors contemplated within the scope of the invention includes receptors for Her- 2/neu or erbB2.
  • a polypeptide reactive with a cell-surface receptor according to the present invention includes antibodies or fragments thereof, including single-chain antibodies, which react with receptors for Her-2/neu or erbB2.
  • the Iigand is genetically fused with an adenoviral capsid protein.
  • the Iigand is chemically conjugated to an adenoviral capsid protein.
  • the Iigand is conjugated to an antibody or fragment thereof that binds a viral capsid protein.
  • the Iigand is conjugated to the antibody or fragment thereof as a fusion, e.g., a fusion-sc-F v .
  • the therapeutic gene product is selected from the group consisting of protein, ribozyme and antisense.
  • the therapeutic gene product is " a cytocide.
  • Exemplary cytocides include ribosome-inactivating proteins.
  • the therapeutic gene product is a prodrug.
  • Exemplary prodrugs include thymidine kinase, cytosine deaminase, or nitroreductase.
  • Other embodiments disclose a wide variety of therapeutic gene products, including products that replace or repair defective, improperly regulated, or nonfunctional genes.
  • therapeutic gene products within the context of the present invention stimulate wound healing, tissue repair, connective tissue growth, angiogenesis, or the amelioration of ischemia, to name a few examples.
  • therapeutic gene products treat, interfere with or block a disease process, such as hyperproliferation of cells, tumor growth, metastasis, and the like.
  • the present invention also discloses a variety of treatment methods.
  • the invention contemplates a method of treating tumors, comprising administering a pharmaceutical composition comprising a physiologically acceptable buffer and a tropism-modified adenoviral vector presenting a Iigand on its surface, wherein the vector includes a nucleotide sequence encoding a therapeutic gene product under the control of a promoter, wherein the therapeutic gene product is selected from the group consisting of E-cadherin, BGP, Rb, p53, CDKN2/P16/MTS1, PTEN/MMAC1, APC, p33INGl, Smad4, maspin, VHL, WT1, Menl , NF2, MXI1, and FHIT.
  • the invention also provides methods of treating ischemia, comprising administering a pharmaceutical composition comprising a physiologically acceptable buffer and a tropism-modified adenoviral vector presenting a Iigand on its surface, wherein the vector includes a nucleotide sequence encoding a therapeutic gene product under the control of a promoter, wherein the therapeutic gene product is selected from the group consisting of IGF, TGF ⁇ l, TGF ⁇ 2, TGF ⁇ 3, HGF, VEGF 121, VEGF 165, FGF1, FGF2, FGF4, FGF5, PDGF-A, and PDGF-B.
  • the invention provides methods of treating connective tissue injury, comprising administering a pharmaceutical composition comprising a physiologically acceptable buffer and a tropism-modified adenoviral vector presenting a Iigand on its surface, wherein the vector includes a nucleotide sequence encoding a therapeutic gene product under the control of a promoter, wherein the therapeutic gene product is selected from the group consisting of PTH, BMP1, BMP2, BMP3, BMP4, BMP5, BMP6, BMP7, BMP8, BMP10, BMP1 1, mammalian BMP, and Xenopus BMP.
  • An alternative method comprises the administration of a pharmaceutical composition comprising a physiologically acceptable buffer and a tropism-modified adenoviral vector presenting a Iigand on its surface, wherein the vector includes a nucleotide sequence encoding a therapeutic gene product under the control of a promoter, wherein the therapeutic gene product is selected from the group consisting of Bovine VEGF, VEGF, VEGF-B, VEGF-C, Angiopoietin-1, Angiogenin, IGF-1 , IGF-II, HGF, PDGF A, PDGF B, TGFB1, TGFB2, and TGFB3.
  • the present invention also discloses various methods of treating malignancies, including cancer.
  • a method of treating cancer comprising contacting the cancer cells with a pharmaceutical composition comprising a physiologically acceptable buffer and a tropism-modified adenoviral vector presenting a Iigand on its surface, wherein the vector includes a nucleotide sequence encoding a therapeutic gene product under the control of a promoter, wherein the therapeutic gene product is selected from the group consisting of HSVTK, VZVTK, nitroreductase, and cytosine deaminase; and contacting the cancer cells with a substrate.
  • the substrate is a molecule that is acted upon to produce a molecule that is cytotoxic or cytostatic to the cancer cells.
  • the Iigand is a polypeptide reactive with a specific cellular receptor; various polypeptides useful in this regard are recited hereinabove.
  • the receptor is an FGF receptor.
  • the polypeptide reactive with an FGF receptor is FGF-2.
  • the polypeptide reactive with an FGF receptor is selected from the group consisting of FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9, FGF-11, FGF-13, FGF-14, and FGF-15.
  • the Iigand is an antibody or a fragment thereof.
  • the antibody is a single-chain antibody.
  • the Iigand is conjugated to an antibody or fragment thereof that binds a viral capsid protein.
  • the viral capsid protein is adenovirus fiber protein - for example, an adenovirus knob protein.
  • the Iigand may be chemically conjugated to a protein on the surface of a viral vector or may be attached to the capsid as a component of a fusion protein.
  • the therapeutic gene product is selected from the group consisting of protein, ribozyme and antisense.
  • the therapeutic gene product is a cytocide.
  • Exemplary cytocides include ribosome-inactivating proteins.
  • the therapeutic gene product is a prodrug.
  • Exemplary prodrugs include thymidine kinase, nitroreductase, and cytosine deaminase.
  • Other embodiments disclose a wide variety of therapeutic gene products, including products that replace or repair defective, improperly regulated, or nonfunctional genes.
  • therapeutic gene products within the context of the present invention stimulate wound healing, tissue repair, connective tissue growth, angiogenesis, or the amelioration of ischemia, to name a few examples.
  • therapeutic gene products treat, interfere with or block a disease process, such as hyperproliferation of cells, tumor growth, metastasis, and the like.
  • Figure 1 shows a comparison of AdCMV-Luc transduction for four KS cell lines.
  • KS cells were incubated with recombinant adenovirus expressing luciferase in the absence or presence of a Fab fragment blocking adenoviral knob-mediated infection.
  • RLU Relative light units
  • FIG. 1 shows the enhanced AdCMV-Luc infectivity of KS cell lines by Fab-FGF2 conjugate. The enhanced infectivity of the Ad-conjugate complex was assessed in the presence and absence of anti-FGF2 antisera.
  • Relative light units (RLU) are plotted on the vertical axis, while the relevant KS cell lines ⁇ KSY-1, RW376, KS- SLK, and CVU-1 — are indicated on the horizontal axis.
  • the closed bars represent AdCMV-Luc; stippled bars represent AdCMV-Luc + Fab-FGF2; and the open (colorless) bars represent AdCMV-Luc + Fab-FGF2 + anti-FGF2 antisera.
  • Figure 3 illustrates enhanced AdCMVHSVtk/GCV cell killing in KSY-1 and KS-SLK cells by Fab-FGF2 conjugate.
  • the effect of GCV on AdCMVHStk- transfected cells was assessed in the presence or absence of the conjugate and expressed as a percentage of cells surviving compared to the cell not exposed to GCV (i.e., -GCV).
  • Viable cells in duplicate wells were counted, in triplicate, after trypan blue exclusion. On the vertical axis, the % of cells surviving is shown, in both Figs. 3A and 3B. In Fig.
  • KSY-1 cells transfected with AdCMVHSVtk or AdCMVHSVtk + Fab-FGF2 are identified on the horizontal axis.
  • KS-SLK cells transfected with AdCMVHSVtk or AdCMVHSVtk + Fab-FGF2 are identified on the horizontal axis.
  • Figure 4 illustrates a schema for the synthesis and purification of the Fab- FGF2 conjugate. It should be expressly understood that this schema may be applied to the synthesis and purification of any Fab-ligand conjugate and is thus not limited to the one illustrated.
  • Figure 5 shows the results of SDS-PAGE of Fab-FGF2 under non- reducing conditions. Equal amounts (2 ug) of FGF2 (lane 2), Fab (lane 3), or Fab-FGF2 (lane 4) were applied to the gel and compared to the molecular weight standards (lane 1 , in thousands) by staining with Coomassie blue.
  • Figure 5B Western blot analysis of Fab-FGF2 conjugate is shown. The protein was transferred to a nitrocellulose membrane, probed with an anti-FGF2 rabbit polyclonal antibody and then with 1 5 I- Protein A and visualized by autoradiography. A band was observed for FGF2 (lane 5) and for the Fab-FGF2 conjugate (lane 7), but not for Fab antibody alone (lane 6).
  • FIG. 6 shows functional validation of the Fab-FGF2 conjugate.
  • Fig. 6A stimulation of endothelial cell proliferation by FGF2 and the Fab-FGF2 conjugate is shown.
  • Bovine aortic endothelial cells were treated with various concentrations of FGF2 or Fab-FGF2 (30 pg/mL to 6 ng/mL) and the cell number determined.
  • Cell count (x 1000) is plotted on the vertical axis, while pg/mL are plotted on the horizontal axis. Open circles represent FGF2, while closed circles represent Fab- FGF2.
  • Fab-FGF2 binding to Ad5 knob in an ELISA is illustrated.
  • Recombinant Ad5 knob was probed with either Fab-FGF2, a blank control, or FGF2.
  • Fab-FGF2 was added to plates that did not contain Ad5 knob. Absorbance is plotted on the vertical axis, while the following are shown on the horizontal axis of the bar graph, proceeding from left to right: No knob + Fab-FGF2; Knob + Fab-FGF2; Knob alone; and Knob + FGF2.
  • Figure 7 illustrates the results of in vitro infection of a panel of cell lines using the Fab-FGF2 conjugate.
  • Fig. 7A inhibition of luciferase expression by the Fab is shown.
  • the four cell lines were infected with either the AdCMVLuc or the AdCMVLuc premixed with the Fab as described in the text.
  • the data are expressed as a percentage of the luciferase expression when AdCMVLuc alone was used for each cell line. Percentage is plotted on the vertical axis; cell lines 3T3, PANC-1, SKOV3.ipl, and D54 MG are illustrated along the horizontal axis. Open bars represent AdCMVLuc, while closed bars represent AdCMVLuc + Fab.
  • Fig. 7A inhibition of luciferase expression by the Fab is shown.
  • the four cell lines were infected with either the AdCMVLuc or the AdCMVLuc premixed with the Fab as described in the text.
  • the data are expressed as a
  • luciferase expression in the four cell lines when infected with either AdCMVLuc or the AdCMVLuc-Fab-FGF2 conjugate is shown.
  • the bars illustrate the luciferase expression in relative light units (RLU) per microgram of protein and represent triplicate measurements + standard deviation.
  • RLU/ug of protein is plotted on the vertical axis.
  • cell lines 3T3, PANC-1, SKOV3.ipl, and D54 MG are illustrated. Closed bars represent AdCMVLuc, while cross-hatched bars represent AdCMVLuc + Fab-FGF2.
  • Fig. 7C inhibition of luciferase expression by the anti-FGF2 antibody is shown.
  • the four cell lines were infected with either AdCMVLuc premixed with the Fab-FGF2 conjugate or AdCMVLuc premixed with the Fab-FGF2 conjugate and the anti-FGF2 antibody as described above.
  • the data are expressed as a percentage of the luciferase expression seen when the ADCMVLuc-Fab-FGF2 complex was used for each cell line. Percentages are plotted on the vertical axis; cell lines 3T3, PANC-1, SKOV3.ipl , and D54 MG are illustrated along the horizontal axis. Lightly shaded bars represent AdCMVLuc + Fab-FGF2, while the dark, closed bars represent AdCMVLuc + Fab-FGF2 + anti-FGF2 Ab.
  • Figures 8A-C illustrate the expression of ⁇ -galactosidase in the liver of mice after treatment with Ad ⁇ gal or FGF2-Ad ⁇ gal.
  • Fig. A no Xgal stained cells in the liver of C57B1/6 mice treated with excipient are seen.
  • Fig. 8B numerous Xgal stained hepatocytes are present in the liver of C57B1/6 mice treated with Ad ⁇ gal at a dosage of 2x10 10 pfu per mouse, i.v.
  • Fig. 8C treatment with FGF2-Ad ⁇ gal at 2 xlO 10 pfu per mouse, i.v. transduces very few hepatocytes.
  • Figure 9 shows the serum transaminase and alkaline phosphatase levels in mice treated with Ad ⁇ gal or FGF2-Ad ⁇ gal.
  • Serum transaminases AST, ALT
  • alkaline phosphatase were measured on day 7 in C57B1/6 mice after treatment with either excipient; Ad ⁇ gal, 2xl0el0 pfu, i.v.; or FGF2-Ad ⁇ gal, 2xl0el0 pfu, i.v.
  • FIGS 10A and 10B illustrate the histopathology of the liver of mice after treatment with Ad ⁇ gal or FGF2-Ad ⁇ gal.
  • very little inflammatory infiltrate is observed.
  • FIG 11 shows a survival analysis of tumor bearing mice treated with either Adtk or FGF2-Adtk.
  • B 16 melanoma cells were treated ex vivo for one hour with either Adtk or FGF2-Adtk and then implanted intraperitoneally into BDFl mice at 2x10e6 cells per mouse. Mice were then treated with either ganciclovir (GCV) or H 2 0 (as a control) for 14 days, i.p. Survival of tumor bearing mice treated with FGF2-Adtk and then administered ganciclovir was prolonged; such mice have a statistically prolonged survival compared to all other groups (p ⁇ .001).
  • Figure 12 illustrates the enhancement of Ad-mediated gene delivery by the Fab-FGF2 conjugate.
  • AdCMVLuc (5 x 10 7 pfu) as preincubated with the optimal dose of the Fab fragment (1.44 ⁇ g) or Fab-FGF2 conjugate (1.94 ⁇ g) in 20 ⁇ L HBS for 30 min at room temperature.
  • the vector or vector complexes were then diluted in DMEM/F-12 + 2% FCS and 24.000 SKOV3.ipl cells in 24-well plates were infected at an MOI of 50 pfu/cell.
  • Inhibition experiments were performed by adding a polyclonal anti-FGF2 antibody (Sigma, St. Louis, MO) to the Ad CMVLuc-Fab-FGF2 complex prior to infection.
  • Cell lysates were assayed for luciferase activity 24 hours post- infection.
  • the protein concentration of the lysates was determined to permit normalization of the data, which are expressed as relative light units (RLU) per microgram of cellular protein. Results are the mean ⁇ SD of triplicate experiments.
  • FIG. 13 illustrates the results of FGF2-enhancement of Ad-mediated expression of the HSV-TK gene, which augments therapeutic benefit in a survival experiment.
  • a total of 95 female SCID mice aged 6-8weeks were inoculated intraperitoneally with 2 x 107 SKOV3.ipl cells on day 0.
  • Figure 14 illustrates antibody responses at day 21 following a single injection of excipient, adenovirus or FGF-Fab:Ad conjugate.
  • Optical density (O.D.) x 10 3 is plotted on the vertical axis, while data points corresponding to single injections of excipient, Ad, or FGF-Fab:Ad conjugate are identified on the horizontal axis.
  • Open squares, circles and diamonds correspond to anti-adenovirus protein responses, while closed squares, circles and diamonds correspond to anti-knob protein responses.
  • FIG. 15 A shows that FGF2 retargeting of adenoviral infection results in increased transgene expression.
  • HUVECs ' were infected with AdCMVLuc alone, AdCMVLuc + Fab, or AdCMVLuc + Fab-FGF2, and luciferase expression was measured 24 hours later.
  • a representative graph of 3 separate experiments is shown. Data is mean +/- SD. * p ⁇ .001 vs. Ad alone.
  • Fig. 15B shows the blocking of FGF2 retargeting. HUVECs were infected with AdCMVLuc + Fab-FGF2 alone or blocked with an anti-FGF antibody, heparin or excess free FGF. * p ⁇ 0.001 vs. Ad + Fab-FGF2.
  • FIG. 15C shows that enhanced gene expression is seen with FGF2.
  • Fig. 15D illustrates the results of a tritiated binding assay. Tritiated AdCMVLuc alone or following incubation with Fab, Fab-FGF2 or Fab- FGF2+antiFGF antibody was bound to cells at 4 degrees for 1 hr. Following washing, residual bound radioactivity (counts per minute, cpm) was measured in a scintillation counter. * p ⁇ 0.001 vs. Ad alone, ** p ⁇ 0.001 vs. Ad + Fab-FGF2.
  • FIGS 16A-B illustrate that Fab-FGF2 retargeting enhances gene expression in HCAECs and HASMCs.
  • HCAECs (Fig. 16A) and HASMCs (Fig. 16B) were infected with AdCMVLuc alone, AdCMVLuc + Fab, or AdCMVLuc + Fab-FGF2, and luciferase expression was measured 24 hours later.
  • a representative graph of three experiments is shown. Data is mean +/- SD. * p ⁇ .001
  • Figure 17 describes the determination of the enhancing effect of FGF2 retargeting at different viral doses.
  • HUVECs were infected with AdCMVLuc at a dose of 10, 50 or 100 pfu/cell with or without Fab-FGF2 retargeting. Luciferase assay was performed 24 hours later. Results are mean +/- SD.
  • FIGS 18A-18G show the flow cytometry analysis of ⁇ -galactosidase transduction.
  • Figure 19 illustrates the reduction of FGF2 enhancement of gene delivery in quiescent cells.
  • Figure 20 illustrates the successful retargeting of an Ad vector linked to a marker (Ad ⁇ gal) using either FGF2 or 11A8-Fab and the successful delivery of the marker sequence in HCT116 cells. From left to right, the shaded bars represent Ad ⁇ gal; Fab; FGF2Fab, 30x; FGF2Fab, 3x; HA8Fab, 30x; and HA8Fab, 3x. Molar excess of Ligand-Fab:Knob Monomer is indicated in the latter four categories. On the vertical axis, mU ⁇ gal/mg protein is indicated.
  • FGF retargeted vectors enhances potency; FGF -retargeted vectors deliver and promote the expression of a therapeutic gene to more target cells and in each cell so targeted.
  • the vectors of the present invention are significantly less toxic to the liver and are less immunogenic than are other Ad vectors.
  • retargeting the viral vector retargeted with FGF induces cytotoxicity to specific cell types when therapeutic gene sequences (e.g. cytotoxic sequences, such as HSV-tk) are delivered; FGF retargeted vectors are thus able to transduce cells which are normally insensitive to Ad infection.
  • therapeutic gene sequences e.g. cytotoxic sequences, such as HSV-tk
  • the FGF-retargeted vectors and related compositions and methods of the present invention are unexpectedly and significantly superior to other gene therapy vectors, particularly viral vectors.
  • Ad vectors have been described herein as exemplary, it should be appreciated that other viral and non-viral vectors may benefit from the retargeting strategies disclosed herein. Therefore, the present invention makes it feasible to engineer and produce novel constructs and vectors that are able to package and deliver effective amounts of therapeutic agents or nucleic acid sequences encoding same for efficacious use in a variety of therapeutic applications, without endangering the subject to whom they are administered.
  • amino acids which occur in the various amino acid sequences appearing herein, are identified according to their well known three letter or one letter abbreviations.
  • nucleotides which occur in the various DNA fragments, are designated with the standard single letter designations used routinely in the art.
  • to "bind to a receptor” refers to the ability of a Iigand to specifically recognize and detectably bind to a receptor, as assayed by standard, e.g., in vitro, assays.
  • a "conjugate” refers two or more molecules that are linked together.
  • the molecules may be conjugated directly or through a linker, such as a peptide, or they may be held together via ionic or other intermolecular forces.
  • a conjugate may be produced by chemical coupling methods or by recombinant expression of chimeric DNA molecules to produce fusion proteins.
  • a "cytocide-encoding agent” is a nucleic acid molecule that encodes a product that results in cell death and generally acts by inhibiting protein synthesis.
  • Such a product may act by cleaving rRNA or ribonucleoprotein, inhibiting an elongation factor, cleaving mRNA, or other mechanism that reduces protein synthesis to a level such that the cell cannot survive.
  • the product may be a protein, ribozyme, antisense, and the like.
  • the nucleic acid molecule may contain additional elements besides the cytocide gene. Such elements include a promoter, enhancer, splice site, transcription terminator, poly(A) signal sequence, bacterial or mammalian origin of replication, selection marker, and the like.
  • Heparin-binding growth factor refers to any member of a family of heparin-binding growth factor proteins, in which at least one member of the family binds heparin.
  • Preferred growth factors in this regard include fibroblast growth factor (FGF), vascular endothelial growth factor (VEGF), and heparin binding EGF-like factor (HBEGF).
  • FGF fibroblast growth factor
  • VEGF vascular endothelial growth factor
  • HEGF heparin binding EGF-like factor
  • Such growth factors encompass isoforms, peptide fragments derived from a family member, splice variants, and single or multiple exons, some forms of which may not bind heparin.
  • NABD nucleic acid binding domain
  • An NABD may bind to single or double strands of RNA or DNA or mixed RNA/DNA hybrids.
  • the nucleic acid binding domain may bind to a specific sequence or bind irrespective of the sequence.
  • nucleic acid refers to RNA or DNA that is intended for internalization into a cell and includes, but is not limited to, DNA encoding a therapeutic protein, a cytotoxic protein, a prodrug, a ribozyme, a deoxyribozyme, or antisense, the complement of these NAs, an antisense nucleic acid, and other such molecules.
  • Reference to nucleic acids includes duplex DNA, single-stranded DNA, RNA in any form, including triplex, duplex or single-stranded RNA, anti-sense RNA, polynucleotides, oligonucleotides, single nucleotides, chimeras, and derivatives thereof.
  • Nucleic acids may be composed of the well-known deoxyribonucleotides and ribonucleotides (i.e., the bases adenosine, cytosine, guanine, thymidine, and uridine). As well, various other nucleotide derivatives, non-phosphate backbones or phosphate- derived backbones may be used.
  • PO oligonucleotides normal phosphodiester oligonucleotides
  • oligonucleotides resistant to cleavage such as those in which the phosphate group has been altered to a phosphotriester, methylphosphonate, or phosphorothioate may be used (see U.S. Patent No. 5,218,088).
  • receptor-binding internalized Iigand refers to any peptide, polypeptide, protein or non-protein, such as a peptidomimetic, that is capable of binding to a cell-surface molecule and internalization.
  • the receptor-binding internalized Iigand is conjugated to a nucleic acid binding domain, either as a fusion protein or through chemical conjugation, and is used to deliver a neuronal therapeutic-encoding agent to a cell.
  • the Iigand is directly conjugated to a nucleic acid molecule, which may be further complexed with a nucleic acid binding domain.
  • ligands include growth factors, cytokines, antibodies, hormones, and the like.
  • a "targeted agent” is a chemical agent that is usually a nucleic acid molecule, but that may also be a protein, a carbohydrate, a lipid or any other class of chemical agent that is internally delivered to a cell by a receptor-binding internalized Iigand, and upon internalization alters or affects cellular metabolism, growth, activity, viability or other property or characteristic of the cell.
  • a "therapeutic nucleic acid” describes any nucleic acid molecule used in the context of the invention that effects a treatment, generally by modifying gene transcription or translation. It includes, but is not limited to, the following types of nucleic acids: nucleic acids encoding a protein, antisense RNA, DNA intended to form triplex molecules, protein binding nucleic acids, and small nucleotide molecules.
  • a therapeutic nucleic acid may be used to effect genetic therapy by serving as a replacement for a defective gene, or by encoding a therapeutic product, such as a tumor-suppressing agent, prodrug, proliferation enhancer, or cytocide, to name a few examples.
  • the therapeutic nucleic acid may contain all or a portion of a gene and may function by recombining with DNA already present in a cell, thereby replacing or complementing a defective portion of a gene. It may also encode a portion of a protein and exert its effect by virtue of co-suppression of a gene product.
  • operative linkage or operative association of two nucleotide sequences refers to the functional relationship between such sequences.
  • Nucleotide sequences include, but are not limited to, DNA encoding a product, DNA encoding a signal sequence, promoters, enhancers, transcriptional and translational stop sites, and polyadenylation signals.
  • operative linkage of DNA encoding a therapeutic gene product to a promoter refers to the physical and functional relationship between the DNA and the promoter such that transcription of the DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to, and transcribes the DNA.
  • polypeptide reactive with an FGF receptor refers to any polypeptide that specifically interacts with an FGF receptor (e.g. the high affinity FGF receptor), and is transported into the cell by virtue of its interaction with the FGF receptor.
  • a prodrug is a compound that metabolizes or otherwise converts an inactive, nontoxic compound to a biologically, pharmaceutically, therapeutically, or toxic active form of the compound.
  • a prodrug may also be a pharmaceutically inactive compound that is modified upon administration to yield an active compound through metabolic or other processes.
  • receptor-binding internalized Iigand refers to any peptide, polypeptide, protein or non-protein, such as a peptidomimetic, that is capable of binding to a cell-surface molecule and internalizing.
  • the receptor-binding internalized Iigand may be conjugated to a viral capsid protein, either as a fusion protein or through chemical conjugation, either directly or indirectly (e.g. via a bispecific antibody).
  • the Iigand may be conjugated to the antibody or fragment thereof as a fusion, e.g., a fusion-sF v .
  • Receptor-binding internalized ligands may thus be used to deliver therapeutic product- encoding agents to cells.
  • ligands include growth factors, cytokines, antibodies, hormones, and the like.
  • a "wound site" as used herein is defined as any location in the host that arises from traumatic tissue injury, or alternatively, from tissue damage either induced by, or resulting from, surgical procedures.
  • Viral Vectors With Altered Tropism Viruses - particularly adenoviruses - have not often been considered to be ideal candidates for clinically-useful vectors, as their native tropism causes them to be quite infective, as well as highly immunogenic and toxic.
  • These principal difficulties, as well as others which relate to the virus' native tropism, have been encountered by others of skill in the art - and those difficulties have not been successfully overcome.
  • the native forms of most (if not all) viral and retroviral vectors ⁇ that is, vectors possessing their native tropism - are unable to efficiently target potential host cells. This low targeting efficiency may be due to the failure of cells to express the appropriate receptors or to express sufficient quantities of those receptors. In many instances, failure of the vector to escape the endosome to reach the nucleus is a relevant factor, as well.
  • viral constructs that have their native tropism modified (altered) or ablated (blocked).
  • a further goal comprises modification of the virus in some fashion - e.g., genetically or immunologically - to provide the virus with a new target.
  • preferred viral constructs of the present invention possess the ability to target particular cell types.
  • the term "tropism” refers to the movement or targeting of a viral vector (including viruses and viral particles) toward a receptor. Consistent with the foregoing, if a viral vector is displaying its native tropism, it is targeting its cognate receptor. In the context of adenovirus (Ad), it tends to bind to integrin receptors, which is believed to be required for subsequent internalization of adenovirus into the host cell. Adenoviruses attach to host-cell receptors via the penton fiber glycoprotein and enter cells through the process of receptor-mediated endocytosis mediated by the penton base. Ad apparently utilizes separate proteins for attachment and entry in a manner similar to enveloped human viruses.
  • Ad adenovirus
  • retargeted reprogrammed
  • tropism-modified altered tropism
  • altered tropism particularly as applied to viruses and viral vectors, are often used interchangeably herein and are meant to identify viral vectors whose endogenous (or native) tropism has been ablated or modified.
  • the native tropism of the viral vector is either unchanged, or it is modified, or even ablated; but the viral vector also includes a Iigand which conveys an altered (i.e. non-native) tropism.
  • such a modification may be partial - i.e., the viral vector retains at least a portion of its native tropism - or it may be complete, whereby the native tropism of the viral vector is completely ablated.
  • tropism-modified altered tropism
  • altered tropism e.g., partially modified, or fully ablated
  • retargeted is occasionally used to describe such vectors, it is more appropriately used to describe vectors that " do include a Iigand which confers a new tropism to the vector.
  • Ad adenovirus
  • the present invention further addresses the contexts in which one may wish to re-target an Ad vector without altering its native tropism at all; when one may wish to modify Ad tropism by retargeting it and by diminishing its native tropism; and when one may wish to re-target Ad and completely ablate its native tropism.
  • FGF ligands and related moieties as efficient targeting and delivery agents is disclosed herein.
  • ligands When such ligands are linked in some fashion to a viral vector whose native tropism has been blocked or otherwise ablated, targeting efficiency increases dramatically, as does trafficking of the Iigand (and anything conjugated or otherwise linked thereto) to the nucleus.
  • Iigand and anything conjugated or otherwise linked thereto
  • FGF ligands are associated with a wide variety of diseases and as their cognate receptors are expressed on a variety of cell types, such ligands are ideal for use in the delivery of toxins in vitro and in vivo.
  • FGF ligands when used in conjunction with viral vectors — i.e., to confer a new tropism on such vectors ⁇ they are ideal for use in the delivery of therapeutic nucleotide sequences, as well.
  • a viral vector possesses the ability to efficiently deliver genetic material in vitro and in vivo — and Ad vectors are one such example ⁇ the combination of FGF-related ligands and viral vectors with modified tropism is a powerful combination indeed.
  • Ad- mediated gene transfer using a conjugate including an FGF-related Iigand is greater than the level of gene transfer when Ad alone is used.
  • Other conjugates ⁇ e.g. the Fab-folate conjugate of Douglas, et al. ( Id. , 1996) have not been able to facilitate Ad-mediated gene transfer as efficiently as conjugates including FGF-related ligands. Indeed, many such conjugates (including the Fab-folate conjugate) are not even able to reach the level achieved with Ad alone. Irrespective of the explanation for the remarkable ability of FGF-related ligands to achieve extremely efficient targeting and delivery into specific cells, exploitation of this ability leads to the development of viral vectors with new tropisms and enhanced gene-delivery potential.
  • Virus Adenovirus
  • the pentagonal capsomere (the penton) at the vertex of the adenovirus icosahedron consists of a fiber projection, linked by noncovalent bonds to the penton base, anchored in the capsid.
  • Adenoviruses are nonenveloped, regular icosahedrons (20 triangular surfaces and 12 vertices) that are about 65-80 nm in diameter (about 1400 angstroms (A)).
  • a structure, called fiber, projects from each of the vertices. The length of the fiber varies with the adenovirus serotype.
  • the protein coat or capsid is composed of 252 subunits (capsomeres), of which 240 are hexons and 12 are pentons. Each of the pentons contains a penton base on the surface of the capsid and a fiber projecting from the base, which is surrounded by five hexons. The name penton is derived from these geometric relationships.
  • Ad vectors derived from any of the serotypes presently identified may be modified as disclosed herein.
  • Human adenovirus serotypes from type 1 through 47 are currently available from the American Type Culture Collection (ATCC), Rockville, MD and may thus be able to function effectively as vectors, particularly when modified according to the within- disclosed invention.
  • viral vectors of the present invention may be constructed using any appropriate and useful viral serotype.
  • the invention is thus not limited to a particular serotype or serotypes.
  • Ad2 DNA was the first adenovirus genome to be completely sequenced; its sequence includes a total of 35,937 bp.
  • the sequence of Ad5 DNA was completed more recently; its sequence includes a total of 35,935 bp. Portions of many other adenovirus genomes have also been sequenced.
  • the upper packaging limit for adenovirus virions is about 105% of the wild-type genome length. (See, e.g., Bett et al., J. Virol. 67(10):59l ⁇ -2 ⁇ (1993).) Thus, for Ad2 and Ad5, this would be an upper packaging limit of about 38kb of DNA.
  • the viral vectors of the present invention may retain their ability to express the genome packaged within (i.e., they may retain their infectivity), but they do not act as infectious agents to the extent that they cause disease in the subjects to whom they are administered for therapeutic purposes.
  • the Ad-derived viral vectors disclosed herein may be used to target and deliver genes into specific cells by incorporating the attachment sequence for other receptors (such as FGF) onto the fiber protein by recombinant DNA techniques or by immunological means, thus producing chimeric molecules or conjugates. This should result in the ability to target and deliver genes into a wide range of cell types with the advantage of evading recognition by the host's immune system.
  • the within-disclosed targeting and delivery systems are also much more efficient at targeting and delivery than are viral vectors utilizing their native tropism, as will be further illustrated below.
  • the within-disclosed delivery systems and constructs provide for increased flexibility in gene design to enable stable integration of molecules of choice into proliferating and nonproliferating cell types.
  • modified penton base polypeptides such as those described in Wickham et al. (J. Virol. 70:6831-8 (1996)) may have therapeutic utility when used according to the within-disclosed methods.
  • C. Immunological Modification of Viral Tropism utilizes immunological constructs.
  • one means of immunologically modifying a viral vector is via the construction of a bispecific antibody that binds to a viral capsid protein on one "end” and binds to a targeting moiety (Iigand) on the other.
  • a viral vector may be re-targeted via the targeting Iigand. If the capsid protein to which one portion of the antibody is bound happens to be the protein via which the virus typically binds and/or enters cells, then the virus' native tropism is affected as well.
  • fusion proteins e.g., ligand-sFv fusions - is another method of immunologically modifying a viral vector. Similar to the foregoing example, the Iigand portion of the fusion confers a novel tropism upon the vector, while the antibody portion links the Iigand to the vector. As before, depending upon the function of the viral capsid protein to which the antibody portion binds, attachment of the antibody may also interfere with or ablate the vims' native tropism. Further, while these methodologies are rather less efficient, one may readily generate multiple antibodies or fragments thereof - e.g.
  • constructs using antibody fragments which function to link a targeting Iigand to the viral capsid and which simultaneously modify the virus' native tropism are more ideal for use in gene therapy applications.
  • growth factor receptor-binding ligands particularly polypeptides reactive with an FGF receptor — are particularly useful re-targeting agents.
  • adenoviral anti-knob antibodies and fragments thereof are described herein as exemplary. Methods of preparing and using anti-knob antibodies and immunologically active fragments thereof are further described in the Examples that follow. Similarly, methods of preparing and using antibody-ligand conjugates are also described.
  • any attempt to modify the tropism of an adenovirus vector preferably preserves the vector's ability to perform these three functions efficiently.
  • An understanding of the adenovirus entry pathway should also facilitate attempts to modify the tropism of adenoviral vectors to permit the targeting of specific cell types.
  • the therapeutic goal is the modification of Ad tropism for tumor cell-specific targeting
  • two linked requirements are involved.
  • Mob neutralizing anti- knob monoclonal antibody
  • Ad capsid protein e.g. knob protein
  • Polypeptides reactive with an FGF receptor are exemplary targeting ligands which are useful in this regard, as discussed in greater detail below.
  • FGF2 can serve as a vehicle to introduce DNA into cells with specificity.
  • FGF2-anti-knob Fab complexes have now been exploited for their ability to specifically target the within-disclosed adenoviral vectors to FGF receptor-bearing cells (see the Examples below).
  • adenoviral vectors have the ability to efficiently transfer genes to a wide range of cell types in vitro and in vivo. Because of this, adenoviral vectors have been used in a number of different gene therapy approaches.
  • adenovirus lacks the ability to accomplish cell-specific targeted gene delivery because the tropism of the parent adenovirus is quite broad, permitting widespread transduction of various end organs after systemic in vivo delivery. This broad tropism is based upon the fact that the cellular binding receptor for adenovirus is ubiquitously expressed. It is this property of the adenovirus which undermines the potential utility of adenoviral vectors as a candidate system for accomplishing the specific transduction of disseminated tumor cells.
  • adenoviral vectors The lack of tumor-specific targeting of adenoviral vectors would allow ectopic expression of the delivered anti-cancer gene construct. Thus, despite the capacity of the adenoviral vector to accomplish high efficiency in vivo gene delivery via the vascular route, a means must be developed to redirect its tropism specifically to tumor targets. This will require both the ablation of the endogenous viral tropism and the introduction of novel tropism.
  • adenoviral tropism can accomplish tumor cell-specific transduction.
  • retroviral cell-binding activity or tropism can be altered by modifications of the viral envelope glycoprotein which interacts with specific receptors on the cell surface.
  • One approach has involved the construction of "pseudotypes," in which the retroviral genome is coated by the envelope protein of another virus (see, e.g., Weiss et al., Virology 76: 808-25 (1977)). The host range of the pseudotyped particle is thus dictated by the virus providing the envelope protein.
  • the mAb and fragments thereof are used to prepare FGF-Fab constructs as well (see Example 1 , Section A.4 below).
  • hybridomas were generated by standard techniques after immunization of mice with intact Ad5 followed by two rounds of immunization with purified recombinant Ad5 knob.
  • BABL/c mice were immunized with Ad5, followed by two rounds of immunization with recombinant Ad5 knob, a gift from R. D. Gerard (Univ. of Texas). (Also see Henry et al., J. Virol.
  • Sensitized lymphocytes were fused with P3-X63-Ag8.653 cells.
  • the reactivity of the hybridoma supernatants with trimeric Ad5 knob was determined in an ELISA.
  • Fab fragments were prepared and purified after digestion of intact 1D6.14 with papain. Both the parent antibody and the Fab fragment were capable of neutralizing adenovirus infection in a dose-dependent manner. (Douglas et al., Id. (1996)).
  • mRNA is isolated from the hybridoma and the ScFv was generated by splice site overlap extension PCR using standard techniques (Miller, R. et al, manuscript in preparation).
  • This anti-knob scFv 01D6 will be employed to generate the bispecific retargeting fusion protein. This is accomplished by genetic insertion of the FGF2 ligand by PCR based cloning into the 01D6 pET25 E. coli expression vector. Convenient restriction sites, Nco and Nhe 1, were added to the 5' and 3' respectively for ease of cloning.
  • the amplified heavy and light chain product was cloned into the pET25 expression vector (Novagen, Milwaukee, WI).
  • the expression vector, pET25 contains the promoter for T7 RNA polymerase, lac operator, pelB leader sequence, the Nco 1 restriction site in frame with pelB, the HSVTag sequence and a His Tag sequence.
  • the FGF2 is expressed as both N-terminal and C-terminal fusion protein.
  • flexible linkers may be added between the scFv and FGF2 to help favor proper protein folding.
  • FGF2 downstream of the scFv is described below.
  • Oligos that may be used to remove the stop codon and add a restriction site in the ScFv include (5'-3'):
  • the PCR product has Eco Rl and Nde 1 sites a the 5' and 3' ends.
  • the amplified fragment is preferably digested with Eco Rl and Nde 1 , isolated by gel electrophoresis and purified using GENECLEAN (Bio 101, Vista, CA).
  • FGF2 is obtained by digestion with restriction enzymes Nde 1 and Bam HI from the pET 1 1a FGF2 expression vector (previously generated at PRIZM, San Diego, CA).
  • the remaining section of the ScFv is isolated by digestion of the pET25 ScFv with Nco 1 and Eco Rl .
  • the digested fragment is isolated by agarose gel and purified using GENECLEAN.
  • the purified fragments are ligated together with Nco 1 Bam HI digested pET25 in a 4-way ligation.
  • the ligation may be transformed in to Novablue (Novagen) and clones evaluated for insertion of the fragments and further analyzed for correct restriction map. Glycerol stocks of clones with the correct restriction map are also preferably generated.
  • DNA is purified and sequenced for verification.
  • a sample of the pellet and the supernatant is analyzed by SDS-PAGE and Western analysis using antibodies to FGF2 and heavy and light chains to determine the percentage of fusion protein within each fraction. If the fusion protein fractionates to the pellet then a refolding method such as lysis in 6 M guanidine solution and gradual dialysis into non-denaturing buffer is attempted. Alternatively, the periplasmic proteins can be isolated by osmotic shock and assayed for fusion protein. Purification is accomplished by either heparin chromatography or via the His Tag at the N-terminus of the fusion protein using metal chelate resin affinity chromatography.
  • the purified fusion protein is tested for binding activity by ELISA using either FGF2 antibody coated plates or heavy and light chain antibody coated plates and detected with alkaline phosphatase.
  • ELISA ELISA-binding protein
  • the fusion protein can easily by excised with restriction enzymes and ligated into a mammalian expression vector using the Vh leader sequence.
  • the recombinant fusion protein must bind both the adenovirus knob as well as the cognate receptor.
  • these proteins are analyzed for their knob binding capacity in an ELISA.
  • each protein is used to probe boiled and unboiled recombinant Ad5 knob in an immunoblot.
  • a neutralizing assay is performed using AdCMVLuc.
  • binding and internalization assays are performed on receptor positive cells. The purified ScFv is tested for receptor binding in endothelial cells as outlined in the preliminary results. In addition, binding and internalization studies are completed for the fusion protein.
  • This analysis will determine the capacity of the recombinant bispecific fusion protein to bind Ad5 knob and FGF receptors in the context of a fusion protein, as well as ablate endogenous adenovirus tropism. These molecules are then evaluated for their ability to target adenoviral infection via the FGF receptor as described above.
  • Viral particles e.g., an adenovirus protein
  • a nucleotide sequence encoding a ligand molecule may be operatively linked for expression to a viral nucleotide sequence - - particularly to a sequence encoding a structural protein.
  • the fiber protein of adenovirus may be modified via attachment of a heterologous nucleotide sequence to the C-terminus of the gene encoding adenoviral fiber protein.
  • one or more heterologous sequences may be inserted at an internal site — i.e., within the viral fiber protein sequence.
  • Ad fiber protein via placing a sequence encoding the terminal decapeptide of gastrin releasing peptide (GRP) at the 3' end of the coding sequence of the Ad5 fiber gene.
  • GRP gastrin releasing peptide
  • viral proteins may be modified via means that are not precisely “immunologic” or “genetic.” Modification of viral proteins via means other than those exemplified herein is fully within the scope of the present invention.
  • useful reprogrammed vectors of the present invention may undergo chemical alteration of their native tropism, e.g., via chemical inactivation of the virus, and they may subsequently be "reactivated” by another molecule or process designed to retarget the viral vector.
  • heat inactivation is one method contemplated within the scope of chemical alterations which may be made to viral vectors of the present invention.
  • Chemical alteration of the molecular moiety e.g. fiber protein
  • Methods of altering viral proteins via chemical means are known to those of skill in the art and may readily be ascertained in the relevant literature.
  • the present invention provides a variety of methods of "reprogramming" the tropism of a virus (or viral vector), including methods utilizing ligands such as FGF proteins, polypeptides, analogs or mimics to assist in re-targeting the vector. While certain ligands are described as exemplary, it will be appreciated by those of skill in the art that a wide variety of molecules may appropriately be used as ligands according to the within-disclosed methodologies. The following lists ⁇ while not exhaustive — will provide one with a better understanding of the variety of ligands available for use to specifically target preselected cells and to direct the vector, conjugate or complex with which the ligand is associated into the cell — and ideally, into the nucleus.
  • ligands such as FGF proteins, polypeptides, analogs or mimics
  • the ligands may be produced by recombinant or other means in preparation for attachment to viral (e.g. adenoviral) proteins.
  • viral e.g. adenoviral
  • the DNA sequences and methods to obtain the sequences of these ligands are well known, (see GenBank). Based on the DNA sequences, the genes may be synthesized either synthetically (for small proteins), amplified from cell genomic or cDNA, isolated from genomic or cDNA libraries and the like. Restriction sites to facilitate cloning into the viral vector may be incorporated, such as in primers for amplification.
  • Such molecules include, without limitation, proteins that bind cancer cells, endothelial cells, cardiovascular cells, cells in the eye and the like.
  • ligands include growth factors and cytokines.
  • Many growth factors and families of growth factors share structural and functional features and may be used in the present invention. Families of growth factors include fibroblast growth factors FGF-1 through FGF-15, and vascular endothelial growth factor (VEGF).
  • growth factors such as PDGF (platelet-derived growth factor), TGF- ⁇ (transforming growth factor), TGF- ⁇ , HB-EGF, angiotensin, bombesis, erythropoietin, stem cell factor, M-CSF, G-CSF, GM-CSF, and endoglin also bind to specific identified receptors on cell surfaces and may be used in the present invention.
  • Cytokines including interleukins, CSFs (colony stimulating factors), and interferons, have specific receptors, and may be used as described herein.
  • ligands and ligand/receptor pairs include urokinase/urokinase receptor (GenBank Accession Nos. X02760/X74309); ⁇ -1,3 fucosyl transferase, ⁇ l-antitrypsin/E-selectin (GenBank Accession Nos. M98825, D38257/M87862); P-selectin glycoprotein ligand, P-selectin ligand/P-selectin (GenBank Accession Nos. U25955, U02297/L23088), VCAM1/VLA-4 (GenBank Accession Nos.
  • E9 antigen (Blann et al., Atherosclerosis 720:221, 1996)/TGF ⁇ receptor; Fibronectin (GenBank Accession No. X02761); type I ⁇ l- collagen (GenBank Accession No. Z74615), type I ⁇ 2-collagen (GenBank Accession No. Z74616), hyaluronic acid/CD44 (GenBank Accession No. M59040); CD40 ligand (GenBank Accession No. L07414)/CD40 (GenBank Accession No. M83312); ELF-3, LERTK-2 ligands (GenBank Accession Nos. L37361 , U09304) for elk-1 (GenBank Accession No.
  • VE-cadherin GenBank Accession No. X79981
  • ligand for catenins ICAM-3 (GenBank Accession No. X69819)
  • ligand for LFA-1 and von Willebrand Factor
  • von Willebrand Factor GeneBank Accession No. X04385
  • fibrinogen and fibronectin GenBank Accession No. X92461
  • ligands for ⁇ v ⁇ 3 integrin GenBank Accession Nos. U07375, L28832
  • ligands include CSF-1 (GenBank Accession Nos. Ml 1038, M37435); GM-CSF (GenBank Accession No. X03021); IFN- ⁇ (interferon) (GenBank Accession No. A02076; WO 8502862-A); IFN- ⁇ (GenBank Accession No. A02137; WO 8502624-A); IL-l- ⁇ (interleukin 1 alpha) (GenBank Accession No. X02531, M15329); IL-l- ⁇ (interleukin 1 beta) (GenBank Accession No. X02532, M15330, M15840); IL-1 (GenBank Accession No.
  • IL-2 GenBank Accession No. A14844, A21785, X00695, X00200, X00201 , X00202
  • IL-3 GenBank Accession No. M14743, M20137
  • IL-4 GenBank Accession No. M13982
  • IL-5 GenBank Accession No. X04688, J034708
  • IL-6 GenBank Accession No. Y00081, X04602, M54894, M38669, Ml 4584
  • IL-7 GenBank Accession No. J04156
  • IL-8 GeneBank Accession No. Zl 1686
  • IL-10 GenBank Accession No.
  • IL-1 1 GenBank Accession No. M57765 M37006
  • IL-13 GenBank Accession No. X69079, U10307
  • TNF- ⁇ Tumor necrosis factor
  • A21522 TNF- ⁇
  • TNF- ⁇ GeneBank Accession No. D 12614
  • urokinase/urokinase receptor GenBank Accession Nos. X02760/X74309
  • ⁇ -1,3 fucosyl transferase, ⁇ l-antitrypsin/E-selectin GenBank Accession Nos.
  • Still other ligands include PDGF (GenBank Accession No. X03795, X0281 1), angiotensin (GenBank Accession No. K02215), and all RGD-containing peptides and proteins, such as ICAM-1 (GenBank Accession No. X06990) and VCAM-1 (GenBank Accession No. X53051) that bind to integrin receptors.
  • Other ligands include TNF ⁇ (GenBank Accession No. A21522, X01394), IFN- ⁇ (GenBank Accession No. A1 1033, A11034), IGF-I (GenBank Accession No. A291 17, X56773, S61841, X56774, S61860), IGF-II (GenBank Accession No.
  • Atrial naturietic peptide GenBank Accession No. X54669
  • endothelin-1 GenBank Accession No. Y00749
  • coagulation factor Xa GenBank Accession No. L00395, L00396, L29433, N00045, M14327
  • TGF- ⁇ l GenBank Accession No. A23751
  • IL-l ⁇ GenBank Accession No. X03833
  • IL-l ⁇ GenBank Accession No. Ml 5330
  • endoglin GenBank Accession No. X72012.
  • FGF fibroblast growth factor
  • the members of the FGF family have a high degree of amino acid sequence similarities and common physical and biological properties, including the ability to bind to one or more FGF receptors.
  • This family of proteins includes FGFs designated FGF-1 (acidic FGF
  • FGF aFGF
  • FGF-2 basic FGF
  • FGF-3 int-2
  • FGF-4 hst-1/K-FGF
  • FGF-5 see, e.g., U.S. Patent No.
  • FGF-6 hst-2
  • FGF-7 keratinocyte growth factor
  • KGF keratinocyte growth factor
  • FGF-8 see, e.g., Tanaka et al., Proc Natl. Acad. Sci.
  • FGF-9 see, Miyamoto et al., Mol. Cell. Biol. 75:4251-4259, 1993
  • FGF-1 1 WO 96/39507
  • FGF-13 WO 96/39508
  • FGF-14 WO 96/39506
  • FGF-15 WO 96/39509
  • Other polypeptides that are reactive with an FGF receptor that is any polypeptide that specifically interacts with an FGF receptor, preferably the high affinity FGF receptor, and is transported by way of endosomes into the cell by virtue of its interaction with the FGF receptor are suitable within the present invention.
  • DNA encoding FGF peptides and/or the amino acid sequences of FGFs are well known.
  • rat FGF-2 see Shimasaki et al., Biochem. Biophys. Res. Comm., 1988, and Kurokawa et al., Nucleic Acids Res. 16:5201, 1988
  • FGF-3, FGF-6, FGF-7 and FGF-9 are known (see also U.S. Patent No. 5,155,214; U.S. Patent No. 4,956,455; U.S. Patent No. 5,026,839; U.S. Patent No. 4,994,559, EP 0,488,196 A2, EMBL or GenBank databases, and references discussed herein).
  • FGFs exhibit a mitogenic effect on a wide variety of mesenchymal, endocrine and neural cells and are also important in differentiation and development. FGFs stimulate collateral vascularization and angiogenesis, which makes them useful as "payloads" as well, as discussed in a subsequent section. In some instances, FGF- induced mitogenic stimulation may be detrimental. For example, cell proliferation and angiogenesis are an integral aspect of tumor growth. Members of the FGF family, including FGF-2, are thought to play a pathophysiological role, for example, in tumor development, rheumatoid arthritis, proliferative diabetic retinopathies and other complications of diabetes. To reduce or eliminate mitogenesis, muteins of FGF may be used and constructed as described below. Such muteins retain the ability to bind to high and low affinity receptors.
  • FGF-7 which is also known as KGF
  • KGF can be used to target the vectors and constructs of the present invention to hyperproliferating SMCs and a variety of epithelial cells.
  • KGF is also particularly useful in targeting hepatocytes and type II pneumocytes of the lung.
  • FGFs are mediated by high affinity receptor tyrosine kinases present on the cell surface of FGF-responsive cells (see, e.g., PCT WO 91/00916,
  • Low affinity receptors also appear to play a role in mediating FGF activities.
  • the high affinity receptor proteins are single chain polypeptides with molecular weights ranging from 110 to 150 kD, depending on cell type that constitute a family of structurally related FGF receptors.
  • FGF receptor genes Four FGF receptor genes have been identified, three of which generate multiple mRNA transcripts via alternative splicing of the primary transcript. Some receptor specificity has been uncovered. For example, FGF-9 binds specifically to FGFR3, which is expressed in epithelial cells and cartilage rib bone, epithelial cells exclusively express FGFR3IIIb, while mesenchymal cells express FGFR3IIIb and
  • FGFs may be used as ligands.
  • various forms of FGFs may be used as ligands.
  • FGF cDNA or genomic FGF DNA is often preferred for such therapeutic use, other forms may efficaciously be used as well.
  • Vascular endothelial growth factors can directly stimulate endothelial cell growth, enhance angiogenesis, enhance glucose transport, and cause a rapid and reversible increase in blood vessel permeability.
  • VEGF is expressed during normal development and in certain normal adult organs.
  • Purified VEGF is a basic, heparin-binding, homodimeric glycoprotein that is heat-stable, acid-stable and may be inactivated by reducing agents. Polypeptides reactive with a VEGF receptor are thus contemplated for use as ligands in the context of the present invention.
  • VEGF vascular endothelial growth factor
  • VPF vascular permeability factor
  • vasculotropin see, e.g., Plouet et al., EMBO J. 5:3801-3806, 1989.
  • VEGF vascular endothelial growth factor
  • VPF vascular permeability factor
  • vasculotropin see, e.g., Plouet et al., EMBO J. 5:3801-3806, 1989.
  • VEGF vascular endothelial growth factor
  • VPF vascular permeability factor
  • vasculotropin see, e.g., Plouet et al., EMBO J. 5:3801-3806, 1989.
  • DNA sequences encoding VEGF and methods to isolate these sequences may be found primarily in U.S. Patent No. 5,240,848, U.S. Patent No. 5,332,671, U.S. Patent No. 5,219,739, U.S. Patent No. 5,194,596, and Houch et al., Mol. Endocrin. 5:180, 1991.
  • DNA encoding VEGF refers to DNA that encodes any such member of the VEGF family, including VEGF isoforms that result from alternative splicing of RNA transcribed from a VEGF gene (see, e.g., International PCT Application No. WO 90/13649, which is based on U.S. applications serial nos. 07/351,361, 07/369,424, 07/389,722, to GENENTECH, INC., and any U.S. Patent based U.S. applications Serial Nos. 07/351 ,361, 07/369,424, 07/389,722; European Patent Applications EP 0 506 477 Al and EP 0 476 983 Al to Merck & Co.; Houck et al.
  • DNA encoding the VEGF polypeptide may be obtained from any source known to those of skill in the art; it may be isolated using standard cloning methods, synthesized or obtained from commercial sources, prepared as described in any of the above noted patents and publications.
  • VEGF vascular endothelial growth factor
  • the predominant isoform secreted by a variety of normal and transformed cells is VEGF 165 .
  • the secreted isoforms, VEGF, 21 and VEGF 155 are preferred VEGF proteins.
  • the longer isoforms, VEGF, 89 and VEGF 206 bind to the extracellular matrix and need to be released by an agent, such as suramin, heparin or heparinase, or plasmin.
  • VEGF 12 is a weakly acidic polypeptide that lacks the heparin binding domain and, consequently, does not bind to heparin.
  • Other preferred VEGF proteins contain various combinations of VEGF exons, such that the protein still binds VEGF receptor and is internalized.
  • a VEGF protein used as a ligand in the context of this invention either retain any of its in vivo biological activities, such as stimulating endothelial cell growth, or bind heparin other than bind a VEGF receptor on a cell and be internalized.
  • VEGF is used as a carrier for DNA encoding a molecule useful in wound healing, it would be desirable that VEGF exhibit vessel permeability activity and promotion of fibroblast migration and angiogenesis.
  • VEGF is used as payload, as described further in Section F below, retention of such abilities is also desirable. It will be apparent from the teachings provided within the subject application which of the activities of VEGF are desirable to maintain.
  • VEGF receptors Two tyrosine kinases have been identified as VEGF receptors.
  • the first known as fms-like tyrosine kinase or FLT, is a receptor tyrosine kinase that is specific for VEGF.
  • FLT fms-like tyrosine kinase
  • expression of FLT mRNA is localized to the endothelium and to populations of cells that give rise to endothelium.
  • the second receptor, KDR (human kinase insert domain-containing receptor), and its mouse homologue FLK-1 are closely related to FLT.
  • the KDR/FLK-1 receptor is expressed in endothelium during the fetal growth stage, during earlier stages of embryonic development, and in adult tissues.
  • messenger RNA encoding FLT and KDR have been identified in tumor blood vessels and specifically by endothelial cells of blood vessels supplying glioblastomas.
  • FLT and KDR mRNAs are upregulated in tumor blood vessels in invasive human colon adenocarcinoma, but not in the blood vessels of adjacent normal tissues.
  • HBEGF Heparin-binding epidermal growth factors HBEGF interacts with the same high affinity receptors as EGF on bovine aortic smooth muscle cells and human A431 epidermoid carcinoma cells (Higashiyama, Science 257:936-939, 1991). HBEGFs exhibit a mitogenic effect on a wide variety of cells including BALB/c 3T3 fibroblast cells and smooth muscle cells, but are not mitogenic for endothelial cells (Higashiyama et al., Science 251:936-939, 1991). However, HBEGF has a stimulatory effect on collateral vascularization and angiogenesis. Members of the HBEGF family are thought to play a pathophysiological role, for example, in a variety of tumors, such as bladder carcinomas, breast tumors and non-small cell lung tumors. Thus, these cell types are likely candidates for delivery of therapeutic gene products.
  • HBEGF isolated from U-937 cells is heterogeneous in structure and contains at least 86 amino acids and two sites of O-linked glycosyl groups (Higashiyama et al., J. Biol. Chem. 267:6205-6212, 1992).
  • the carboxyl-terminal half of the secreted HBEGF shares approximately 35% sequence identity with human EGF, including six cysteines spaced in the pattern characteristic of members of the EGF protein family.
  • the amino-terminal portion of the mature factor is characterized by stretches of hydrophilic residues and has no structural equivalent in EGF.
  • Site-directed mutagenesis of HBEGF and studies with peptide fragments have indicated that the heparin-binding sequences of HBEGF reside primarily in a 21 amino acid stretch upstream of and slightly overlapping the EGF-like domain.
  • DNA encoding an HBEGF peptide or polypeptide refers to any DNA fragment encoding an HBEGF, HBEGF fragment or HBEGF mutein that binds an EGF receptor and internalizes.
  • DNA sequences encoding HBEGF fragments are available from publicly accessible databases, "such as: EMBL, GenBank (Accession Nos. M93012 (monkey) and M60278 (human)); the plasmid pMTN-HBEGF (ATCC #40900) and pAX-HBEGF (ATCC #40899) (described in PCT Application WO/92/06705); and Abraham et al., Biochem. Biophys. Res. Comm. 790:125-133, 1993).
  • HBEGFs The effects of HBEGFs are mediated by EGF receptor tyrosine kinases expressed on cell surfaces of HBEGF-responsive cells (see, e.g., U.S. Patent Nos. 5,183,884 and 5,218,090; and Ullrich et al., Nature 509:4113-425, 1984).
  • the EGF receptor proteins which are single chain polypeptides with molecular weights 170 kD, constitute a family of structurally related EGF receptors.
  • Cells known to express the EGF receptors include smooth muscle cells, fibroblasts, keratinocytes, and numerous human cancer cell lines, such as the: A431 (epidermoid); KB3-1 (epidermoid); COLO 205 (colon); CRL 1739 (gastric); HEP G2 (hepatoma); LNCAP (prostate); MCF-7 (breast); MDA-MB-468 (breast); NCI 417D (lung); MG63 (osteosarcoma); U-251 (glioblastoma); D-54MB (glioma); and SW-13 (adrenal).
  • A431 epidermoid
  • KB3-1 epidermoid
  • COLO 205 colon
  • CRL 1739 gastric
  • HEP G2 hepatoma
  • LNCAP prostate
  • MCF-7 breast
  • MDA-MB-468 breast
  • NCI 417D lung
  • MG63 osteo
  • HBEGFs (including fragments or derivatives thereof) are used as ligands
  • HBEGF need only bind a specific EGF receptor and be internalized.
  • Members of the HBEGF family are those that have sufficient nucleotide identity to hybridize under normal stringency conditions (typically greater than 75% nucleotide identity).
  • Subfragments or subportions of a full-length HBEGF may also be desirable.
  • One skilled in the art may find from the teachings provided within that certain biological activities are more or less desirable, depending upon the application.
  • Antibodies to molecules expressed on the surface of cells are useful within the context of the present invention as long as the antibody is internalized following binding.
  • Such antibodies include, but are not limited to, antibodies to FGF receptors, VEGF receptors, urokinase receptor, E- and P-selectins, VCAM-1, PDGF receptor, TGF receptor, endosialin, alpha, , , beta 3 integrin, LFA-1, E9 antigen, CD40, cadherins, and elk-1.
  • Antibodies that are specific to cell surface molecules expressed by cells are readily generated as monoclonals or polyclonal antisera. Many such antibodies are available (e.g., from American Type Culture Collection, Rockville, MD).
  • antibodies to ligands that bind/internalize may also be used.
  • the viral particles will have antibody on their surface, which will then be complexed to the ligand (see further discussion below).
  • antibodies are understood to include monoclonal antibodies, polyclonal antibodies, anti-idiotypic antibodies, antibody fragments (e.g., Fab, and F(ab')2, F v variable regions, or complementarity determining regions).
  • Antibodies are generally accepted as specific against indolicidin analogues if they bind with a K j of greater than or equal to 10 " ⁇ M, preferably greater than of equal to 10" ⁇ M.
  • the affinity of a monoclonal antibody or binding partner can be readily determined by one of ordinary skill in the art (see Scatchard, Ann. N Y. Acad. Sci. 57:660-672, 1949). Once suitable antibodies have been obtained, they may be isolated or purified by many techniques well known to those of ordinary skill in the art.
  • the 11A8 antibody is a monoclonal antibody which recognizes the high affinity fibroblast growth factor receptor (FGFR1).
  • FGFR1 fibroblast growth factor receptor
  • mice were immunized with intact SK-HEP1 cells, derived from a liver adenocarcinoma, which express high affinity FGF receptors. Hybridomas were screened using the extracellular domain of FGFR1. One resulting monoclonal, 11A8, recognizes the high affinity FGF receptor by Western blotting, immunoprecipitates FGF receptor from cell extracts and recognizes the native receptor on the cell surface. Immuno fluorescence studies show that 11A8 reacts with a membrane-associated protein on the surface of SK-Hep-1 and SK-Mel-28 (human melanoma) cells, which also express numerous FGF receptors.
  • 11A8 When 11A8 is conjugated to the ribosome inactivating protein saporin, it becomes a potent cytocidal agent that targets cells that express high affinity FGF receptors.
  • the resulting immunotoxin, HA8-saporin inhibits solid tumor growth of a human melanoma xenografted into nude mice.
  • 11 A8 When 11 A8 is conjugated to nucleic acid or to the viral vectors of the present invention, it is able to target cells expressing its cognate receptor and to deliver therapeutic gene sequences to those cells, as it is able to internalize as well.
  • One assay that is used is a test for an antibody to kill cells. Briefly, the test hybridoma antibody and test cells are incubated. Unbound antibody is washed away. A second stage antibody, such as an anti-IgG antibody, conjugated to saporin is incubated with the test cells. Cell killing is assessed by any known assay, including trypan blue exclusion, MTT uptake, fluorescein diacetate staining, and the like.
  • recombinants may be screened individually or co-expressed to form Fab fragments or antibodies (see Huse et al., supra; Sastry et al., supra). Positive plaques may subsequently be converted to a non-lytic plasmid that allows high level expression of monoclonal antibody fragments from E. coli. Similarly, portions or fragments, such as Fab and Fv fragments, of antibodies may also be constructed utilizing conventional enzymatic digestion or recombinant DNA techniques to yield isolated variable regions of an antibody.
  • the genes which encode the variable region from a hybridoma producing a monoclonal antibody of interest are amplified using nucleotide primers for the variable region.
  • Antibodies to molecules expressed on the surface of tumor cells are useful within the context of the present invention as long as the antibody is internalized following binding.
  • Such antibodies include but are not limited to antibodies to FGF receptors, VEGF receptors, and the receptors set forth above.
  • Antibodies may be polyclonal or monoclonal. Commercially available antibodies to some tumor cell surface molecules may be used if they internalize.
  • One assay that is used is a test for an antibody to kill tumor cells. Briefly, the test hybridoma antibody and tumor cells are incubated. Unbound antibody is washed away. A second stage antibody, such as an anti-IgG antibody, conjugated to saporin is incubated with the tumor cells. Cell killing is assessed by any known assay, including trypan blue exclusion, MTT uptake, fluorescein diacetate staining, and the like.
  • Antibodies to molecules on smooth muscle cells are useful within the context of the present invention as long as the antibody is internalized following binding.
  • Such antibodies include but are not limited to antibodies to FGF receptors, EGF receptors, TNF ⁇ receptor, IFN- ⁇ receptor, TGF receptor, endothelin 1 receptor.
  • Antibodies may be polyclonal or monoclonal. Commercially available antibodies to some smooth muscle cell surface molecules may be used if they internalize. Briefly, antibodies are raised by immunization of mice, rats, rabbits or other animals with normal, tumorigenic, or cultured smooth muscle cells.
  • Antibody-secreting hybridomas are grown, and the antibodies are tested for binding to smooth muscle cells by ELISA, section staining, flow cytometry, confocal microscopy and the like.
  • the antibodies When the antibodies are to be used on hyperproliferating smooth muscle cells, preferably the antibody does not bind or binds much less to quiescent smooth muscle cells. Positive antibodies are further tested for internalization.
  • One assay that is used is a test for an antibody to kill smooth muscle cells. Briefly, the test hybridoma antibody and smooth muscle cells are incubated. Unbound antibody is washed away. A second stage antibody, such as an anti-IgG antibody, conjugated to saporin is incubated with the smooth muscle cells. Cell killing is assessed by any known assay, including trypan blue exclusion, MTT uptake, fluorescein diacetate staining, and the like.
  • Antibodies to molecules expressed on the surface of endothelial and smooth muscle cells are useful within the context of the present invention as long as the antibody is internalized following binding.
  • Such antibodies include but are not limited to antibodies to FGF receptors, VEGF receptors, urokinase receptor, E- and P-selectins, VCAM-1, PDGF receptor, TGF receptor, endosialin, alpha,, beta 3 integrin, LFA-1, E9 antigen, CD40, cadherins, and elk-1.
  • Antibodies may be polyclonal or monoclonal. Commercially available antibodies to some endothelial or smooth muscle cell surface molecules may be used if they internalize.
  • One assay that is used is a test for an antibody to kill cells. Briefly, the test hybridoma antibody and test cells are incubated. Unbound antibody is washed away. A second stage antibody, such as an anti-IgG antibody, conjugated to saporin is incubated with the test cells. Cell killing is assessed by any known assay, including trypan blue exclusion, MTT uptake, fluorescein diacetate staining, and the like.
  • receptor-binding internalized ligands are used to deliver nucleic acids, including a therapeutic agent-encoding agent, to a cell expressing an appropriate receptor on its cell surface.
  • Numerous molecules that bind specific receptors have been identified and are suitable for use in the present invention.
  • ligands that target smooth muscle cells are useful in the context of this invention.
  • Smooth muscle cells (SMC) are an essential requirement for neovessel formation, providing the contractile and structural components of capillaries, venules, veins, arterioles, and arteries. As such, targeting SMC will also affect neovascularization processes in diseased tissues.
  • Such molecules include growth factors, cytokines, and antibodies.
  • growth factors and families of growth factors share structural and functional features and may be used in the present invention. Families of growth factors include fibroblast growth factors FGF-1 through FGF-15, and vascular endothelial growth factor (VEGF). Other growth factors, such as PDGF (platelet-derived growth factor), TGF- ⁇ (transforming growth factor), TGF- ⁇ , HB-EGF, angiotensin and endoglin also bind to specific identified receptors on cell surfaces and may be used in the present invention.
  • PDGF platelet-derived growth factor
  • TGF- ⁇ transforming growth factor
  • TGF- ⁇ transforming growth factor
  • HB-EGF transforming growth factor
  • angiotensin and endoglin also bind to specific identified receptors on cell surfaces and may be used in the present invention.
  • Antibodies that are specific to cell surface molecules expressed by endothelial cells or smooth muscle cells are readily generated as monoclonals or polyclonal antisera. Many such antibodies are available (e.g., from American Type Culture Collection, Rock
  • Cytokines including interleukins, CSFs (colony stimulating factors), and interferons, have specific receptors on endothelial cells, and may be used as described herein. These and other ligands are discussed in more detail below. Fragments of these ligands may be used within the present invention, so long as the fragment retains the ability to bind to the appropriate cell surface molecule. Likewise, ligands with substitutions or other alterations, but which retain binding ability, may also be used.
  • a particular ligand refers to a polypeptide(s) having an amino acid sequence of the native ligand, as well as modified sequences, (e.g., having amino acid substitutions, deletions, insertions or additions compared to the native protein) as long as the ligand retains the ability to bind to its receptor on an endothelial cell and be internalized.
  • Ligands that bind to tumor cells As noted above, receptor-binding internalized ligands are used to deliver nucleic acids to a cell expressing an appropriate receptor on its cell surface. Numerous molecules that bind specific receptors on tumor cells have been identified and are suitable for use in the present invention. For example, the following table sets forth some of the better known ligands and cell surface molecules on various tumors.
  • Prostate tumors Prostate specific antigen- 1 ; probasin
  • Angiogenic tumors FGF; VEGF; PDGF FGF receptor; VEGF receptor; PDGF receptor; PDGF receptor
  • FGF Myeloid leukemias
  • CD antibodies FGF receptor; CD molecules
  • Endometrial VEGF VEGF receptor carcinoma cervical carcinoma
  • transferrin receptor is preferentially expressed on most all tumor cells.
  • Antibodies that are specific to cell surface molecules on tumors are readily generated as monoclonals or polyclonal antisera. Many such antibodies are available (e.g., from American Type Culture Collection, Rockville, MD).
  • Fragments of these ligands may be used within the present invention, so long as the fragment retains the ability to bind to the appropriate cell surface molecule.
  • ligands with substitutions or other alterations, but which retain binding ability may also be used.
  • a particular ligand refers to a polypeptide(s) having an amino acid sequence of the native ligand, as well " as modified sequences, (e.g., having amino acid substitutions, deletions, insertions or additions compared to the native protein) as long as the ligand retains the ability to bind to its receptor on a tumor cell and be internalized.
  • Some of the more useful receptors according to the present invention are those that efficiently bind ligand and not only internalize it but enhance its delivery to the nucleus. Thus, ligands that specifically target such receptors are especially preferred. ligands that specifically target receptors that direct the ligand to the nucleus with high efficiency are even more preferred.
  • Ligands also encompass muteins that possess the ability to bind to their receptor expressing cells and be internalized. Such muteins include, but are not limited to, those produced by replacing one or more of the cysteines with serine as described herein. Typically, such muteins will have conservative amino acid changes. DNA encoding such muteins will, unless modified by replacement of degenerate codons, hybridize under conditions of at least low stringency to native DNA sequence encoding the wild-type ligand. (Exemplary methods of generating FGF muteins are described in Example 3.)
  • DNA encoding a ligand may be prepared synthetically based on known amino acid or DNA sequence, isolated using methods known to those of skill in the art (e.g., PCR amplification), or obtained from commercial or other sources.
  • DNA encoding a ligand may differ from the above sequences by substitution of degenerate codons or by encoding different amino acids. Differences in amino acid sequences, such as those occurring among the homologous ligand of different species as well as among individual organisms or species, are tolerated as long as the ligand binds to its receptor.
  • Ligands may be isolated from natural sources or made synthetically, such as by recombinant means or chemical synthesis.
  • receptor-binding ligands may be used in the present invention. Any protein, polypeptide, analogue, or fragment that binds to a cell-surface receptor and is internalized may be used. These ligands may be produced by recombinant or other means in preparation for conjugation to the nucleic acid binding domain. The DNA sequences and methods to obtain the sequences of these receptor-binding internalized ligands are well known. For example, these ligands include CSF-1 (GenBank Accession Nos. Ml 1038, M37435; Kawasaki et al., Science 250:291-296, 1985; Wong et al.. Science 255:1504-1508, 1987); GM-CSF (GenBank Accession No.
  • IFN- ⁇ interferon
  • IFN- ⁇ Interferon
  • IFN- ⁇ GeneBank Accession No. A02137; Patent No. WO 8502624-A, June 20, 1985
  • IL-l- ⁇ interleukin 1 alpha
  • IL-l- ⁇ interleukin 1 beta
  • IL-1 GenBank Accession No. K02770, M54933, M38756; Auron et al., Proc. Natl. Acad. Sci. USA 57:7907-791 1, 1984; Webb et al, Adv. Gene Technol.
  • IL-2 GenBank Accession No. A14844, A21785, X00695, X00200, X00201 , X00202; Lupker et al., Patent No. EP 0307285-A, March 15, 1989; Perez et al., Patent No. EP 0416673-A, March 13, 1991 ; Holbrook et al., Nucleic Acids Res. 72:5005-5013, 1984; Degrave et al., EMBO J. 2:2349-2353, 1983; Taniguchi et al., Nature 502:305-310, 1983); IL-3 (GenBank Accession No.
  • IL-4 GenBank Accession No. M13982; Yokota et al, Proc. Natl. Acad. Sci. USA 55:5894-5898, 1986
  • IL-5 GenBank Accession No. X04688, J03478; Azuma et al., Nucleic Acids Res. 74:9149-9158, 1986; Tanabe et al., J. Biol. Chem. 262: 16580-16584, 1987
  • IL-6 GenBank Accession No.
  • IL-10 GenBank Accession No. X78437, M57627; Vieira et al., Proc. Natl. Acad. Sci. USA 55:1172-1176, 1991
  • IL-11 GenBank Accession No. M57765 M37006; Paul et al., Proc. Natl. Acad. Sci. USA 57:7512-7516, 1990
  • IL- 13 GenBank Accession No.
  • TNF- ⁇ Tumor necrosis factor
  • TNF- ⁇ Tumor necrosis factor
  • ligand for LFA-1 and von Willebrand Factor (GenBank Accession No. X04385), fibrinogen and fibronectin (GenBank Accession No. X92461 ligands for ⁇ v ⁇ 3 integrin (GenBank Accession Nos. U07375, L28832) and GP30 ligand (S68256) for erbB2.
  • DNA sequences of other suitable receptor-binding internalized ligands may be obtained from GenBank or EMBL DNA databases, reverse-synthesized from protein sequence obtained from PIR database or isolated by standard methods (Sambrook et al., supra) from cDNA or genomic libraries.
  • receptor-binding ligands may be used in the present invention. Any protein, polypeptide, analogue, or fragment that binds to a smooth muscle cell-surface receptor and is internalized may be used. These ligands may be produced by recombinant or other means in preparation for conjugation to the nucleic acid binding domain. The DNA sequences and methods to obtain the sequences of these receptor-binding internalized ligands are well known. For example, these ligands include PDGF (GenBank Accession No. X03795, X02811), angiotensin (GenBank Accession No.
  • RGD-containing peptides and proteins such as ICAM-1 (GenBank Accession No. X06990) and VCAM-1 (GenBank Accession No. X53051) that bind to integrin receptors.
  • Other ligands include TNF ⁇ (GenBank Accession No. A21522, X01394), IFN- ⁇ (GenBank Accession No. Al 1033, Al 1034), IGF-I (GenBank Accession No. A291 17, X56773, S61841 , X56774, S61860), IGF-II (GenBank Accession No. A00738, X06159, Y00693), atrial naturietic peptide (GenBank Accession No.
  • DNA sequences of other suitable receptor-binding internalized ligands may be obtained from GenBank or EMBL DNA databases, reverse-synthesized from protein sequence obtained from PIR database or isolated by standard methods (Sambrook et al., supra) from cDNA or genomic libraries.
  • any protein, polypeptide, analogue, or fragment that binds to a cell-surface receptor and is internalized may be used.
  • Molecules that mimic or interact with a cell surface molecule that is trafficked to the nucleus are also included within the scope of the present invention.
  • These ligands may be produced by recombinant or other means in preparation for conjugation to the nucleic acid binding domain.
  • the DNA sequences and methods to obtain the sequences of these receptor-binding internalized ligands are well known.
  • these ligands and ligand/receptor pairs include urokinase/urokinase receptor (GenBank Accession Nos.
  • X02761 type I ⁇ l- collagen (GenBank Accession No. Z74615), type I ⁇ 2-collagen (GenBank Accession No. Z74616), hyaluronic acid/CD44 (GenBank Accession No. M59040); CD40 ligand (GenBank Accession No. L07414)/CD40 (GenBank Accession No. M83312); ELF-3, LERTK-2 ligands (GenBank Accession Nos. L37361 , U09304) for elk-1 (GenBank Accession No. M25269); VE-cadherin (GenBank Accession No. X79981); ligand for catenins; ICAM-3 (GenBank Accession No.
  • DNA sequences of other suitable receptor-binding internalized ligands may be obtained from GenBank or EMBL DNA databases, reverse-synthesized from protein sequence obtained from PIR database or isolated by standard methods (Sambrook et al., supra) from cDNA or genomic libraries.
  • Ligands or fragments thereof that bind to a cell-surface receptor and are internalized, but which are mimetics of "true" polypeptides, are also contemplated for use in the present invention.
  • the invention contemplates the preparation and use of non-peptide peptidomimetics useful for mimicking the activity of peptides, which makes peptidomimetics additional sources of targeting ligands that may be attached to the viral vectors of the present invention.
  • peptidomimetic molecules useful as ligands and/or "linkers" herein are described in published International App. No. WO 9220704; Brandt, et al., Antimicrob Agents Chemother, 40:1078, 1996; Sepp-Lorenzino, et al., Cancer Res, 55:5302, 1995; and Chander et al., J Pharm Sci, 84:404, 1995. Notwithstanding the fact that such mimetics are not true peptides, various covalent and non-covalent means of linking such peptidomimetic molecules to viral proteins may be used as disclosed herein.
  • Ligands for use in the present invention may also be selected by a method such as phage display (see, for example, U.S. Patent No. 5,223,409.) Briefly, in this method, DNA sequences are inserted into the gene III or gene VIII gene of a filamentous phage, such as Ml 3. Several vectors with multicloning sites have been developed for insertion (McLafferty et al., Gene 725:29-36, 1993; Scott and Smith, Science 249:386- 390, 1990; Smith and Scott, Methods Enzymol. 277:228-257, 1993). Using tumor cell targeting as an example, the inserted DNA sequences may be randomly generated or be variants of a known binding domain for binding tumor cells.
  • Single chain antibodies may readily be generated using this method.
  • the inserts encode from 6 to 20 amino acids.
  • the peptide encoded by the inserted sequence is displayed on the surface of the bacteriophage.
  • Bacteriophage expressing a binding domain for tumor cells are selected for by binding to tumor cells. Unbound phage are removed by a wash, typically containing 10 mM Tris, 1 mM EDTA, and without salt or with a low salt concentration. Bound phage are eluted with a salt containing buffer, for example. The NaCl concentration is increased in a step-wise fashion until all the phage are eluted. Typically, phage binding with higher affinity will be released by higher salt concentrations.
  • Eluted phage are propagated in the bacteria host. Further rounds of selection may be performed to select for a few phage binding with high affinity. The DNA sequence of the insert in the binding phage is then determined. Once the predicted amino acid sequence of the binding peptide is known, sufficient peptide for use herein as an nucleic acid binding domain may be made either by recombinant means or synthetically. Recombinant means is used when the receptor-binding internalized ligand/nucleic acid binding domain is produced as a fusion protein. The peptide may be generated as a tandem array of two or more peptides, in order to maximize affinity or binding.
  • Identifying and Isolating Internalizing Molecules Any and all molecules that mimic or interact with a cell surface molecule that is trafficked to the nucleus are also included within the scope of the present invention.
  • One exemplary method of identifying and isolating such molecules is essentially as follows.
  • a cell or tissue of interest e.g., a cell to which one wishes to target a therapeutic moiety.
  • generate antibodies preferably, monoclonal antibodies ⁇ to the cell surface of the putative target cell. Identify and isolate hybridomas secreting the antibodies to the cell surface. Methods of generating monoclonal antibodies and of identifying hybridomas producing said antibodies are known in the art.
  • the monoclonal antibodies are admixed with a culture of target cells and allowed to incubate for a predetermined period of time.
  • a second antibody is added to the admixture — that is, an antibody to the first antibody (anti-idiotype antibody).
  • the second antibody is toxic to the target cell upon internalization and delivery to the nucleus; in this manner, cell death is indicative of internalization of the first antibody, to which the second antibody is bound.
  • Modified peptides especially those lacking proliferative function, and chimeric peptides, which retain their specific binding and internalizing activities, are also contemplated for use herein. Modifications also include the addition or deletion of residues, such as the addition of a cysteine to facilitate conjugation and to form conjugates that contain a defined molar ratio (e.g., 1 :1) of the polypeptides (see, e.g., U.S. Patent No. 5,175,147; PCT Application No. WO 89/00198, U.S. Serial No.
  • Still other useful modifications include adding sequence that are subject to post- translational modification (e.g. , myristylation, palmatylation, phophorylation, ribosylation) that improve or alter protein function, stability or the like.
  • post- translational modification e.g. , myristylation, palmatylation, phophorylation, ribosylation
  • any ligand that binds to a cell surface receptor and is internalized may be used within the context of this invention.
  • Such ligands may be polypeptides or peptide analogues, including peptidomimetics.
  • Ligands also include fragments thereof, or constrained analogues of such peptides that bind to the receptor and internalize a linked targeted agent.
  • Members of the FGF family, including FGF-1 to FGF-15, are preferred.
  • Modified peptides, especially those lacking proliferative function, and chimeric peptides, which retain the specific binding and internalizing activities are also contemplated for use herein.
  • Modification of the polypeptide may be effected by any means known to those of skill in this art.
  • the preferred methods herein rely on modification of DNA encoding the polypeptide and expression of the modified DNA.
  • DNA encoding one of the receptor-binding internalized ligands discussed above may be mutagenized using standard methodologies. For example, cysteine residues that are responsible for aggregate formation may be deleted or replaced. If necessary, the identity of cysteine residues that contribute to aggregate formation may be determined empirically, by deleting and/or replacing a cysteine residue and ascertaining whether the resulting protein aggregates in solutions containing physiologically acceptable buffers and salts. In addition, fragments of these receptor-binding internalized ligands may be constructed and used.
  • the binding region of many of these ligands have been delineated.
  • the receptor binding region of FGF2 has been identified by mutation analysis and FGF peptide agonists/antagonists to reside between residues 33-77 and between 102- 129 of the 155 amino acid form (Baird et al., PNAS 55:2324; Erickson et al., Biochem. 55:3441).
  • Exons 1-4 of VEGF are required for receptor binding. Fragments may also be shown to bind and internalize by any one of the tests described herein.
  • Mutations may be made by any method known to those of skill in the art, including site-specific or site-directed mutagenesis of DNA encoding the protein and the use of DNA amplification methods using primers to introduce and amplify alterations in the DNA template, such as PCR splicing by overlap extension (SOE).
  • Site-directed mutagenesis is typically effected using a phage vector that has single- and double- stranded forms, such as Ml 3 phage vectors, which are well-known and commercially available.
  • Other suitable vectors that contain a single-stranded phage origin of replication may be used (see, e.g., Veira et al., Meth. Enzymol. 15:3, 1987).
  • site-directed mutagenesis is performed by preparing a single-stranded vector that encodes the protein of interest (/ ' . e. , a member of the FGF family or a therapeutic molecule, such as an intrabody).
  • An oligonucleotide primer that contains the desired mutation within a region of homology to the DNA in the single-stranded vector is annealed to the vector followed by addition of a DNA polymerase, such as E. coli DNA polymerase I (Klenow fragment), which uses the double stranded region as a primer to produce a heteroduplex in which one strand encodes the altered sequence and the other the original sequence.
  • the heteroduplex is introduced into appropriate bacterial cells and clones that include the desired mutation are selected.
  • the resulting altered DNA molecules may be expressed recombinantly in appropriate host cells to produce the modified protein.
  • Suitable conservative substitutions of amino acids are well-known and may be made generally without altering the biological activity of the resulting molecule. For example, such substitutions are generally made by interchanging within the groups of polar residues, charged residues, hydrophobic residues, small residues, and the like. If necessary, such substitutions may be determined empirically merely by testing the resulting modified protein for the ability to bind to and internalize upon binding to the appropriate receptors. Those that retain this ability are suitable for use in the conjugates and methods herein.
  • an amino acid residue of a receptor-binding internalized ligand is non-essential if the polypeptide that has been modified by deletion or alteration of the residue possesses substantially the same ability to bind to its receptor and internalize a linked agent as the unmodified polypeptide.
  • biological activity generally refers to the activity of a compound or a physiological response that results upon in vivo administration of a compound, composition or other mixture. Biological activity thus encompasses therapeutic effects and pharmaceutical activity of such compounds, compositions, complexes, and mixtures. Biological activity also refers to the ability of a molecule to bind to a cell, to internalize and to localize to the nucleus. Biological activity may be determined with reference to particular in vitro activities as measured in a defined assay. For example, within the context of this invention, a biological activity of FGF, or fragments of FGF, is the ability of FGF to bind to cells bearing FGF receptors and internalize a linked agent.
  • This activity may be assessed in vitro, e.g., by conjugating FGF to a cytotoxic agent (such as saporin), contacting cells bearing FGF receptors (e.g., fibroblasts) with the conjugate, and assessing cell proliferation or inhibition of growth.
  • a cytotoxic agent such as saporin
  • FGF receptors e.g., fibroblasts
  • In vivo activity may be determined using recognized animal models, such as the mouse xenograft model for anti-tumor activity (see, e.g., Beitz et al., Cancer Research 52:221- 230, 1992; Houghton et al., Cancer Res. 42:535-539, 1982; Bogden et al., Cancer (Philadelphia) 45:10-20, 1981 ; Hoogenhout et al., Int. J. Radiat. Oncol, Biol. Phys. 9:871-879, 1983; Stastny et al., Cancer
  • Binding to a receptor followed by internalization are the only activities required for a ligand to be suitable for use herein.
  • some of the ligands are growth factors and cause mitogenesis.
  • all of the FGF proteins induce mitogenic activity in a wide variety of normal diploid mesoderm-derived and neural crest-derived cells.
  • a test of such "FGF mitogenic activity” which reflects the ability to bind to FGF receptors and to be internalized, is the ability to stimulate proliferation of cultured bovine aortic endothelial cells (see, e.g., Gospodarowicz et al., J. Biol. Chem. 257:12266-12278, 1982; Gospodarowicz et al., Proc.
  • Muteins with reduced mitogenic activity are made by the methods described herein.
  • FGF muteins with reduced mitogenic activity have been constructed by site-directed mutagenesis.
  • Non- or reduced-mitogenic proteins can also be constructed by swapping the receptor-binding domain with the receptor-binding domain of a related protein.
  • the domain of FGF2 may be swapped with the receptor-binding domain of FGF7 to create an FGF that does not cause proliferation and may alter the binding profile.
  • FGF FGF may be fluorescently labeled with FITC or radiolabeled with 125 I. Fluorescein-conjugated FGF is incubated with cells and examined microscopically by fluorescence microscopy or confocal microscopy for internalization. When FGF is labeled with 12 T, the labeled FGF is incubated with cells at 4°C. Cells are temperature shifted to 37°C and washed with 2 M NaCl at low pH to remove any cell- bound FGF. Label is then counted and thereby measuring internalization of FGF.
  • the ligand in another method of assaying the binding and internalization abilities of a ligand, can be conjugated with a nucleic acid binding domain by any of the methods described herein and complexed with a plasmid encoding saporin or conjugated with saporin or other cytotoxic molecule and assessed for cytotoxicity. As discussed below, the complex may be used to transfect cells and cytotoxicity measured.
  • muteins of the FGFs are known to those of skill in the art (see, e.g., U.S. Patent No. 5,175,147; PCT Application No. WO 89/00198, U.S. Serial No. 07/070,797; PCT Application No. WO 91/15229; and U.S. Serial No. 07/505,124). Such muteins may also be used according to the teachings of the present invention.
  • Molecules that encode therapeutic products are molecules that effect a treatment upon or within a cell, generally by modifying gene transcription of translation.
  • Therapeutic nucleic acids of the present invention may be used in the context of "positive” or “negative” gene therapy, depending on the effect one seeks to achieve.
  • a therapeutic nucleotide sequence may encode all or a portion of a gene. If it encodes all (or the most critical functional portions) of a gene, it may effect genetic therapy by serving as a replacement for a defective gene. Such a sequence may also function by recombining with DNA already present in a cell, thereby replacing a defective portion of a gene.
  • a variety of positive gene therapy applications and therapeutic gene products are described hereinbelow and include such diverse applications as the treatment of ischemia, the promotion of wound healing, the stimulation of bone growth and regrowth, increased angiogenesis, and the like.
  • the replacement of a defective or nonfunctional gene with one that produces the desired gene product is also considered “positive” gene therapy, whether one is replacing a dysfunctional or nonfunctional regulatory sequence or a sequence that encodes a structural protein.
  • "negative" gene therapy is encompassed by the present invention as well.
  • therapeutic nucleic acids of the present invention may encode products that reduce or halt hyperproliferative diseases (e.g. of SMCs; restenosis is one example), tumor formation and growth, metastasis, and the like, to name a few examples. Further details regarding both positive and negative gene therapy applications are set forth below in subsequent sections of the specification. The following illustrations are thus intended to be exemplary and not limiting.
  • FGF gene with a leader sequence to promote secretion is preferable.
  • the FGF gene is preferably driven by a constitutive promoter.
  • muteins of the FGFs are known to those of skill in the art and may be useful as payload molecules as well as ligands. (See, e.g., U.S. Patent No. 5,175,147; PCT Application No. WO 89/00198, U.S. Serial No.
  • IGF insulin growth factor
  • TGF ⁇ l TGF ⁇ 2, and TGF ⁇ 3
  • HGF hepatocyte growth factor
  • PDGF A see, e.g., U.S. Pat. Nos. 5605816 and 5219759
  • PDGF B see, e.g., U.S. Pat. Nos.
  • Nucleic acid sequences encoding the following therapeutic products are also useful as payloads according to the present invention: VEGF 121, VEGF 165, FGF1, FGF2, FGF4, and FGF5. Sequence information for these molecules is provided elsewhere herein.
  • angiogenic factors are described in various sections herein, including sections E.l .a. and E.l .b.
  • the conjugates provided herein may also be used to deliver a ribozyme, deoxyribozyme, antisense oligonucleotide, and the like to targeted cells.
  • These nucleic acids may be present in the complex of ligand and nucleic acid binding domain or encoded by a nucleic acid in the complex. Alternatively, the nucleic acid may be directly linked to the ligand.
  • Such products include antisense RNA, antisense DNA, ribozymes, triplex-forming oligonucleotides, and oligonucleotides that bind proteins.
  • the nucleic acids can also include RNA trafficking signals, such as viral packaging sequences (see, e.g., Sullenger et al.
  • Nucleic acids and oligonucleotides for use as described herein can be synthesized by any method known to those of skill in this art (see, e.g., WO 93/01286, U.S. Application Serial No. 07/723,454; U.S. Patent No. 5,218,088; U.S. Patent No. 5,175,269; U.S. Patent No. 5,109,124).
  • Identification of oligonucleotides and ribozymes for use as antisense agents and DNA encoding genes for targeted delivery for genetic therapy involve methods well known in the art. For example, the desirable properties, lengths and other characteristics of such oligonucleotides are well known.
  • Antisense oligonucleotides are typically designed to resist degradation by endogenous nucleolytic enzymes by using such linkages as: phosphorothioate, methylphosphonate, sulfone, sulfate, ketyl, phosphorodithioate, phosphoramidate, phosphate esters, and other such linkages (see, e.g., Agrwal et al., Tetrahedron' Lett. 25:3539-3542 (1987); Miller et al., J. Am. Chem. Soc. 95:6657-6665 (1971); Stec et al., Tetrahedron Lett. 26:2191-2194 (1985); Moody et al., Nucl.
  • Antisense nucleotides are oligonucleotides that bind in a sequence- specific manner to nucleic acids, such as mRNA or DNA. When bound to mRNA that has complementary sequences, antisense prevents translation of the mRNA (see, e.g., U.S. Patent No. 5,168,053 to Altman et al.; U.S. Patent No. 5,190,931 to Inouye, U.S. Patent No. 5,135,917 to Burch; U.S. Patent No. 5,087,617 to Smith and Clusel et al. (1993) Nucl. Acids Res. 27:3405-3411, which describes dumbbell antisense oligonucleotides).
  • Triplex molecules refer to single DNA strands that bind duplex DNA forming a colinear triplex molecule, thereby preventing transcription (see, e.g., U.S. Patent No. 5,176,996 to Hogan et al., which describes methods for making synthetic oligonucleotides that bind to target sites on duplex DNA).
  • Particularly useful antisense nucleotides and triplex molecules are molecules that are complementary or bind to the sense strand of DNA or mRNA that encodes a protein involved in cell proliferation, such as an oncogene or growth factor, (e.g., bFGF, int-2, hst-1/K-FGF, FGF-5, hst-2/FGF-6, FGF-8).
  • an oncogene or growth factor e.g., bFGF, int-2, hst-1/K-FGF, FGF-5, hst-2/FGF-6, FGF-8.
  • Other useful antisense oligonucleotides include those that are specific for IL-8 (see, e.g., U.S. Patent No.
  • nucleic acids or nucleic acids that encode antisense can be linked to bFGF for the treatment of psoriasis.
  • Anti-sense oligonucleotides or nucleic acids encoding antisense specific for nonmuscle myosin heavy chain and/or c-myb see, e.g., Simons et al. (1992) Circ. Res. 70:835-843; PCT Application WO 93/01286, U.S. application Serial No. 07/723,454: LeClerc et al. (1991) J. Am. Coll. Cardiol. 17 (2 Suppl A): ⁇ 05A; Ebbecke et al. (1992) Basic Res. Cardiol. 57:585-591) can be targeted by an FGF, for example to inhibit smooth muscle cell proliferation, such as occurs following angioplasty.
  • a ribozyme is an RNA molecule that specifically cleaves RNA substrates, such as mRNA, resulting in inhibition or interference with cell growth or expression.
  • RNA substrates such as mRNA
  • Ribozymes can be targeted to any RNA transcript and can catalytically cleave such transcript (see, e.g., U.S. Patent No. 5,272,262; U.S. Patent No. 5,144,019; and U.S. Patent Nos. 5,168,053, 5,180,818, 5,116,742 and 5,093,246 to Cech et al.).
  • Any such ribozyme or nucleic acid encoding the ribozyme may be delivered to a cell bearing a receptor for a receptor-internalized binding ligand.
  • Ribozymes and the like may be delivered to the targeted cells by DNA encoding the ribozyme linked to a eukaryotic promoter, such as an eukaryotic viral promoter, such that upon introduction into the nucleus, the ribozyme will be directly transcribed.
  • the construct will also include a nuclear translocation sequence, generally as part of the ligand or as part of a linker between the ligand and nucleic acid binding domain.
  • Prodrugs A nucleic acid molecule encoding a prodrug may alternatively be used within the context of the present invention. Prodrugs are inactive in the host cell until either a substrate or an activating molecule is provided. Most typically, a prodrug activates a compound with little or no cytotoxicity into a toxic compound. Three of the more often used prodrug molecules, all of which are suitable for use in the present invention, are nitroreductase, thymidine kinase (e.g. HSVtk) and cytosine deaminase (e.g. E. coli CD).
  • nitroreductase thymidine kinase
  • cytosine deaminase e.g. E. coli CD
  • gene products which either directly or indirectly activate a compound with little or no cytotoxicity into a toxic product may be utilized within the context of the present invention.
  • Representative examples of such gene products include HSVTK (herpes simplex: virus thymidine kinase) and VZVTK (varicella zoster virus thymidine kinase), which selectively phosphorylate certain purine arabinosides and substituted pyrimidine compounds. Phosphorylation converts these substrates (compounds) to metabolites that are cytotoxic or cytostatic.
  • ganciclovir for example, exposure of the drugs ganciclovir, acyclovir, or any of their analogues (e.g., FIAU, FIAC, DHPG) to cells expressing HSVTK allows conversion of the drug into its corresponding active nucleotide triphosphate form.
  • analogues e.g., FIAU, FIAC, DHPG
  • E coli guanine phosphoribosyl transferase which converts thioxanthine into toxic thioxanthine monophosphate (Besnard et al, Mol. Cell. Biol.
  • alkaline phosphatase which converts inactive phosphorylated compounds such as mitomycin phosphate and doxorubicin-phosphate to toxic dephosphorylated compounds
  • fungal e.g., Fusarium oxysporum
  • bacterial cytosine deaminase which converts 5-fluorocytosine to the toxic compound 5-fluorouracil
  • carboxypeptidase G2 which cleaves glutamic acid from para-N-bis (2-chloroethyl) aminobenzoyl glutamic acid, thereby creating a toxic benzoic acid mustard
  • Penicillin-V amidase which converts phenoxyacetabide derivatives of doxorubicin and melphalan to toxic compounds (see generally, Vrudhula et al., J.
  • Herpesviridae thymidine kinases including both primate and non-primate herpesviruses, are suitable.
  • Such he ⁇ esviruses include He ⁇ es Simplex Virus Type 1 (McKnight et al., Nuc. Acids Res 5:5949-5964, 1980), He ⁇ es Simplex Virus Type 2 (Swain and Galloway, J. Virol. 46:1045-1050, 1983), Varicella Zoster virus (Davison and Scott, J. Gen. Virol.
  • thymidine kinase can phosphorylate nucleosides (e.g., dT) and nucleoside analogues such as ganciclovir (9- ⁇ [2-hydroxy- 1 -(hydroxymethyl) ethoxyl methyl ⁇ guanosine), famciclovir, buciclovir, penciclovir, valciclovir, acyclovir (9-[2-hydroxy ethoxy)methyl] guanosine), trifluorothymidine, l-[2-deoxy, 2-fluoro, beta-D-arabino furanosyl]-5-iodouracil, ara-A (adenosine arabinoside, vivarabine), 1 -beta-D-arabinofuranoxyl thymine, 5-ethyl-2'- deoxyuridine, 5-iodo-5'
  • nucleosides e.g., dT
  • gene products may render a cell susceptible to toxic agents.
  • Such products include tumor necrosis factor, viral proteins, and channel proteins that transport drugs.
  • a cytocide-encoding agent may be constructed as a prodrug, which when expressed in the proper cell type is processed or modified to an active form.
  • the saporin gene may be constructed with an N- or C-terminal extension containing a protease-sensitive site. The extension renders the protein inactive and subsequent cleavage in a cell expressing the appropriate protease restores enzymatic activity.
  • Tumor Suppressor Genes The definition of a tumor suppressor gene has recently been broadened to include genes (and their products) which are subject to frequent downregulation in cancer, suggestive of an important tumor-suppressing activity despite the lack of mutation. Examples of the foregoing include cell adhesion molecules such as E-cadherin (GenBank Accession No. Z18923), which play a role in tissue development and epithelial cell differentiation. E-cadherin expression correlates with epithelial differentiation, whereas loss of E-cadherin expression promotes epithelial dedifferentiation and invasiveness of human carcinoma cells. Thus, the restoration of E- cadherin function prevents invasiveness of epithelial tumor cells.
  • E-cadherin GeneBank Accession No. Z18923
  • BGP biliary glycoprotein
  • tumor-suppressor genes useful according to the present invention include the following. It should be noted, however, that this list is not exhaustive, only exemplary: Rb (GenBank Accession No. M15400); p53 (GenBank Accession Nos. X02469, M60950); CDKN2/P16/MTS1 (GenBank Accession No. S78535,U12818); PTEN/MMAC1 (GenBank Accession No. U92436); APC (GenBank Accession No. M74088); p33INGl (GenBank Accession No. AF001954); Smad4 (GenBank Accession No. U59914); maspin (GenBank Accession No.
  • VHL von Hippel-Lindau
  • WTl Wilms tumor
  • Binl GeneBank Accession No. U68485); Menl (GenBank Accession Nos. U93237, U93326); Neurofibromatosis 2 (NF2) (GenBank Accession No. L27065); MXI1 (GenBank Accession No. L07648): and FHIT (GenBank Accession No. U46922).
  • VEGF vascular growth factor
  • VEGF-related proteins and polypeptides are particularly useful for such applications and include the following: VEGF (Bovine; GenBank Accession No. M32976); VEGF (Bovine; GenBank Accession No. M31836); VEGF-C (GenBank Accession No. X94216); VEGF-B (GenBank Accession No. U48801); VEGF (GenBank Accession No.
  • X62568 Angiopoietin-1 (GenBank Accession No. U83508); Angiogenin (GenBank Accession No. Ml 1567); IGF-1 (GenBank Accession No. X03563); IGF-II (GenBank Accession Nos. X03562, M13970, M141 16, M14117, M141 18); HGF (GenBank Accession Nos. X16323, S80567); PDGF A (GenBank Accession No. X03795); PDGF B (GenBank Accession Nos. X02744, X0281 1); TGFB1 (GenBank Accession No. A23751); TGFB2 (GenBank Accession No. A23752); and TGFB3 (GenBank Accession No. A23753).
  • Still other useful therapeutic nucleotide sequences encode the following molecules - many of which are particularly useful in the repair of connective tissue, such as bone: PTH (GenBank Accession Nos. J00301, V00597); BMP1 (GenBank Accession Nos. M22488, Y08723; see also U.S. Pat. No. 5,108.922); BMP2(GenBank Accession No. M22489; also see U.S. Pat. No. 5,013,649); BMP3 (GenBank Accession No. M22491 ; see also U.S. Pat. No. 5,116,738); BMP5 (see U.S. Pat. Nos. 5,635,373 and 5,106,748); BMP6 (see U.S. Pat. No.
  • BMP7 see U.S. Pat. No. 5,141 ,905
  • BMP8 see U.S. Pat. No. 5,688,678
  • BMP10 see U.S. Pat. No. 5637480
  • BMP1 1 see U.S. Pat. No. 5639638
  • mammalian BMPs see U.S. Pat. No. 5,620,867
  • tissue differentiation affecting factor see U.S. Patent No. 5679783
  • mo ⁇ hogenic protein OP-3 see U.S. Patent No. 56521 18
  • osteoinductive factors see U.S. Patent No. 4877864
  • osteogenic proteins see U.S. Patent Nos. 5,106,626, 4,968,590, and RE35694
  • Xenopus BMPs see U.S. Pat. No. 5,670,338).
  • BMPs bone mo ⁇ hogenic proteins
  • PTH parathyroid hormone
  • IGFs insulin-like growth factors
  • BMP1 GenBank Accession Nos. M22488, Y08723
  • BMP2 GenBank Accession No. M22489
  • BMP3 GenBank Accession No. M22491
  • IGF-1 GenBank Accession No. X03563
  • IGF-II GeneBank Accession Nos. X03562, Ml 3970, M141 16, M141 17, M14118.
  • Sequences encoding other BMPs such as BMP4, BMP5, BMP6, and the like are also useful as disclosed herein.
  • Apoptosis-Inducing Agents There are many agents, both of a chemical and proteinaceous nature, that can induce apoptosis. Therefore, apoptosis-inducing agents are also therapeutic agents within the context of the present invention.
  • nucleotide sequences which encode such agents which sequences may be delivered with high specificity using the vectors of the present intention, include the following. As before, this listing is exemplary and is neither exhaustive nor limiting of the invention: p53 (GenBank Accession Nos. X02469, M60950); c-myc (GenBank Accession No. E01841); TNF- alpha (GenBank Accession No. E02870); Fas ligand (GenBank Accession No.
  • a cytocide-encoding agent is a nucleic acid molecule (e.g., DNA or RNA) that, upon internalization by a cell, and subsequent transcription (if DNA) and[/or] translation into a cytocidal agent, is cytotoxic or cytostatic, to a cell, for example, by inhibiting cell growth through interference with protein synthesis or through disruption of the cell cycle.
  • a nucleic acid molecule e.g., DNA or RNA
  • Cytocides include saporin, the ricins, abrin, gelonin, other ribosome inactivating proteins, Pseudomonas exotoxin, diphtheria toxin, angiogenin, tritin, dianthins 32 and 30, momordin, pokeweed antiviral protein, mirabilis antiviral protein, bryodin, angiogenin, and shiga exotoxin, as well as other cytocides that are known to those of skill in the art. Inhibitors of cell cycle are well known.
  • DNA molecules that encode an enzyme that results in cell death or renders a cell susceptible to cell death upon the addition of another product are preferred.
  • saporin is an enzyme that cleaves rRNA and inhibits protein synthesis.
  • Other enzymes that inhibit protein synthesis are especially well suited for use in the present invention.
  • the product may be a ribozyme, antisense, or other nucleic acid molecule that causes cell death.
  • Ribosome-inactivating proteins which include ricin, abrin, and saporin, are plant proteins that catalytically inactivate eukaryotic ribosomes. Ribosome- inactivating proteins inactivate ribosomes by interfering with the protein elongation step of protein synthesis.
  • the ribosome-inactivating protein saporin also referred to as SAP
  • SAP ribosome-inactivating protein saporin
  • Saporin proteins for use in this invention have amino acid sequences found in the natural plant host Saponaria officinalis (e.g., SEQ ID NO. 22) or modified sequences, such as amino acid substitutions, deletions, insertions or additions, but that still express substantial ribosome inactivating activity.
  • SEQ ID NO. 22 amino acid sequences found in the natural plant host Saponaria officinalis
  • modified sequences such as amino acid substitutions, deletions, insertions or additions, but that still express substantial ribosome inactivating activity.
  • molecular isoforms of the protein are also known. Any of these saporin proteins or modified proteins that are cytotoxic may be used in the present invention.
  • saporin polypeptides include other members of the multi-gene family coding for isoforms of saporin-type ribosome inactivating proteins including SO-1 and SO-3 (Fordham-Skelton et al., Mol. Gen. Genet. 227: 134-138, 1990), SO-2 (see, e.g., U.S. Application Serial No. 07/885,242; GB 2,216,891 ; see also Fordham-Skelton et al., Mol. Gen. Genet. 229:460-466, 1991), SO-4 (see, e.g., GB 2,194,241 B; see also Lappi et al., Biochem. Biophys. Res. Commun.
  • SO-1 and SO-3 Forms of saporin-type ribosome inactivating proteins
  • SO-2 see, e.g., U.S. Application Serial No. 07/885,242; GB 2,216,891 ; see also Fordham-Skelton et
  • Ribosome inactivating protein encoding DNA sequences may use mammalian-preferred codons (SEQ. ID NO. 23). Preferred codon usage as exemplified in Current Protocols in Molecular Biology, infra, and Zhang et al. (Gene 705:61, 1991) for mammals, yeast, Drosophila, E. coli, and primates is established for saporin sequences.
  • cytocides that inhibit protein synthesis are useful in the present invention.
  • the gene sequences for these cytocides may be isolated by standard methods, such as PCR, probe hybridization of genomic or cDNA libraries, antibody screenings of expression libraries, or clones may be obtained from commercial or other sources.
  • the DNA sequences of many of these cytocides are well known, including ricin A chain (GenBank Accession No. X02388); maize ribosome inactivating protein (GenBank Accession No. L26305); gelonin (GenBank Accession No. L12243; PCT Application WO 92/03155; U.S. Patent No. 5,376,546; diphtheria toxin (GenBank Accession No.
  • KOI 722 trichosanthin (GenBank Accession No. M34858); tritin (GenBank Accession No. D13795); pokeweed antiviral protein (GenBank Accession No. X78628); mirabilis antiviral protein (GenBank Accession No. D90347); dianthin 30 (GenBank Accession No. X59260); abrin (GenBank Accession No. X55667); shiga (GenBank Accession No. Ml 9437) and Pseudomonas exotoxin (GenBank Accession Nos. K01397, M23348).
  • DNA molecules encoding these proteins may be synthesized, and may contain mammalian-preferred codons.
  • the therapeutic product-encoding agent such as saporin DNA sequence
  • the plasmid can optionally include sequences, such as origins of replication that allow for the extrachromosomal maintenance of the saporin-containing plasmid, or can be designed to integrate into the genome of the host (as an alternative means to ensure stable maintenance in the host).
  • origins of replication that allow for the extrachromosomal maintenance of the saporin-containing plasmid
  • other cytocides that inhibit protein synthesis are useful in the present invention.
  • the gene sequences for these cytocides may be isolated by standard methods, such as PCR, probe hybridization of genomic or cDNA libraries, antibody screenings of expression libraries, or clones may be obtained from commercial or other sources.
  • ricin A chain GenBank Accession No. X02388
  • maize ribosome inactivating protein GenBank Accession No. L26305
  • gelonin GeneBank Accession No. L12243; PCT Application WO 92/03155; U.S. Patent No. 5,376,546; diphtheria toxin (GenBank Accession No. KOI 722); trichosanthin (GenBank Accession No. M34858); tritin (GenBank Accession No. D13795); pokeweed antiviral protein (GenBank Accession No. X78628); mirabilis antiviral protein (GenBank Accession No.
  • DNA molecules encoding these proteins may be synthesized, and may contain mammalian-preferred codons.
  • a therapeutic product-encoding agent of the present invention such as a DNA sequence, is generally introduced into a plasmid in operative linkage with an appropriate promoter for expression of polypeptides in the recipient cells.
  • the plasmid can optionally include sequences such as origins of replication that allow for the extrachromosomal maintenance of the saporin-containing plasmid, or can be designed to integrate into the genome of the host (as an alternative means to ensure stable maintenance in the host).
  • constructs will also contain elements necessary for transcription and translation.
  • the choice of the promoter will depend upon the cell type to be transformed and the degree or type of control desired. Promoters can be constitutive or active in any cell type, tissue specific, cell specific, event specific, temporal-specific or inducible.
  • Cell-type specific promoters and event type specific promoters are preferred.
  • constitutive or nonspecific promoters include the SV40 early promoter (U.S. Patent No. 5,118,627), the SV40 late promoter (U.S. Patent No. 5,118,627), CMV early gene promoter (U.S. Patent No. 5,168,062), and adenovirus promoter.
  • cellular promoters are also amenable within the context of this invention. In particular, cellular promoters for the so-called housekeeping genes are useful. Viral promoters are preferred, because generally they are stronger promoters than cellular promoters.
  • Tissue specific promoters are particularly useful for expression in a wide variety of cells, including endothelial and smooth muscle cells. By using one of this class of promoters, an extra margin of specificity can be attained.
  • SMC-specific promoters are particularly useful in targeting proliferative diseases involving SMC.
  • FGFR promoter, EGFR promoter, PDGF receptor promoter, integrin receptor promoters, ⁇ -actin promoter, SMI and SM2 myosin heavy chain promoters, calponin-hl promoter, SM22 alpha angiotensin receptor promoter are useful within the context of this invention.
  • tissue-specific promoters include alpha-crystalline, tyrosinase, ⁇ -fetoprotein, prostate specific antigen, CEA, ⁇ -actin, VEGF receptor, erbB-2, C-myc, cyclin D, FGF receptor, gamma-crystalline promoter, tek, tie, urokinase receptor, E- selectin, P-selectin, VCAM-1, endoglin, endosialin, alpha v integrin, ⁇ 3 integrin, endothelin-1, ICAM-3, E9, von Willebrand Factor, CD-44, CD40, vascular endothelial cadherin, notch 4 and high molecular weight melanoma-associated antigen.
  • Endothelial-specific promoters are especially useful in targeting proliferative diseases involving endothelial cells.
  • the following promoters are especially useful: VEGF-receptor promoter (Morishita et al., J. Biol. Chem. 270:27948, 1995; GenBank Accession No. X89776); FGF receptor promoter; TEK or tie 2 promoter, a receptor tyrosine kinase expressed predominately in endothelium of actively growing blood vessels (Huang et al., Oncogene 77:2097, 1995; GenBank Accession No.
  • HSENDOG endosialin, expressed preferentially in tumor capillaries (Rettig et al., PNAS 59: 10832, 1992); alpha V-beta3 integrin (Villa-Garcia et al, Blood 5:668, 1994; Donahue et al., BBA 7279:228, 1994); endothelin-1, a growth factor for endothelial cells (GenBank Accession No. M25377; GenBank Accession No. J04819; GenBank Accession No. J05489); ICAM-3, expressed in tumor endothelium (Patey et al.. Am. J. Pathol. 745:465, 1996; Fox et al., J. Path.
  • GenBank Accession No. S50015 E9 antigen, upregulated in tumor endothelium (Wang et al., Int. J. Cancer 54:363, 1993); von Willebrand factor (Roboudi and Lynch, Mol. Cell. Biol. 14:999, 1994; GenBank Accession No. HUMVWFI; GenBank Accession No. HUMVWFA); CD44 (Hofmann et al., Cancer Res. 55:1516, 1993; Maltzman et al., Mol. Cell. Biol. 76:2283, 1996; GenBank Accession No. HUMCD44B); CD40 (Pammer et al., Am. J. Pathol.
  • vascular-endothelial cadherin highly expressed in endothelial cells of hemangiomas (Martin-Padura et al., J. Pathol. 775:51, 1995); notch 4 (Uyttendaele et al., Development 122:2251, 1996) and high molecular weight melanoma-associated antigen.
  • Inducible promoters may also be used. These promoters include MMTV
  • LTR PCT WO 91/13160
  • inducible by dexamethasone metallothionein
  • inducible by heavy metals metallothionein
  • promoters with cAMP response elements inducible by cAMP.
  • the nucleic acid may be delivered to a cell and will remain quiescent until the addition of the inducer. This allows further control on the timing of production of the gene product.
  • Event-type specific promoters are active or up-regulated only upon the occurrence of an event, such as tumorigenicity or viral infection.
  • the HIV LTR is a well known example of an event-specific promoter.
  • the promoter is inactive unless the tat gene product is present, which occurs upon viral infection.
  • Some event-type promoters are also tissue-specific.
  • promoters that are coordinately regulated with a particular cellular gene may be used.
  • promoters of genes that are coordinately expressed when a particular FGF receptor gene is expressed may be used. Then, the nucleic acid will be transcribed when the FGF receptor, such as FGFR1, is expressed, and not when FGFR2 is expressed.
  • This type of promoter is especially useful when one knows the pattern of FGF receptor expression in a particular tissue, so that specific cells within that tissue may be killed upon transcription of a cytotoxic agent gene without affecting the surrounding tissues.
  • the construct must contain the sequence that binds to the nucleic acid binding domain.
  • the target nucleotide sequence may be contained within the coding region of the cytocide, in which case, no additional sequence need be inco ⁇ orated. Additionally, it may be desirable to have multiple copies of target sequence. If the target sequence is coding sequence, the additional copies must be located in non-coding regions of the cytocide- encoding agent.
  • the target sequences of the nucleic acid binding domains are typically generally known. If unknown, the target sequence may be readily determined. Techniques are generally available for establishing the target sequence (e.g., see PCT Application WO 92/05285 and U.S. Serial No. 586,769).
  • repressor sequences In addition to the promoter, repressor sequences, negative regulators, or tissue-specific silencers may be inserted to reduce non-specific expression of the cytocide or prodrug. Multiple repressor elements may be inserted in the promoter region. Repression of transcription is independent on the orientation of repressor elements or distance from the promoter.
  • One type of repressor sequence is an insulator sequence.
  • Negative regulatory elements have been characterized in the promoter regions of a number of different genes.
  • the repressor element functions as a repressor of transcription in the absence of factors, such as steroids, as does the NSE in the promoter region of the ovalbumin gene (Haecker et al., Mol. Endocrinology 9:1113-1126, 1995).
  • These negative regulatory elements bind specific protein complexes from oviduct, none of which are sensitive to steroids.
  • Three different elements are located in the promoter of the ovalbumin gene. Oligonucleotides corresponding to portions of these elements repress viral transcription of the TK reporter.
  • One of the silencer elements shares sequence identity with silencers in other genes (TCTCTCCNA).
  • Repressor elements have also been identified in the promoter region of collagen II gene. Gel retardation studies showed that nuclear factors from HeLa cells bind specifically to DNA fragments containing the silencer region, whereas chondrocyte nuclear extracts did not show any binding activity (Savanger et al., J. Biol. Chem. 265(12):6669-6674, 1990). Repressor elements have also been shown to regulate transcription in the carbamyl phosphate synthetase gene (Goping et al., Nucleic Acid Research 25(10): 1717-1721, 1995). This gene is expressed in only two different cell types, hepatocytes and epithelial cells of the intestinal mucosa.
  • Negative regulatory regions have also been identified in the promoter region of the choline acetyltransferase gene, the albumin promoter (Hu et al., J. Cell Growth Differ. 5(9):577-588, 1992), phosphoglycerate kinase (PGK-2) gene promoter (Misuno et al., Gene 119(2):293-291 , 1992), and in the 6-phosphofructo-2-kinase/fructose-2, 6-bisphosphatase gene, in which the negative regulatory element inhibits transcription in non-hepatic cell lines (Lemaigre et al., Mol. Cell Biol. 77(2):1099-1 106).
  • Tse-1 has been identified in a number of liver specific genes, including tyrosine aminotransferase (TAT). TAT gene expression is liver specific and inducible by both glucocorticoids and the cAMP signaling pathway.
  • the cAMP response element (CRE) has been shown to be the target for repression by Tse-1 and hepatocyte-specific elements (Boshart et al., Cell 67(5):905-916, 1990).
  • elements that increase the expression of the desired product are inco ⁇ orated into the construct.
  • Such elements include internal ribosome binding sites (IRES; Wang and Siddiqui, Curr. Top. Microbiol Immunol 205:99, 1995; Ehrenfeld and Semler, Curr. 'Top. Microbiol. Immunol. 205:65, 1995; Rees, et al., Biotechniques 20:102, 1996; Sugimoto et al., Biotechnology 12:694, 1994).
  • IRES increase translation efficiency.
  • other sequences may enhance expression. For some genes, sequences especially at the 5' end inhibit transcription and/or translation. These sequences are usually palindromes that can form hai ⁇ in structures.
  • any such sequences in the nucleic acid to be delivered are generally deleted.
  • Expression levels of the transcript or translated product are assayed to confirm or ascertain which sequences affect expression.
  • Transcript levels may be assayed by any known method, including Northern blot hybridization, Rnase probe protection and the like.
  • Protein levels may be assayed by any known method, including ELISA.
  • Other elements may be inco ⁇ orated into the construct.
  • the construct includes a transcription terminator sequence, including a polyadenylation sequence, splice donor and acceptor sites, and an enhancer.
  • Other elements useful for expression and maintenance of the construct in mammalian cells or other eukaryotic cells may also be inco ⁇ orated (e.g., origin of replication). Because the constructs are conveniently produced in bacterial cells, elements that are necessary or enhance propagation in bacteria are inco ⁇ orated. Such elements include an origin of replication, selectable marker and the like (see discussion below).
  • An additional level of control for initiating expression of the nucleic acid only in appropriate cells or enhancing uptake of complex is the delivery of two constructs, one of which encodes the cytocide and the other construct encodes a second gene that controls expression of the promoter driving the cytocide or prodrug or enhances uptake of the complexes into tumor masses or other target cells.
  • the cytocide encoding agent is controlled by a promoter, such as a heat shock promoter.
  • the second construct is a gene, such as a gene that elicits SOS pathway under control of a tumor-specific promoter.
  • the two constructs are co-delivered or sequentially delivered. When delivered into tumor cells, the SOS gene is expressed and results in causing expression of the cytocide-encoding agent. In this case, the two constructs could be merged into one construct.
  • the first construct is a cytocide gene under control of a promoter, such as those described above.
  • the second construct comprises a different promoter controlling expression of a gene, such as IL-2, that induces leakiness in a tumor mass to allow better penetration.
  • a gene such as IL-2
  • the constructs are plasmid vectors.
  • a preferred construct is a modified pNASS vector (Clontech, Palo Alto, CA). In the modified vector, amp. R gene is replaced by kan. R gene, a poly A signal sequence is added upstream of the mammalian promoter.
  • a T7 promoter is added downstream of the mammalian promoter and upstream of the cytocide or prodrug gene to facilitate verification of cytotoxic activity.
  • Other suitable mammalian expression vectors are well known (.see, e.g., Ausubel et al., 1995; Sambrook et al., supra; Invitrogen catalogue, San Diego, CA; Novagen, Madison, WI; Pharmacia catalogue, Uppsala, Sweden; and others).
  • compositions and methods of the present invention are useful in the treatment and prevention of various diseases. While certain diseases are listed below as examples, it is to be understood that the vectors, complexes, conjugates, and other constructs disclosed herein are useful in a wide variety of therapeutic applications, including the treatment of proliferative disease, quiescent disease, and metabolic disease. As noted previously, the origin of the disease is irrelevant; thus, whether the condition or disease is genetic, congenital, or acquired, the compositions and methods of the present invention are particularly useful in therapeutic interventions.
  • treatment means any manner in which the symptoms of a condition, disorder or disease are ameliorated or otherwise beneficially altered. Treatment also encompasses any pharmaceutical use of the compositions herein, whether said uses are in vivo, ex vivo, or in vitro. As used herein, “amelioration” of the symptoms of a particular disorder refers to any lessening, whether permanent or temporary, lasting or transient, that can be attributed to or associated with administration of the composition. 1. Treatment of tumors
  • compositions of the present invention are used to treat tumors.
  • cell growth is excessive or uncontrolled.
  • Tumors suitable for treatment within the context of this invention include, but are not limited to, breast tumors, gliomas, melanomas, prostate cancer, hepatomas, sarcomas, lymphomas, leukemias, ovarian tumors, thymomas, nephromas, pancreatic cancer, colon cancer, head and neck cancer, stomach cancer, lung cancer, mesotheliomas, myeloma, neuroblastoma, retinoblastoma, cervical cancer, uterine cancer, and squamous cell carcinoma of skin.
  • ligands for these cancers bind to cell surface receptors that are generally preferentially expressed in tumors. Many of these cell surface receptors and their ligands are known. For tumors without such ligand-receptor pairs, ligands, such as antibodies, can be developed.
  • compositions of the present invention Through delivery of the compositions of the present invention, unwanted growth of cells may be slowed or halted, thus ameliorating the disease.
  • the methods utilized herein specifically target and kill or halt proliferation of tumor cells having receptors for the ligand on their surfaces.
  • This treatment is suitable for warm-blooded animals: mammals, including, but not limited to, humans, horses, dogs, and cats, and for non-mammals, such as avian species.
  • Methods of treating such animals with these FGF conjugates are provided herein. These conjugates are shown to be effective against tumors, as well as against other pathophysiological conditions caused by a proliferation of cells which are sensitive to FGF mitogenic stimulation.
  • the conjugates may be used to treat or prevent atherosclerosis and stenosis, a process and the resulting condition that occurs following angioplasty in which the arteries become reclogged.
  • treatment of atherosclerosis involves widening a stenotic vascular lumen, permitting greater blood flow and oxygenation to the distal tissue.
  • these procedures induce a normal wound healing response in the vasculature that results in restenosis.
  • anti- thrombotics/platelet inhibitors and vascular stents effectively address acute/subacute thrombosis and elastic recoil, respectively.
  • no therapy can modify the vascular remodeling that is due to proliferation of smooth muscle cells at the lesion, their deposition of extracellular matrix and the subsequent formation of a neointima. Accordingly, restenosis remains a significant clinical problem.
  • Wound response also occurs after other interventions, such as balloon angioplasty of coronary and peripheral vessels, with or without stenting; carotid endarterectomies; vein grafts; and synthetic grafts in peripheral arteries and arteriovenous shunts.
  • intervention such as balloon angioplasty of coronary and peripheral vessels, with or without stenting; carotid endarterectomies; vein grafts; and synthetic grafts in peripheral arteries and arteriovenous shunts.
  • compositions of the present invention are used to treat angiogenesis-dependent diseases.
  • diseases include angiofibroma, arteriovenous malformations, arthritis, atherosclerotic plaques, corneal graft neovascularization, delayed wound healing, diabetic retinopathy, granulations due to burns, hemangiomas, hemophilic joints, hypertrophic scars, neovascular glaucoma, nonunion fractures, Osler-weber syndrome, psoriasis, pyogenic granuloma, retrolental fibroplasia, scleroderma, solid tumors, trachoma, and vascular adhesions.
  • the present invention provides nucleic acid delivery vehicles that bind to cell surface molecules (receptors) via a ligand and internalize, thus delivering a nucleic acid molecule. 4. Positive Gene Therapy
  • the molecules, constructs and methods of the present invention may also be useful in a wide variety of so-called "positive gene therapy” applications. Since positive gene therapy applications have been discussed in detail in earlier sections of the specification, that information will not be repeated herein. Nevertheless, it should be apparent to one of skill in the art that the molecules, constructs and methods of the present invention are able to effect a treatment upon or within a cell, generally by modifying gene transcription of translation, which makes them ideal in a variety of "positive" gene therapy applications, such as the stimulation of wound repair and bone regrowth.
  • a wide variety of positive gene therapy applications and therapeutic gene products have thus been described above and include such diverse applications as the treatment of ischemia, the promotion of wound healing, the stimulation of bone growth and regrowth, increased vascularization, and the like.
  • the augmentation or replacement of a "defective" or nonfunctional gene with one that produces the desired gene product is also considered “positive” gene therapy, whether one is replacing a dysfunctional or nonfunctional regulatory sequence or a sequence that encodes a structural protein.
  • compositions suitable for administration of the conjugates and complexes provided herein include any such carriers known to those skilled in the art to be suitable for the particular mode of administration.
  • the conjugates and complexes may be formulated as the sole pharmaceutically active ingredient in the composition or may be combined with other active ingredients.
  • the conjugates and complexes can be administered by any appropriate route, for example, orally, parenterally, including intravenously, intradermally, subcutaneously, or topically, in liquid, semi-liquid or solid form and are formulated in a manner suitable for each route of administration.
  • Preferred modes of administration depend upon the indication treated. Dermatological and ophthalmologic indications will typically be treated locally; whereas, tumors and restenosis, will typically be treated by systemic, intradermal, or intramuscular modes of administration.
  • conjugates and complexes herein may be formulated into pharmaceutical compositions suitable for topical, local, intravenous and systemic application.
  • topical administration either by topical administration or by injection is preferred.
  • Time release formulations are also desirable, irrespective of the route or form in which the conjugates and complexes of the present invention are administered.
  • an "effective amount" of a compound for treating a particular disease is an amount that is sufficient to ameliorate, or in some manner reduce the symptoms associated with the disease. Such amount may be administered as a single dosage or may be administered according to a regimen, whereby it is effective. The amount may cure the disease but, typically, is administered in order to ameliorate the symptoms of the disease. Repeated administration may be required to achieve the desired amelioration of symptoms.
  • an effective amount is that amount which, in the composition administered and by the technique administered, provides an amount of therapeutic agent to the involved tissues sufficient to prevent or reduce cell proliferation or to ameliorate quiescent or metabolic disease.
  • concentrations or amounts of the conjugates and complexes that are effective requires delivery of an amount, upon administration, that ameliorates the symptoms or treats the disease.
  • the compositions are formulated for single dosage administration.
  • Therapeutically effective concentrations and amounts may be determined empirically by testing the conjugates and complexes in known in vitro and in vivo systems, such as those described here; dosages for humans or other animals may then be extrapolated therefrom.
  • the conjugate is included in the pharmaceutically acceptable carrier in an amount sufficient to exert a therapeutically useful effect in the absence of undesirable side effects on the patient treated.
  • the conjugates may be delivered as pharmaceutically acceptable salts, esters or other derivatives of the conjugates include any salts, esters or derivatives that may be readily prepared by those of skill in this art using known methods for such derivatization and that produce compounds that may be administered to animals or humans without substantial toxic effects. It is understood that number and degree of side effects depends upon the condition for which the conjugates and complexes are administered. For example, certain toxic and undesirable side effects are tolerated when treating life-threatening illnesses, such as tumors, that would not be tolerated when treating disorders of lesser consequence.
  • concentration of conjugate in the composition will depend on abso ⁇ tion, inactivation and excretion rates thereof, the dosage schedule, and amount administered as well as other factors known to those of skill in the art.
  • the conjugate and complex are substantially pure.
  • substantially pure means sufficiently homogeneous to appear free of readily detectable impurities as determined by standard methods of analysis, such as thin layer chromatography (TLC), gel electrophoresis, high performance liquid chromatography (HPLC), used by those of skill in the art to assess such purity, or sufficiently pure such that further purification would not detectably alter the physical and chemical properties, such as enzymatic and biological activities, of the substance.
  • TLC thin layer chromatography
  • HPLC high performance liquid chromatography
  • the conjugates and complexes may be formulated for local or topical application, such as for topical application to the skin and mucous membranes, such as in the eye, in the form of gels, creams, and lotions and for application to the eye or for intracisternal or intraspinal application.
  • solutions particularly those intended for ophthalmic use, may be formulated as 0.01% -10% isotonic solutions, pH about 5-7, with appropriate salts.
  • the ophthalmic compositions may also include additional components, such as hyaluronic acid.
  • the conjugates and complexes may be formulated as aerosols for topical application (see, e.g., U.S. Patent Nos. 4,044,126, 4,414,209, and 4,364,923).
  • Solutions or suspensions used for parenteral, intradermal, subcutaneous, or topical application can include any of the following components: a sterile diluent, such as water for injection, saline solution, fixed oil, polyethylene glycol, glycerine, propylene glycol or other synthetic solvent; antimicrobial agents, such as benzyl alcohol and methyl parabens; antioxidants, such as ascorbic acid and sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid (EDTA); buffers, such as acetates, citrates and phosphates; and agents for the adjustment of toxicity such as sodium chloride or dextrose.
  • a sterile diluent such as water for injection, saline solution, fixed oil, polyethylene glycol, glycerine, propylene glycol or other synthetic solvent
  • antimicrobial agents such as benzyl alcohol and methyl parabens
  • antioxidants such as ascorbic acid and sodium bisulfit
  • parental preparations can be enclosed in ampules, disposable syringes or multiple dose vials made of glass, plastic or other suitable material.
  • suitable carriers include physiological saline or phosphate buffered saline (PBS), and solutions containing thickening and solubilizing agents, such as glucose, polyethylene glycol, and polypropylene glycol and mixtures thereof.
  • PBS physiological saline or phosphate buffered saline
  • Liposomal suspensions may also be suitable as pharmaceutically acceptable carriers. These may be prepared according to methods known to those skilled in the art.
  • the resulting mixture may be a solution, suspension, emulsion or the like.
  • the form of the resulting mixture depends upon a number of factors, including the intended mode of administration and the solubility of the conjugate in the selected carrier or vehicle.
  • the effective concentration is sufficient for ameliorating the symptoms of the disease, disorder or condition treated and may be empirically determined based upon in vitro and/or in vivo data, such as the data from the mouse xenograft model for tumors or rabbit ophthalmic model. If necessary, pharmaceutically acceptable salts or other derivatives of the conjugates and complexes may be prepared.
  • the active materials can also be mixed with other active materials, that do not impair the desired action, or with materials that supplement the desired action, including viscoelastic materials, such as hyaluronic acid, which is sold under the trademark HEALON (solution of a high molecular weight (MW of about 3 millions) fraction of sodium hyaluronate; manufactured by Pharmacia, Inc. see, e.g., U.S. Patent Nos.
  • HEALON solution of a high molecular weight (MW of about 3 millions) fraction of sodium hyaluronate
  • VISCOAT fluorine-containing (meth)acrylates, such as, lH,lH,2H,2H-hepta- decafluorodecylmethacrylate; see, e.g., U.S. Patent Nos. 5,278.126, 5,273,751 and 5,214,080; commercially available from Alcon Surgical, Inc.), ORCOLON (see, e.g., U.S. Patent Nos.
  • the viscoelastic materials are present generally in amounts ranging from about 0.5 to 5.0%>, preferably 1 to 3% by weight of the conjugate material and serve to coat and protect the treated tissues.
  • the compositions may also include a dye, such as methylene blue or other inert dye, so that the composition can be seen when injected into the eye or contacted with the surgical site during surgery.
  • the conjugates and complexes may be formulated for local or topical application, such as for topical application to the skin and mucous membranes, such as in the eye, in the form of gels, creams, and lotions and for application to the eye.
  • Such solutions particularly those intended for ophthalmic use, may be formulated as 0.01%- 10%) isotonic solutions, pH about 5-7, with appropriate salts.
  • Suitable ophthalmic solutions are known (see, e.g., U.S. Patent No. 5,116,868, which describes typical compositions of ophthalmic irrigation solutions and solutions for topical application).
  • Such solutions which have a pH adjusted to about 7.4, contain, for example, 90-100 mM sodium chloride, 4-6 mM dibasic potassium phosphate, 4-6 mM dibasic sodium phosphate, 8-12 mM sodium citrate, 0.5-1.5 mM magnesium chloride, 1.5-2.5 mM calcium chloride, 15-25 mM sodium acetate, 10-20 mM D.L. -sodium ⁇ -hydroxybutyrate and 5-5.5 mM glucose.
  • the conjugates and complexes may be prepared with carriers that protect them against rapid elimination from the body, such as time release formulations or coatings.
  • Such carriers include controlled release formulations, such as, but not limited to, implants and microencapsulated delivery systems, and biodegradable, biocompatible polymers, such as carboxymethylcellulose, ethylene vinyl acetate, polyanhydrides, polyglycolic acid, polyorthoesters, polylactic acid and others.
  • the composition may be applied during surgery using a sponge, such as a commercially available surgical sponges (see, e.g., U.S. Patent Nos. 3,956,044 and 4,045,238; available from Week, Alcon, and Mentor), that has been soaked in the composition and that releases the composition upon contact with the eye.
  • compositions may also be applied in pellets (such as Elvax pellets - ethylene-vinyl acetate copolymer resin); about 1- 5 ⁇ g of conjugate per 1 mg resin) that can be implanted in the eye during surgery.
  • pellets such as Elvax pellets - ethylene-vinyl acetate copolymer resin
  • the conjugate should be provided in a composition that protects it from the acidic environment of the stomach.
  • the composition can be formulated in an enteric coating that maintains its integrity in the stomach and releases the active compound in the intestine.
  • the composition may also be formulated in combination with an antacid or other such ingredient.
  • Oral compositions will generally include an inert diluent or an edible carrier and may be compressed into tablets or enclosed in gelatin capsules.
  • the active compound or compounds can be inco ⁇ orated with excipients and used in the form of tablets, capsules or troches.
  • Pharmaceutically compatible binding agents and adjuvant materials can be included as part of the composition.
  • the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder, such as macrocrystalline cellulose, gum tragacanth and gelatin; an excipient such as starch and lactose, a disintegrating agent such as, but not limited to, alginic acid and corn starch; a lubricant such as, but not limited to, magnesium stearate; a glidant, such as, but not limited to, colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; and a flavoring agent such as peppermint, methyl salicylate, and fruit flavoring.
  • a binder such as macrocrystalline cellulose, gum tragacanth and gelatin
  • an excipient such as starch and lactose, a disintegrating agent such as, but not limited to, alginic acid and corn starch
  • a lubricant such as, but not limited to, magnesium stearate
  • the dosage unit form When the dosage unit form is a capsule, it can contain, in addition to material of the above type, a liquid carrier such as a fatty oil.
  • dosage unit forms can contain various other materials which modify the physical form of the dosage unit, for example, coatings of sugar and other enteric agents.
  • the conjugates and complexes can also be administered as a component of an elixir, suspension, syrup, wafer, chewing gum or the like.
  • a syrup may contain, in addition to the active compounds, sucrose as a sweetening agent and certain preservatives, dyes and colorings and flavors.
  • the active materials can also be mixed with other active materials that do not impair the desired action, or with materials that supplement the desired action, such as cis-platin for treatment of tumors.
  • the compounds may be packaged as articles of manufacture containing packaging material, one or more conjugates and complexes or compositions as provided herein within the packaging material, and a label that indicates the indication for which the conjugate is provided.
  • a therapeutically effective dosage should produce a serum concentration of active ingredient of from about 0.1 ng/ml to about 500 ⁇ g/ml.
  • the pharmaceutical compositions typically should provide a dosage of from about 0.01 mg/kg to about 100 - 2000 mg/kg of conjugate, depending upon the conjugate.
  • Local application for ophthalmic disorders and dermatological disorders should provide about 1 ng up to 100 ⁇ g, preferably about 1 ng to about 10 ⁇ g, per single dosage administration. It is understood that the amount to administer will be a function of the conjugate selected, the indication treated, and possibly the side effects that will be tolerated.
  • Therapeutically effective concentrations and amounts may be determined for each application herein empirically by testing the conjugates and complexes in known in vitro and in vivo systems (e.g., murine, rat, rabbit, or baboon models), such as those described herein; dosages for humans or other animals may then be extrapolated therefrom.
  • the rabbit eye model is a recognized model for studying the effects of topically and locally applied drugs (see, e.g., U.S. Patent Nos. 5,288,735, 5,263,992, 5,262,178, 5,256,408, 5,252,319, 5,238,925, 5,165,952; see also Mirate et al., Curr. Eye Res. 7:491-493, 1981).
  • the active ingredient may be administered at once, or may be divided into a number of smaller doses to be administered at intervals of time. It is understood that the precise dosage and duration of treatment is a function of the disease being treated and may be determined empirically using known testing protocols or by extrapolation from in vivo or in vitro test data. It is to be noted that concentrations and dosage values may also vary with the severity of the condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions, and that the concentration ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed compositions.
  • a therapeutic nucleotide composition of the present invention comprises a nucleotide sequence encoding a therapeutic molecule as described herein.
  • a therapeutic nucleotide composition may further comprise an enhancer element or a promoter located 5' to and controlling the expression of said therapeutic nucleotide sequence or gene.
  • the promoter is a DNA segment that contains a DNA sequence that controls the expression of a gene located 3' or downstream of the promoter.
  • the promoter is the DNA sequence to which RNA polymerase specifically binds and initiates RNA synthesis (transcription) of that gene, typically located 3' of the promoter.
  • the subject therapeutic nucleotide composition consists of a nucleic acid molecule that comprises at least 2 different operatively linked DNA segments.
  • a recombinant DNA molecule (rDNA) of the present invention is a hybrid DNA molecule comprising at least 2 nucleotide sequences not normally found together in nature.
  • the therapeutic nucleotide composition of the present invention is from about 20 base pairs to about 100,000 base pairs in length.
  • the nucleic acid molecule is from about 50 base pairs to about 50,000 base pairs in length. More preferably the nucleic acid molecule is from about 50 base pairs to about 10,000 base pairs in length. Most preferred is a nucleic acid molecule from about 50 pairs to about 4,000 base pairs in length.
  • the therapeutic nucleotide can be a gene or gene fragment that encodes a protein or peptide that provides the desired therapeutic effect such as replacement of alpha 1 -antitrypsin or cystic fibrosis transmembrane regulator protein and the like.
  • the therapeutic nucleotide can be a DNA or RNA oligonucleotide sequence that exhibits enzymatic therapeutic activity.
  • examples of the latter include antisense oligonucleotides that will inhibit the transcription of deleterious genes or ribozymes that act as site-specific ribonucleases for cleaving selected mutated gene sequences.
  • a therapeutic nucleotide sequence of the present invention may comprise a DNA construct capable of generating therapeutic nucleotide molecules, including ribozymes and antisense DNA, in high copy numbers in target cells, as described in published PCT application No. WO 92/06693 (the disclosure of which is inco ⁇ orated herein by reference).
  • a regulatable promoter is a promoter where the rate of RNA polymerase binding and initiation is modulated by external stimuli. Such stimuli include compositions light, heat, stress and the like. Inducible, suppressible and repressible promoters are regulatable promoters. Regulatable promoters may also include tissue specific promoters. Tissue specific promoters direct the expression of that gene to a specific cell type. Tissue specific promoters cause the gene located 3' of it to be expressed predominantly, if not exclusively in the specific cells where the promoter expressed its endogenous gene.
  • tissue-specific promoter expresses the gene located 3' of it at all, then it is expressed appropriately in the correct cell types as has been reviewed by Palmiter et al., Ann. Rev. Genet. 20: 465-499 (1986).
  • a tissue specific promoter controls the expression of a gene, that gene will be expressed in a small number of tissues or cell types rather than in substantially all tissues and cell types.
  • tissue specific promoters include the immunoglobulin promoter described by Brinster et al., Nature 306: 332-336 (1983) and Storb et al., Nature 310: 238-231 (1984); the elastase-I promoter described by Swift et al., Cell 38: 639-646 (1984); the globin promoter described by Townes et al, Mol. Cell Biol. 5: 1977-1983 (1985), and Magram et al., Mol. Cell. Biol.
  • BTSH beta-thyroid stimulating hormone
  • MMTV mouse mammary tumor virus
  • albumin albumin promoter described by Palmiter et al., Ann. Rev. Genet. 20: 465-499 (1986); the keratin promoter described by Vassar et al., PNAS USA 86: 8565-8569 (1989); the osteonectin promoter described by McVey et al., J. Biol. Chem.
  • compositions of the present invention may contain a physiologically tolerable carrier together with one or more therapeutic nucleotide sequences of this invention, dissolved or dispersed therein as an active ingredient.
  • the composition is not immunogenic or otherwise able to cause undesirable side effects when administered to a mammal or human patient for therapeutic purposes.
  • compositions, carriers, diluents and reagents are used interchangeably and represent that the materials are capable of administration to or upon a mammal without the production of undesirable physiological effects such as nausea, dizziness, gastric upset and the like.
  • compositions designed to preferentially target non-epithelial cells may include an adenovirus-derived protein-ligand conjugate and a therapeutic nucleotide sequence.
  • useful ligands directed to specific receptors include FGF and related ligands (FGFR); the V3 loop of HIV gpl20 (CD4); transferrin (transferrin receptor); LDL (LDL receptors); and deglycosylated proteins (asialoglycoprotein receptor).
  • FGFR FGF and related ligands
  • CD4 transferrin (transferrin receptor); LDL (LDL receptors); and deglycosylated proteins (asialoglycoprotein receptor).
  • Polypeptides having a sequence that includes an amino acid residue sequence selected from the group comprising -EDPGFFNVE- and - EDPGKQLYNVE- are capable of targeting receptors such as the CR2 receptor, and are thus useful in compositions disclosed herein.
  • Useful ligands also include antibodies and attachment sequences, as well as receptors themselves. Antibodies to cell receptor molecules such as integrins and the like, MHC Class I and Class II, asialoglycoprotein receptor, transferrin receptors, LDL receptors, CD4, and CR2 are but a few useful according to the present invention. It is also understood that the ligands typically bound by receptors, as well as analogs to those ligands, may be used as cellular targeting agents as disclosed herein.
  • Exemplary and preferred nucleotide sequences encode an expressible peptide, polypeptide or protein, and may further include an active constitutive or inducible promoter sequence.
  • preferred therapeutic nucleotide sequences according to the present invention are capable ' of delivering HIV antisense nucleotides to latently-infected T cells via CD4.
  • delivery of Epstein-Barr Virus (EBV) EBNa-1 antisense nucleotides to B cells via CR2 is capable of effecting therapeutic results.
  • EBV Epstein-Barr Virus
  • compositions that contains active ingredients dissolved or dispersed therein are well understood in the art.
  • compositions are prepared as injectables either as liquid solutions or suspensions, however, solid forms suitable for solution, or suspensions, in liquid prior to use can also be prepared.
  • the preparation can also be emulsified, or formulated into suppositories, ointments, creams, dermal patches, or the like, depending on the desired route of administration.
  • the active ingredient can be mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient and in amounts suitable for use in the therapeutic methods described herein.
  • Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol or the like and combinations thereof, including vegetable oils, propylene glycol, polyethylene glycol and benzyl alcohol (for injection or liquid preparations); and vaseline, vegetable oil, animal fat and polyethylene glycol (for externally applicable preparations).
  • the composition can contain wetting or emulsifying agents, isotonic agents, dissolution promoting agents, stabilizers, colorants, antiseptic agents, soothing agents and the like additives (as usual auxiliary additives to pharmaceutical preparations), pH buffering agents and the like which enhance the effectiveness of the active ingredient.
  • compositions of the present invention can include pharmaceutically acceptable salts of the components therein.
  • Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the polypeptide) that are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, tartaric, mandelic and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine and the like. Physiologically tolerable carriers are well known in the art.
  • liquid carriers are sterile aqueous solutions that contain no materials in addition to the active ingredients and water, or contain a buffer such as sodium phosphate at physiological pH value, physiological saline or both, such as phosphate-buffered saline. Still further, aqueous carriers can contain more than one buffer salt, as well as salts such as sodium and potassium chlorides, dextrose, polyethylene glycol and other solutes.
  • Liquid compositions can also contain liquid phases in addition to and to the exclusion of water.
  • additional liquid phases are glycerin, vegetable oils such as cottonseed oil, and water-oil emulsions.
  • a therapeutic composition typically contains an amount of a therapeutic nucleotide sequence of the present invention sufficient to deliver a therapeutically effective amount to the target tissue, typically an amount of at least 0.1 weight percent to about 90 weight percent of therapeutic nucleotide sequence per weight of total therapeutic composition.
  • a weight percent is a ratio by weight of therapeutic nucleotide sequence to total composition.
  • 0.1 weight percent is 0.1 grams of DNA segment per 100 grams of total composition.
  • the therapeutic nucleotide compositions comprising synthetic oligonucleotide sequences of the present invention can be prepared using any suitable method, such as, the phosphotriester or phosphodiester methods. See Narang et al., Meth. Enzymol. 68: 90, (1979); U.S. Patent No. 4,356.270; and Brown et al., Meth. Enzymol. 68 :109, (1979).
  • the synthesis of the family members can be conducted simultaneously in a single reaction vessel, or can be synthesized independently and later admixed in preselected molar ratios.
  • nucleotide residues that are conserved at preselected positions of the sequence of the family member can be introduced in a chemical synthesis protocol simultaneously to the variants by the addition of a single preselected nucleotide precursor to the solid phase oligonucleotide reaction admixture when that position number of the oligonucleotide is being chemically added to the growing oligonucleotide polymer.
  • the addition of nucleotide residues to those positions in the sequence that vary can be introduced simultaneously by the addition of amounts, preferably equimolar amounts, of multiple preselected nucleotide precursors to the solid phase oligonucleotide reaction admixture during chemical synthesis. For example, where all four possible natural nucleotides (A,T,G and C) are to be added at a preselected position, their precursors are added to the oligonucleotide synthesis reaction at that step to simultaneously form four variants.
  • Nucleotide bases other than the common four nucleotides (A,T,G or C), or the RNA equivalent nucleotide uracil (U), can be used in the present invention.
  • inosine (I) is capable of hybridizing with A, T and G, but not C.
  • the preselected therapeutic nucleotide composition is designed to contain oligonucleotides that can hybridize to four sequences that vary at one position, several different oligonucleotide structures are contemplated.
  • the composition can contain four members, where a preselected position contains A,T,G or C.
  • the composition can contain two members, where a preselected position contains I or C, and has the capacity the hybridize at that position to all four possible common nucleotides.
  • other nucleotides may be included at the preselected position that have the capacity to hybridize in a non-destabilizing manner with more than one of the common nucleotides in a manner similar to inosine.
  • the reprogrammed viral delivery vehicles may be assessed in any number of in vitro model systems.
  • target cells are grown in culture and incubated with the nucleic acid delivery vehicle.
  • the nucleic acid can encode a reporter, in which case, the reporter product is assayed, or encode a cytocidal product, in which case cell killing is measured.
  • any assayable gene product can be used.
  • reporter genes a wide variety of suitable genes are available. Such reporters include ⁇ - galactosidase, alkaline phosphatse, ⁇ -glucuronidase, large T antigen, any protein for which an antibody exists or can be developed. The choice of a reporter depends, in part, upon the cells being tested.
  • the nucleic acid can encode a cytocidal product. Such products include all those described herein.
  • the delivery vehicles may be assessed in in vivo model systems. Generally, a xenogeneic tumor model system will be used, but other tumor model systems are useful as well. In the xenogeneic system, an immunodeficient mouse, or other immunodeficient animal, is injected with tumor cells, such as human tumor cells. The nucleic acid delivery vehicle is administered and tumor growth is monitored. Any reduction of tumor growth is useful within the context of this invention.
  • KS Kaposi' s sarcoma
  • Consant Recent Results in Cancer Research 139:423-32 (1995)
  • KS Kaposi' s sarcoma
  • Consant Recent Results in Cancer Research 139:423-32 (1995)
  • KS Kaposi' s sarcoma
  • Consant Recent Results in Cancer Research 139:423-32 (1995)
  • KS Kaposi' s sarcoma
  • Consant Current results in Cancer Research 139:423-32 (1995)
  • Effective treatment for KS is currently lacking, with the duration of survival being only 9.9 months with some newer experimental protocols (Gill, et al., J. Clin. Oncol. 74:2353-64 (1996)).
  • KS cells are refractory to transduction by a variety of viral and non-viral vector systems, thus limiting even those gene therapy approaches based on loco-regional gene delivery.
  • a derivative vector has now been developed which possesses the capacity to target KS cells and is further described hereinbelow.
  • KSY-1 The human AIDS-KS cell line KSY-1 (Lunardi-Iskandar, et al., J. Natl. Cancer Inst. 57:974-981 (1995)), RW376, and CVU-1 were obtained for use as described herein.
  • KS-SLK Siegal, et al., Cancer 65:492-498 (1990) was derived from an oral KS lesion in an immunosuppressed patient and was also obtained for use as described below. All cell lines are grown in Dulbecco's Modified Eagle s Medium/Ham s
  • F 12 at 1 :1 ratio by weight (DMEM/F12 Cellgro Mediatech, Washington, DC) + 10% fetal bovine serum (FBS, Hyclone, Logan, UT) + 2 mM glutamine (Cellgro Mediatech) + penicillin/streptomycin (Cellgro Mediatech) at 37°C in 5% CO 2 (CM). Media changes are performed every 3-4 days. Cells are passaged using Trypsin/EDTA (Cellgro Mediatech) when cells achieved confluency. Viability is determined in confluent cells exposed to trypsin EDTA, centrifuged at 800 x g in the presence of CM, and counted using a hemocytometer after trypan blue exclusion. Ganciclovir (GCV; Cytovene) is purchased from Hoffman Laboratories (Nutley, NJ). Tissue culture plates and flasks were manufactured by Nunclon (Denmark). 2. Anti-Knob Antibodies and Fragments
  • hybridomas are generated by standard techniques after immunization of mice with intact Ad5 followed by two rounds of immunization with purified Ad5 knob (native or recombinant).
  • Ad5 knob native or recombinant
  • one clone designated 1D6.14, was chosen for further study and the mAb is purified from ascites fluid by affinity chromatography using an immobilized protein A column.
  • Anti-knob mAbs are generated by established methods (see, e.g., Harlow and Lane, Antibodies, a Laboratory Manual, Cold Spring Harbor Laboratory, NY (1988)) after immunization of BALB/c mice with Ad5, followed by two rounds of immunization with purified recombinant Ad5 knob (see Henry, et al., J. Virol. 68:5239- 46 (1994)). Sensitized lymphocytes are fused with P3-X63-Ag8.653 cells. The reactivity of the hybridoma supernatants with trimeric Ad5 knob is determined in an ELISA. The ability of the hybridoma supernatants to neutralize Ad5 infection is assayed by endpoint CPE.
  • the 1D6.14 hybridoma cells are injected into BALB/c mice and ascites fluid collected (Harlow and Lane, Id. (1988)).
  • Purification of the mAb is performed by affinity chromatography on immobilized protein A using an ImmunoPure IgG purification kit (Pierce, Rockford, IL).
  • Fab fragments are prepared and purified by digestion of 1D6.14 on immobilized papain followed by affinity chromatography on immobilized protein A, using an ImmunoPure Fab purification kit (Pierce). After extensive dialysis against phosphate-buffered saline (PBS), the concentrations of the purified mAb and Fab fragment are determined using the Bio-Rad protein assay (Bio- Rad, Hercules, CA).
  • the Fab fragment of the antibody rather than the intact immunoglobulin.
  • the two antigen- binding arms of the parent antibody might be prevented from crosslinking different viruses to form large complexes that might prove refractory to cellular uptake.
  • Intact 1D6.14 is digested with papain and the Fab fragments are purified. Both the parent antibody, 1D6.14, and the Fab fragment are capable of neutralizing adenovirus infection in a dose-dependent manner, whereas a control antibody failed to block infection. (See Douglas et al., Id. (1996).)
  • AdCMV-Luc firefly luciferase
  • AdCMV HMVtk CMV-driven he ⁇ es simplex thymidine kinase gene
  • AdCAG-GFPS65T an enhanced variant of green fluorescent protein
  • Recombinant adenoviruses are propagated on the permissive 293 cell line, purified using a cesium chloride gradient, and subsequently plaque titered on 293 cells employing standard methods (Graham and Prevec, in Methods in Mol. Biol. 7: Gene Transfer and Expression Techniques, Murray and Walker (eds.), Humana Press, Clifton, 1991, pp. 109-129).
  • Virus stocks are stored frozen at -80°C until use.
  • the Fab-FGF2 conjugate is constructed by linking modified recombinant basic fibroblast growth factor (FGF2-3; Sosnowski, et al., J. Biol. Chem. 277:33647-
  • the Fab is derivatized with the heterobifunctional crosslinking reagent S-2-pyridyl disulfide (SPDP; Pharmacia, Uppsala, Sweden) at a 1 :3 molar ratio and incubated at room temperature for 30 minutes to yield a modified Fab fragment (PDP-Fab).
  • SPDP heterobifunctional crosslinking reagent S-2-pyridyl disulfide
  • the PDP-Fab is dialyzed to remove unbound linker.
  • Purified FGF2 is generated as previously described (Sosnowski et al., Id. (1996)), then reduced and mixed at a 2: 1 molar ratio with PDP-Fab, and incubated at 4°C for 16 hrs with shaking.
  • FGF2 is prepared and reduced as follows.
  • a 155-amino-acid human FGF2 in which the cysteine at position 96 is mutagenized to serine ( Lappi, D.A., Matsunami, R., Martineau, D., and Baird, A. (1993) Anal. Biochem. 272:446-451), may be used as described in the present invention. It should be appreciated that this molecule is described as exemplary, and not as a limitation; other variants of FGF and polypeptides reactive with the FGF receptor complex are useful according to the present invention.
  • FGF2 is expressed in E. coli, and purified to homogeneity by conventional chromatography techniques.
  • FGF2 (C96S; may also be referred to herein as FGF2-3) is adjusted to pH 7.0 by adding Tris-base. FGF2 is then reduced by adding MTG to a final concentration of 20 mM. The reaction is allowed to incubate at room temperature for 30 minutes. Excess MTG is removed by passing FGF2 (C96S) over a PD-10 column (Pharmacia). Running buffer is 10 mM NaOAc/ HOAc pH 5.4 containing 0.14 M NaCl, ImM EDTA.
  • the Fab is thiolated essentially as follows. 1.6 mg of Fab is dialyzed against NaPO4 (0.1 M Sodium Phosphate buffer, pH 7.5 containing 0.1 M NaCl and 1.0 mM EDTA) at 1 :250 (v/v) for 3 hr with 2 changes of buffer. The dialyzed Fab fragment is centrifuged at 14,000 ⁇ m (Eppendorf centrifuge 5415C) for 10 minutes and the supernatant collected. The Fab fragment is derivitized with SPDP (Pharmacia), (SPDP dissolved in ethanol) , at a molar ratio of 1 :3 for 30 minutes at room temperature with occasional stirring.
  • SPDP Pharmaacia
  • FGF2 and the Fab are carried out essentially as follows. FGF2 and PDP-Fab are mixed at a molar ratio of 2: 1 at pH 7.5 and incubated at 4 C for 16 hours with shaking. An aliquot of the reaction mixture is analysed by SEC-HPLC. The conjugate is purified over a Heparin-Sepharose column ( 1 ml Heparin Hi-Trap, Pharmacia) to remove unconjugated Fab fragment. The material is loaded onto the column in 10 mM Tris pH 7.4 and washed in the same buffer plus 0.6 M NaCl.
  • the conjugate When the absorbance returns to background the conjugate is eluted from the column in the same buffer containing 2 M NaCl. An aliquot of the 2M eluate is analyzed by SEC- HPLC. The 2M eluate is loaded onto Sephacryl S-100 to remove free FGF2 and buffer exchanged into PBS, pH 7.4. Fractions 17-26 are pooled as final purified Fab-FGF2 material.
  • the conjugation reaction is monitored by reducing an aliquot of the reaction mixture with DTT and monitoring the absorbance of PDP at 343 nM.
  • Purified Fab-FGF2, FGF2 and Fab are analyzed by SDS-PAGE (12%) and by Western analysis using an antibody generated against FGF2.
  • the material is assayed in an endothelial proliferation assay.
  • Bovine aortic endothelial cells are seeded at 1000 cells/well on a 24 well flat-bottom tissue culture plate in DMEM (Biowhittaker), 10% FCS (Hyclone), 50 mg/ml Gentamycin (JRH Biosciences), and 2mM L-glutamine (Biowhittaker). The following day serial dilutions of FGF2 and Fab- FGF2 ranging from 6 ng/ml to 10 pg/ml, are added to the wells in triplicate. After 48 hours the media is removed and 1.5 mis of fresh media containing the same concentrations of FGF2 and Fab-FGF2 are added to the cells.
  • the results of the proliferation assay reveal that conjugation of the Fab fragment to FGF2 did not interfere with FGF2's ability to bind to its receptor and stimulate proliferation.
  • the conjugate is purified over a heparin-Sepharose column (Pharmacia) by loading in lOmM Tris HC1, pH 7.4, washing with 10 mM Tris HC1/0.6 mM NaCl, pH 7.4 and eluting in 10 mM Tris HC1/2M NaCl, pH 7.4.
  • the eluant is separated over a Sephacryl S-100 column equilibrated with Dulbecco s phosphate-buffered saline (PBS, pFI 7.4) to remove excess salt and unconjugated protein.
  • PBS Dulbecco s phosphate-buffered saline
  • the size and activity of the conjugate is subsequently analyzed by western blot ( Immunoblotting, in Antibodies: A Laboratory Manual, Chapter 12, Harlow and Lane (eds.), Cold Spring Harbor Laboratory (1988)) and enzyme-linked immunoassay (ELISA) analysis (see Immunoassays, in Antibodies: A Laboratory Manual, Chapter 14, Harlow and Lane (eds.), Cold Spring Harbor Laboratory (1988)).
  • western blot Immunoblotting, in Antibodies: A Laboratory Manual, Chapter 12, Harlow and Lane (eds.), Cold Spring Harbor Laboratory (1988)
  • ELISA enzyme-linked immunoassay
  • adenoviral transduction 24,000 cells of each KS cell line are plated in triplicate into each well of a 12-well plate in the presence of 1 ml of CM. The cells are incubated overnight to allow cells to adhere. Infection complexes are mixed in a final volume of 50ul containing: (1) adenovirus (AdCMV-Luc or Ad-CAG-GFPS65T) at 50 plaque forming units (pfu)/cell; (2) adenovirus + Fab-FGF2 conjugate; (3) adenovirus + Fab; or (4) adenovirus + Fab-FGF2 conjugate + anti-FGF2 antisera (Sigma), 16ul.
  • AdCMV-Luc or Ad-CAG-GFPS65T Ad-CAG-GFPS65T
  • the complexes are incubated in 1.5 ml of polypropylene tubes at 27°C for 30 minutes.
  • the mixtures are then diluted in DMEM/F12 + 2%> FBS and added to each well in a volume of 200ul.
  • the cells are incubated at 37°C in 5% CO 2 for 1 hr, then 800ul of DMEM/F12 + 10%) FBS is added to each well.
  • Twenty-four hours after the addition of virus, the cells are rinsed with PBS and assayed for luciferase activity or analyzed by fluorescence activated cell sorting (FACS).
  • FACS fluorescence activated cell sorting
  • the cells are lysed in 200ul of Promega (Madison, WI) lysis buffer. Twenty ul of each sample is subsequently mixed with lOOul of Promega luciferase assay reagent according to manufacturer s instructions and triplicate determinations of duplicate samples are assayed in a Berthold luminometer.
  • KSY-1 or KS-SLK cells are plated in duplicate in 6-well plates in 2 ml of CM. The cells are incubated at
  • AdCMVHSVtk AdCMVHSVtk + Fab
  • AdCMVHSVtk + Fab-FGF2 conjugate AdCMVHSVtk + Fab-FGF2 conjugate
  • KS cells (2 x 10 4 /well) are plated into replicate wells of a 24-well tissue culture plate in CM and incubated at 37°C on 5% C0 2 for 48 hrs. The cells are rinsed and endogenous peroxidase is blocked with 1% H 2 O 2 /methanol for 30 minutes. The cells are then rinsed and blocked in 3% bovine serum albumin (BSA; Fraction V, Boehringer Mannheim, GermanyVPBS for 1 hour at 27°C.
  • BSA bovine serum albumin
  • Rabbit anti-fibroblast growth factor receptor antiserum (FGFR1- and FGFR2-reactive; Upstate Biotechnologies, Inc., Lake Placid, NY) or control rabbit IgG (Vector; Buriingame, CA) is diluted 1 :400 in 3% BSA/PBS and allowed to incubate on cells for 1 hour at 37°C.
  • the cells are rinsed and stained with diaminobenzidine (Sigma)using a Vectastain rabbit horseradish peroxidase kit according to the manufacturer's instructions.
  • the cells are rinsed and stored under water until photomicrographs are taken.
  • adenoviral vectors have been employed for a variety of in vivo cancer therapy applications.
  • adenoviral vectors have the advantage of systemic ability and high levels of gene expression in vivo.
  • the native transduction efficiency of the Ad is examined.
  • two AIDS-KS cell lines KSY-1 and RW376), one KS cell line from an immunosuppressed patient (KS-SLK), and one classical KS cell line (CVU-1) are employed.
  • the adenoviral transduction of each cell line is determined by infecting each cell line with AdCMV-Luc in the presence or absence of the anti-adenovirus knob Fab (see Fig. 1) and subsequently measuring luciferase activity 24 hours after infection.
  • FIG. 1 shows a comparison of AdCMV-Luc transduction for four KS cell lines.
  • KS cells are incubated with recombinant adenovirus expressing luciferase in the absence or presence of a Fab fragment blocking adenoviral knob-mediated infection. Experiments are performed in triplicate. Relative light units (RLU) are shown on the vertical axis; across the horizontal axis, the following cell lines are indicated: KSY-1 ; RW376; KS-SLK; and CVU-1.
  • the open (colorless) bar represents AdCMV-Luc
  • the closed (dark) bar represents AdCMV-Luc + anti-knob Fab.
  • KSY-1 and KS-SLK are poorly transducible by adenovirus, yielding ⁇ 10 6 relative light units (RLU) per assay.
  • the KS cell line CVU-1 is moderately transducible (1.83 x 10 6 + 1.15 x 10 5 RLU per assay), whereas the RWE376 cell line is highly transducible, yielding luciferase readings of 2.88 x 10 6 + 5.4 x 10 4 RLU per assay.
  • the luciferase activity obtained after transduction using AdCMV-Luc correlated with FACS analysis data obtained from cells that are infected with AdCAG- GFPS65T.
  • FACS analysis of the KS cell lines transduced with 100 pfu per cell of AdCAG-GFPS65T fewer than 1% of KSY-1 and KS-SLK cells are transducible.
  • the CVU-1 and TW376 KS cell lines are significantly more transducible yielding 12% and 99% transduction efficiencies, respectively.
  • an anti-adenoviral knob Fab blocked AdCMV-Luc transduction by >50% (p ⁇ 0.01).
  • the CVU-1 ' cell line exhibited a less dramatic (20%) - albeit statistically significant (p ⁇ 0.05) — block in adenoviral transduction. This low level of inhibition correlates with the modest level of transduction efficiency by the native adenovirus. This suggests that the degree to which these cells are refractory inversely correlates with knob-dependent cell binding. Based on this recognition, it is hypothesized that this limitation to infection might be overcome using other cellular entry pathways to achieve effective gene transfer. In this regard, an immunological approach has now been developed that allows retargeting of adenovirus vectors to heterologous cellular pathways (see Douglas et al., Id. (1996)). As an initial validating step in these studies, we sought to determine whether KS cells expressed FGFR, and whether this receptor could serve as a potential substrate for retargeting.
  • KSY-1 (A,B), RW376 (C,D), KS-SLK (E,F) and CVU-1 (G,H) cell lines are stained with polyclonal antiserum raised against a peptide common to FGFR-1 and FGFR-2 or with non-immune control. Immunoreactivity is observed in all four cell lines (data not shown) as well as in mouse fibroblasts (positive control; not shown).
  • FGF2 fibroblast growth factor
  • a covalent conjugate is synthesized using SDPD to form a disulfide bond between the Fab and the cysteine present on modified FGF2.
  • the conjugate is first pre-incubated with AdCMV-Luc prior to cellular transduction.
  • the AdCMV-Luc + Fab-FGF2 mixture is further incubated with blocking antisera raised against FGFs to assess whether retargeting is occurring via the FGF2 moiety of the Fab-FGF2 conjugate.
  • Figure 3 illustrates the results of the AdCMV-Luc retargeting experiments using the Fab-FGF2 conjugate as well as the FGF2 blocking experiments.
  • Figure 3 shows the enhanced AdCMV-Luc infectivity of KS cell lines by
  • Fab-FGF2 conjugate The enhanced infectivity of the Ad-conjugate complex is assessed in the presence and absence of anti-FGF2 antisera.
  • Relative light units (RLU) are plotted on the vertical axis, while the relevant KS cell lines - KSY-1, RW376, KS-SLK, and CVU-1 ⁇ are indicated on the horizontal axis.
  • the closed bars represent AdCMV-Luc; stippled bars represent AdCMV-Luc + Fab-FGF2; and the open (colorless) bars represent AdCMV-Luc + Fab-FGF2 + anti-FGF2 antisera.
  • Figure 4 illustrates enhanced AdCMVHSVtk/GCV cell killing in KSY-1 and KS-SLK cells by Fab-FGF2 conjugate.
  • the effect of GCV on AdCMVHStk- transfected cells is assessed in the presence or absence of the conjugate and expressed as a percentage of cells surviving compared to the cell not exposed to GCV (i.e., -GCV).
  • Viable cells in duplicate wells are counted, in triplicate, after trypan blue exclusion. On the vertical axis, the % of cells surviving is shown, in both Figs. 4A and 4B. In Fig.
  • KSY-1 cells transfected with AdCMVHSVtk or AdCMVHSVtk + Fab-FGF2 are identified on the horizontal axis.
  • KS-SLK cells transfected with AdCMVHSVtk or AdCMVHSVtk + Fab-FGF2 are identified on the horizontal axis.
  • Cell killing is expressed as a ratio of cells surviving in the presence of GCV relative to the number of cells surviving in the absence of GCV.
  • Figure 4 demonstrates that retargeting AdCMVHSVtk with Fab-FGF2 resulted in a significant enhancement of the KS cells susceptibility to GCV-mediated killing.
  • Fab neutralizing anti-knob antibody fragment
  • FGF2 basic fibroblast growth factor
  • the Fab- FGF2 conjugate is then used to target an Ad vector carrying the luciferase reporter gene (AdCMVLuc) to FGF receptor-positive cells (Swiss 3T3, PANC-1, SKOV3.ipl, and D54 MG) in vitro.
  • AdCMVLuc luciferase reporter gene
  • FGF receptor-positive cells Swiss 3T3, PANC-1, SKOV3.ipl, and D54 MG
  • PANC-1 a human pancreatic epithelioid carcinoma cell line, and Swiss 3T3, a mouse fibroblast cell line, are obtained from the American Type Culture Collection (ATCC, Rockville, MD).
  • ATCC American Type Culture Collection
  • D54 MG human glioma cells, are a derivative of the Al 72 cell line established by Giard et al. (See, e.g. , Giard et al., J. Natl. Cancer Inst. 57:1417-23 (1973); Bigner, et al., J. Neuropathol Exp. Neurol 40:390-409 (1981); and Goldman et al., Mol Biol. Cell 4:121-33 (1993).)
  • the SKOV3.ipl human ovarian adenocarcinoma cell line is kindly provided by Janet Price (Baylor University). (The related SKOV3 cell line is available from the ATCC under accession no. HTB-77.) Bovine aortic endothelial cells are obtained from primary cultures (Gospodarowicz, et al., Endocrinology 777:2383-91 (1985)).
  • the 3T3, PANC-1 and SKOV3.ipl cells are maintained in Dulbecco's modified Eagles medium (DMEM) supplemented with 10%) fetal calf serum (FCS) (Summit Biotechnology, Fort Collins, CO) and 2mM L-glutamine.
  • DMEM Dulbecco's modified Eagles medium
  • FCS fetal calf serum
  • the D54 MG cells are maintained in DMEM/F12 supplemented with 7%> FCS and 2 mM L-glutamine.
  • the bovine aortic endothelial cells are maintained in DMEM supplemented with 10% FCS, gentamycin (50 ug/mL), 2 mM L-glutamine, 1 mM MEM sodium pyruvate solution, and 0.1 mM MEM non-essential amino acids solution.
  • AdCMVLuc (Herz and Gerard, PNAS USA 90:2812-6 (1993)) is an El-deleted replication-deficient Ad5 vector which expresses firefly luciferase (Luc) under the control of the cytomegalovirus (CMV) promoter.
  • CMV cytomegalovirus
  • the aforementioned vector may be prepared as described in the cited reference.
  • the adenovirus is propagated on the permissive 293 cell line and purified by standard techniques. 2. Conjugation of FGF2 to 1D6.14-Fab
  • the 1D6.14-Fab is generated and characterized as previously described (Douglas, et al., Nature Biotech. 74: 1574-78 (1996)).
  • the Fab (1.6 mg) is dialyzed against 0.1 M sodium phosphate buffer, pH 7.5, containing 0.1 M NaCl and 1.0 mM EDTA (BPS-E) at 1 :250 (v/v) for 3 hours with two changes of buffer.
  • the dialyzed Fab ⁇ fragment is centrifuged at 14,000 ⁇ m for 10 minutes and the supernatant collected.
  • the Fab fragment is derivatized with N-succinimidyl-3(pyridyldithio)propionate (SPDP) (Pharmacia, Uppsala, Sweden) at a molar ratio of 1 :3 for 30 minutes at room temperature, with occasional stirring.
  • SPDP N-succinimidyl-3(pyridyldithio)propionate
  • the excess SPDP and low molecular weight reaction byproducts are removed by dialysis against PBS-E (1 :500, v/v).
  • An FGF2 mutein is used in all of the studies described herein; this mutein has its cysteine at position 96 mutagenized to serine.
  • the FGF2 mutein is expressed in E. coli and purified as described previously (Lappi, et al., Anal. Biochem. 272:446-51 (1993)).
  • the reaction containing the FGF2 mutein is adjusted to pH 7.5 by adding Tris-base and reduced by adding monothioglycerol (MTG; Evans Chemetics, Waterloo, NY) to a final concentration of 20 mM.
  • MTG monothioglycerol
  • the reaction is performed at room temperature for 30 minutes before the excess MTG is removed by passing the mixture over a PD-10 column (Pharmacia) and eluting with 10 mM NaOAc/HOAc, pH 5.4, containing 0.14 M NaCl and 1 mM EDTA.
  • the reduced FGF2 mutein is then mixed with the SPDP derivatized Fab at a molar ratio of 2: 1 at pH 7.5 and incubated at 4 C for 16 hours with shaking.
  • the conjugate is purified over a heparin-Sepharose column (1 mL heparin Hi-Trap, Pharmacia) to remove unconjugated Fab fragment by loading the reaction mixture onto the column in 10 mM Tris pH 7.4 and washing in the same buffer plus 0.6 M NaCl. When the absorbance returned to background, the conjugate is eluted from the column with the same buffer containing 2 M NaCl. The 2 M eluate is then loaded onto a Sephacryl S-100 column (Pharmacia) to remove free FGF2 mutein and buffer exchanged into PBS pH 7.4. The final protein concentration of the Fab is 0.24 mg/mL. The Fab is used directly in the following studies. 3. Characterization of Fab-FGF2 Conjugate
  • the Fab-FGF2 conjugate is evaluated by SDS-PAGE (12%) under nonreducing conditions and stained with Coomassie blue.
  • Western blot analysis is also conducted on the conjugate by transferring protein to a nitrocellulose membrane, probing with anti-FGF2 rabbit polyclonal antibodies and then with 1251-Protein A, which is revealed by autoradiography.
  • the activity of the FGF2 component of the Fab-FGF2 conjugate is confirmed using a cell proliferation assay.
  • Bovine aortic endothelial cells are seeded at 1000 cells/well in 24-well tissue culture plates. The following day, serial dilutions of FGF2 or the Fab-FGF2 conjugate (30 pg/m: to 6 ng/mL) are added to triplicate wells. After 48 hours, the media are removed and 1.5 mL of fresh media containing the same concentrations of FGF2 and Fab-FGF2 are added. Following another 72 hr incubation, the media are removed, the cells are washed with PBS, treated with 0.25% trypsin, and counted using a Coulter Particle Counter (Coulter).
  • FGF2 plaque forming units
  • AdCMVLuc plaque forming units
  • 3T3, PANC-1, SKOV3.ipl, and D54 MG cells plated at a density of 24,000 cells/well 24 hours previously.
  • the cells are first washed with PBS and supplemented with 200 uL of OPTI-MEM reduced serum media (Gibco-BRL, Grand Island, NY) prior to addition of the complexes.
  • the cells After incubation for 1 hr at 37 C, the cells are supplemented with 1 mL of complete media and allowed to incubate an additional 24 hours at 37 C. The cells are then lysed and extracts assayed for luciferase activity using a luciferase assay system (Promega, Madison, WI) according to the manufacturer's protocol. The relative light units (RLU) are normalized for protein content using the BioRad protein assay, following the manufacturer's protocol. Inhibition studies are conducted by adding a polyclonal anti-FGF2 antibody (Sigma Immunochemicals) to the AdCMVLuc-Fab-FGF2 mixture prior to cell infection. All experiments are performed in triplicate.
  • a polyclonal anti-FGF2 antibody Sigma Immunochemicals
  • the AdCMVLuc-Fab and AdCMVLuc-Fab-FGF2 conjugates are made in a manner consistent with that described above.
  • Two days after Ad injection the mice are sacrificed and the tumors and dorsal mesothelial lining harvested.
  • the organs are rinsed with water, homogenized in grinding buffer (50 mM K 3 PO 4 , 1 mM EDTA, 1 mM dithiothreitol, 10%) glycerol), and lysed with lysis buffer (Promega).
  • the homogenates are incubated on ice for 30 minutes and then centrifuged for 10 min at 14,000 ⁇ m and 4 C. The supernatants are assayed for luciferase activity as described above and standardized for total protein content.
  • the Fab fragment of the 1D6.14 anti-Ad5 knob neutralizing antibody is derivatized with SPDP and conjugated to the one remaining active cysteine on the FGF2 mutein ( Figure 4).
  • the reaction is monitored by size exclusion HPLC and the conjugate purified using a heparin-Sepharose column followed by Sephacryl S-100 gel filtration.
  • Figure 4 illustrates a schema for the synthesis and purification of the Fab- FGF2 conjugate. It should be expressly understood that this schema may be applied to the synthesis and purification of any Fab-ligand conjugate and is thus not limited to the one illustrated.
  • Figure 5A shows the results of SDS-PAGE of Fab-FGF2 under non- reducing conditions. Equal amounts (2 ug) of FGF2 (lane 2), Fab (lane 3), or Fab-FGF2 (lane 4) are applied to the gel and compared to the molecular weight standards (lane 1 , in thousands) by staining with Coomassie blue.
  • Figure 5B Western blot analysis of Fab- FGF2 conjugate is shown. The protein is transferred to a nitrocellulose membrane, probed with an anti-FGF2 rabbit polyclonal antibody and then with 12 T-Protein A and visualized by autoradiography. A band is observed for FGF2 (lane 5) and for the Fab- FGF2 conjugate (lane 7), but not for Fab antibody alone (lane 6).
  • the Fab-FGF2 conjugate is compared with unconjugated FGF2 in an endothelial cell proliferation assay.
  • the results of the endothelial cell proliferation assay showed the conjugation of the Fab to FGF2 did not interfere with the ability of FGF2 to bind to its cognate receptor and stimulate proliferation (Fig. 6A).
  • an ELISA assay is performed.
  • the plates are probed using an anti-FGF2 primary antibody and then with a goat anti-rabbit secondary antibody prior to addition of the substrate for visualization.
  • the Fab-FGF2 conjugate had an absorbance of 3.70 + 0.13 when added to wells containing Ad5 knob, compared to 0.35 + 0.04 in wells without the Ad5 knob (Fig. 6B).
  • the absorbance of the conjugate is significantly greater than when FGF2 alone is added (1.55 + 0.03) (p ⁇ 0.002). Therefore, we are able to show that the Fab portion of the Fab-FGF2 conjugate bound to Ad5 knob after conjugation and that the FGF2 portion of the conjugate is still functional as evidenced by the endothelial cell proliferation assay.
  • Figure 6 shows functional validation of the Fab-FGF2 conjugate.
  • Fig. 6A stimulation of endothelial cell proliferation by FGF2 and the Fab-FGF2 conjugate is shown.
  • Bovine aortic endothelial cells are treated with various concentrations of FGF2 or Fab-FGF2 (30 pg/mL to 6 ng/mL) and the cell number determined.
  • Cell count (x 1000) is plotted on the vertical axis, while pg/mL are plotted on the horizontal axis. Open circles represent FGF2, while closed circles represent Fab- FGF2.
  • Fab-FGF2 binding to Ad5 knob in an ELISA is illustrated.
  • Recombinant Ad5 knob is probed with either Fab-FGF2, a blank control, or FGF2.
  • Fab-FGF2 is added to plates that did not contain Ad5 knob.
  • Absorbance is plotted on the vertical axis, while the following are shown on the horizontal axis of the bar graph, proceeding from left to right: No knob + Fab-FGF2; Knob + Fab-FGF2; Knob alone; and Knob + FGF2.
  • the conjugate is then used to show targeting of AdCMVLuc to high-affinity FGF receptors in vitro.
  • Figure 7 illustrates the results of in vitro infection of a panel of cell lines using the Fab-FGF2 conjugate.
  • Fig. 7A inhibition of luciferase expression by the Fab is shown.
  • the four cell lines are infected with either the AdCMVLuc or the AdCMVLuc premixed with the Fab as described in the text.
  • the data are expressed as a percentage of the luciferase expression when AdCMVLuc alone is used for each cell line. Percentage is plotted on the vertical axis; cell lines 3T3, PANC-1, SKOV3.ipl, and D54 MG are illustrated along the horizontal axis. Open bars represent AdCMVLuc, while closed bars represent AdCMVLuc + Fab.
  • luciferase expression in the four cell lines when infected with either AdCMVLuc or the AdCMVLuc-Fab-FGF2 conjugate is shown.
  • the bars illustrate the luciferase expression in relative light units (RLU) per microgram of protein and represent triplicate measurements ⁇ standard deviation.
  • RLU/ug of protein is plotted on the vertical axis.
  • cell lines 3T3, PANC-1, SKOV3.ipl, and D54 MG are illustrated. Closed bars represent AdCMVLuc, while cross-hatched bars represent AdCMVLuc + Fab-FGF2.
  • Fig. 7C inhibition of luciferase expression by the anti-FGF2 antibody is shown.
  • the four cell lines are infected with either AdCMVLuc premixed with the Fab-FGF2 conjugate or AdCMVLuc premixed with the Fab-FGF2 conjugate and the anti-FGF2 antibody as described above.
  • the data are expressed as a percentage of the luciferase expression seen when the ADCMVLuc-Fab-FGF2 complex is used for each cell line. Percentages are plotted on the vertical axis; cell lines 3T3, PANC-1, SKOV3.ipl, and D54 MG are illustrated along the horizontal axis. Lightly shaded bars represent AdCMVLuc + Fab-FGF2, while the dark, closed bars represent AdCMVLuc + Fab-FGF2 + anti-FGF2 Ab.
  • each of the cell lines exhibited a higher level of luciferase activity (2.9 x 10 5 , 1.3 x 10 5 , 2.0 x 10 6 , and 4.1 x 10 6 RLU/ug of protein, respectively) when infected with AdCMVLuc premixed with the Fab-FGF2 conjugate than when infected with AdCMVLuc alone (Fig. 7B).
  • Table 1 The results illustrated in Table 1 indicate that the tumor is more susceptible to Ad transduction than the dorsal mesothelial lining (131 vs. 15.1 RLU/ug protein, respectively) and both organs showed a reduction in luciferase activity when the Ad-Fab complex is administered to mice (31.6% inhibition in tumor and 11.9% inhibition in abdominal lining). However, when the mice are administered Ad-Fab- FGF2, both the tumor and the abdominal lining exhibited higher luciferase activity (9250 and 404 RLU/ug protein, respectively) than when administered the Ad alone.
  • FGF-related molecules including analogs, derivatives, fragments, and mimics thereof, are useful in conjugates, compositions, systems and methods of the present invention.
  • Procedures for the preparation of FGF muteins are provided hereinbelow for purposes of example and illustration of some of the molecules that are useful as disclosed herein.
  • Plasmid pFC80 containing the FGF2 coding sequence, is a gift of Drs. Paolo Sarmientos and Antonella Isacchi of Farmitalia Cargo Erba (Milan, Italy). Plasmid pFC80, has been described in the PCT Application Serial No. WO 90/02800 and PCT Application Serial No. PCT/US93/05702. The sequence of DNA encoding FGF2 in pFC80 is that set forth in PCT Application Serial No. PCT/US93/05702.
  • SDS gel electrophoresis is performed on a PhastSystem utilizing 20% > gels (Pharmacia).
  • Western blotting is accomplished by transfer of electrophoresed protein to nitrocellulose using the PhastTransfer system (Pharmacia), as described by the manufacturer.
  • the antisera to SAP and basic FGF are used at a dilution of 1 :1000.
  • Horseradish peroxidase labeled anti-IgG is used as the second antibody.
  • the oligonucleotide used for in vitro mutagenesis of cysteine 78 is AGGAGTGTCTGCTAACC, which spans nucleotides 225-241 of FGF2.
  • the oligonucleotide for mutagenesis of cysteine 96 is
  • TTCTAAATCGGTTACCGATGACTG which spans nucleotides 279-302.
  • the mutated replicative form DNA is transformed into E. coli strain JM109 and single plaques are picked and sequenced for verification of the mutation.
  • the FGF mutated gene is then cut out of Ml 3, ligated into the expression vector pFC80, which had the non-mutated form of the gene removed, and transformed into E. coli strain JM109. Single colonies are picked and the plasmids sequenced to verify the mutation is present. Plasmids with correct mutation are then transformed into the E. coli strain FIC ⁇ 2 and single colonies from these transformations are used to obtain the mutant basic FGFs. Approximately 20 mg protein per liter of fermentation broth is obtained.
  • the cells are pelleted and resuspended in lysis solution (10 mM TRIS, pH 7.4, 150 mM NaCl, lysozyme, 10 ⁇ g/mL, aprotinin, 10 ⁇ g/mL, leupeptin, 10 ⁇ g/mL, pepstatin A, 10 ⁇ g/mL and 1 mM PMSF; 45-60 ml per 16 g of pellet) and incubated while stirring for 1 hour at room temperature. The solution is frozen and thawed three times and sonicated for 2.5 minutes.
  • lysis solution 10 mM TRIS, pH 7.4, 150 mM NaCl, lysozyme, 10 ⁇ g/mL, aprotinin, 10 ⁇ g/mL, leupeptin, 10 ⁇ g/mL, pepstatin A, 10 ⁇ g/mL and 1 mM PMSF; 45-60 ml per 16 g of pellet
  • Extract volumes (40 ml) are diluted to 50 ml with 10 mM TRIS, pH 7.4 (buffer A). Pools are loaded onto a 5 ml Hi-Trap heparin-Sepharose column (Pharmacia, Uppsala, Sweden) equilibrated in 150 mM sodium chloride in buffer A. The column is washed with 0.6 M sodium chloride and 1 M sodium chloride in buffer A and then eluted with 2 M sodium chloride in buffer A.
  • [C78S]FGF and [C96SJFGF is measured on adrenal capillary endothelial cells in culture.
  • Cells are plated at 3,000 per well in a 24 well plate in 1 ml of 10% calf serum-HDMEM. Cells are allowed to attach, and samples are added in triplicate at the indicated concentration and incubated for 48 h at 37°C. An equal quantity of samples is added and further incubated for 48 hr. Medium is aspirated; cells are treated with trypsin (1 ml volume) to remove cells to 9 ml of Hematall diluent and counted in a Coulter Counter. The results show that the two mutants that retain virtually complete proliferative activity of native basic FGF as judged by the ability to stimulate endothelial cell proliferation in culture.
  • viral vectors re-targeted with polypeptides that target the FGF receptor - including derivatives and fragments of FGF and polypeptide portions thereof - are useful in conjugates, compositions, systems and methods of the present invention.
  • Procedures and exemplary data illustrating some of the novel and unexpected advantages of the use of the constructs of the present invention are provided hereinbelow for pu ⁇ oses of example and illustration. A. Methods
  • FGF Ad ⁇ gal or Ad ⁇ gal 77 ⁇ g of FGF-Fab, or an equivalent volume of 0.9%) NaCl is incubated for 30 minutes at room temperature with 2 x 10 10 pfu of Ad ⁇ gal.
  • 2 x 10'° pfu of either Ad ⁇ gal or FGF- Ad ⁇ gal are injected intravenously per mouse (over a 30 second period) in a final volume of 0.32 ml.
  • Control mice received 0.32 ml of excipient (25 mM Tris pH 7.5, 100 mM NaCl, 10 mg/ml lactose).
  • mice per group are sacrificed. Serum is collected for analysis of serum transaminases and alkaline phosphatase. The liver, lungs, spleen, and kidneys are removed and weighed. A portion of liver and lung are immediately snap frozen in liquid nitrogen, stored at -80°C and then processed for quantitative analysis of ⁇ -galactosidase activity. Portions of each organ are snap frozen in OCT using isopentane precooled with dry ice and stored at -80°C. Another portion of each organ is fixed for 4 hours at 4°C in 10% neutral buffered formalin and then embedded in paraffin. On day 7, three mice per group are sacrificed and tissues and serum are processed in the same manner.
  • mice are then treated with ganciclovir (or H 2 0) beginning on day 1, qdxl4, at a dose of 100 mg/kg. Mice are then followed for survival. Statistical analysis is performed using Kaplan- Meier and a Logrank (Mantel-Cox) post-hoc analysis.
  • FGF-2 Ad ⁇ gal and Ad ⁇ gal are injected intravenously into mice and expression of ⁇ gal in hepatocytes is assessed.
  • Figures 8A-C illustrate the expression of ⁇ -galactosidase in the liver of mice after treatment with Ad ⁇ gal or FGF2-Ad ⁇ gal.
  • Fig. A no Xgal stained cells in the liver of C57B1/6 mice treated with excipient are seen.
  • Fig. 8B numerous Xgal stained hepatocytes are present in the liver of C57B1/6 mice treated with Ad ⁇ gal at a dosage of 2x10 10 pfu per mouse, i.v.
  • Fig. 8C treatment with FGF2-Ad ⁇ gal at 2x10 10 pfu per mouse, i.v. transduces very few hepatocytes.
  • Figure 9 shows the serum transaminase and alkaline phosphatase levels in mice treated with Ad ⁇ gal or FGF2-Ad ⁇ gal.
  • Serum transaminases (AST, ALT) and alkaline phosphatase are measured on day 7 in C57B1/6 mice after treatment with either excipient; Ad ⁇ gal, 2xl0 10 pfu, i.v.; or FGF2-Ad ⁇ gal, 2xl0 10 pfu, i.v.
  • serum transaminase levels are elevated 8.2 to 13.6-fold in the Ad ⁇ gal treated group but only a moderate 3.2 to 4.7-fold in the FGF- 2Ad ⁇ gal treated group (see Fig. 9).
  • Serum alkaline phosphatase is also elevated in the serum of Ad ⁇ gal treated mice but is normal in FGF-2Ad ⁇ gal treated mice.
  • FIGS 10A and 10B illustrate the histopathology of the liver of mice after treatment with Ad ⁇ gal or FGF2-Ad ⁇ gal.
  • Ad ⁇ gal Ad ⁇ gal
  • FGF-2Ad ⁇ gal FGF-2Ad ⁇ gal.
  • very little inflammatory infiltrate is observed.
  • B16 murine melanoma cell line is chosen as the target. B16 cells are incubated for 1 hour ex vivo with either Adtk or FGF-2Adtk prior to implantation intraperitoneally in BDFl mice. Ganciclovir therapy is initiated in vivo, one day post tumor cell inoculation.
  • Figure 11 shows a survival analysis of tumor bearing mice treated with either Adtk or FGF2-Adtk.
  • B16 melanoma cells are treated ex vivo for one hour with either Adtk or FGF2-Adtk and then implanted intraperitoneally into BDFl mice at 2x10 6 cells per mouse.
  • Mice are then treated with either ganciclovir (GCV) or H 2 0 (as a control) for 14 days, i.p. Survival of tumor bearing mice treated with FGF2-Adtk and then administered ganciclovir is prolonged; such mice have a statistically prolonged survival compared to all other groups (pO.OOl).
  • mice bearing B16 melanoma treated with Adtk plus ganciclovir are indistinguishable from the control mice which received untreated B16 tumor cells plus the ganciclovir regimen (Fig. 11).
  • mice which received B16 melanoma treated with FGF2-Adtk demonstrated a 241% increase in median survival compared with control mice (Fig. 11).
  • an FGF2-redirected adenoviral vector carrying the gene for he ⁇ es simplex virus thymidine kinase (AdCMVHSV-TK) is shown to result in a significant prolongation of survival compared with the same number of particles of unmodified AdCMVHSV-TK.
  • equivalent survival rates are achieved with a tenfold lower dose of the FGF2-redirected AdCMVHSV-TK compared with the unmodified vector.
  • the human ovarian carcinoma cell line SKOV3.ipl is readily available from a variety of sources. Our supply is obtained from Janet Price (Baylor University, Houston, TX) and maintained in Dulbecco's modification of Eagle's medium (DMEM). 293 cells are purchased from the American Type Culture Collection, Rockville, MD and maintained in DMEM/Ham's F-12 medium. (See also Graham, et al., J. General Virol.
  • FCS heat-inactivated fetal calf serum
  • glutamine 2 mM
  • penicillin 100 units/ml
  • streptomycin 100 ⁇ g/ml
  • AdCMVLuc an E1-, E3-deleted Ad5 vector which expresses firefly luciferase under the control of the CMV promoter
  • AdCMVlacZ an El-deleted Ad5 vector which expresses E coli ⁇ -galactosidase from the CMV promoter is obtained from De-chu Tang (University of Alabama at Birmingham, AL).
  • AdCMVHSV-TK has been described previously and is an ⁇ l -deleted Ad5 vector which expresses HSV-TK from the CMV promoter (see Rosenfeld et al., Clin.
  • adenoviral vectors are propagated on the permissive 293 cell line and purified according to standard techniques (Graham and Prevec, "Manipulation of Ad Vectors,” in Methods in Molecular Biology Vol 7, Gene Transfer and Expression Techniques, Murray and Walker (eds.), Humana Press, Clifton, 1991, pp. 109-128).
  • the Fab-FGF2 conjugate is constructed by conjugating the Fab fragment of 1D6.14, a neutralizing monoclonal antibody directed against the Ad5 knob, with an FGF2 mutein as described elsewhere herein. Analysis by mass spectrometry indicated that the conjugate contained a single molecule of FGF2 linked to a Fab fragment.
  • the FGF2 component of the Fab-FGF2 conjugate retained the ability to bind its cognate receptor and stimulate endothelial cell proliferation.
  • the Fab component of the Fab- FGF2 conjugate retained the ability to recognize trimeric Ad5 knob, as determined in an ⁇ LISA.
  • SKOV3.ipl cells are seeded in 24-well plates at a density of 24,000 cells per well. Increasing dilutions of the Fab fragment are incubated with 10 8 PFU of AdCMVLuc for 30 min at room temperature in a total volume of 20 ⁇ l H ⁇ P ⁇ S-buffered saline (HBS). The vector is then diluted with DM ⁇ M/F-12 + 2% FCS (infecting medium) and 100 ⁇ l of the complexes are added at an MOI of 50 PFU per cell to the SKOV3.ipl cells.
  • HBS H ⁇ P ⁇ S-buffered saline
  • the infecting medium is aspirated and replaced with 1 ml of DMEM/F-12 + 10%> FCS (complete medium).
  • the cells are lysed and extracts are assayed for luciferase activity by a chemiluminescent assay (Promega, Madison, WI).
  • the protein concentration of the lysates is determined in order to permit normalization of the data.
  • the lowest dose of Fab which blocked infection is used in subsequent experiments.
  • the molar ratio of Fab to FGF2 in the conjugate is known to be 1 :1, this value is used to calculate the optimal dose of Fab-FGF2 to be employed in subsequent retargeting experiments.
  • AdCMVLuc (5 x 10 7 PFU) is preincubated with the optimal dose of the Fab fragment (1.44 ⁇ g) or Fab-FGF2 conjugate (1.94 ⁇ g) in 20 ⁇ l HBS for 30 min at room temperature.
  • the vector or vector complexes are then diluted in infecting medium and 24,000 SKOV3.ipl cells in 24 well plates are infected at an MOI of 50 PFU per cell in a final volume of 100 ⁇ l.
  • Inhibition experiments are performed by adding a polyclonal anti-FGF2 antibody (Sigma, St. Louis, MO) to the AdCMVLuc-Fab- FGF2 complex prior to infection.
  • Cell lysates are assayed for luciferase activity 24 h post-infection.
  • the protein concentration of the lysates is determined in order to permit normalization of the data.
  • Statistical analysis is performed using the Student t-test.
  • SKOV3.ipl cells are infected with AdCMVLacZ. Sixteen hours prior to infection, SKOV3.ipl cells are seeded in 6- well plates at a density of 3 x 10 5 cells per well. AdCMVLacZ (5 x 10 7 PFU) is preincubated with or without Fab-FGF2 (1.94 ⁇ g) in 20 ⁇ l HBS for 30 min at room temperature. The vector or vector-Fab-FGF2 complexes are then diluted in infecting medium and incubated with the SKOV3.ipl cells at an MOI of either 5 or 50 PFU per cell in a final volume of 200 ⁇ l.
  • the infecting medium is aspirated, the cells are washed with PBS and 3 ml of complete medium are added to each well.
  • Expression of ⁇ -galactosidase is determined 24 h post-infection by staining with the chromogenic substrate X-gal according to standard techniques. The cells are rinsed twice with PBS and fixed with 0.5% glutaraldehyde for 10 min at 37°C.
  • Cells are then washed twice for 15 min with PBS containing 1 mM MgCl 2 , after which they are stained with a PBS solution containing 5 mM K 3 Fe(CN) 6 , 5 mM K 4 Fe(CN) 6 , 1 mM MgCl 2 and 1 mg/ml X-gal (5-bromo-4 chloro-3-indolyl-beta-D-galactoside; Sigma). After removal of the X-gal solution, the cells are overlaid with 10% glycerol, and stored at 4°C.
  • mice Animal Program (Frederick, MD), and received an intraperitoneal injection of 2 x 10 7 SKOV3.ipl cells on day 0.
  • the mice are separated into 10 groups of 10 animals, except that the control group with tumor cells only contained 5 mice.
  • the treated groups are injected intraperitoneally with 2 x 10 s or 2 x 10 9 PFU of AdCMVHSV-TK alone or AdCMVHSV-TK complexed with FGF2.
  • ganciclovir 50 mg/kg bodyweight
  • AdCMVLuc an E1-, E3-deleted Ad5 vector which expresses firefly luciferase (Herz, et al., PNAS USA 90:2812-16 (1993)), is then premixed with the unconjugated anti-knob Fab fragment or the Fab-FGF2 conjugate prior to infection of SKOV3.ipl call monolayers at a multiplicity of infection (MOI) of 50 plaque-forming units (pfu) per cell. Expression of luciferase activity in infected cells is determined 24 hours post-infection; this value is directly proportional to the number of infecting virus particles.
  • MOI multiplicity of infection
  • Figure 12 illustrates the enhancement of Ad-mediated gene delivery by the Fab-FGF2 conjugate.
  • AdCNVLuc (5 x 10 7 pfu) as preincubated with the optimal dose of the Fab fragment (1.44 ⁇ g) or Fab-FGF2 conjugate (1.94 ⁇ g) in 20 ⁇ L HBS for 30 min at room temperature.
  • the vector or vector complexes are then diluted in DMEM/F-12 + 2% FCS and 24,000 SKOV3.
  • " ipl cells in 24-well plates are infected at an MOI of 50 pfu/cell. Inhibition experiments are performed by adding a polyclonal anti- FGF2 antibody (Sigma, St. Louis, MO) to the Ad CMVLuc-Fab-FGF2 complex prior to infection.
  • Cell lysates are assayed for luciferase activity 24 hours post-infection.
  • the protein concentration of the lysates is determined to permit normalization of the data, which are expressed as relative light units (RLU) per microgram of cellular protein.
  • RLU relative light units
  • SKOV3.ipl cell monolayers are infected at different MOIs with an El -deleted Ad5 vector carrying the ⁇ -galactosidase reporter gene, AdCMVLacZ, in the presence or absence of Fab-FGF2.
  • AdCMVLacZ (5 x 10 7 pfu) is preincubated with or without Fab-FGF2 (1.94 ⁇ g) in 20 ⁇ L HBS for 30 min at room temperature.
  • the vector or vector-Fab-FGF2 complexes are then diluted in DMDM/F-12 + 2% FCS and SKOV3.ipl cells are infected at an MOI of 5 or 50 pfu/cell.
  • Expression of ⁇ -galactosidase is determined 24 hours post-infection by staining with the chromogenic substrate X-gal.
  • Fab-FGF2 conjugate mediated Ad infection of a greater percentage of target cells than the native virus, permitting the transduction of a given number of target cells to be achieved by a lower dose of virus (results not shown).
  • adenoviral vectors produce a dose-dependent inflammatory response in rodents and primates.
  • Vector-associated toxicity has also been observed in human clinical trials and threatens to prevent the adenovirus from realizing its full potential as a vector for human gene therapy. This suggests that it would be advantageous to reduce the number of Ad particles required for a given level of gene transfer in vivo. Therefore, we sought to determine whether Fab-FGF2-mediated enhancement of Ad infection could be exploited for therapeutic advantage.
  • a murine model of human ovarian cancer is established as described previously by intraperitoneal injection of SCID mice with SKOV3.ipl cells (Yu, et al., Cancer Research 55:891-8 (1993); Rosenfeld, et al., J. Molec. Med. 74:455-462 91996)). Five days later, the treated mice are injected intraperitoneally at two MOIs (2 x 10 8 or 2 x 10 9 pfu) either with AdCMVHSV-TK, an El -deleted Ad5 vector which expresses the prodrug-activating HSV-TK gene, or with AdCMVHSV-TK premixed with the Fab- FGF2 conjugate.
  • mice are then treated for 14 days with 50 mg/kg of the prodrug ganciclovir (GCV) or with an equivalent volume of serum-free medium.
  • GCV prodrug ganciclovir
  • Ten animals are studied in each group. These animals are monitored daily and the length of survival of each mouse is recorded (Fig. 13).
  • Figure 13 illustrates the results of FGF2-enhancement of Ad-mediated expression of the HSV-TK gene, which augments therapeutic benefit in a survival experiment.
  • a total of 95 female SCID mice aged 6-8weeks are inoculated intraperitoneally with 2 x 107 SKOV3.ipl cells on day 0.
  • Adenoviral vectors have been shown to activate specific immune response.
  • the host immune response is specific to adenoviral protein including the fiber knob protein.
  • FGF2-retargeted Ad will be used as a strategy to blunt or block the antiviral immune response.
  • mice are treated with lx 10 9 pfu of adenovirus alone or FGF2-retargeted adenovirus.
  • the ratio of FGF-Fab to adenovirus is also varied in this experiment.
  • a total of four groups with the total of number of animals in each group at 10 or 13.
  • Group 1 animals received 200 ⁇ l of excipient (25nM Tris pH 7.5, 100 mM NaCl, 10 mg/ml lactose) given by i.p.
  • Group 2 received adenovirus alone at 1 x 10 9 pfu in 200 ⁇ l i.p.
  • Group 3 received FGF2- retargeted adenovirus at lxlO 9 pfu/200 ⁇ l i.p. injection with FGF2-Fab to adenovirus knob ratio of 30:1.
  • Group 4 received FGF2-retargeted adenovirus at 1 xlO 9 pfu per 300 ⁇ l given i.p. with a FGF2-Fab to adenovirus knob ratio of 2000:1. Mice are checked and body weights are measured twice weekly. On day 21 post i.p. injection, blood samples are collected from 5 of the animals from each of the four groups.
  • the blood samples are put into an Eppendorf tube and allowed to clot. The samples are centrifuged and the serum is collected. Serum samples are assayed by ELISA for production of antibodies to adenoviral proteins and specifically to adenoviral knob protein.
  • Microtiter plates (96 well) are coated with adenovirus (3 xlO 8 pfu in 100 ⁇ l per well) and incubated overnight at room temperature. The wells are rinse 3 times with PBS and then blocked with PBS + 10% goat serum for 2 hours at room temperature. The wells are rinsed 3 times followed by addition of primary antibody at a dilution of 1 :50. After 30 minutes at room temperature the wells are rinsed 3 times with PBS followed by addition of alkaline phosphatase anti-mouse Ig secondary. After 30 minutes the wells are rinsed with TBS (Tris buffered saline) followed by addition of PNPP substrate. Color reaction is allowed to occur for 60 minutes.
  • TBS Tris buffered saline
  • Microtiter plates (96 well) are coated with 1 OOng of knob protein in 100 ul per well and incubated overnight at room temperature. The wells are rinsed 3 times with PBS and then blocked with PBS + 10% BSA for 2 hours at room temperature. The wells are rinsed 3 times followed by addition of primary antibody at a dilution of 1 :50. After 30 minutes at room temperature the wells are rinsed 3 times with PBS followed by addition of alkaline phosphatase anti-mouse Ig secondary. After 30 minutes the wells are rinsed with TBS followed by addition of PNPP substrate. Color reaction is allowed to occur for 60 minutes.
  • Figure 14 illustrates antibody responses at day 21 following a single injection of excipient, adenovirus or FGF-Fab:Ad conjugate.
  • Optical density (O.D.) x 10 3 is plotted on the vertical axis, while data points corresponding to single injections of excipient, Ad, or FGF-Fab:Ad conjugate are identified on the horizontal axis.
  • Open squares, circles and diamonds correspond to anti-adenovirus protein responses, while closed squares, circles and diamonds correspond to anti-knob protein responses.
  • animals treated with excipient had a background response ranging from 14 to 43 with a median response of 33 optical density units.
  • Animals treated with adenovirus developed a robust response to adenovirus proteins.
  • Response varied from 1180 to 667 with a median response of 808 optical density units (see Fig. 14).
  • Antibody response generated from the FGF2-retargeted adenovirus is significantly reduced.
  • Response varied from 556 to 38 with a median of 175 optical density units.
  • knob protein To determine the percentage of response derived from knob protein the antisera generated from all the treated groups are analyzed by knob ELISA. Animals treated with excipient had background responses varying from 28 to 21 with a median response of 24 optical density units. Fig. 14 also shows that animals treated with adenovirus had a significant response to knob protein ranging from 582 to 412 with a median response of 559 optical density units. Antibody response generated from the FGF2-retargeted adenovirus ( at a FGF2-Fab : adenovirus ratio of 2000:1) is significantly reduced. Response varied from 422 to 24 with a median of 34 optical density units.
  • retargeting of viral vectors using polypeptides reactive with the FGF receptor is a viable strategy, not only in the context of enhancing delivery and expression of a gene of choice, but in reducing the immunogenicity of the viral vector.
  • Such retargeted vectors may well be more useful in producing systemic therapeutic effects in view of their reduced potential for stimulating an antibody response in an individual to which such vectors are administered in a therapeutic context.
  • any proposed approach is dependent on a vector vehicle which is capable of achieving adequate gene delivery to target cells in vivo.
  • the adenovirus has a number of properties which make it a promising vector for in vivo applications (Brody SL, et al., Ann N Y Acad Sci. 1994; 716:90-101) and a number of gene therapy approaches for vascular diseases have been developed in model systems employing these vectors (Rios CD, et al., Arterioscl Thromb Vase Biol.
  • FGF2 fibroblast growth factor
  • FGF2 basic FGF
  • HCAECs human coronary artery endothelial cells
  • EBM-2 media Clonetics Co ⁇ oration
  • EGM-2 MV supplements - FBS 5%
  • hydrocortisone human fibroblast growth factor
  • vascular endothelial growth factor vascular endothelial growth factor
  • R3-insulin growth factor- 1 ascorbic acid
  • human endothelial growth factor gentamycin and amphotericin.
  • HASMCs human aortic smooth muscle cells
  • All cells are maintained at 37°C in a humidified atmosphere containing 5% CO 2 .
  • a recombinant ElA-deleted adenovirus expressing firefly luciferase under the control of the cytomegalovirus (CMV) promoter (AdCMVLuc (Herz J, et al., Proc Natl Acad Sci USA. 1993; 90(7):2812-2816)) is propagated in the permissive 293 cell line, purified by centrifugation through two cesium chloride gradients and plaque titered on 293 cells by standard techniques (Graham F, et al., Methods in Molecular Biology. Vol. 7 - Gene Transfer and Expression Techniques. Clifton, NJ: Humana Press; 1991 :pp. 109-129).
  • CMV cytomegalovirus
  • a recombinant ElA-deleted adenovirus expressing the Escherichia coli ⁇ galactosidase gene under the control of the cytomegalovirus promoter (AdCMVLacZ) is prepared as above.
  • An irrelevant virus (AdAmpg, which encodes the genes for retroviral packaging functions) is used as a control in the galactosidase experiments.
  • the Fab-FGF2 is constructed by conjugating recombinant FGF2 (Lappi DA, et al., Anal Biochem. 1993; 212(2):446-451) with the Fab fragment of a neutralizing monoclonal antibody (1D6.14) generated against the adenovirus serotype 5 knob region (Douglas JT, et al., Nat Biotech. 1996; 14:1574-1578).
  • the conjugation procedure and subsequent confirmation of the activity of the Fab and FGF2 components of the conjugate have been described elsewhere (Goldman CK, et al., Cancer Res. 1997; 57(8) : 1447- 1451).
  • conjugation is performed using N-succinimidyl 3-(2- pyridyldithio)propionate (SPDP; Pharmacia, Uppsala, Sweden) followed by purification using heparin-Sepharose and Sepharose S-100 column chromatography (Pharmacia). Mass spectrometry of the resulting conjugate indicated a 1 :1 molar ratio of Fab to FGF2.
  • Activity of the Fab and FGF2 components is confirmed by enzyme-linked immunoassay and cellular proliferation assay.
  • ELISA plates are coated with recombinant adenovirus knob protein, Fab-FGF2 conjugate is applied to the plates, then bound conjugate is detected using an anti-FGF antibody.
  • FGF activity of the conjugate is confirmed with a proliferation assay using bovine endothelial cells.
  • AdCMVLuc (5x10 6 plaque forming units (pfu) in 1 ml, diluted from stock in HEPES- buffered saline(HBS; 150mmol/L HEPES, 20mmol/L NaCl, pH 7.8) is mixed with Fab (0.2mg) or Fab-FGF2 (0.27mg) in 1.5 mL polypropylene microcentrifuge tubes and incubated at room temperature for 30 minutes in a total volume of 5 ml. For experiments in which different concentrations of virus are used, the amount of Fab or Fab-FGF2 is adjusted to keep the proportions constant.
  • each mixture is brought to 350 ml with warmed (37°C ) DMEM/F12 (50:50) media (Cellgro) containing 2% FBS, glutamine, penicillin and streptomycin.
  • Blocking with excess FGF2 is performed by preincubating cells for 30 min with a 100 fold excess of free FGF2 (compared to the amount in the conjugate) as well as including this amount of FGF2 in the infecting media.
  • Blocking with heparin is performed by using a concentration of 500 U/ml in the infecting media (i.e. 50-fold excess compared to the concentration of heparin in the HUVEC propagation medium).
  • Luciferase expression is analyzed using a Luciferase Assay System kit (Promega, Madison WI), according to the manufacturer's instructions. Briefly, media are aspirated from cells, cells are washed with PBS, then lysed in Promega cell lysis buffer (100 ml per well). Twenty microliters of lysate are added to 100 ml of Promega luciferase assay reagent and determinations of relative light units (RLU) are made using a Berthold luminometer calibrated to ensure the RLU readout is within the linear range of the system.
  • RLU relative light units
  • AdCMVLacZ is complexed with Fab or Fab-FGF2 in the manner described for AdCMVLuc, then cells are infected as above. Beta-galactosidase activity is assessed 48 hours later. Media are removed from cells and cells are washed once with PBS, then fixed in 0.5% glutaraldehyde for 10 mins. Following 2 washes with 10 mM magnesium chloride, cells are stained overnight at room temperature in the dark with a solution containing 1 mg/mL X-gal (GibcoBRL, Grand Island NY) . Negative controls included staining of uninfected cells and staining of cells infected with an irrelevant virus (AdAmpg). The number of stained versus total cells are counted in three random high power (lOOx) fields.
  • Beta-galactosidase expression is also assessed by fluorescent activated cell sorting (FACS) analysis.
  • FACS fluorescent activated cell sorting
  • a binding assay using 3 H labeled adenovirus is performed as described (Wickham TJ, et al., J Virol. 1996; 70(10):6831-6838). Briefly, cells are harvested from confluent 80 cm 2 flasks with Versene (GibcoBRL) and resuspended at a density of 10 7 cells per mL.
  • 3 H- AdCMVLuc (10,000 cpm, specific activity 1.5 x lO '3 counts per particle) is incubated with Fab, Fab-FGF2 or Fab-FGF2 + anti FGF antibody, as described above, then added to 10 6 cells in a final volume of 200 ml of Dulbecco's Modified Eagle's Media (DMEM; Cellgro), 10 mmol/L HEPES, 1 mmol/L magnesium chloride.
  • DMEM Dulbecco's Modified Eagle's Media
  • HUVECs are harvested by trypsinization, washed twice with cold (5 °C) D-PBS, then fixed with 1% paraformaldehyde for 30 minutes on ice. Following two washes with cold D-PBS, cells are resuspended in D-PBS (200,000 cells in 100ml), then a monoclonal antibody against FGF receptors (EcR6, PRIZM Pharmaceuticals, San Diego CA) is added to a final concentration of 50 mg/mL and incubated for 30 minutes on ice. This antibody is chosen because the epitope it recognizes has been mapped to a region shared by all four described FGF receptors. Controls consisted of mouse IgG (Sigma) and no primary antibody.
  • FGF2 retargeting of adenovirus enhances gene expression in HUVECs
  • the adenovirus is a promising vector for in situ gene delivery to the vasculature.
  • the achievement of high levels of transduction of vascular cells in vivo is limited by target cell cytotoxicity at high concentrations of virus. Therefore, we aimed to develop a strategy which would enable a reduction in the concentration of adenoviral vector necessary to achieve a given level of transfection.
  • the level of native adenoviral receptors on vascular cells is relatively low, it is hypothesized that enhanced gene delivery could be achieved by targeting adenoviral infection to an alternate receptor, the FGF receptor, which is expressed on vascular cells.
  • HUVECs are transfected with AdCMVLuc alone or following incubation of the virus with a retargeting conjugate, which is formed by linking FGF2 to the Fab fragment of a neutralizing antibody directed against the adenoviral fiber knob domain.
  • a retargeting conjugate which is formed by linking FGF2 to the Fab fragment of a neutralizing antibody directed against the adenoviral fiber knob domain.
  • cells are also infected with virus which had been incubated with Fab alone. Twenty four hours later, luciferase reporter gene expression, which is proportional to the number of infecting virus particles, is assessed.
  • Transfection with AdCMVLuc is inhibited 87 ⁇ 3%> (mean ⁇ SD of three experiments) by 1D6.14 Fab, thus confirming the stability of Fab binding to adenoviral knob in these experiments.
  • the Fab-FGF2 retargeted virus is incubated with a polyclonal antibody against FGF, an excess of free FGF2, or with heparin (which binds to FGF) prior to infection of HUVECs. Transfection is inhibited by each of these reagents; 82 ⁇ 4%, 41 ⁇ 29%, and 97 ⁇ 0.6% respectively (means ⁇ SD of three experiments), confirming that the enhancement is specifically mediated via FGF2 (Fig
  • HUVECs we investigated the effect of FGF2 retargeting on gene delivery to primary cultures of human coronary artery endothelial cells and human aortic smooth muscle cells. Cells are infected in triplicate as previously described, and three experiments are performed for each. Transduction of these cells is significantly enhanced by Fab-FGF2.
  • FGF2 retargeting of adenovirus allows a reduction in adenoviral dose Because our primary goal is to provide a means to reduce adenoviral dose as a way of avoiding cytotoxicity, we next sought evidence that the enhancement in gene expression seen with FGF2 retargeting would enable a reduction in the dose of virus necessary to achieve the same level of transgene expression.
  • HUVECs are infected with AdCMVLuc at a dose of 10, 50 or 100 pfu/cell with or without Fab-FGF2.
  • a luciferase assay performed 24 hours later showed an approximately equivalent level of transduction using 10 pfu/cell with FGF2 retargeting as is seen with 100 pfu/cell when virus alone is used ( Figure 17).
  • the enhanced luciferase reporter gene expression seen with FGF2 retargeting could potentially either be due to greater expression per cell, or to a greater number of transduced cells, or both. Therefore the number of transduced cells is determined by infection with AdCMVLacZ with or without Fab-FGF2 and assessing ⁇ -galactosidase expression by staining and counting of cells.
  • Confluent cultures are prepared by plating cells at 24, 000 per well in 24 well plates, then allowing them to reach confluence with no further feeding (to day 5) or with one change of media only (on day 5 for those cells maintained for 10 days). Under these conditions, at 5 and 10 days the cells appeared relatively quiescent as evidenced by a total lack of mitotic figures, but good viability is maintained (good mo ⁇ hology, no evidence of cell death). Cells are then infected with AdCMVLuc with or without FGF2 retargeting and fresh complete media is added to the wells.
  • results are expressed as a ratio of the gene expression seen in the cells infected with retargeted adenovirus, compared with cells plated at the same time which are infected with unmodified virus (data not shown). In this way we corrected for any factors which might impact on adenoviral transduction per se with extended time in culture (e.g. cellular metabolic rate).
  • FACS analysis for FGF receptors is performed using rapidly proliferating cells and cells maintained in confluent culture as above.
  • a monoclonal anti-FGF receptor antibody (EcR6) which recognizes a common epitope shared between all four described FGF receptor subtypes, and negative controls consisting of cells incubated with mouse IgG or no primary antibody.
  • EcR6 monoclonal anti-FGF receptor antibody
  • negative controls consisting of cells incubated with mouse IgG or no primary antibody.
  • FGF2 has an extremely short half life in vivo and generally must be given by infusion or in a sustained release formulation for stimulatory effects to be seen (Edelman ER, et al., J Clin Invest. 1992; 89(2):465-473).
  • the binding of FGF2 to cellular receptors is a complex process involving high affinity tyrosine kinase receptors (of which four have been described) as well as binding to low affinity binding sites (heparan sulfates) on the cell surface (Yayon A, et al, Cell. 1991 ; 64(4):841-848).
  • FGF2-saporin is subsequently shown to inhibit neointimal formation in an angioplasty model (Farb A, et al., Circ Res. 1997; 80(4):542-550), and selective targeting has also been demonstrated in a model of arteriovenous grafts (Chen C, et al., Circulation. 1996; 94(8):1989-1995). Whether such selectivity will be seen in the context of adenoviral targeting however, awaits in vivo investigation.
  • gene expression is enhanced in cell lines to which the retargeted adenoviral vectors of the present invention are administered.
  • enhanced gene expression was observed not only in those cell lines understood to be sensitive to adenoviral infection; enhanced expression was also observed in cell lines that are normally resistant to Ad infection.
  • Ad-Sensitive Cell Lines For example, enhanced gene expression is observed when retargeted Ad vectors are used in the following cell lines. In each instance, the abbreviation and cell type of each cell line is indicated.
  • Ad vectors have been used as vectors to deliver genes to a wide variety of tissues. Despite achieving high expression levels in vivo, Ad vectors display limitations such as anti-vector immune responses, transient expression, and normal tissue toxicity, which limit therapeutic potential. Targeting strategies to abrogate native tropism and redirect Ad uptake through defined receptors should decrease vector-related toxicities, increase transduction efficiency, and thus allow for systemic administration.
  • FGF-2 basic fibroblast growth factor
  • FGF-retargeted Ad demonstrates markedly decreased hepatic toxicity, liver transgene expression, and immunogenicity.
  • FGF- retargeting is established by conferring sensitivity to tumors that are highly resistant to Ad infection, resulting in enhanced survival of Ad-resistant tumor-bearing mice. This broadly useful method to redirect native Ad tropism may offer significant therapeutic advantages.
  • Replication-deficient human adenoviruses mainly serotypes 2 and 5 have been used as vectors for gene delivery in a wide variety of cell types.
  • adenoviral vectors Despite achieving high expression levels using adenoviral vectors, the toxicity, short-term transgene expression, and immunogenicity limit the usefulness of adenoviral vectors and have prevented demonstration of clinical efficacy (Goldman, et al., Cancer Res 57, 1447-1451 (1997); Wagner, et al., Annu Rev Med 48, 203-216 (1997)).
  • Several approaches are under investigation to either block the native tropism of adenovirus, decrease its immunogenicity via deletion of parts of its genome, or target the virus to cell types of interest, with mixed success.
  • FGF2-anti-knob fiber Fab conjugate is made as described herein (see also Goldman, et al., Cancer Res 57, 1447-1451 (1997)).
  • FGF2-Fab (0.34 mg/mL) is stored at -80°C in Dulbecco's phosphate-buffered saline (Gibco BRL, Grand Island, NY).
  • AdCMVHSV-TK has been previously described and is an El -deleted Ad5 vector which expresses HSV-TK from the CMV promoter.
  • Ad5 ⁇ -gal is obtained from Molecular Medicine LLC (La Jolla, CA).
  • Ad5 ⁇ -gal is an El-deleted, E3-mutated vector which expresses ⁇ -gal from the CMV promoter.
  • AC2 cells are derived from a clone of 293 cells that had been selected for higher virus production levels (Molecular Medicine, LLC). Viruses are plaque purified and individual isolates used to infect AC2 cultures. Virus is purified using chromatographic methods to generate infectious virus equivalent to CsCl preparation. Particle number and plaque titering assays are performed using standard methods 2 . Plaque forming units (pfu) for Ad5HSV-TK and Ad ⁇ -gal are determined to be 4x10 10 per mL and 9x10 10 per mL, respectively. Particle to pfu ratios for Ad5HSVtk and Ad5 ⁇ -gal are determined to be 22.5 and 18.9, respectively.
  • FGF2-Ad ⁇ -gal and Ad ⁇ -gal Targeting FGF2-Ad ⁇ -gal and Ad ⁇ -gal is assessed in female C57B1/6 mice.
  • 77 ⁇ g of FGF2-Fab, or an equivalent volume of 0.9%) NaCl is incubated for 30 minutes at room temperature with 2 x 10 10 pfu of Ad ⁇ -gal.
  • 2 x 10 10 pfu of either Ad ⁇ -gal or FGF2-Ad ⁇ -gal are injected intravenously per mouse (over a 30 second period) in a final volume of 0.32 mL. This amounts to a 50:1 molar ratio of FGF2-Fab to fiber molecules.
  • mice received 0.32 mL of excipient (25 mM Tris pH 7.5, 100 mM NaCl, 10 mg/mL lactose). On days 2, 4, 7 and 12 post injection, 3 to ' 6 mice per group are sacrificed. Serum is collected for analysis of transaminases and alkaline phosphatase. The liver is removed, weighed, and immediately snap frozen in liquid nitrogen, stored at -80°C and then processed for quantitative analysis of ⁇ -galactosidase activity. A portion of liver is either fixed for 4 hours at 4°C in 10% neutral buffered formalin and then embedded in paraffin, or snap frozen in OCT using isopentane precooled with dry ice and stored at -80°C.
  • excipient 25 mM Tris pH 7.5, 100 mM NaCl, 10 mg/mL lactose.
  • 3 to ' 6 mice per group are sacrificed. Serum is collected for analysis of transaminases and alkaline phosphatase. The liver is
  • cryostat sections are fixed in 2% paraformaldehyde, 0.5%o glutaraldehyde in PBS pH 7.4 for 30 min. at room temperature. Tissue sections are then rinsed in PBS containing 0.03% NP-40 and 2 mM MgCl 2 and incubated for 16 hours at 37°C in 1 mg/mL 5-bromo-4-chloro-3-indolylb-D-galactopyranoside (X-Gal) (Fischer), 5 mM K 3 Fe(CN) 6 , and 5 mM K 4 Fe(CN) 6 in PBS pH 7.4 containing 2 mM MgCl 2 and 0.03%o NP-40.
  • X-Gal 5-bromo-4-chloro-3-indolylb-D-galactopyranoside
  • ⁇ -gal activity is quantitated in mouse liver homogenates according to standard techniques. Briefly, frozen tissues are minced and homogenized on ice in cold lysis buffer by hand using a glass tissue grinder. 100 mg of liver weight is added per mL of 0.2%) Triton-X, 100 mM potassium phosphate lysis buffer, pH 7.8. Homogenates are clarified by two centrifugation steps of 20 minutes each at 4°C in a microfuge at 12,000g.
  • Clontech Luminescent ⁇ -gal Detection Kit II (catalog # K2048-1). lO ⁇ l of each sample dilution is incubated with 75 ⁇ l Clontech ⁇ -gal Reagent in 96-well plates at room temperature for 1 hour and read in a Dynafech Laboratories ML3000 Microtiter plate luminometer. The activity of each sample is determined by extrapolation from a standard curve of ⁇ -gal enzyme supplied with the Clontech kit, and is expressed in mU/g organ weight. Statistical analysis of the data is performed using an unpaired t-test.
  • substrate reactions are determined using a microplate reader set at a wavelength of 490 nm for reference and 405 nm for detection. All wells are blanked against six wells that had not received primary antibody, and the mean of three triplicate wells determined for each serum sample. Data are expressed as OD405 x l0 3 .
  • Ad vector delivered extravenously is cleared rapidly, within the first 24 hours, in the liver. Concomitantly, there is considerable transduction of liver hepatocytes and associated transgene expression. This is in part due to a high concentration of the Ad cellular receptor, Coxsackie-adenovirus receptor (CAR), in the rodent liver.
  • CAR Coxsackie-adenovirus receptor
  • Ad transgene expression rapidly declines over the first 7 days after Ad vector administration but is associated with significant liver toxicity as manifest by increased serum transaminases, necrosis, and inflammation (Yang, et al., Id.
  • FGF2 basic fibroblast growth factor
  • FGF2 binds FGF receptors with unusually high affinity (Kd lO " ' 2 M) compared to other ligand-receptor interactions.
  • FGF receptors are upregulated in a number of diseases characterized by unwanted cellular proliferation, and many human malignancies contain elevated levels of one or more of the four recognized FGF receptors.
  • FGF2 targets DNA both in vitro and in vivo. Recently, we have demonstrated up to a 12-fold increase in gene expression using FGF2-retargeted Ad compared to Ad in delivering reporter genes or the HSV thymidine kinase (TK) gene to human Kaposi's sarcoma cell lines in vitro and human ovarian carcinoma cells both in vitro and in vivo (Sosnowski, et al., J Biol Chem 271 : 33647-33653 (1996)). We reasoned that the enhanced in vivo potency implied greater specificity, thus it is appropriate to assess whether FGF2-Ad shows diminished toxicity and immunogenicity by altering its native tropism. Redirected tropism may be further evaluated in mice challenged with tumor cells resistant to native Ad infection.
  • TK thymidine kinase
  • a bifunctional molecule is made by conjugating FGF2 to a blocking anti-fiber Fab. This molecule is then incubated with Ad prior to transduction of cultured cells or use in vivo. The high-affinity interaction of this Fab with the knob domain of the Ad fiber protein has been measured at 2.1x10 "9 M using Biacore analysis. This value is comparable or greater than commercially available therapeutic antibodies.
  • FGF2-Ad ⁇ -galactosidase ( ⁇ -gal) and Ad ⁇ -gal are injected intravenously into mice and expression of ⁇ -gal in the liver is assessed.
  • mice are sacrificed on days 2, 4, and 7 post injection of either excipient, Ad ⁇ -gal (2xl0 10 pfu, i.v.) or FGF2-Ad ⁇ -gal (2x10 10 pfu, i.v.).
  • Liver tissue is processed and stained with Xgal as described above.
  • markedly greater numbers of Xgal-stained hepatocytes are present in the livers of mice treated with Ad ⁇ -gal compared to the livers of mice treated with FGF2-Ad ⁇ -gal, which had a profound decrease in X-gal-stained hepatocytes (not shown).
  • No X-gal + hepatocytes are observed in control mice (data not shown).
  • Quantitation of ⁇ -galactosidase activity in the liver (Table 3) parallels the histochemical results and demonstrated 12- to 20-fold less ⁇ -gal in the livers of FGF2-
  • Ad ⁇ -gal-treated mice than in the livers of Ad ⁇ -gal-treated mice.
  • a modest level of ⁇ -galactosidase is still present in the liver of Ad ⁇ -gal-treated mice (259 mU/gram) but is undetectable in the liver of FGF2-Ad ⁇ -gal-treated mice.
  • Figure 9 shows the serum transaminase and alkaline phosphatase levels in mice treated with Ad ⁇ -gal or FGF2-Ad ⁇ -gal.
  • Ad ⁇ -gal (2xl0 10 pfu, i.v.) or FGF2-Ad ⁇ -gal (2xl0 10 pfu, i.v.) serum is prepared and transaminases (ALT, AST) and alkaline phosphatase (Alk Phos) are measured.
  • the data are presented as mean +/- S.E.
  • serum transaminase levels are elevated 8- to 16-fold in the Ad ⁇ -gal treated group but only 3- to 5-fold in the FGF2-Ad ⁇ -gal-treated group (see Figure 9).
  • Serum alkaline phosphatase is also elevated in the serum of Ad ⁇ - gal-treated mice but is within normal limits iri FGF2-Ad ⁇ -gal -treated mice.
  • Histopathology on day 7 revealed evidence of severe hepatocellular necrosis and a marked inflammatory infiltrate in the liver of mice treated with Ad ⁇ -gal (Ad ⁇ -gal, 2x10 10 pfu, i.v.), but analysis of livers from the FGF2-Ad ⁇ -gal-treated group (FGF2-Ad ⁇ -gal, 2x10 10 pfu, i.v.) revealed that the hepatocellular necrosis is almost completely abrogated and only a minimal inflammatory infiltrate is observed (data not shown).
  • Figure 14 illustrates serum antibody levels of anti-adenovirus and anti- knob protein antibodies in mice treated with either excipient, Ad ⁇ -gal, or FGF2-Ad ⁇ -gal.
  • Ad ⁇ -gal 1 x 10 9 PFU, i.p.
  • FGF2-Ad ⁇ - gal sera are prepared and assayed by ELISA for specific antibody levels directed against either total adenovirus or purified knob protein.
  • Data are presented as the mean OD 405 x 10 3 value of three triplicate wells as determined for each serum sample.
  • the arithmetic mean (dashed line) are compared using one-way analysis of variance and Fisher's procedure for least significant differences for a posteriori contrasts.
  • the adenovirus group differs from both the excipient and FGF2-Ad groups by pO.OOOl.
  • FGF2-Ad induces a lower mean anti-Ad antibody response and 2/5 mice had no anti-Ad antibody in the FGF2-Ad treated group.
  • mean titers are less, and 3/5 mice generated no antibody response to the knob domain of fiber protein in the FGF2-Ad-treated group compared to the Ad-treated group.
  • the data which demonstrate that the mean anti-knob antibody response is >50% of the anti-Ad response, supports the hypothesis that knob is an immunodominant epitope (see Fig. 14).
  • B16 murine melanoma cell line is chosen as the target.
  • B16 tumor cells express FGFR1 and FGFR3 mRNA and are sensitive to FGF2-targeted DNA and protein toxins.
  • B16 cells are incubated for 1 hour ex vivo with either Ad containing the herpes simplex virus thymidine kinase gene (AdHSVTK) or FGF2-AdHSVTK prior to implantation intraperitoneally in BDFl mice.
  • AdHSVTK herpes simplex virus thymidine kinase gene
  • FGF2-AdHSVTK FGF2-AdHSVTK
  • Figure 11 shows survival analysis of mice treated with either B16F0 tumor cells incubated ex vivo with AdHSVTK or FGF2-AdHSVTK.
  • mice bearing B16 melanoma treated with AdHSVTK plus ganciclovir are indistinguishable from the control mice which received untreated B16 tumor cells plus the ganciclovir regimen (median survival 18-19 days; see Fig. 11).
  • mice which received B 16 melanoma treated with FGF2-AdTK, at two different FGF2-Fab to knob molar ratios demonstrated a2.6-fold increase in median survival compared with the control groups ( Figure 11).
  • the transduction of normal, non-tumor cells by adenovirus can lead to toxicity which has limited preclinical studies and initial clinical trials to direct injection into tumors or locoregional delivery to a compartment containing tumor cells (Goldman, et al., Id. (1997); Mazue, et al., Toxicol Lett 64-65, 329-338 (1992); Ying, et al., Cancer 74, 848-853 (1994)).
  • the immunogenicity of adenoviruses is a potential hurdle to repeat dosing. We have developed a method to abrogate the native tropism of adenovirus and redirect its cellular uptake through FGF receptors.
  • FGF2-Ad induced 12- to 20-fold less transgene expression ( ⁇ -gal) in the liver than non-retargeted Ad and had only a modest effect on serum transaminase levels compared to the robust increase of serum transaminases in the mice receiving Ad.
  • FGF2-Ad displayed reduced immunogenicity, as anti-Ad and anti-fiber protein antibodies are not found in all treated mice, unlike the Ad-treated group.
  • FGF2-anti-fiber Fab could block the antibody response to the fiber protein
  • the blunting of the response to other epitopes on the virion surface is unexpected. Whether FGF2-Fab is masking these other epitopes through steric hindrance, or whether it directs the clearance of virus through less immunogenic pathways, is unknown.
  • Multiple doses of the re-engineered vectors of the present invention may be administered in vivo without an appreciable level of humoral response resulting therefrom.
  • the modified vectors of the present invention are significantly less immunogenic than other vectors described in the art.
  • an Ad-resistant tumor line (B16 murine melanoma) can be made sensitive to FGF2-AdHSVTK transduction.
  • Mice challenged with FGF2-AdHSVTK-treated B16 melanoma cells have greatly prolonged survival when compared to mice bearing control or AdHSVTK-treated B16 melanoma cells.
  • FGF2-AdHSVTK to be at leastl 0-fold more potent than AdHSVTK in vivo in a human ovarian cancer model which is sensitive to Ad (Rancourt, et al., Nat Med (1997)).
  • FGF2-retargeted Ad Because of the enhanced efficacy and decreased toxicity of FGF2-retargeted Ad in comparison to Ad, the therapeutic index in vivo is greatly enhanced. FGF2 retargeting of viral vectors thus provides a useful approach to targeted gene delivery, which will be required for successful clinical oncology applications.
  • Ad21 An Ad vector that produces an intracellular single-chain antibody to the Her-2/neu receptor (i.e., an "intrabody”) is evaluated for activity in vivo.
  • this Ad Ad21
  • FGF2FabAd21 FGF2FabAd21
  • mice receive a single ip dose of either Ad21 or FGF2FabAd21 at either of two dose levels and then they are followed for survival.
  • dosages of Ad21 and FGF2FabAd21 administered are lxl 0 9 pfu and 5x10 9 pfu.
  • conjugates of anti-knob Fab and KGF, as well as conjugates of anti-knob Fab and 11 A8 antibody are constructed as described below.
  • Administration of conjugates retargeted using the aforementioned polypeptides reactive with FGF receptor demonstrate successful modification of Ad tropism as well as a concomitant increase in gene expression, as described.
  • KGF is particularly useful in targeting epithelial cells, hepatocytes, and type II pneumocytes of the lung, which makes it ideal for a variety of gene targeting and delivery applications, as discussed previously. Therefore, its inco ⁇ oration into a ligand- Fab construct and its use as an Ad-retargeting agent provides additional treatment options, particularly when one is addressing disease conditions that involve the cells and receptors specifically targeted by KGF - e.g. hepatocytes and type II pneumocytes.
  • a method of generating and purifying Ad knob antigen, which is used to generate anti-knob antibody (from which Fab and other fragments are readily prepared) is also described as exemplary.
  • a fed-batch fermentation generated approximately 1.4 kg paste and knob is purified using two sequential chromatography steps: cation-exchange followed by immobilized metal ion affinity chromatography (IMAC).
  • Cation-exchange chromatography CEC is used as a capture and primary recovery step following lysis and clarification.
  • the CEC-purified product is then purified by IMAC (charged with nickel) based on the affinity of the poly-histidine n-terminus of knob for nickel.
  • IMAC immobilized metal ion affinity chromatography
  • knob antigen In the native state, the knob antigen has been shown to exist as homotrimer. The theoretical molecular weight based on the cDNA which codes for knob monomer is 22,539 Da. Based on the analyses to date, the purified product appears to exist principally as a trimeric molecule with binding characteristics equivalent to the reference standard. Knob antigen is also useful as an affinity ligand immobilized to a chromatographic resin for in-process testing and use in purifying preparative quantities of FGF-Fab. KGF-Fab, EGF-Fab and 11 A8-Fab.
  • mice Female Balb/C mice were injected subcutaneously with 10 7 SK-HEP-1 cells in 0.2 ml Dulbecco's PBS to generate the antibody 11A8. The animals were reimmunized 14 and 28 days later with 10 7 cells injected intraperitoneally. The fusion was done 4 days after the final immunization.
  • Spleen cells taken from an immunized mouse were fused with NS-0 cells using PEG- 1500.
  • Hybridoma cells were selected in RPMI-1640 containing HAT and 0.005% 2-mercaptoethanol followed by RPMI-1640 containing HT.
  • ELISA was used for screening the hybridomas. Briefly, plates were coated with 50 ul of ECDR 1 (100 ng/ml) overnight at 4°C. After washing, conditioned media samples were added. A second antibody conjugated to horseradish peroxidase (Bio-Rad, 1 : 1000 dilution) was used to detect hybridomas. Cells in positive wells were cloned by limiting dilution.
  • Antibodies were purified by ammonium sulfate precipitation and Affi-Gel Protein A agarose column (Bio-Rad, Richmond, CA) chromatography according to the manufacturer's protocol. The purity of the antibody was checked by a 7.5% PhastGel
  • KGF is conjugated to Fab (anti-knob).
  • the conjugate is purified using procedures analogous to those used for the conjugation and purification of FGF-Fab as described hereinabove (i.e., Heparin- Sepharose affinity chromatography followed by size exclusion chromatography), with minor modifications.
  • KGF and 1 1A8 are derivatized with SPDP (monoderivatized) according to the manufacturer's instructions (Pharmacia, Piscataway, NJ); isolated and then conjugated to Fab.
  • SPDP dioderivatized
  • the final bulk conjugate is analyzed by SE- HPLC, and the molar ratios of KGF to Fab are determined by SDS-PAGE/Coomassie (results not shown).
  • SE-HPLC demonstrates that the conjugate is heterogeneous but does not contain detectable levels of free KGF or free Fab.
  • the molar ratios of Fab to KGF are estimated at 1 : 1, based on scanning densitometry of SDS-PAGE/Coomassie stained gels under reducing conditions (data not shown).
  • Biological activity of the KGF component of the conjugate is assessed by a proliferation assay performed on Balb/MK cells.
  • the conjugate is equipotent to the derivatized KGF and underivatized KGF standard (not shown).
  • the knob-binding activity and transduction activity are readily evaluated using standard assays and procedures, as those of skill in the relevant art will readily appreciate.
  • Figure 20 illustrates the successful retargeting of an Ad vector linked to a marker (Ad ⁇ gal) using either FGF2 or 11 8-Fab and the successful delivery of the marker sequence in HCT116 cells. From left to right, the shaded bars represent Ad ⁇ gal; Fab; FGF2Fab, 30x; FGF2Fab, 3x; HA8Fab, 30x; and HA8Fab, 3x. Molar excess of Ligand-Fab:Knob Monomer is indicated in the latter four categories. On the vertical axis, mU ⁇ gal/mg protein is indicated. (25K, 72 hr; 300 MOI.)
  • ADDRESSEE SEED and BERRY LLP

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Wood Science & Technology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Public Health (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Oncology (AREA)
  • Dermatology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Ultra Sonic Daignosis Equipment (AREA)
  • Magnetic Resonance Imaging Apparatus (AREA)
PCT/US1998/004964 1997-03-14 1998-03-13 Adenoviral vectors with modified tropism Ceased WO1998040508A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP98910375A EP0973926A1 (en) 1997-03-14 1998-03-13 Adenoviral vectors with modified tropism
CA002283461A CA2283461A1 (en) 1997-03-14 1998-03-13 Adenoviral vectors with modified tropism
AU64629/98A AU742365B2 (en) 1997-03-14 1998-03-13 Adenoviral vectors with modified tropism
JP53984898A JP2001515493A (ja) 1997-03-14 1998-03-13 改変された親和性を有するアデノウイルスベクター

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US4078297P 1997-03-14 1997-03-14
US60/040,782 1997-03-14
US6526597P 1997-11-10 1997-11-10
US60/065,265 1997-11-10

Publications (1)

Publication Number Publication Date
WO1998040508A1 true WO1998040508A1 (en) 1998-09-17

Family

ID=26717429

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1998/004964 Ceased WO1998040508A1 (en) 1997-03-14 1998-03-13 Adenoviral vectors with modified tropism

Country Status (6)

Country Link
US (2) US6613563B1 (https=)
EP (1) EP0973926A1 (https=)
JP (1) JP2001515493A (https=)
AU (1) AU742365B2 (https=)
CA (1) CA2283461A1 (https=)
WO (1) WO1998040508A1 (https=)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000029600A1 (en) 1998-11-19 2000-05-25 Georgetown University Systemic viral/ligand gene delivery system and gene therapy
WO2000020572A3 (de) * 1998-10-02 2000-07-20 Juergen Schrader Gewebebindende peptide, ihre identifizierung, herstellung und verwendung
WO2001026643A1 (en) * 1999-10-14 2001-04-19 The Wistar Institute Inhibition of tumorigenic properties of melanoma cells
WO2001058940A3 (en) * 2000-02-09 2002-04-25 Genvec Inc Adenoviral capsid containing chimeric protein IX
WO2002004522A3 (en) * 2000-07-10 2002-07-18 Novartis Ag Bifunctional molecules and vectors complexed therewith for targeted gene delivery
WO2004011489A3 (fr) * 2002-07-25 2004-07-01 Inst Nat Sante Rech Med Adenovirus modifies pour changer leur tropisme, de preference pour le ciblage des lymphocytes b ou des cellules ovariennes
EP1399023A4 (en) * 2001-06-01 2006-02-01 Wyeth Corp COMPOSITIONS AND METHODS FOR SYSTEMIC ADMINISTRATION OF SEQUENCES THAT CODE FOR BONE MORPHOGENESIS PROTEINS
EP1642981A4 (en) * 2003-05-10 2006-09-06 Zhaohui Peng MEDICINE BY RECOMBINANT GENE OF ADENOVIRUS VECTOR AND P53 GENE FOR TREATING PROLIFERATIVE DISEASES
EP2385124A2 (en) 1999-05-14 2011-11-09 Arbor Vita Corporation Peptides or peptide analogues for modulating the binding of a PDZ protein and a PL protein
JP2012001566A (ja) * 1999-10-07 2012-01-05 Carlos Estuard Aguilar-Cordova 遺伝子治療による固体腫瘍及び転移の治療方法

Families Citing this family (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU687117B2 (en) * 1993-10-25 1998-02-19 Canji, Inc. Recombinant adenoviral vector and methods of use
US20060275261A1 (en) * 1993-10-25 2006-12-07 Canji, Inc. Adenoviral vectors having a protein IX deletion
US6210939B1 (en) 1993-10-25 2001-04-03 Canji, Inc. Recombinant adenoviral vector and methods of use
US20010006629A1 (en) * 1993-10-25 2001-07-05 Richard J. Gregory Recombinant adenoviral vector and methods of use
US7001733B1 (en) 1998-05-12 2006-02-21 Rigel Pharmaceuticals, Inc. Methods and compositions for screening for modulations of IgE synthesis, secretion and switch rearrangement
US7060433B1 (en) 1999-11-12 2006-06-13 Rigel Pharmaceuticals, Inc. Methods and compositions for screening using diphtheria toxin constructs
AU2001237256A1 (en) * 2000-03-08 2001-09-17 Neurosearch A/S A method of sensitising endothelial cells to prodrugs
US6506365B1 (en) * 2000-09-25 2003-01-14 Baxter Aktiengesellschaft Fibrin/fibrinogen binding conjugate
US7306792B2 (en) * 2001-03-27 2007-12-11 New York University Tumor therapy with alphavirus-based and high affinity laminin receptor-targeted vectors
DE60234100D1 (de) * 2001-04-24 2009-12-03 Vlaams Interuniv Inst Biotech Verwendung von "hypoxia inducible factor 2alpha" zur behandlung von "neonatal respiratory distress syndrome"
JP2002335965A (ja) * 2001-05-14 2002-11-26 Japan Science & Technology Corp 細胞特異的発現複製ベクター
WO2002103004A1 (en) * 2001-06-15 2002-12-27 The Children's Hospital Of Philadelphia Surface modification for improving biocompatibility
KR100996226B1 (ko) * 2001-10-31 2010-11-24 유니버시티 오브 노스 텍사스 헬스 사이언스 센터 뼈 형태발생 단백질(bmp), bmp 수용체 및 bmp결합 단백질 및 녹내장 진단 및 치료에서 그의 용도
US20030133912A1 (en) * 2001-12-11 2003-07-17 Davidson Beverly L. Receptor-targeted adenoviral vectors
US7033333B1 (en) * 2002-08-02 2006-04-25 Arthur Croft Self actuated cervical (neck) traction device
WO2004029581A2 (en) * 2002-09-26 2004-04-08 The Children's Hospital Of Philadelphia Method of determining surface binding capacity
US20070098702A1 (en) * 2005-02-17 2007-05-03 University Of Maryland, Baltimore Recombinant protein polymer vectors for systemic gene delivery
WO2007050128A2 (en) * 2005-05-31 2007-05-03 Vectorlogics, Inc. Shielded adenoviral vectors and methods of use
WO2006130690A2 (en) * 2005-06-01 2006-12-07 Joslin Diabetes Center, Inc. Methods and compositions for inducing brown adipogenesis
US7858356B2 (en) 2005-11-24 2010-12-28 Genomidea, Inc. Mutant paramyxovirus and method for production thereof
US7659999B2 (en) * 2005-12-23 2010-02-09 Xerox Corporation UIdesign: N-up calculator user interface
CA2637600A1 (en) 2006-01-17 2007-07-26 Health Research, Inc. Heteroduplex tracking assay
WO2008128251A1 (en) 2007-04-17 2008-10-23 The Children's Hospital Of Philadelphia Humanized viral vectors and methods of use thereof
WO2009137689A2 (en) * 2008-05-07 2009-11-12 Surmodics, Inc. Delivery of nucleic acid complexes from particles
US20110159098A1 (en) * 2009-12-30 2011-06-30 Surmodics, Inc. Stabilization and delivery of nucleic acid complexes
US8389804B2 (en) 2010-04-08 2013-03-05 University Of Florida Research Foundation, Inc. Viral based transient-expression vector system that allows multiple applications
CN102933713B (zh) * 2010-04-08 2015-05-13 佛罗里达大学研究基金会有限公司 具有多功能的瞬时表达病毒载体体系
US8901092B2 (en) 2010-12-29 2014-12-02 Surmodics, Inc. Functionalized polysaccharides for active agent delivery
RU2542385C2 (ru) * 2012-08-31 2015-02-20 Общество с ограниченной ответственностью "НекстГен" Способ получения фармацевтической композиции для индукции развития кровеносных сосудов в тканях, фармацевтическая композиция, полученная этим способом, и способ лечения ишемии тканей и/или органов человека
US10947282B2 (en) 2015-01-19 2021-03-16 The Texas A & M University System Functionalized protein-based materials and their uses
RU2612497C2 (ru) 2015-05-26 2017-03-09 Общество с ограниченной ответственностью "НекстГен" Оптимизированная нуклеотидная последовательность и фармацевтическая композиция на ее основе с пролонгированной экспрессией трансгена vegf
EP3625714B1 (en) 2017-05-16 2021-03-17 Life Technologies Corporation Methods for compression of molecular tagged nucleic acid sequence data
US20220340627A1 (en) * 2019-09-20 2022-10-27 The Board Of Trustees Of The Leland Stanford Junior University Dach1 builds artery networks that protect against cardiac injury in adults

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2649119A1 (fr) * 1989-06-30 1991-01-04 Centre Nat Rech Scient Procede de pilotage de retrovirus en utilisant des complexes bifonctionnels
WO1994010323A1 (en) * 1992-11-04 1994-05-11 Imperial Cancer Research Technology Limited Virus with modified binding moiety specific for the target cells
US5332671A (en) * 1989-05-12 1994-07-26 Genetech, Inc. Production of vascular endothelial cell growth factor and DNA encoding same
WO1994026892A1 (en) * 1993-05-12 1994-11-24 Genetics Institute, Inc. Bmp-11 compositions
WO1995026412A1 (en) * 1994-03-28 1995-10-05 The Uab Research Foundation Ligands added to adenovirus fiber
WO1997005266A1 (en) * 1995-07-25 1997-02-13 Introgene B.V. Methods and means for targeted gene delivery

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5191067A (en) * 1989-04-27 1993-03-02 The Salk Institute For Biological Studies Fibroblast growth factor conjugates
WO1992011033A1 (en) * 1990-12-20 1992-07-09 Arch Development Corporation Control of gene expression by ionizing radiation
DE69333115D1 (de) * 1992-09-22 2003-08-28 Biofocus Discovery Ltd Rekombinante viren, die an ihrer äusseren oberfläche ein nichtvirales polypeptid präsentieren

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5332671A (en) * 1989-05-12 1994-07-26 Genetech, Inc. Production of vascular endothelial cell growth factor and DNA encoding same
FR2649119A1 (fr) * 1989-06-30 1991-01-04 Centre Nat Rech Scient Procede de pilotage de retrovirus en utilisant des complexes bifonctionnels
WO1994010323A1 (en) * 1992-11-04 1994-05-11 Imperial Cancer Research Technology Limited Virus with modified binding moiety specific for the target cells
WO1994026892A1 (en) * 1993-05-12 1994-11-24 Genetics Institute, Inc. Bmp-11 compositions
WO1995026412A1 (en) * 1994-03-28 1995-10-05 The Uab Research Foundation Ligands added to adenovirus fiber
WO1997005266A1 (en) * 1995-07-25 1997-02-13 Introgene B.V. Methods and means for targeted gene delivery

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
DOUGLAS J.T.: "Targeted gene delivery by tropism-modified adenoviral vectors.", NATURE BIOTECHNOLOGY, vol. 14, November 1996 (1996-11-01), pages 1574 - 1578, XP002030944 *
FINCH P. W. ET AL.: "HUMAN KGF IS FGF-RELATED WITH PROPERTIES OF A PARACRINE EFFECTOR OF EPITHELIAL CELL GROWTH", SCIENCE, vol. 245, no. 4919, 18 August 1989 (1989-08-18), pages 752 - 755, XP000081363 *
GOLDMAN C. ET AL.: "Targeted gene delivery to Kaposis's sarcoma cells via the fibroblast growth factor receptor.", CANCER RESEARCH, vol. 57, 15 April 1997 (1997-04-15), pages 14477 - 1451, XP002067519 *
HOGANSON D. K. ET AL.: "FGF2 retargeted adenoviral vectors mediate increased gene transfer.", SIXTH INTERNATIONAL CONFERENCE ON GENE THERAPY OF CANCER, SAN DIEGO, CALIFORNIA, USA, NOVEMBER 20-22, 1997. CANCER GENE THERAPY 4 (6 CONF. SUPPL.). 1997. S24. ISSN: 0929-1903, XP002067520 *
KRASNYKH V. N. ET AL.: "Generation of recombinant adenovirus vectors with modified fibers for altering viral tropism.", JOURNAL OF VIROLOGY, vol. 70, no. 10, October 1996 (1996-10-01), pages 6839 - 6846, XP002067518 *
MICHAEL S.I. ET AL.: "Addition of a short peptide ligand to the adenovirus fiber protein.", GENE THERAPY, vol. 2, 1995, pages 660 - 668, XP002067517 *
MILLER R. ET AL.: "Targeting adenoviral gene delivery to the epidermal growth factor receptor.", SIXTH INTERNATIONAL CONFERENCE ON GENE THERAPY OF CANCER, SAN DIEGO, CALIFORNIA, USA, NOVEMBER 20-22, 1997. CANCER GENE THERAPY 4 (6 CONF. SUPPL.). 1997. S39. ISSN: 0929-1903, XP002067522 *
REYNOLDS P. N. ET AL.: "Enhanced gene transfer to vascular endothelium using retargeted adenoviral vector.", SIXTH INTERNATIONAL CONFERENCE ON GENE THERAPY OF CANCER, SAN DIEGO, CALIFORNIA, USA, NOVEMBER 20-22, 1997. CANCER GENE THERAPY 4 (6 CONF. SUPPL.). 1997. S39. ISSN: 0929-1903, XP002067521 *
SOSNOWSKI B.A. ET AL.: "Targeting DNA to cells with basic fibroblast growth factor (FGF2).", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 271, no. 52, 27 December 1996 (1996-12-27), pages 33647 - 33653, XP002067516 *
WATKINS S.J. ET AL.: "Targeting adenovirus-mediated gene delivery with recombinant antibodies.", IMMUNOTECHNOLOGY (1996 KEYSTONE MEETING ON EXPLORING AND EXPLOITING ANTIBODY AND IG SUPERFAMILY COMBINING SITES; TAOS, NEW MEXICO, USA), vol. 2, no. 4, 22 February 1996 (1996-02-22), pages 307, XP000672146 *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000020572A3 (de) * 1998-10-02 2000-07-20 Juergen Schrader Gewebebindende peptide, ihre identifizierung, herstellung und verwendung
WO2000029600A1 (en) 1998-11-19 2000-05-25 Georgetown University Systemic viral/ligand gene delivery system and gene therapy
CN100572542C (zh) * 1998-11-19 2009-12-23 乔治敦大学 系统性病毒/配体基因输送系统和基因治疗
EP2385124A2 (en) 1999-05-14 2011-11-09 Arbor Vita Corporation Peptides or peptide analogues for modulating the binding of a PDZ protein and a PL protein
JP2012001566A (ja) * 1999-10-07 2012-01-05 Carlos Estuard Aguilar-Cordova 遺伝子治療による固体腫瘍及び転移の治療方法
WO2001026643A1 (en) * 1999-10-14 2001-04-19 The Wistar Institute Inhibition of tumorigenic properties of melanoma cells
WO2001058940A3 (en) * 2000-02-09 2002-04-25 Genvec Inc Adenoviral capsid containing chimeric protein IX
US6740525B2 (en) 2000-02-09 2004-05-25 Genvec, Inc. Adenoviral capsid containing chimeric protein IX
WO2002004522A3 (en) * 2000-07-10 2002-07-18 Novartis Ag Bifunctional molecules and vectors complexed therewith for targeted gene delivery
US7226587B2 (en) 2001-06-01 2007-06-05 Wyeth Compositions and methods for systemic administration of sequences encoding bone morphogenetic proteins
EP1399023A4 (en) * 2001-06-01 2006-02-01 Wyeth Corp COMPOSITIONS AND METHODS FOR SYSTEMIC ADMINISTRATION OF SEQUENCES THAT CODE FOR BONE MORPHOGENESIS PROTEINS
WO2004011489A3 (fr) * 2002-07-25 2004-07-01 Inst Nat Sante Rech Med Adenovirus modifies pour changer leur tropisme, de preference pour le ciblage des lymphocytes b ou des cellules ovariennes
AU2004240968B2 (en) * 2003-05-10 2008-04-17 Zhaohui Peng Recombinant gene medicine of adenovirus vector and gene p53 for treating proliferative diseases
KR100880701B1 (ko) * 2003-05-10 2009-02-02 자오후이 펭 증식성 질환 치료용 아데노바이러스 벡터 및 p53 유전자의재조합 유전자 약제
EP1642981A4 (en) * 2003-05-10 2006-09-06 Zhaohui Peng MEDICINE BY RECOMBINANT GENE OF ADENOVIRUS VECTOR AND P53 GENE FOR TREATING PROLIFERATIVE DISEASES

Also Published As

Publication number Publication date
JP2001515493A (ja) 2001-09-18
AU6462998A (en) 1998-09-29
EP0973926A1 (en) 2000-01-26
US6613563B1 (en) 2003-09-02
US20040029280A1 (en) 2004-02-12
CA2283461A1 (en) 1998-09-17
AU742365B2 (en) 2002-01-03

Similar Documents

Publication Publication Date Title
US6613563B1 (en) Viral vectors with modified tropism
US6569677B1 (en) Modified adenoviral fiber and target adenoviruses
US6054312A (en) Receptor-mediated gene delivery using bacteriophage vectors
AU734515B2 (en) A short-shafted adenoviral fiber and its use
US5521291A (en) Conjugates for introducing nucleic acid into higher eucaryotic cells
AU743051B2 (en) Gene transfer with adenoviruses having modified fiber proteins
CZ162398A3 (cs) Vektory a způsoby pro genový přenos do buněk
JP2001503250A (ja) 束縛ペプチドモチーフを用いたターゲッティングアデノウイルス
JP4350800B2 (ja) 高キャパシティーアデノウイルスベクターの開発の促進に使用するためのパッケージング細胞系
AU771686B2 (en) Adenoviral vectors with modified tropism
CA2527721A1 (en) Chimeric adenovirus capsid proteins
MXPA98004203A (en) Vectors and methods for gene transfer acelu
MXPA00002076A (en) Receptor-mediated gene delivery using bacteriophage vectors
AU2007200616A1 (en) Gene Transfer with Adenoviruses Having Modified Fiber Proteins
HK1002284B (en) Novel implant and novel vector for the treatment of acquired diseases
HK1002284A1 (en) Novel implant and novel vector for the treatment of acquired diseases

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM GW HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2283461

Country of ref document: CA

Ref country code: CA

Ref document number: 2283461

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 64629/98

Country of ref document: AU

ENP Entry into the national phase

Ref country code: JP

Ref document number: 1998 539848

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1998910375

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1998910375

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 64629/98

Country of ref document: AU

WWW Wipo information: withdrawn in national office

Ref document number: 1998910375

Country of ref document: EP