WO1998040487A1 - Recepteur d'angiogenine, compositions et procedes associes - Google Patents

Recepteur d'angiogenine, compositions et procedes associes Download PDF

Info

Publication number
WO1998040487A1
WO1998040487A1 PCT/US1998/005176 US9805176W WO9840487A1 WO 1998040487 A1 WO1998040487 A1 WO 1998040487A1 US 9805176 W US9805176 W US 9805176W WO 9840487 A1 WO9840487 A1 WO 9840487A1
Authority
WO
WIPO (PCT)
Prior art keywords
angiogenin
polypeptide
receptor
cells
protein
Prior art date
Application number
PCT/US1998/005176
Other languages
English (en)
Inventor
Bert L. Valle
Guo-Fu Hu
Original Assignee
The Endowment For Research In Human Biology, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Endowment For Research In Human Biology, Inc. filed Critical The Endowment For Research In Human Biology, Inc.
Priority to AU65603/98A priority Critical patent/AU6560398A/en
Publication of WO1998040487A1 publication Critical patent/WO1998040487A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • Embodiments of the present invention relate in general to novel cell surface receptors for angiogenin. Embodiments of the present invention also relate to methods for regulating expression of cell surface receptors for angiogenin, and further to methods of stimulating cell proliferation. Embodiments of the present invention also relate to therapeutic methods for treating conditions associated with abnormal angiogenesis.
  • Angiogenin is a potent inducer of angiogenesis (Fett et al., 1985, Biochemistry 24: 5480-5486), a complex process of blood vessel formation that consists of several separate but interconnected steps at the cellular and biochemical level: (i) activation of endothelial cells by the action of an angiogenic stimulus, (ii) invasion of activated endothelial cells into the surrounding tissues and migration toward the source of the angiogenic stimulus, and (iii) proliferation and differentiation of endothelial cells to form a new microvasculature (Folkman and Shing, 1992, J. Biol. Chem. 267: 10931-10934; Moscatelli and Rifkin, 1988, Biochim. Biophys.
  • Angiogenin has been demonstrated to induce most of the individual events in the process of angiogenesis including binding to endothelial cells (Badet et al., 1989, Proc. Natl. Acad. Sci. USA 86: 8427-8431), stimulating second messengers (Bicknell and Vallee, 1988, Proc. Natl. Acad. Sci. USA 85: 5961-5965), mediating cell adhesion (Soncin, 1992, Proc. Natl. Acad. Sci. USA 89: 2232-2236), activating cell-associated proteases (Hu and Riordan, 1993, Biochem. Biophys. Res. Commun.
  • angiogenin is a unique feature of angiogenin is that although it was originally isolated from the conditioned medium of human adenocarcinoma cells (Fett et al., 1985, supra) based solely on its angiogenic activity on the chick chorioallantoic membrane (CAM), it actually is a constituent of human plasma and normally circulates at a concentration of 250 to 360 ng/ml (Shimoyama et al., 1996, Cancer Res. 56: 2703-2706; Blaser et al., 1993, Eur. J. Clin. Chem. Clin. Biochem. 31_: 513-516). Angiogenesis is a highly controlled process under usual physiological conditions.
  • Abnormal angiogenesis can have devastating consequences as in many pathological conditions such as arthritis, diabetic retinopathy and tumor growth.
  • circulating angiogenin In order to avoid unwanted, rampant angiogenesis, circulating angiogenin must be poised for action without actively stimulating neovascularization.
  • extravascular angiogenin does stimulate the formation of blood vessels as evidenced by the angiogenesis seen in the chick embryo CAM assay (Fett et al., 1985, supra , in the cornea and meniscus of the knee of the rabbit (King and Vallee, 1991, J. Bone Joint Surg.
  • angiogenin binding protein located on the endothelial cell surface (Hu et al., 1991 , Proc. Natl. Acad. Sci.
  • VEGF vascular endothelial growth factor
  • bFGF basic f ⁇ broblast growth factor
  • aFGF acidic fibroblast growth factor
  • epidermal growth factor epidermal growth factor
  • angiogenin stimulates ->H- thymidine uptake and proliferation of bovine brain capillary endothelial cells, but not of bovine aortic arch endothelial cells (Chamoux et al., 1991, Biochem. Biophys. Res. Commun. 176: 833-839). It has been reported that initial vascular sprouting and elongation can be achieved merely by migration and redistribution of existing endothelial cells from the limbal vessels and does not require proliferation of endothelial cells (Sholley et al., 1984, Lab. Invest. ]_: 624-634). However, subsequent vascular ingrowth will not progress without cell proliferation.
  • angiogenin cell surface receptors for angiogenin and the mechanisms by which angiogenin stimulates angiogenesis.
  • angiogenin cell surface receptors which can be used in methods to therapeutically treat conditions associated with normal angiogenesis, such as those occurring in pathological conditions such as arthritis, diabetic retinopathy and tumor growth, and in physiological processes such as wound repair, reproduction and development.
  • Embodiments of the present invention are directed to a novel isolated angiogenin cellular receptor protein ("AR") expressed on the membrane surface of endothelial cells, as well as fragments thereof, particularly those which retain angiogenin binding activity.
  • AR angiogenin cellular receptor protein
  • the invention also provides nucleic acids, e.g., which encode the angiogenin receptor, which can be used as probes to detect an AR-encoding nucleic acid, and/or which can be used in antisense methods to inhibit expression of the receptor.
  • the invention also provides antibodies specifically immunoreactive with the subject receptors, as well as cells ectopically expressing the receptor and methods for isolating the receptor or fragments thereof.
  • Clinical applications of the invention include diagnostic applications, acceleration of angiogenesis in wound healing, and inhibition of angiogenesis.
  • embodiments of the present invention are directed to methods for stimulating the growth of human endothelial cells using angiogenin under certain reaction conditions.
  • Other embodiments of the present invention are further directed to methods for regulating expression of the cellular receptor protein under certain reaction conditions.
  • An alternate embodiment of the present invention is directed to methods of therapeutically treating conditions associated with abnormal angiogenesis.
  • human endothelial cells in low concentration are contacted with a growth stimulating amount of angiogenin to stimulate the growth and proliferation of endothelial cells.
  • angiogenin receptor is useful, for example, as a therapeutic agent and as a component in a diagnostic assay for angiogenin.
  • Polyclonal or monoclonal antibodies against the angiogenin receptor are raised by methods well known in the art and are useful in methods for inhibiting the angiogenin receptor.
  • a method for therapeutically treating abnormal angiogenesis wherein an isolated 170 kDa cellular receptor protein for angiogenin is used to inhibit angiogenesis by binding to angiogenin.
  • a method for inhibiting angiogenesis wherein fragments and derivatives of the 170 kDa cellular receptor protein for angiogenin are used to treat angiogenesis-based diseases.
  • a method for therapeutically treating a condition associated with angiogenesis is disclosed wherein the 170 kDa cellular receptor protein for angiogenin is inhibited in a manner to reduce angiogenesis.
  • a method for promoting angiogenesis is disclosed wherein the 170 kDa cellular receptor protein for angiogenin is activated to enhance processes such as wound healing and repair.
  • Fig. 1 is a graph depicting the results of an experiment demonstrating dose-dependent stimulation of -1H -thymidine incorporation and proliferation of endothelial cells by angiogenin.
  • Fig. 2 is an autoradiograph showing binding and crosslinking of angiogenin to a 170 kDa protein.
  • Fig. 3 is a graph showing concentration dependent binding of angiogenin to HUVE cells and Scatchard analysis of the binding data.
  • Fig. 4 is an SDS-PAGE analysis of the 170 kDa angiogenin receptor.
  • Lanes A and B were the samples from a deactivated Sepharose and an angiogenin-Sepharose affinity column, respectively.
  • Angiogenesis or the proliferation of new capillary blood vessels, is a fundamental process necessary for normal growth and development of tissues. It is a prerequisite for the development and differentiation of the vascular tree, as well as for a wide variety of fundamental physiological processes including embryogenesis, somatic growth, tissue and organ repair and regeneration, cyclical growth of the corpus luteum and endometrium, and development and differentiation of the nervous system.
  • angiogenesis occurs in the follicle during its development, in the corpus luteum following ovulation and in the placenta to establish and maintain pregnancy.
  • Angiogenesis additionally occurs as part of the body's repair processes, e.g. in the healing of wounds and fractures.
  • Abnormal angiogenesis (that is to say, stimulation of the growth of new blood vessels owing to a pathological syndrome) is an established characteristic of many diseases, especially diabetic retinopathy, rheumatoid arthritis, haemangioma and the growth of solid tumours.
  • angiogenesis is a factor in tumor growth since a tumor must continuously stimulate growth of new capillary blood vessels in order to grow.
  • Angiogenesis can also play an important part in other diseases, such as arterio- coronary disease.
  • the regulation of angiogenesis is an important mechanism for developmental control in both normal and disease states.
  • the present invention concerns the discovery of a new family of angiogenin receptors, also referred to herein as "AR proteins” or “ARs”, which are demonstrated to bind to angiogenin polypeptides with high affinity. As described herein, the subject receptors exhibit expression domains indicative of an important role in angiogenin-mediated signalling.
  • certain aspects of the present invention relate to nucleic acids encoding AR polypeptides, the AR polypeptides themselves (including various fragments), antibodies immunoreactive with AR proteins, and preparations of such compositions.
  • the present invention provides diagnostic and therapeutic assays and reagents for detecting and treating disorders involving, for example, aberrant expression (or loss thereof) of AR, AR ligands (particularly angiogenin proteins), or signal transducers thereof.
  • drug discovery assays are provided for identifying agents which can modulate the biological function of AR proteins, such as by altering the binding of the receptor to angiogenin proteins or other extracellular/matrix factors, or the ability of the bound AR protein to transduce angiogenin signals.
  • agents can be useful therapeutically to alter the growth, maintenance and/or differentiation of a tissue, particularly endothelially-derived tissue.
  • AR angiogenin receptor
  • the term "angiogenin receptor” or "AR” refers to a family of polypeptides characterized at least in part by being identical or sharing a degree of sequence homology with all or a portion of the receptor polypeptide described in the appended examples, e.g., containing amino acid sequence(s) identical or homologous with the peptidyl sequences represented in SEQ ID No: 1, 2, 3 or 5.
  • the subject receptor polypeptides can be cloned or purified from any of a number of eukaryotic organisms, especially vertebrates, and particularly mammals.
  • other AR polypeptides can be generated according to the present invention, which polypeptides do not ordinarily exist in nature but rather are generated by non-natural mutagenic techniques.
  • the human angiogenin receptor includes an extracellular domain, e.g., and therefore apparently has a secretion signal sequence (e.g., a peptidyl portion which causes extracellular secretion of at least a portion of the protein).
  • the protein also has an apparent membrane-anchoring domain, e.g., presumably in the form of a transmembrane domain, though other possible membrane-anchoring domains may be incorporated in the protein, e.g., such as RGD sequences, GPI-linkages and the like.
  • the receptor is also characterized by its tight binding of angiogenin, having an apparent dissociation constant in the nanomolar range. Additionally, comparison of the partial sequence data reveals homology of the angiogenin receptor with certain receptor tyrosine kinases (RTKs), suggesting that the subject angiogenin receptor may also be an RTK.
  • RTKs receptor tyrosine kinases
  • a “membrane-anchoring" region refers to a sequence of amino acids that is capable of retaining the AR polypeptide at the cell surface.
  • a "glycosylated" AR polypeptide has one or more covalent linkages with ⁇ - glycosyl groups (e.g. derivatized with a carbohydrate).
  • the AR protein can be glycosylated on an existing residue, or can be mutated to preclude carbohydrate attachment, or can be mutated to provide new glycosylation sites, such as for N-linked or
  • nucleic acid refers to polynucleotides such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA).
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • the term should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single (sense or antisense) and double-stranded polynucleotides.
  • the term “gene” or “recombinant gene” refers to a nucleic acid comprising an open reading frame encoding an AR polypeptide, including both exon and (optionally) intron sequences.
  • a “recombinant gene” refers to nucleic acid encoding an AR polypeptide and comprising AR-encoding exon sequences, though it may optionally include intron sequences which are derived from, for example, a chromosomal angiogenin receptor gene or from an unrelated chromosomal gene.
  • the term “intron” refers to a DNA sequence present in a given AR gene which is not translated into protein and is generally found between exons.
  • the term “transfection” means the introduction of a nucleic acid, e.g., an expression vector, into a recipient cell by nucleic acid-mediated gene transfer.
  • "Transformation” refers to a process in which a cell's genotype is changed as a result of the cellular uptake of exogenous DNA or RNA, and, for example, the transformed cell expresses a recombinant form of an AR polypeptide or, where anti-sense expression occurs from the transferred gene, the expression of a naturally-occurring form of the AR protein is disrupted.
  • the term “specifically hybridizes” refers to the ability of a nucleic acid probe/primer of the invention to hybridize to at least 15, 25, 50 or 100 consecutive nucleotides of an AR gene, or a sequence complementary thereto, or naturally occurring mutants thereof, such that it has less than 15%, preferably less than 10%, and more preferably less than 5% background hybridization to a cellular nucleic acid (e.g., mRNA or genomic DNA) encoding a protein other than an AR protein, as defined herein.
  • a cellular nucleic acid e.g., mRNA or genomic DNA
  • phenotype refers to the entire physical, biochemical, and physiological makeup of a cell, e.g., having any one trait or any group of traits.
  • induction or “induce”, as relating to the biological activity of an angiogenin protein, refer generally to the process or act of causing to occur a specific effect on the phenotype of a cell. Such effects can be in the form of causing a change in the phenotype, e.g., differentiation to another cell phenotype, or can be in the form of maintaining the cell in a particular phenotype, e.g., preventing dedifferentation or promoting survival of a cell.
  • vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • plasmids refer generally to circular double stranded DNA loops which, in their vector form are not bound to the chromosome.
  • vectors are used interchangeably as the plasmid is the most commonly used form of vector.
  • the invention is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto.
  • Transcriptional regulatory sequence is a generic term used throughout the specification to refer to DNA sequences, such as initiation signals, enhancers, and promoters, which induce or control transcription of protein coding sequences with which they are operably linked.
  • transcription of a recombinant AR gene is under the control of a promoter sequence (or other transcriptional regulatory sequence) which controls the expression of the recombinant gene in a cell-type in which expression is intended. It will also be understood that the recombinant gene can be under the control of transcriptional regulatory sequences which are the same or which are different from those sequences which control transcription of the naturally-occurring forms of AR genes.
  • a "transgenic animal” is any animal, preferably a non-human mammal, bird or an amphibian, in which one or more of the cells of the animal contain heterologous nucleic acid introduced by way of human intervention, such as by transgenic techniques well known in the art.
  • the nucleic acid is introduced into the cell, directly or indirectly by introduction into a precursor of the cell, by way of deliberate genetic manipulation, such as by microinjection or by infection with a recombinant virus.
  • the term genetic manipulation does not include classical cross-breeding, or in vitro fertilization, but rather is directed to the introduction of a recombinant DNA molecule.
  • transgenic animal may be integrated within a chromosome, or it may be extrachromosomally replicating DNA.
  • the transgene causes cells to express a recombinant form of an angiogenin receptor, e.g. either agonistic or antagonistic forms.
  • transgenic animals in which the recombinant AR gene is silent are also contemplated, as for example, the FLP or CRE recombinase dependent constructs.
  • transgenic animal also includes those recombinant animals in which gene disruption of one or more AR genes is caused by human intervention, including both recombination and antisense techniques.
  • non-human animals include vertebrates such as rodents, non-human primates, livestock, avian species, amphibians, reptiles, etc.
  • chimeric animal is used herein to refer to animals in which the recombinant gene is found, or in which the recombinant is expressed in some but not all cells of the animal.
  • tissue-specific chimeric animal indicates that a recombinant AR gene is present and/or expressed or disrupted in some tissues but not others.
  • genes for a particular polypeptide may exist in single or multiple copies within the genome of an individual. Such duplicate genes may be identical or may have certain modifications, including nucleotide substitutions, additions or deletions, which all still code for polypeptides having substantially the same activity.
  • the term "DNA sequence encoding an AR polypeptide" may thus refer to one or more genes within a particular individual.
  • certain differences in nucleotide sequences may exist between individuals of the same species, which are called alleles. Such allelic differences may or may not result in differences in amino acid sequence of the encoded polypeptide yet still encode a protein with the same biological activity.
  • Homology and identity each refer to sequence similarity between two polypeptide sequences, with identity being a more strict comparison. Homology and identity can each be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same amino acid residue, then the polypeptides can be referred to as identical at that position; when the equivalent site is occupied by the same amino acid (e.g., identical) or a similar amino acid (e.g., similar in steric and/or electronic nature), then the molecules can be referred to as homologous at that position. A percentage of homology or identity between sequences is a function of the number of matching or homologous positions shared by the sequences. An "unrelated" or “non-homologous" sequence shares less than 40 percent identity, though preferably less than 25 percent identity, with an AR sequence of the present invention.
  • Cells “host cells” or “recombinant host cells” are terms used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
  • a “chimeric protein” or “fusion protein” is a fusion of a first amino acid sequence encoding an AR polypeptide with a second amino acid sequence defining a domain (e.g. polypeptide portion) foreign to and not substantially homologous with any domain of an AR protein.
  • a chimeric protein may present a foreign domain which is found (albeit in a different protein) in an organism which also expresses the first protein, or it may be an "interspecies", “intergenic”, etc. fusion of protein structures expressed by different kinds of organisms.
  • a fusion protein can be represented by the general formula X- AR-Y, wherein AR represents a portion of the fusion protein which is derived from an AR protein, and X and Y are, independently, absent or represent amino acid sequences which are not related to AR sequences in an organism.
  • a "reporter gene construct” is a nucleic acid that includes a “reporter gene” operatively linked to a transcriptional regulatory sequence(s). Transcription of the reporter gene is controlled by such sequences. The activity of at least one or more of these control sequences is directly or indirectly regulated by a signal transduction pathway involving a phospholipase, e.g., is directly or indirectly regulated by a second messenger produced by the phospholipase activity.
  • the transcriptional regulatory sequences can include a promoter and other regulatory regions, such as enhancer sequences, that modulate the activity of the promoter, or regulatory sequences that modulate the activity or efficiency of the RNA polymerase that recognizes the promoter, or regulatory sequences that are recognized by effector molecules, including those that are specifically induced upon activation of a phospholipase.
  • modulation of the activity of the promoter may be effected by altering the RNA polymerase binding to the promoter region, or, alternatively, by interfering with initiation of transcription or elongation of the mRNA.
  • Such sequences are herein collectively referred to as transcriptional regulatory elements or sequences.
  • the construct may include sequences of nucleotides that alter the stability or rate of translation of the resulting mRNA in response to second messages, thereby altering the amount of reporter gene product.
  • an isolated nucleic acid encoding an AR polypeptide preferably includes no more than 10 kilobases (kb) of nucleic acid sequence which 4naturally immediately flanks the AR gene in genomic DNA, more preferably no more than 5kb of such naturally occurring flanking sequences, and most preferably less than 1.5kb of such naturally occurring flanking sequence.
  • isolated also refers to a nucleic acid or peptide that is substantially free of cellular material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized.
  • isolated nucleic acid is meant to include nucleic acid fragments which are not naturally occurring as fragments and would not be found in the natural state.
  • angiogenesis means the generation of new blood vessels into a tissue or organ. Under normal physiological conditions, humans or animals only undergo angiogenesis in very specific restricted situations. For example, angiogenesis is normally observed in wound healing, fetal and embryonal development and formation of the corpus luteum, endometrium and placenta.
  • the control of angiogenesis is a highly regulated system of angiogenic stimulators and inhibitors. The control of angiogenesis has been found to be altered in certain disease states and, in many cases, the pathological damage associated with the disease is related to the uncontrolled angiogenesis.
  • a "patient” or “subject” to be treated can mean either a human or non-human animal.
  • the present invention features a purified or recombinant AR polypeptide having a core peptide chain with a molecular weight of about 170kDa.
  • the AR polypeptide may preferably have a molecular weight of about 55kDa, and include an amino acid sequence similar or identical to SEQ ID No. 1, 2, 3 and/or 5.
  • the subject angiogenin receptor shares certain sequence homologies with the RTK protein Ros 1.
  • certain full-length forms of the subject angiogenin receptor protein will be about the same size as the Ros 1 protein, e.g., having a molecular weight of about 265kDa (e.g., +/- 10 kd).
  • certain post-translational modifications e.g., glycosylation, phosphorylation and the like, can increase the apparent molecular weight of the AR protein relative to the unmodified polypeptide chain, and cleavage of certain sequences, such as pro-sequences, can likewise decrease the apparent molecular weight.
  • AR polypeptides include: a mature AR polypeptide which lacks a signal sequence peptide; a mature, extracellular fragment (soluble) of the receptor.
  • the AR polypeptide includes an angiogenin binding domain.
  • an agonist e.g., mimics or potentiates a bioactivity of the wild-type AR protein
  • an antagonist e.g., inhibits a bioactivity of the wild-type AR protein
  • homologs of the subject AR protein can be generated by mutagenesis, such as by discrete point mutation(s), or by truncation. For instance, mutation can give rise to homologs which retain substantially the same, or merely a subset, of the biological activity of the AR polypeptide from which it was derived.
  • antagonistic forms of the protein can be generated which are able to inhibit the function of the naturally occurring form of the protein, such as by competitively binding to angiogenin proteins and competing with wild-type AR, or binding to other angiogenin receptors (such as subunits of an angiogenin receptor) to form unresponsive angiogenin receptor complexes.
  • the AR protein and homologs thereof provided by the subject invention may be either positive or negative regulators of cell growth, death and/or differentiation.
  • polypeptides referred to herein as having an activity of an angiogenin receptor are defined as polypeptides which include an amino acid sequence corresponding (e.g., identical or homologous) to all or a portion of the amino acid sequences of the AR protein isolated according to the appended examples, e.g., having a polypeptide including one or both amino acid sequences represented in SEQ ID No: 1, 2, 3 or 5, and which agonize or antagonize all or a portion of the biological/biochemical activities of a naturally occurring receptor.
  • biological activity include the ability to bind with high affinity angiogenin proteins.
  • bioactivity of certain embodiments of the subject AR polypeptides can be characterized in terms of an ability to modulate proliferation (and optionally migration) of endothelial cells, e.g, in an angiogenin-dependent fashion, and/or a (tyrosine) kinase activity.
  • a polypeptide has biological activity if it is a specific agonist or antagonist of a naturally- occurring form of an angiogenin receptor.
  • the term "recombinant AR polypeptide” refers to a polypeptide which is produced by recombinant DNA techniques, wherein generally, DNA encoding an AR polypeptide is inserted into a suitable expression vector which is in turn used to transform a host cell to produce the heterologous protein.
  • derived from is meant to include within the meaning of "recombinant protein” those proteins having an amino acid sequence of a native AR protein, or an amino acid sequence similar thereto which is generated by mutations including substitutions and deletions (including truncation) of a naturally occurring form of the protein.
  • the present invention also provides methods of producing the subject AR polypeptides.
  • the angiogenin receptor can be purified from a natural source, such as by the protocols set forth in the appended examples.
  • the protein is produced by recombinant techniques and purifed by methods suitable for the host cell and/or the presence of additional amino acids in the recombinant protein.
  • a host cell transfected with a nucleic acid vector directing expression of a nucleotide sequence encoding the subject polypeptides can be cultured under appropriate conditions to allow expression of the peptide to occur.
  • the cells may be harvested, lysed and the protein isolated.
  • a cell culture includes host cells, media and other byproducts. Suitable media for cell culture are well known in the art.
  • the recombinant AR polypeptide can be isolated from cell culture medium, host cells, or both using techniques known in the art for purifying proteins including ion-exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis, and immunoaffinity purification with antibodies specific for such peptides.
  • the recombinant AR polypeptide is a fusion protein containing a domain which facilitates its purification, such as GST fusion protein or poly(His) fusion protein.
  • This invention also pertains to a host cell transfected to express recombinant forms of the subject AR polypeptides.
  • the host cell may be any eukaryotic or prokaryotic cell.
  • a nucleotide sequence derived from the cloning of AR proteins, encoding all or a selected portion of a full-length protein can be used to produce a recombinant form of an AR polypeptide via microbial or eukaryotic cellular processes.
  • MAP e.g., E. coli or CM89 or S. cerevisiae
  • in vitro by use of purified MAP e.g., procedure of Miller et al., supra.
  • the coding sequences for the polypeptide can be incorporated as a part of a fusion gene including a nucleotide sequence encoding a different polypeptide.
  • This type of expression system can be useful under conditions where it is desirable to produce an immunogenic fragment of an AR protein.
  • the VP6 capsid protein of rotavirus can be used as an immunologic carrier protein for portions of the AR polypeptide, either in the monomeric form or in the form of a viral particle.
  • nucleic acid sequences corresponding to the portion of a subject AR protein to which antibodies are to be raised can be incorporated into a fusion gene construct which includes coding sequences for a late vaccinia virus structural protein to produce a set of recombinant viruses expressing fusion proteins comprising AR epitopes as part of the virion. It has been demonstrated with the use of immunogenic fusion proteins utilizing the Hepatitis B surface antigen fusion proteins that recombinant Hepatitis B virions can be utilized in this role as well.
  • chimeric constructs coding for fusion proteins containing a portion of an AR protein and the poliovirus capsid protein can be created to enhance immunogenicity of the set of polypeptide antigens (see, for example, EP Publication No: 0259149; and Evans et al. (1989) Nature 339:385; Huang et al. (1988) J. Virol. 62:3855; and Schlienger et al. (1992) J. Virol. 66:2).
  • the Multiple Antigen Peptide system for peptide-based immunization can also be utilized to generate an immunogen, wherein a desired portion of an AR polypeptide is obtained directly from organo-chemical synthesis of the peptide onto an oligomeric branching lysine core (see, for example, Posnett et al. (1988) JBC 263:1719 and Nardelli et al. (1992) J. Immunol. 148:914).
  • Antigenic determinants of AR proteins can also be expressed and presented by bacterial cells.
  • fusion proteins can also facilitate the expression of proteins, and accordingly, can be used in the expression of the AR polypeptides of the present invention, particularly truncated forms of the AR protein.
  • AR polypeptides can be generated as glutathione-S-transferase (GST-fusion) proteins.
  • GST-fusion proteins can enable easy purification of the AR polypeptide, as for example by the use of glutathione-derivatized matrices (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al. (N.Y.: John Wiley & Sons, 1991)).
  • a fusion gene coding for a purification leader sequence such as a poly-(His)/enterokinase cleavage site sequence at the N-terminus of the desired portion of the recombinant protein, can allow purification of the expressed fusion protein by affinity chromatography using a Ni 2+ metal resin.
  • the purification leader sequence can then be subsequently removed by treatment with enterokinase to provide the purified protein (e.g., see Hochuli et al. (1987) J. Chromatography 411 :177; and Janknecht et al. PNAS 88:8972).
  • fusion genes are known to those skilled in the art. Essentially, the joining of various DNA fragments coding for different polypeptide sequences is performed in accordance with conventional techniques, employing blunt- ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation.
  • the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers.
  • PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al. John Wiley & Sons: 1992).
  • the AR polypeptides may also be chemically modified to create AR derivatives by forming covalent or aggregate conjugates with other chemical moieties, such as glycosyl groups, lipids, cholesterol, phosphate, acetyl groups and the like.
  • Covalent derivatives of AR proteins can be prepared by linking the chemical moieties to functional groups on amino acid sidechains of the protein or at the N-terminus or at the C-terminus of the polypeptide.
  • formulations of multimeric AR polypeptides are also provided.
  • the multimers of the soluble forms of the subject AR polypeptides may be produced according to the methods known in the art.
  • the AR multimers are cross-linked chemically by using known methods which will result in the formation of either dimers or higher multimers of the soluble forms of the AR polypeptides.
  • Another way of producing the multimers of the soluble forms of the AR polypeptides is by recombinant techniques, e.g., by inclusion of hinge regions.
  • This linker can facilitate enhanced flexibility of the chimeric protein allowing the various AR monomeric subunits to freely and (optionally) simultaneously interact with an AR ligand by reducing steric hindrance between the two fragments, as well as allowing appropriate folding of each portion to occur.
  • the linker can be of natural origin, such as a sequence determined to exist in random coil between two domains of a protein.
  • the linker can be of synthetic origin.
  • the sequence (Gly4Ser)3 can be used as a synthetic unstructured linker. Linkers of this type are described in Huston et al. (1988) PNAS 85:4879; and U.S. Patent Nos. 5,091,513 and 5,258,498.
  • Naturally occurring unstructured linkers of human origin are preferred as they reduce the risk of immunogenicity.
  • the present invention also makes available isolated AR polypeptides which are isolated from, or otherwise substantially free of other cellular proteins, especially receptors and/or other inductive polypeptides which may normally be associated with the AR polypeptide.
  • the term "substantially free of other cellular proteins" (also referred to herein as "contaminating proteins") or “substantially pure or purified preparations” are defined as encompassing preparations of AR polypeptides having less than 20% (by dry weight) contaminating protein, and preferably having less than 5% contaminating protein.
  • Functional forms of the subject polypeptides can be prepared, for the first time, as purified preparations by using a cloned gene as described herein.
  • purified it is meant, when referring to a peptide or DNA or RNA sequence, that the indicated molecule is present in the substantial absence of other biological macromolecules, such as other proteins.
  • the term “purified” as used herein preferably means at least 80% by dry weight, more preferably in the range of 95-99% by weight, and most preferably at least 99.8% by weight, of biological macromolecules of the same type present (but water, buffers, and other small molecules, especially molecules having a molecular weight of less than 5000, can be present).
  • pure as used herein preferably has the same numerical limits as “purified” immediately above.
  • Isolated and purified do not encompass either natural materials in their native state or natural materials that have been separated into components (e.g., in an acrylamide gel) but not obtained either as pure (e.g. lacking contaminating proteins, or chromatography reagents such as denaturing agents and polymers, e.g. acrylamide or agarose) substances or solutions.
  • purified AR preparations will lack any contaminating proteins from the same animal from which AR is normally produced, as can be accomplished by recombinant expression of, for example, a mammalian AR protein in a yeast or bacterial cell.
  • Isolated peptidyl portions of AR proteins can also be obtained by screening peptides recombinantly produced from the corresponding fragment of the nucleic acid encoding such peptides.
  • fragments can be chemically synthesized using techniques known in the art such as conventional Merrifield solid phase f-Moc or t-Boc chemistry.
  • an AR polypeptide of the present invention may be arbitrarily divided into fragments of desired length with no overlap of the fragments, or preferably divided into overlapping fragments of a desired length. The fragments can be produced
  • the recombinant AR polypeptides of the present invention also include homologs of the authentic AR proteins, such as versions of those proteins which are resistant to proteolytic cleavage, as for example, due to mutations which alter ubiquitination, prenylation or the like, enzymatic release of the extracellular domain, or other enzymatic targeting associated with the protein.
  • Modification of the structure of the subject AR polypeptides can be for such purposes as enhancing therapeutic or prophylactic efficacy, stability (e.g., ex vivo shelf life and resistance to proteolytic degradation in vivo), or post-translational modifications.
  • modified peptides when designed to retain at least one activity of the naturally- occurring form of the protein, or to produce specific antagonists thereof, are considered functional equivalents of the AR polypeptides (though they may be agonistic or antagonistic of the bioactivities of the authentic protein).
  • Such modified peptides can be produced, for instance, by amino acid substitution, deletion, or addition.
  • Whether a change in the amino acid sequence of a peptide results in a functional AR homolog can be readily determined by assessing the ability of the variant peptide to produce a response in cells in a fashion similar to the wild-type protein, or competitively inhibit such a response.
  • Polypeptides in which more than one replacement has taken place can readily be tested in the same manner.
  • This invention further contemplates a method for generating sets of combinatorial point mutants of the subject AR proteins as well as truncation mutants, and is especially useful for identifying potential variant sequences (e.g. homologs) that are functional in modulating signal transduction and/or ligand binding.
  • the purpose of screening such combinatorial libraries is to generate, for example, novel AR homologs which can act as either agonists or antagonists, or alternatively, possess novel activities all together.
  • AR homologs can be engineered by the present method to provide selective, constitutive activation of angiogenin activity, or alternatively, to be dominant negative inhibitors of AR-dependent signal transduction. For instance, mutagenesis can provide
  • AR homologs which are able to bind extracellular ligands yet are unable to bind or signal through intracellular regulatory proteins.
  • Exemplary techniques which have been employed in the directed evolution of other proteins include Scott et al. (1990) Science 249:386-390; Roberts et al. (1992) PNAS 89:2429-2433; Devlin et al. (1990) Science 249: 404-406; Cwirla et al. (1990) PNAS 87: 6378-6382; and methods described in U.S. Patents Nos. 5,223,409, 5,198,346, and 5,096,815.
  • a library of coding sequence fragments can be provided for an AR clone in order to generate a variegated population of AR fragments for screening and subsequent selection of bioactive fragments.
  • a variety of techniques are known in the art for generating such libraries, including chemical synthesis.
  • a library of coding sequence fragments can be generated by (i) treating a double stranded PCR fragment of an AR coding sequence with a nuclease under conditions wherein nicking occurs only about once per molecule; (ii) denaturing the double stranded DNA; (iii) renaturing the DNA to form double stranded DNA which can include sense/antisense pairs from different nicked products; (iv) removing single stranded portions from reformed duplexes by treatment with S 1 nuclease; and (v) ligating the resulting fragment library into an expression vector.
  • an expression library can be derived which codes for N-terminal, C-terminal and internal fragments of various sizes.
  • a wide range of techniques are known in the art for screening gene products of combinatorial libraries made by point mutations or truncation, and for screening cDNA libraries for gene products having a certain property. Such techniques will be generally adaptable for rapid screening of the gene libraries generated by the combinatorial mutagenesis of AR homologs.
  • the most widely used techniques for screening large gene libraries typically comprises cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity, such as angiogenin binding, facilitates relatively easy isolation of the vector encoding the gene whose product was detected.
  • the invention also provides for reduction of the receptor to generate mimetics, e.g. peptide or non-peptide agents, which are able to disrupt a biological activity of the native receptor, e.g. as inhibitors of protein-protein interactions, such as with a ligand of the receptor.
  • mimetics e.g. peptide or non-peptide agents
  • Such mutagenic techniques as described above are also useful to map the determinants of the AR proteins which participate in protein-protein interactions involved in, for example, interaction of the subject receptor with angiogenin polypeptides.
  • a similar system can be used to derive fragments of an angiogenin protein which bind to an AR protein and competitively inhibit binding of the full length angiogenin protein.
  • the critical residues of either an angiogenin receptor or angiogenin which are involved in molecular recognition of the other can be determined and used to generate AR-derived or angiogenin-derived peptidomimetics which competitively inhibit receptor/ligand interactions.
  • peptidomimetic compounds can be generated which mimic those residues which facilitate the interaction.
  • mimetics may then be used to interfere with the normal function of an AR protein (or its ligand).
  • non-hydrolyzable peptide analogs of such residues can be generated using benzodiazepine (e.g., see Freidinger et al.
  • nucleic acid as used herein is intended to include fragments as equivalents.
  • equivalent is understood to include nucleotide sequences encoding functionally equivalent AR polypeptides or functionally equivalent peptides having an activity of an AR protein such as described herein.
  • Equivalent nucleotide sequences will include sequences that differ by one or more nucleotide substitutions, additions or deletions, such as allelic variants.
  • Equivalents will also include nucleotide sequences that hybridize under stringent conditions (i.e., equivalent to about 20-27°C below the melting temperature (T m ) of the DNA duplex formed in about 1 M salt) to a human gene encoding an angiogenin receptor, e.g., hybridizes to at least the coding sequence of SEQ ID No: 4 or 6 or the AR sequence of ATCC deposit , and preferably to a human gene encoding an angiogenin receptor including amino acid sequences represented in SEQ ID No: 1, 2, 3 or 5.
  • Preferred nucleic acids encode an AR polypeptide comprising an amino acid sequence at least 60%, 70% or 80% homologous, more preferably at least 85% homologous and most preferably at least 95% homologous with an amino acid sequence of a naturally occurring AR protein, e.g., such as a human angiogenin receptor described in the appended examples, e.g., including one or both of the amino acid sequences represented in SEQ ID No: 1, 2, 3 or 5.
  • Nucleic acids which encode polypeptides at least about 98-99% homology with such sequences are of course also within the scope of the invention, as are nucleic acids identical in sequence with the receptor described in the appended examples and, e.g., having the amino acid sequences enumerated in Sequence listing.
  • Nucleic acids having a sequence that differs from the AR gene of HUVE cells, e.g., due to degeneracy in the genetic code, are also within the scope of the invention. Such nucleic acids encode functionally equivalent peptides (i.e., a peptide having a biological activity of an AR polypeptide) but differ in sequence from the sequence shown in the sequence listing due to degeneracy in the genetic code. For example, a number of amino acids are designated by more than one triplet. Codons that specify the same amino acid, or synonyms (for example, CAU and CAC each encode histidine) may result in "silent" mutations which do not affect the amino acid sequence of an AR polypeptide.
  • Codons that specify the same amino acid, or synonyms for example, CAU and CAC each encode histidine
  • an AR gene fragment refers to a nucleic acid having fewer nucleotides than the nucleotide sequence encoding the entire mature form of an AR protein yet which (preferably) encodes a polypeptide which retains some biological activity of the full length protein.
  • Fragment sizes contemplated by the present invention include, for example, 5, 10, 25, 50, 75, 100, or 200 amino acids in length.
  • the polypeptide will include all or a sufficient portion of the ligand domain to bind to an angiogenin polypeptide.
  • Angiogenin receptor-encoding nucleic acids can be obtained from mRNA present in cells of metazoan organisms, especially vertebrates, and most preferably mammals. It will also be possible to obtain nucleic acids encoding AR polypeptides of the present invention from genomic DNA from both adults and embryos.
  • a gene encoding an AR protein can be cloned from either a cDNA or a genomic library in accordance with protocols generally known to persons skilled in the art.
  • a cDNA encoding an AR protein can be obtained by isolating total mRNA from a cell, such as a mammalian cell, e.g.
  • Receptor genes can also be isolated by expression cloning techniques, e.g., using antibodies raised against the purified receptor protein, or by ligand blotting techniques with labeled angiogenin, as described in the appended examples. Another aspect of the invention relates to the use of the isolated nucleic acid in
  • antisense therapy refers to administration or in situ generation of oligonucleotide probes or their derivatives which specifically hybridize (e.g. bind) under cellular conditions, with the cellular mRNA and/or genomic DNA encoding a subject AR protein so as to inhibit expression of that protein, e.g. by inhibiting transcription and/or translation.
  • the binding may be by conventional base pair complementarity, or, for example, in the case of binding to DNA duplexes, through specific interactions in the major groove of the double helix.
  • antisense refers to the range of techniques generally employed in the art, and includes any therapy which relies on specific binding to oligonucleotide sequences.
  • an antisense construct of the present invention can be delivered, for example, as an expression plasmid which, when transcribed in the cell, produces RNA which is complementary to at least a unique portion of the cellular mRNA which encodes an AR protein.
  • the antisense construct is an oligonucleotide probe which is generated ex vivo and which, when introduced into the cell causes inhibition of expression by hybridizing with the mRNA and/or genomic sequences of an AR gene.
  • oligonucleotide probes are preferably modified oligonucleotides which are resistant to endogenous nucleases, e.g. exonucleases and/or endonucleases, and are therefore stable in vivo.
  • nucleic acid molecules for use as antisense oligonucleotides are phosphoramidate, phosphorothioate and methylphosphonate analogs of DNA (see also U.S. Patents 5,176,996; 5,264,564; and 5,256,775), or peptide nucleic acids (PNAs). Additionally, general approaches to constructing oligomers useful in antisense therapy have been reviewed, for example, by Van der Krol et al. (1988) Biotechniques 6:958-976; and Stein et al. (1988) Cancer Res 48:2659-2668.
  • the modified oligomers of the invention are useful in therapeutic, diagnostic, and research contexts.
  • the oligomers are utilized in a manner appropriate for antisense therapy in general.
  • the oligomers of the invention can be formulated for a variety of routes of administration, including systemic and topical or localized administration. Techniques and formulations generally may be found in Remmington's Pharmaceutical Sciences, Meade Publishing Co., Easton, PA.
  • injection is preferred, including intramuscular, intravenous, intraperitoneal, and subcutaneous.
  • the oligomers of the invention can be formulated in liquid solutions, preferably in physiologically compatible buffers such as Hank's solution or Ringer's solution.
  • the oligomers may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms are also included.
  • the oligomers of the invention may be used as diagnostic reagents to detect the presence or absence of the target DNA or RNA sequences to which they specifically bind. Such diagnostic tests are described in further detail below.
  • the antisense constructs of the present invention by antagonizing the normal biological activity of an AR protein, e.g., by reducing the level of its expression, can be used in the manipulation of tissue, e.g. tissue maintenance, differentiation or growth, both in vivo and ex vivo.
  • the anti-sense techniques can be used to investigate the role of the subject receptor in developmental events, as well as the normal cellular function of the receptor in adult tissue.
  • Such techniques can be utilized in cell culture, but can also be used in the creation of transgenic animals (described infra).
  • This invention also provides expression vectors containing a nucleic acid encoding an AR polypeptide, operably linked to at least one transcriptional regulatory sequence. Operably linked is intended to mean that the nucleotide sequence is linked to a regulatory sequence in a manner which allows expression of the nucleotide sequence.
  • transcriptional regulatory sequence includes promoters, enhancers and other expression control elements.
  • Such regulatory sequences are described in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
  • any of a wide variety of expression control sequences, sequences that control the expression of a DNA sequence when operatively linked to it, may be used in these vectors to express DNA sequences encoding AR polypeptides of this invention.
  • Such useful expression control sequences include, for example, a viral LTR, such as the LTR of the Moloney murine leukemia virus, the early and late promoters of SV40, adenovirus or cytomegalovirus immediate early promoter, the lac system, the tip system, the TAC or TRC system, T7 promoter whose expression is directed by T7 RNA polymerase, the major operator and promoter regions of phage ⁇ , the control regions for fd coat protein, the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase, e.g., Pho5, the promoters of the yeast ⁇ -mating factors, the polyhedron promoter of the bacculovirus system and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof.
  • a viral LTR such as the LTR of the Moloney murine leukemia virus, the early and late promoter
  • gene constructs of the present invention can also be used as a part of a gene therapy protocol to deliver nucleic acids, e.g., encoding either an agonistic or antagonistic form of a subject AR protein or an antisense molecule described above.
  • another aspect of the invention features expression vectors for in vivo or in vitro transfection and expression of an AR polypeptide or antisense molecule in particular cell types so as to reconstitute the function of, or alternatively, abolishes all or a portion of the biological function of AR-induced transcription in a tissue in which the naturally- occurring form of the protein is misexpressed (or has been disrupted); or to deliver a form of the protein which alters maintenance or differentiation of tissue, or which inhibits neoplastic or hyperplastic proliferation.
  • Expression constructs of the subject AR polypeptides, as well as antisense constructs, may be administered in any biologically effective carrier, e.g. any formulation or composition capable of effectively delivering the recombinant gene to cells in vivo.
  • Approaches include insertion of the subject gene in viral vectors including recombinant retroviruses, adenovirus, adeno-associated virus, and herpes simplex virus- 1, or recombinant bacterial or eukaryotic plasmids.
  • viral vectors include recombinant retroviruses, adenovirus, adeno-associated virus, and herpes simplex virus- 1, or recombinant bacterial or eukaryotic plasmids.
  • Viral vectors transfect cells directly; plasmid DNA can be delivered with the help of, for example, cationic liposomes
  • lipofectin or derivatized (e.g. antibody conjugated), polylysine conjugates, gramacidin
  • Retrovirus vectors, adenovirus vectors and adeno-associated virus vectors are exemplary recombinant gene delivery system for the transfer of exogenous genes in vivo, particularly into humans. These vectors provide efficient delivery of genes into cells, and the transferred nucleic acids are stably integrated into the chromosomal DNA of the host.
  • non-viral methods can also be employed to cause expression of a subject AR polypeptide in the tissue of an animal.
  • Most nonviral methods of gene transfer rely on normal mechanisms used by mammalian cells for the uptake and intracellular transport of macromolecules.
  • non-viral gene delivery systems of the present invention rely on endocytic pathways for the uptake of the subject AR polypeptide gene by the targeted cell.
  • Exemplary gene delivery systems of this type include liposomal derived systems, poly-lysine conjugates, and artificial viral envelopes.
  • Another aspect of the invention pertains to an antibody specifically reactive with an angiogenin receptor protein.
  • immunogens derived from an AR protein e.g. derived from a purified protein or based on the cDNA sequences
  • anti- protein/anti-peptide antisera or monoclonal antibodies can be made by standard protocols (See, for example, Antibodies: A Laboratory Manual ed. by Harlow and Lane (Cold Spring Harbor Press: 1988)).
  • a mammal such as a mouse, a hamster or rabbit can be immunized with an immunogenic form of the peptide (e.g., an AR polypeptide or an antigenic fragment which is capable of eliciting an antibody response).
  • Techniques for conferring immunogenicity on a protein or peptide include conjugation to carriers or other techniques well known in the art.
  • An immunogenic portion of an AR protein can be administered in the presence of adjuvant.
  • the progress of immunization can be monitored by detection of antibody titers in plasma or serum.
  • Standard ELISA or other immunoassays can be used with the immunogen as antigen to assess the levels of antibodies.
  • anti-AR antisera can be obtained and, if desired, polyclonal anti-AR antibodies isolated from the serum.
  • antibody- producing cells lymphocytes
  • myeloma cells can be harvested from an immunized animal and fused by standard somatic cell fusion procedures with immortalizing cells such as myeloma cells to yield hybridoma cells.
  • Hybridoma cells can be screened immunochemically for production of antibodies specifically reactive with an AR polypeptide of the present invention and monoclonal antibodies isolated from a culture comprising such hybridoma cells.
  • antibody as used herein is intended to include fragments thereof which are also specifically reactive with an AR polypeptide.
  • Antibodies can be fragmented using conventional techniques and the fragments screened for utility in the same manner as described above for whole antibodies. For example, F(ab)2 fragments can be generated by treating antibody with pepsin. The resulting F(ab)2 fragment can be treated to reduce disulfide bridges to produce Fab fragments.
  • the antibody of the present invention is further intended to include bispecific and chimeric molecules having affinity for an AR protein conferred by at least one CDR region of the antibody.
  • Both monoclonal and polyclonal antibodies (Ab) directed against authentic AR polypeptides, or AR variants, and antibody fragments such as Fab, F(ab)2, Fv and scFv can be used to block the action of an AR protein and allow the study of the role of these proteins in, for example, differentiation of tissue. Experiments of this nature can aid in deciphering the role of AR proteins that may be involved in control of proliferation versus differentiation, e.g., in patterning and tissue formation.
  • Antibodies which specifically bind AR epitopes can also be used in immunohistochemical staining of tissue samples in order to evaluate the abundance and pattern of expression of each of the subject AR polypeptides.
  • Anti-AR antibodies can be used diagnostically in immuno-precipitation and immuno-blotting to detect and evaluate AR protein levels in tissue as part of a clinical testing procedure. For instance, such measurements can be useful in predictive valuations of the onset or progression of proliferative disorders marked by upregulation of angiogenesis.
  • the ability to monitor AR protein levels in an individual can allow determination of the efficacy of a given treatment regimen for an individual afflicted with such a disorder.
  • the level of AR polypeptides may be measured from cells in bodily fluid, such as in samples of cerebral spinal fluid or amniotic fluid, or can be measured in tissue, such as produced by biopsy.
  • Diagnostic assays using anti-AR antibodies can include, for example, immunoassays designed to aid in early diagnosis of a disorder, particularly ones which are manifest at birth. Diagnostic assays using anti-AR polypeptide antibodies can also include immunoassays designed to aid in early diagnosis and phenotyping neoplastic or hyperplastic disorders.
  • anti-AR antibodies of the present invention is in the immunological screening of cDNA libraries constructed in expression vectors such as ⁇ gtl l, ⁇ gtl8-23, ⁇ ZAP, and ⁇ ORF8.
  • Messenger libraries of this type having coding sequences inserted in the correct reading frame and orientation, can produce fusion proteins.
  • ⁇ gtl 1 will produce fusion proteins whose amino termini consist of ⁇ -galactosidase amino acid sequences and whose carboxy termini consist of a foreign polypeptide.
  • Antigenic epitopes of an AR protein e.g.
  • orthologs of the AR protein from other species can then be detected with antibodies, as, for example, reacting nitrocellulose filters lifted from infected plates with anti-AR antibodies. Positive phage detected by this assay can then be isolated from the infected plate.
  • the presence of AR homologs can be detected and cloned from other animals, as can alternate isoforms (including splicing variants) from humans.
  • the nucleotide sequences determined from the cloning of AR genes will further allow for the generation of probes and primers designed for use in identifying and/or cloning AR homologs in other cell types, e.g. from other tissues, as well as AR homologs from other organisms.
  • Such probes can also be used as a part of a diagnostic test kit for identifying cells or tissue which misexpress an AR protein, such as by measuring a level of an AR- encoding nucleic acid in a sample of cells from a patient-animal; e.g. detecting AR mRNA levels or determining whether a genomic AR gene has been mutated or deleted.
  • nucleotide probes can be generated from the subject AR genes which facilitate histological screening of intact tissue and tissue samples for the presence (or absence) of receptor-encoding transcripts. Similar to the diagnostic uses of anti-AR antibodies, the use of probes directed to AR messages, or to genomic AR sequences, can be used for both predictive and therapeutic evaluation of allelic mutations which might be manifest in, for example, degenerative disorders marked by loss of particular cell-types, apoptosis, neoplastic and/or hyperplastic disorders (e.g. unwanted cell growth) or abnormal differentiation of tissue.
  • the oligonucleotide probes can help facilitate the determination of the molecular basis for a developmental disorder which may involve some abnormality associated with expression (or lack thereof) of an AR protein. For instance, variation in polypeptide synthesis can be differentiated from a mutation in a coding sequence.
  • the present method provides a method for determining if a subject is at risk for a disorder characterized by aberrant expression of an angiogenin receptor.
  • the method can be generally characterized as comprising detecting, in a sample of cells from the subject, the presence or absence of a genetic lesion characterized by at least one of (i) an alteration affecting the integrity of a gene encoding an AR-protein, or (ii) the mis-expression of the AR gene.
  • such genetic lesions can be detected by ascertaining the existence of at least one of (i) a deletion of one or more nucleotides from an AR gene, (ii) an addition of one or more nucleotides to an AR gene, (iii) a substitution of one or more nucleotides of an AR gene, (iv) a gross chromosomal rearrangement of an AR gene, (v) a gross alteration in the level of a messenger RNA transcript of an AR gene, (vii) aberrant modification of an AR gene, such as of the methylation pattern of the genomic DNA, (vii) the presence of a non-wild type splicing pattern of a messenger RNA transcript of an AR gene, (viii) a non-wild type level of an AR-protein, and (ix) inappropriate post-translational modification of an AR- protein.
  • the present invention provides a large number of assay techniques for detecting lesions in an AR gene, and importantly, provides the ability to discern between different molecular causes
  • a nucleic acid composition comprising a (purified) oligonucleotide probe including a region of nucleotide sequence which is capable of hybridizing to a sense or antisense sequence of an AR gene, such as encoding an amino acid sequence represented by either of SEQ ID No: 1, 2, 3 or 5, or naturally occurring mutants thereof, or 5' or 3' flanking sequences or intronic sequences naturally associated with the subject AR genes or naturally occurring mutants thereof.
  • the nucleic acid of a cell is rendered accessible for hybridization, the probe is exposed to nucleic acid of the sample, and the hybridization of the probe to the sample nucleic acid is detected.
  • detection of the lesion comprises utilizing the probe/primer in a polymerase chain reaction (PCR) (see, e.g. U.S. Patent Nos. 4,683,195 and 4,683,202), such as anchor PCR or RACE PCR, or, alternatively, in a ligation chain reaction (LCR) (see, e.g., Landegran et al. (1988) Science 241 :1077-1080; and Nakazawa et al.
  • PCR polymerase chain reaction
  • LCR ligation chain reaction
  • the method includes the steps of (i) collecting a sample of cells from a patient, (ii) isolating nucleic acid (e.g., genomic, mRNA or both) from the cells of the sample, (iii) contacting the nucleic acid sample with one or more primers which specifically hybridize to an AR gene under conditions such that hybridization and amplification of the AR gene (if present) occurs, and (iv) detecting the presence or absence of an amplification product, or detecting the size of the amplification product and comparing the length to a control sample.
  • nucleic acid e.g., genomic, mRNA or both
  • the level of an AR protein can be detected by immunoassay.
  • the cells of a biopsy sample can be lysed, and the level of an AR protein present in the cell can be quantitated by standard immunoassay techniques.
  • aberrant methylation patterns of an AR gene can be detected by digesting genomic DNA from a patient sample with one or more restriction endonucleases that are sensitive to methylation and for which recognition sites exist in the AR gene (including in the flanking and intronic sequences). See, for example, Buiting et al. (1994) Human Mol Genet 3:893-895. Digested DNA is separated by gel electrophoresis, and hybridized with probes derived from, for example, genomic or cDNA sequences.
  • the methylation status of the AR gene can be determined by comparison of the restriction pattern generated from the sample DNA with that for a standard of known methylation.
  • the ligand binding domain of the AR protein can be used to quantitatively detect the level of AR ligands, e.g., angiogenin proteins.
  • a soluble form of the AR protein can be generated which retains angiogenin binding activity.
  • Samples of bodily fluid(s), e.g., plasma, serum, lymph, marrow, cerebral/spinal fluid, milk, urine and the like can be contacted with the receptor under conditions wherein ligand/receptor binding can occur, and the level of ligand/receptor complexes formed can be detected by any of a variety of techniques known in the art. For example, competitive binding assays using standardized samples of angiogenin proteins can be used to quantitate the amount of analyte bound from the fluid sample.
  • such AR protein can be used to detect the presence of an AR ligand on a cell surface.
  • the AR protein can be contacted with cells from a biopsy, and the ability of the AR protein to decorate (label) certain cells of the sample is ascertained.
  • the binding of the AR protein to cell populations of the sample can be detected, for example, by the use of antibodies against the AR protein, or by detection of a label associated with the AR protein.
  • the AR protein can be labeled, for example, by chemical modification or as a fusion protein.
  • Exemplary labels include radioisotopes, fluorescent compounds, enzyme co-factors, which can be added by chemical modification of the protein, and epitope tags such as myc, pFLAG and the like, or enzymatic activities such as GST or alkaline phosphatase which can be added either by chemical modification or by generation of a fusion protein.
  • the present invention also contemplates the detection of soluble forms of the AR protein in bodily fluid samples. As described in the art, e.g., see Diez- Ruiz et al. (1995) Eur J Haematol 54:1-8 and Owen-Schaub et al.
  • soluble forms of receptors are believed to play a role as modulators of the biological function of their cognate ligands in an agonist/antagonist pattern.
  • the production and release of soluble AR proteins may mediate host response and determine the course and outcome of disease by interacting with AR ligands such as angiogenin and competing with cell surface receptors.
  • the determination of soluble AR proteins in body fluids is a tool to gain information about various disease states, and may be of prognostic value to a clinician.
  • the level of soluble AR protein in a body fluid may give useful information for monitoring, inter alia, neoplastic or hyperplastic transformations.
  • the level of soluble receptor present in a given sample can be quantitated, in light of the present disclosure, using known procedures and techniques.
  • antibodies immunoselective for the ligand binding domain of the AR protein can be used to detect and quantify its presence in a sample, e.g., by well-known immunoassay techniques.
  • a labeled ligand of the receptor can be used to detect the presence of the receptor in the fluid sample.
  • a number of techniques exist in the art for now identifying additional ligands to the AR protein For instance, expression cloning can be carried out on a cDNA or genomic library by isolating cells which are decorated with a labeled form of the receptor.
  • the technique uses the AR protein in an in situ assay for detecting AR ligands in tissue samples and whole organisms.
  • the RAP-w situ assay described below for Receptor Affinity Probe
  • Flanagan and Leder see PCT publications WO 92/06220; and also Cheng et al.
  • the method comprises (i) providing a hybrid molecule (the affinity probe) including the AR protein, or at least the ligand binding domain thereof, covalently bonded to an enzymatically active tag, preferably for which chromogenic substrates exist, (ii) contacting the tissue or organism with the affinity probe to form complexes between the probe and a cognate ligand in the sample, removing unbound probe, and (iii) detecting the affinity complex using a chromogenic substrate for the enzymatic activity associated with the affinity probe.
  • the affinity probe including the AR protein, or at least the ligand binding domain thereof, covalently bonded to an enzymatically active tag, preferably for which chromogenic substrates exist
  • the present invention facilitates the development of assays which can be used to screen for drugs which are either agonists or antagonists of the normal cellular function of the subject angiogenin receptors.
  • the assay evaluates the ability of a compound to modulate binding between an angiogenin receptor and a ligand, e.g., such as an angiogenin protein, that interacts with the receptor, or to mimic the effects of ligand engagement.
  • a ligand e.g., such as an angiogenin protein
  • Exemplary compounds which can be screened against such AR-mediated interactions include peptides, nucleic acids, carbohydrates, small organic molecules, and natural product extract libraries, such as isolated from animals, plants, fungus and/or microbes.
  • a reaction mixture is generated to include an AR polypeptide, compound(s) of interest, and a "target molecule", e.g., a protein, which interacts with the AR polypeptide.
  • target molecules include ligands, such as angiogenin proteins, as well as other peptide and non-peptide interacting molecules.
  • Detection and quantification of interaction of the AR polypeptide with the target molecule provides a means for determining a compound's efficacy at inhibiting (or potentiating) interaction between the AR and the target molecule.
  • the efficacy of the compound can be assessed by generating dose response curves from data obtained using various concentrations of the test compound.
  • a control assay can also be performed to provide a baseline for comparison.
  • interaction of the AR polypeptide and target molecule is quantitated in the absence of the test compound.
  • Interaction between the AR polypeptide and the target molecule may be detected by a variety of techniques. Modulation of the formation of complexes can be quantitated using, for example, detectably labeled proteins such as radiolabeled, fluorescently labeled, or enzymatically labeled AR polypeptides, by immunoassay, by chromatographic detection or use of a biosensor based on, e.g., surface plasmon resonance.
  • binding of AR to the target molecule can be accomplished in any vessel suitable for containing the reactants. Examples include microtitre plates, test tubes, and micro-centrifuge tubes.
  • a fusion protein can be provided which adds a domain that allows the protein to be bound to a matrix.
  • glutathione-S-transferase/AR (GST/AR) fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St.
  • the cell lysates e.g. an 35 ⁇ -labeled lysate
  • the test compound glutathione derivatized microtitre plates
  • the cell lysates e.g. an 35 ⁇ -labeled lysate
  • the test compound glutathione derivatized microtitre plates
  • the cell lysates e.g. an 35 ⁇ -labeled lysate
  • the test compound glutathione derivatized microtitre plates
  • the mixture incubated under conditions conducive to complex formation, e.g. at physiological conditions for salt and pH, though slightly more stringent conditions may be desired.
  • the beads are washed to remove any unbound label, and the matrix immobilized and radiolabel determined directly (e.g. beads placed in scintillant), or in the supernatant after the complexes are subsequently dissociated.
  • the complexes can be dissociated from the matrix, separated by SDS-PAGE, and the level of target molecule found in
  • AR or target molecule can be immobilized utilizing conjugation of biotin and streptavidin.
  • biotinylated AR molecules can be prepared from biotin-NHS (N-hydroxy-succinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, IL), and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).
  • antibodies reactive with AR, but which do not interfere with the interaction between the AR and target molecule can be derivatized to the wells of the plate, and AR trapped in the wells by antibody conjugation.
  • preparations of an target molecule and a test compound are incubated in the AR-presenting wells of the plate, and the amount of complex trapped in the well can be quantitated.
  • Exemplary methods for detecting such complexes include immunodetection of complexes using antibodies reactive with the target molecule, or which are reactive with AR protein and compete with the target molecule; as well as enzyme-linked assays which rely on detecting an enzymatic activity associated with the target molecule, either intrinsic or extrinsic activity. In the instance of the latter, the enzyme can be chemically conjugated or provided as a fusion protein with the target molecule.
  • the target molecule can be chemically cross-linked or genetically fused (if it is a polypeptide) with horseradish peroxidase, and the amount of polypeptide trapped in the complex can be assessed with a chromogenic substrate of the enzyme, e.g. 3,3'-diaminobenzidine tetrahydrochloride or 4-chloro-l- naphthol.
  • a fusion protein comprising the polypeptide and glutathione-S- transferase can be provided, and complex formation quantitated by detecting the GST activity using 1 -chloro-2,4-dinitrobenzene (Habig et al (1974) J Biol Chem 249:7130).
  • the protein to be detected in the complex can be "epitope tagged" in the form of a fusion protein which includes, in addition to the AR sequence, a second polypeptide for which antibodies are readily available (e.g. from commercial sources).
  • the GST fusion proteins described above can also be used for quantification of binding using antibodies against the GST moiety.
  • Other useful epitope tags include myc-epitopes (e.g., see Ellison et al.
  • interaction between the subject receptor and a potential ligand can be detected using surface plasmon resonance such as is currently carried out with "sensor chip” technology.
  • a potential ligand e.g., a surrogate ligand
  • surface plasmon resonance such as is currently carried out with "sensor chip” technology. See for example U.S. Patent 5,485,277; Shinohara et al. (1995) J Biochem (Tokyo) 117:1076-1082; Nice et al. (1993) JChromatogr 646:159-168; and Jonsson et al. (1991) Biotechniques 1 1 : 620-627.
  • Surface plasmon biosensors are basically sensitive refractometers that monitor changes in the optical state of a protein layer, in the case a layer of AR protein.
  • TM-polarized light in the prism is incident at the proper angle to excite surface plasmons, the TM-polarized light is attenuated drastically.
  • a target bioagent such as the ligand
  • the thickness and surface plasmon resonance changes, thereby altering the angular position of the reflected light.
  • An exemplary drug screening assay of the present invention includes the steps of (a) forming a reaction mixture including: (i) an angiogenin polypeptide, (ii) an AR polypeptide, and (iii) a test compound; and (b) detecting interaction of the angiogenin and AR polypeptides.
  • the reaction mixture can be a cell-free protein preparation, e.g., a reconstituted protein mixture or a cell lysate, or it can be a recombinant cell including a heterologous nucleic acid recombinantly expressing the AR polypeptide.
  • the cell-free system can be, e.g., a cell membrane preparation, a reconstituted protein mixture, or a liposome reconstituting the receptor subunits as an angiogenin receptor.
  • the drug screening assay is derived to include a whole cell expressing an AR polypeptide. The ability of a test agent to alter the activity of the AR protein can be detected by analysis of the recombinant cell.
  • agonists and antagonists of the AR biological activity can by detected by scoring for alterations in growth or differentiation (phenotype) of the cell, expression of a reporter gene, and/or nuclear translocation of angiogenin (see for example Moroianu and Rirdon (1994) PNAS 91 :1677-1681).
  • General techniques for detecting each are well known, and will vary with respect to the source of the particular reagent cell utilized in any given assay.
  • the recombinant cell is preferably a metazoan cell, e.g., a mammalian cell, e.g., an insect cell, e.g., a xenopus cell, e.g., an oocyte.
  • the angiogenin receptor can be reconstituted in a yeast cell.
  • a cell which expresses the AR protein e.g., whether endogenous or heterologous
  • a ligand of the AR protein e.g., an angiogenin protein, which is capable of inducing signal transduction from the receptor, and the resulting signaling detected either at various points in the pathway, or on the basis of a phenotypic change to the reagent cell.
  • a test compound which modulates that pathway e.g., potentiates or inhibits, can be detected by comparison with control experiments which either lack the receptor or lack the test compound.
  • visual inspection of the morphology of the reagent cell can be used to determine whether the biological activity of the targeted AR protein has been affected by the added agent.
  • change(s) in the level of an intracellular second messenger responsive to signaling by the AR polypeptide can be detected.
  • the assay may assess the ability of test agent to cause changes in phophorylation patterns, adenylate cyclase activity (cAMP production), GTP hydrolysis, calcium mobilization, and/or phospholipid hydrolysis (IP3, DAG production) upon receptor stimulation.
  • cAMP production adenylate cyclase activity
  • IP3, DAG production phospholipid hydrolysis
  • an angiogenin protein may set in motion a cascade involving the activation and inhibition of downstream effectors, the ultimate consequence of which is, in some instances, a detectable change in the transcription or translation of a gene.
  • Potential transcriptional targets of AR-dependent angiogenin signaling include urokinase type plasminogen activator (see, for example, Jimi et al. supra).
  • the step of detecting interaction of the angiogenin and AR polypeptides comprises detecting, in a cell-based assay, change(s) in the level of expression of a gene controlled by a transcriptional regulatory sequence responsive to signaling by the AR polypeptide.
  • Reporter gene based assays of this invention measure the end stage of the above described cascade of events, e.g., transcriptional modulation.
  • a reporter gene construct is inserted into the reagent cell in order to generate a detection signal dependent on angiogenin signaling. Expression of the reporter gene, thus, provides a valuable screening tool for the development of compounds that act as agonists or antagonists of AR-dependent angiogenin induction.
  • a reporter gene construct is inserted into the reagent cell in order to generate a detection signal dependent on second messengers generated by AR-dependent induction with an angiogenin protein.
  • the reporter gene construct will include a reporter gene in operative linkage with one or more transcriptional regulatory elements responsive to the angiogenin activity, with the level of expression of the reporter gene providing the angiogenin-dependent detection signal.
  • the amount of transcription from the reporter gene may be measured using any method known to those of skill in the art to be suitable. For example, mRNA expression from the reporter gene may be detected using RNase protection or RNA-based PCR, or the protein product of the reporter gene may be identified by a characteristic stain or an intrinsic activity.
  • the amount of expression from the reporter gene is then compared to the amount of expression in either the same cell in the absence of the test compound or it may be compared with the amount of transcription in a substantially identical cell that lacks the target receptor protein. Any statistically or otherwise significant difference in the amount of transcription indicates that the test compound has in some manner altered the inductive activity of the angiogenin protein.
  • the gene product of the reporter is detected by an intrinsic activity associated with that product.
  • the reporter gene may encode a gene product that, by enzymatic activity, gives rise to a detection signal based on color, fluorescence, or luminescence.
  • the reporter or marker gene provides a selective growth advantage, e.g., the reporter gene may enhance cell viability, relieve a cell nutritional requirement, and/or provide resistance to a drug.
  • reporter genes are known to those of skill in the art and others may be identified or synthesized by methods known to those of skill in the art.
  • a reporter gene includes any gene that expresses a detectable gene product, which may be RNA or protein. Preferred reporter genes are those that are readily detectable.
  • the reporter gene may also be included in the construct in the form of a fusion gene with a gene that includes desired transcriptional regulatory sequences or exhibits other desirable properties.
  • reporter genes include, but are not limited to CAT (chloramphenicol acetyl transferase) (Alton and Vapnek (1979), Nature 282: 864-869) luciferase, and other enzyme detection systems, such as beta-galactosidase; firefly luciferase (deWet et al. (1987), Mol. Cell. Biol. 7:725-737); bacterial luciferase (Engebrecht and Silverman (1984), PNAS 1 : 4154-4158; Baldwin et al. (1984), Biochemistry 23: 3663-3667); alkaline phosphatase (Toh et al. (1989) Eur. J. Biochem.
  • CAT chloramphenicol acetyl transferase
  • yet another embodiment of the subject drug screening assays of the present invention provides a recombinant cell, e.g., for carrying out certain of the drug screening methods above, comprising: (i) an expressible recombinant gene encoding a heterologous AR polypeptide whose signal transduction activity is modulated by binding to an angiogenin protein; and (ii) a reporter gene construct containing a reporter gene in operative linkage with one or more transcriptional regulatory elements responsive to the signal transduction activity of the AR polypeptide.
  • Still another aspect of the present invention provides a kit for screening test compounds to identify agents which modulate the binding of angiogenin proteins with an angiogenin receptor, including the above- referenced cell, a preparation of purified angiogenin polypeptide, and AR angiogenin.
  • Still another drug screening assay makes use of purified or semi-purified preparations of the subject angiogenin receptor by detecting changes in, for example, an associated enzymatic activity in response to ligand binding.
  • the activation (or inactivation) of that activity in response to ligand binding can be scored in a drug screening assay.
  • Finn et al. (1989) Biol Chem Hoppc Seyler 370:559- 564 describes the use of purified insulin receptor to detect, wter alia, the autophosphorylating activity of human insulin analogs.
  • a similar approach can be taken with purified angiogenin receptor.
  • agents identified in the subject assay can be formulated in pharmaceutical preparations for in vivo administration to an animal, preferably a human.
  • Another aspect of the present invention relates to a method of inducing and/or maintaining a particular vascularization state, or inhibiting vascularization, by contacting the cells with an agent which modulates AR-dependent signal transduction pathways.
  • agents can be compounds identified in the drug screening assays described above, as well as various forms of the subject angiogenin receptor, antisense constructs, and other agents described herein as inhibitors or potentiators of the subject angiogenin receptor.
  • an extracellular fragment of the receptor e.g., one which retains angiogenin binding, can be used as an antiangiogenesis agent, e.g., in that it may compete with the native receptor for angiogenin binding.
  • Persistent, unregulated angiogenesis occurs in a multiplicity of disease states, tumor metastasis and abnormal growth by endothelial cells and supports the pathological damage seen in these conditions.
  • the diverse pathological states created due to unregulated angiogenesis have been grouped together as angiogenic dependent or angiogenic associated diseases.
  • the present invention provides therapies directed to controlling the angiogenic processes in a manner which leads to the abrogation or mitigation of these diseases.
  • the subject method can be used for treating undesired angiogenesis (e.g., hypervascularization or neovascularization) in a human or animal by administering a composition comprising an effective amount of an agent which inhibits angiogenin-mediated signalling by the subject angiogenin receptor.
  • corneal neovascularization Diseases associated with corneal neovascularization that can be treated according to the present invention include but are not limited to, diabetic retinopathy, retinopathy of prematurity, corneal graft rejection, neo vascular glaucoma and retrolental fibroplasia, epidemic keratoconjunctivitis, Vitamin A deficiency, contact lens overwear, atopic keratitis, superior limbic keratitis, pterygium keratitis sicca, sjogrens, acne rosacea, phylectenulosis, syphilis, Mycobacteria infections, lipid degeneration, chemical burns, bacterial ulcers, fungal ulcers, Herpes simplex infections, Herpes zoster infections, protozoan infections, Kaposi sarcoma, Mooren ulcer, Terrien's marginal degeneration, mariginal keratolysis, trauma, rheumatoid arthritis, system
  • Diseases associated with retinal/choroidal neovascularization that can be treated according to the present invention include, but are not limited to, diabetic retinopathy, macular degeneration, sickle cell anemia, sarcoid, syphilis, pseudoxanthoma elasticurn, Pagets disease, vein occlusion, artery occlusion, carotid obstructive disease, chronic uveitis/vitritis, mycobacterial infections, Lyme's disease, systemic lupus erythematosis, retinopathy of prematurity, Eales disease, Bechets disease, infections causing a retinitis or choroiditis, presumed ocular histoplasmosis, Bests disease, myopia, optic pits, Stargarts disease, pars planitis, chronic retinal detachment, hyperviscosity syndromes, toxoplasmosis, trauma and post-laser complications.
  • diseases associated with rubeosis include, but are not limited to, diseases associated with rubeosis (neovasculariation of the angle) and diseases caused by the abnormal proliferation of fibrovascular or fibrous tissue including all forms of proliferative vitreoretinopathy, whether or not associated with diabetes.
  • Diseases associated with chronic inflammation can be treated by the compositions and methods of the present invention.
  • Diseases with symptoms of chronic inflammation include inflammatory bowel diseases such as Crohn's disease and ulcerative colitis, psoriasis, sarcoidosis and rheumatoid arthritis.
  • Angiogenesis is a key element that these chronic inflammatory diseases have in common. The chronic inflammation depends on continuous formation of capillary sprouts to maintain an influx of inflammatory cells.
  • compositions and methods of the present invention can be used to treat patients with inflammatory bowel diseases such as Crohn's disease and ulcerative colitis. Both Crohn's disease and ulcerative colitis are characterized by chronic inflammation and angiogenesis at various sites in the gastrointestinal tract. Crohn's disease is characterized by chronic granulomatous inflammation throughout the gastrointestinal tract consisting of new capillary sprouts surrounded by a cylinder of inflammatory cells. Prevention of angiogenesis by the compositions and methods of the present invention inhibits the formation of the sprouts and prevents the formation of granulomas.
  • Crohn's disease occurs as a chronic transmural inflammatory disease that most commonly affects the distal ileum and colon but may also occur in any part of the gastrointestinal tract from the mouth to the anus and perianal area.
  • Patients with Crohn's disease generally have chronic diarrhea associated with abdominal pain, fever, anorexia, weight loss and abdominal swelling. Ulcerative colitis is also a chronic, nonspecific, inflammatory and ulcerative disease arising in the colonic mucosa and is characterized by the presence of bloody diarrhea.
  • the inflammatory bowel diseases also show extraintestinal manifestations such as skin lesions. Such lesions are characterized by inflammation and angiogenesis and can occur at many sites other than the gastrointestinal tract.
  • compositions and methods of the present invention are also capable of treating these lesions by preventing the angiogenesis, thus reducing the influx of inflammatory cells and the lesion formation.
  • Sarcoidosis is another chronic inflammatory disease that is characterized as a multisystem granulomatous disorder.
  • the granulomas of this disease may form anywhere in the body and thus the symptoms depend on the site of the granulomas and whether the disease is active.
  • the granulomas are created by the angiogenic capillary sprouts providing a constant supply of inflammatory cells.
  • compositions and methods of the present invention can also treat the chronic inflammatory conditions associated with psoriasis.
  • Psoriasis a skin disease
  • Psoriasis is another chronic and recurrent disease that is characterized by papules and plaques of various sizes.
  • Rheumatoid arthritis is a chronic inflammatory disease characterized by nonspecific inflammation of the peripheral joints. It is believed that the blood vessels in the synovial lining of the joints undergo angiogenesis. In addition to forming new vascular networks, the endothelial cells release factors and reactive oxygen species that lead to pannus growth and cartilage destruction. The factors involved in angiogenesis may actively contribute to, and help maintain, the chronically inflamed state of rheumatoid arthritis.
  • Another disease that can be treated according to the present invention are hemangiomas, Osler-Weber-Rendu disease, or hereditary hemorrhagic telangiectasia, solid or blood borne tumors and acquired immune deficiency syndrome.
  • antiangiogenic agents identified by the present invention can be used to prevent angiogenesis in solid tumors.
  • Angiogenesis is prominent in solid tumor formation and metastasis, and has been associated with several solid tumors, including those deriving from colon, breast , prostate and lung, as well as rhabdomyosarcomas, retinoblastoma, Ewing sarcoma, neuroblastoma, and osteosarcoma.
  • a tumor cannot expand without a blood supply to provide nutrients and remove cellular wastes.
  • Tumors in which angiogenesis is important include solid tumors, and benign tumors such as acoustic neuroma, neurofibroma, trachoma and pyogenic granulomas.
  • Prevention of angiogenesis according to the present invention can halt the growth of these tumors and the resultant damage to the animal due to the presence of the tumor.
  • Angiogenesis is important in two stages of tumor metastasis.
  • the first stage where angiogenesis stimulation is important is in the vascularization of the tumor which allows tumor cells to enter the blood stream and to circulate throughout the body. After the tumor cells have left the primary site, and have settled into the secondary, metastasis site, angiogenesis must occur before the new tumor can grow and expand. Therefore, prevention of angiogenesis can lead to the prevention of metastasis of tumors and containing the neoplastic growth at the primary site.
  • angiogenesis has been associated with certain blood-born tumors such as leukemias, any of various acute or chronic neoplastic diseases of the bone marrow in which unrestrained proliferation of white blood cells occurs, usually accompanied by anemia, impaired blood clotting, and enlargement of the lymph nodes, liver, and spleen. It is believed that angiogenesis plays a role in the abnormalities in the bone marrow that give rise to leukemia-like tumors. Treatment with antiangiogenic agents as described herein can accordingly be used as part of a treatment for such tumors.
  • Angiogenesis is also involved in normal physiological processes such as reproduction and wound healing. Angiogenesis is an important step in ovulation and also in implantation of the blastula after fertilization. Prevention of angiogenesis, e.g., with AR antagonists of the present invention, could be used to induce amenorrhea, to block ovulation or to prevent implantation by the blastula.
  • Angiogenic and antiangiogenic agents can each be used under various circumstances in promoting effective wound healing.
  • excessive repair or fibroplasia can be a detrimental side effect of surgical procedures and may be caused or exacerbated by angiogenesis.
  • Adhesions are a frequent complication of surgery and lead to problems such as small bowel obstruction. In those instance, antiangiogenic agents may be opportunely applied to prevent such complications.
  • angiogenin receptor agonists mitogenic effects that angiogenin receptor agonists is of particular interest given their potential stimulatory effect on collateral vascularization and angiogenesis.
  • Angiogenic agents identified by use of the subject receptor proteins can be used to promote the development of a hemovascular network in a mammal or to accelerate wound healing. Such agents are also potential therapeutics for accelerating vascularization of prosthetic devices, as well as nerve regeneration and in healing of torn or traumatized fibrocartilage material.
  • angiogenic agents identified according the assays herein may be of use in promoting hair growth, as for example in the treatment of alopecia.
  • the invention provides a method for treating undesired angiogenesis in a human or animal comprising the step of administering to the human or animal with the undesired angiogenesis a composition comprising an effective amount of an inhibitor of angiogenin-dependent AR function, e.g., such as a compound which competitively inhibits binding of angiogenin by the receptor (such as a small organic molecule, a peptide or the like, or a soluble extracellular fragment of the AR protein), an AR antisense, a AR kinase inhibitor or the like.
  • an inhibitor of angiogenin-dependent AR function e.g., such as a compound which competitively inhibits binding of angiogenin by the receptor (such as a small organic molecule, a peptide or the like, or a soluble extracellular fragment of the AR protein), an AR antisense, a AR kinase inhibitor or the like.
  • the subject method can be useful in the treatment or prevention of such undesired angiogenic process as may be associated with retinal neovascularization, choroidal neovascularization, diabetic retinopathy, macular degeneration, corneal neovascularization, retinopathy of prematurity, corneal graft rejection, neovascular glaucoma, retrolental fibroplasia, epidemic keratoconjunctivitis, Vitamin A, contact lens overwear, atopic keratitis, superior limbic keratitis, pterygium keratitis sicca, sogrens, acne rosacea, phylectenulosis, syphilis, Mycobacteria infections other than leprosy, lipid degeneration, chemical burns, bacterial ulcers, fungal ulcers, Herpes simplex infections, Herpes zoster infections, protozoan infections, Kaposi's sarcoma, Mooren ulcer, Terrien's marginal
  • Another aspect of the invention features transgenic non-human animals which express a heterologous AR gene of the present invention, and/or which have had one or more genomic AR genes disrupted in at least a tissue or cell-types of the animal.
  • the invention features an animal model for developmental diseases, which animal has one or more AR allele which is mis-expressed. For example, an animal can be generated which has one or more AR alleles deleted or otherwise rendered inactive. Such a model can then be used to study disorders arising from mis-expressed AR genes, as well as for evaluating potential therapies for similar disorders.
  • the transgenic animals of the present invention all include within a plurality of their cells a transgene of the present invention, which transgene alters the phenotype of the "host cell” with respect to regulation by the AR protein, e.g., of cell growth, death and/or differentiation. Since it is possible to produce transgenic organisms of the invention utilizing one or more of the transgene constructs described herein, a general description will be given of the production of transgenic organisms by referring generally to exogenous genetic material. This general description can be adapted by those skilled in the art in order to incorporate specific transgene sequences into organisms utilizing the methods and materials described herein and those generally known in the art.
  • bFGF, aFGF, anti-aFGF polyclonal antibody, fibronectin, monomeric Avidin-Sepharose, Streptavidin-alkaline phosphatase, and Biodyne B nylon membranes were from Promega; methyl- ⁇ H-thymidine (6.7 Ci/mmol) were from Du Pont/New England Nuclear; excellulose GF-5 desalting columns and Iodo-Beads iodination reagent were obtained from Pierce; (disulfosuccinimidyl)suberate (Sulfo-DSS) was obtained from CalBiochem; sulfosuccinimidyl-6-(biotinamido)hexanoate (Sulfo NHS-Biotin) was from Vector Laboratories; complete protease inhibitor cocktail tablets were from Boehringer Mannheim; anti-bFGF monoclonal antibody, biotin, ribonuclease A (RNase A)
  • HUVE Human umbilical venous
  • HUAE umbilical arterial
  • HME microvascular endothelial cells
  • CS Cell Systems Corp.
  • FBS fetal bovine serum
  • HUVE cells were cultured on fibronectin-coated dishes in human endothelial serum free medium (HE-SFM) (Gibco BRL/Life Technology) containing 20 ng/ml bFGF or on uncoated dishes but in HE-SFM + 10% FBS + 20 ng/ml bFGF. Cells between passages 3 and 15 inclusive were used for all experiments. Cell numbers were determined with a Coulter counter, and cell viability was measured by Trypan Blue exclusion assay.
  • HE-SFM human endothelial serum free medium
  • 1 ⁇ I-angiogenin was prepared as follows with the use of Iodo-beads.
  • One Iodo- bead was added to 175 ⁇ l of 0.114 M phosphate buffer, pH 6.5, containing 0.5 mCi Nal2 j anc j incubated at room temperature for 5 min.
  • Angiogenin, 50 ⁇ g in 25 ⁇ l H2O was added and the mixture was incubated at room temperature for another 15 min.
  • the reaction was terminated by removing the Iodo-bead, and iodinated angiogenin was separated from free iodine by a GF-5 desalting column equilibrated in 0.1 M phosphate buffer, pH 6.5. Fractions of 0.5 ml were collected and the radioactivity in each fraction was determined with a gamma counter.
  • ⁇ 1H-thymidine uptake into endothelial cells was determined in the following manner.
  • HUVE and HME cells were seeded in either 24-well plates or 35 mm dishes at a density of 6x10- - 1.5x10 ⁇ cells/cm ⁇ and cultured in HE-SFM containing 10% FBS and 20 ng/ml bFGF at 37 ⁇ C under humidified air containing 5% CO2.
  • Six replicates were used for each sample. After 24 hr, the cells were washed 3 times with prewarmed HE- SFM and serum-starved in HE-SFM for 18 hr.
  • the culture medium was removed and the cells were incubated in HE-SFM with test samples in the presence of 1 ⁇ Ci/ml -1H- thymidine for 14 hr.
  • the cells were washed 3 times with phosphate buffered saline (PBS), precipitated with 10% trichloroacetic acid at RT for 30 min, washed 2 times with ethanol and solubilized with 0.2 M NaOH + 0.2% SDS. After neutralization with 1/5 volume of 1 N HCl, the radioactivity was determined by liquid scintillation counting.
  • PBS phosphate buffered saline
  • Cell proliferation was determined in the following manner. HUVE and HME cells were seeded in either fibronectin- or CS-attachment factor-coated 35 mm dishes in HE- SFM at 4-8x10- cells/cm ⁇ . Test samples (10 ⁇ l) were added immediately after the cells were seeded. When combinations of samples were tested, they were premixed and always adjusted to a final volume of 10 ⁇ l with HE-SFM before addition to the cells. The cells were incubated at 37 ⁇ C in humidified air containing 5% CO2 for 48 hr. At the end of this time, the medium was aspirated, and the cells were washed once with 1 ml PBS and detached with 0.25 ml of trypsin-versene (0.05%) solution. Cell numbers were determined with a Coulter counter.
  • angiogenin stimulates ⁇ H-thymidine incorporation and cell proliferation of human endothelial cells under defined conditions described in Examples IV and V.
  • 1 ⁇ g/ml angiogenin stimulated HUVE cells to increase -1H-thymidine incorporation and proliferation by 33 and 34%, respectively.
  • angiogenin stimulated an average increase of 19 and 25% in -1H-thymidine incorporation and cell proliferation, respectively.
  • Student-Fisher's t-test showed that the increases of -1H- thymidine incorporation and cell proliferation induced by angiogenin in both HUVE and HME cells are statistically significant, as indicated by P values.
  • FIG. 1 is a graph showing experimental results of dose-dependent stimulation of ⁇ H- thymidine incorporation and proliferation of endothelial cells by angiogenin.
  • -1H- thymidine incorporation left panel
  • 1x10 ⁇ of HUVE (solid lines) and HME (dashed lines) cells were used per well in 24-well plates (5x10-* cells/cm ⁇ ) with 6 replicates for each sample.
  • 5x10 ⁇ cells were used per 35 mm dish (5x10- cells/cmr) with 3 replicates for each sample. Data shown are the percent increases over controls.
  • angiogenin stimulated a 14% and 48% and a 15% and 30% increase of - > H-thymidine incorporation in HUVE and HME cells, respectively (Fig. 1, left panel).
  • Raising the angiogenin concentration to 1 ⁇ g/ml enhanced - H-thymidine uptake by 54% and 32% for HUVE and HME cells, respectively, not significantly different from results seen at 100 ng/ml.
  • a similar pattern of concentration dependency was observed for angiogenin-stimulated cell proliferation (Fig. 1 , right panel). Almost no proliferation occurred when cells were cultured in HE-SFM in the absence of angiogenin.
  • angiogenin-induced - H-thymidine incorporation and cell proliferation of HUVE cells were inhibited by 26-2F, an anti-angiogenin monoclonal antibody (Fett et al., 1995, Biochemistry 33: 5421-5427), but not by CCL130, a non- immune control antibody.
  • HUVE cells were plated at 15000 cells per 35 mm culture dish (1500 cells/cm ⁇ ). The effect of 20 ng/ml angiogenin, which induced a 33% increase in ⁇ H-thymidine incorporation and a 16% increase in cell proliferation, was completely inhibited by 10 ⁇ g/ml of 26-2F. Mixtures of angiogenin with 26-2F had no stimulating effect but with CCL 130 (10 ⁇ g/ml) there was a 37% and a 14% increase, respectively.
  • Table 2 Table 2
  • Cell density was the most important factor that influenced angiogenin-induced -1H-thymidine incorporation and cell proliferation. Endothelial cells responded to angiogenin only when they were in sparse culture. The responsiveness diminished when the cell density exceeded 2x10 ⁇ cells/cm ⁇ . On the other hand, cells cannot be too sparse ( ⁇ 10- /cmr) due to the resulting high signal/noise ratio.
  • the optimal density for -1H- thymidine incorporation and cell proliferation assays was 6x10-* - 1.5x10 ⁇ and 4 - 8x10- cells/cm ⁇ , respectively.
  • attachment factor employed was another critical item. In the - ⁇ H- thymidine incorporation assay best results were obtained without the use of any attachment factor. However, for successful cell proliferation assays culture dishes should be coated with fibronectin or the attachment factors from CS.
  • angiogenin activity was not masked by exogenous bFGF.
  • HUVE and HME cells at 7x10 ⁇ and 5x10 ⁇ per 35 mm dish, were stimulated by angiogenin (1 ⁇ g/ml), bFGF (2 ng/ml) or a mixture of the two, respectively.
  • Angiogenin alone stimulated 33 and 16% increases
  • bFGF alone stimulated 182 and 36% increases in HUVE and HME cell proliferation, respectively.
  • a mixture of angiogenin and bFGF stimulated 365 and 62% increases, which were 29 and 19% greater than for samples treated just with bFGF.
  • HUVE (cell number) 69900 ⁇ 1000 93000 ⁇ 4000 197000 ⁇ 3600 255000 ⁇ 5000 100 133 282 365
  • angiogenin-stimulated proliferation of HUVE cells was not inhibited by RNase A, a close homolog of angiogenin but one which is not angiogenic.
  • Experiments were carried out in T-25 flasks containing 1.5x10 ⁇ cells per flask (6x10-3 cells/cm ⁇ ). Three flasks were used for each sample. Concentrations of angiogenin and RNase A were 1 and 10 ⁇ g/ml, respectively. The percent increases induced by 1 ⁇ g/ml angiogenin in the absence or presence of 10 ⁇ g/ml RNase A were 25 and 21%, respectively, while 10 ⁇ g/ml RNase A itself had no effect on cell proliferation under these conditions. The fact that RNase A is not active under the same conditions and did not inhibit angiogenin-induced - H-thymidine incorporation and cell proliferation indicated that the action of angiogenin in endothelial cells is specific.
  • Endothelial cells are known to secrete aFGF and bFGF (Folkman et al., 1988, Am. J. Pathol. 130: 393-400).
  • HUVE and HME cells were plated at 1.6x10 ⁇ cells per well in 24- well plates (8x10-3 cells/cm ⁇ ). Concentrations of angiogenin, anti-aFGF and anti-bFGF antibody were 1, 10 and 10 ⁇ g/ml, respectively.
  • an anti-aFGF antibody had little effect, while an anti-bFGF monoclonal antibody significantly reduced spontaneous -*H-thymidine incorporation of both HME and HUVE cells.
  • ⁇ - ⁇ I-labeled angiogenin was used to bind to the surface of endothelial cells under sparse culture conditions where they exhibit a positive response in both assays.
  • Sulfo-DSS a water soluble, membrane impermeable, bifunctional chemical crosslinker, was used to crosslink 1 ⁇ I-angiogenin to its receptor.
  • angiogenin binds to cell surface actin and that the angiogenin-actin complex dissociates from the cell surface (Hu et al., 1993, Proc. Natl. Acad. Sci. USA 90 1217-1221). If actin was to be expressed on the endothelial cell surface under the conditions used above, it might prevent angiogenin from binding to other cell surface receptors especially when low concentrations of angiogenin or short incubation times are employed. Therefore, the cells were first incubated with 50 ng/ml of ⁇ ⁇ I-angiogenin to deplete them of any cell surface actin. After the first incubation, the cells were reincubated with 50 ng/ml of fresh 125j_ angiogenin and then crosslinked by Sulfo-DSS.
  • endothelial cells (HUVE, HUAE, HME), seeded at 5x10 3 cells/cm 2 , were cultured in HE-SFM + 0% FBS + 20 ng/ml bFGF at 37 °C under 5% humidified CO2 for 24 hr, and starved in HE-SFM for another 24 hr. The cells were then cooled to 4 O washed twice with PBS, and incubated with 50 ng/ml 125j_ angiogenin in PBS at 4 "C for 30 min.
  • the cells were then washed twice with PBS and solubilized in 100 ⁇ l of lxSDS-PAGE sample buffer. The entire sample was subject to SDS-PAGE and autoradiography. In competition experiments, the competitors were premixed with ⁇ -T-angiogenin and were present in both incubations.
  • SDS-PAGE and autoradiography revealed a crosslinked band of approximately 180 kDa with HUVE (lane A), HUAE (lane B) and HME (lane C) cells, indicating that a ⁇ 170 kDa angiogenin binding protein is expressed on the surface of 3 types of endothelial cells.
  • HUVE HUVE
  • HUAE HUAE
  • HME lane C
  • Sulfo-DSS is known to be an inefficient crosslinker for actin-angiogenin (Hu et al., 1993, supra).
  • 170 kDa angiogenin receptor is correlated with the activity of angiogenin in 3 H-thymidine incorporation and cell proliferation assays. No crosslinked band was detected when cell density exceeded 2x10 ⁇ cells/cm 2 .
  • the 170 kDa protein may serve as a functional receptor for angiogenin and mediate angiogenin-stimulated proliferation of endothelial cells. It appears that the 170 kDa angiogenin receptor and actin are not expressed concurrently on the endothelial cell surface.
  • the 170 kDa angiogenin receptor and actin may participate in certain specific cellular functions at different stages in the process of angiogenin-induced angiogenesis.
  • Binding of angiogenin to cell surface actin has been demonstrated to result in activation of a cell-associated protease system and cell invasion (Hu et al., 1994, supra). After the cells are activated and start to migrate and invade the basement membrane, the local density of the cells in the vicinity of the migrating cells decreases and this may trigger the expression of the 170 kDa angiogenin receptor on the remaining adjacent cells. These cells become responsive to stimulation by angiogenin and will therefore divide to fill the space created by the migrating cells. Such density- dependent receptor expression may regulate the angiogenin-induced growth of the new capillary network.
  • the binding constant between angiogenin and its cell surface receptor was determined in the following manner.
  • HUVE cells were cultured under the angiogenin- responsive conditions as described in Example X. The cells were cooled to 4 °C, washed three times with PBS and incubated with various concentration of ⁇ I-angiogenin in PBS at 4 °C for 30 min. At the end of incubation, the medium was removed and the cells were washed 3 times with PBS. The medium and the washing solution were combined and the radioactivity was counted as free * 2 ->I-angiogenin. The cell monolayers were washed once with PBS + 0.5 M NaCl followed by washing with PBS 2 times.
  • Radioactivity in these washing solutions was counted as nonspecifically bound 1 2 ->I- angiogenin.
  • the cells were then solubilized with 62.5 mM Tris-HCl, pH 6.8, containing 3% SDS and 5% 2-mercaptoethanol.
  • the radioactivity in the cell solubilizate was counted as the bound l ⁇ I-angiogenin.
  • the left panel of figure 3 the curve of concentration dependency of l ⁇ I-angiogenin binding to HUVE cells. Scatchard analysis (Fig.3, right panel) of the binding data showed that ⁇ 2 ⁇ I-angiogenin binds to HUVE cells with an apparent K j of 5.9 nM.
  • Angiogenin undergoes nuclear translocation in endothelial cells and this process of nuclear translocation is necessary for its angiogenic activity (Moroianu and Riordan, 1994, Proc. Natl. Acad. Sci. USA, supra; Moroianu and Riordan, 1994, Biochem. Biophys. Res. Commun., supra).
  • the correlation of nuclear translocation of angiogenin and the expression of the 170 kDa angiogenin receptor was established in the following manner.
  • HUVE cells at densities between 5xl0 3 and 2x10 4 cells/cm 2 , were cultured in HE-SFM in the presence of 20 ng/ml bFGF at 37 °C for 24 hr under 5% of humidified CO2- The medium was aspirated and the cells were washed twice with prewarmed (37 °C) HE-SFM. * 2 ->I-angiogenin was added to the cells at a final concentration of 0.2 ⁇ g/ml in HE-SFM and incubated at 37 °C for 30 min.
  • the medium was removed and the cells were washed three times with PBS followed by washing 3 times with 10 mM phosphate, pH 3.0, containing 150 mM NaCl.
  • the cells were then lysed with 10 mM HEPES, pH 7.5, containing 0.5%) Triton X-100 and 1 x complete protease inhibitor cocktail mixture.
  • the lysates were collected and the nuclei monolayers were washed with PBS three times and collected by solubilizing in 62.5 mM Tris-HCl, pH 6.8, containing 3% SDS and 5% 2-mercaptoethanol.
  • the radioactivity in each subcellular fraction was counted with a Gamma counter.
  • Table 7 shows the effect of pretreatment of anti-angiogenin monoclonal antibody on 3 H-thymidine incorporation in HUVE cells stimulated by angiogenin.
  • the effect of the endogenous angiogenin secreted by the cells was neutralized by incubating the cells with 60 ⁇ g/ml of 26-2F for 6 hr.
  • Cells were washed 3 times with HE-SFM and stimulated with 1 ⁇ g/ml angiogenin in HE-SFM containing 1 ⁇ Ci/ml 3 H-thymidine for 18 hr.
  • Incorporation of 3 H-thymidine in TCA-insoluble materials were determined as described in Example IV.
  • results showed that pretreatment of the cells with anti-angiogenin antibody enhances the response of HUVE cells to exogenous angiogenin in 3 H-thymidine incorporation assay. Without pretreatment, 1 ⁇ g/ml of angiogenin stimulated a 39% increase of H-thymidine incorporation. However, after the pretreatment of 26-2F, the same concentration of angiogenin stimulated a 74% increase of H-thymidine incorporation.
  • FBS fetal bovine serum
  • HUVE cells were cultured under angiogenin-responsive conditions as described and their surface molecules were biotinylated and enriched by affinity chromatography on monomeric Avidin-Sepharose. After successive adsorption by DNase I-Sepharose and RNase A-Sepharose to remove actin and other nonspecific binding proteins, the biotinylated angiogenin receptor was purified by affinity chromatography on an angiogenin-Sepharose column. The final product was analyzed by SDS-PAGE and detected with Streptavidin-alkaline phosphatase after transfer to a Biodyne B nylon membrane.
  • HUVE cells at passage 5, were plated at 5x10 3 cells/cm 2 in a T162 flask and cultured in HE-SFM + 10% FBS + 20 ng/ml bFGF at 37 °C for 24 hr. The culture medium was removed and the cells were washed once with prewarmed HE-SFM and incubated in HE-SFM for another 18 hr. The cells were cooled at 4 ⁇ C for 10 min, washed 3 times with cold PBS and biotinylated by incubating with 15 ml of 0.5 mg/ml Sulfo-NHS-Biotin in PBS at 4 "C for 30 min with gentle shaking.
  • Biotinylated membrane molecules were solubilized with 0.5% Triton X-100 in 0.1 M phosphate buffer, pH 7.2, containing lx complete protease inhibitor cocktail at 4 "C for 30 min. The solubilizates were centrifuged to remove cell debris and subjected to chromatography on a monomeric Avidin-Sepharose column. Biotinylated molecules were eluted from the column by 0.1 M biotin in 0.1 M phosphate buffer, pH 7.2, and were successively adsorbed by DNase I- Sepharose and RNase A-Sepharose.
  • the flowthrough fraction was then applied to an angiogenin-Sepharose column and washed with 5 volumes of H2O.
  • the bound materials were eluted from the column with 0.1 % trifluoroacetic acid, lyophilized, and analyzed by SDS-PAGE and western blotting with alkaline phosphatase labeled Streptavidin.
  • a single band of approximately 170 kDa was observed, consistent with the molecular weight estimation from the crosslinking experiments.
  • Approximately 10 ng protein was obtained from cells grown in a single T162 flask.
  • a partial amino acid sequence of a 55 kDa fragment of the angiogenin receptor was obtained in the following manner.
  • a 55 kDa fragment was also isolated from HUVE cells by methods described in Example XIV.
  • the 55 kDa fragment was separated from the 170 kDa protein by SDS/PAGE and the products were visualized by Coomasssie Blue staining. After destaining with 10% ethanol and 7.5% acetic acid, a gel slice containing the 55 kDa fragment was cut and transferred to an Eppendorf tube.
  • the gel slice was washed with water three times over a period of 3 hr, and the peptide was extracted with 150 ⁇ l of 0.1 M sodium acetate, pH 8.5, containing 0.1% SDS at 37 C for 14 hr. After centrifugation to remove the gel debris, the extract was applied directly to a Millipore Prosequencer membrane for amino acid sequence analysis (Laursen et al., 1989, Methods in Protein Sequence Analysis (Wittman-Leibold B., ed.), Springer- Verlag, Berlin, pp 61-68). Water soluble carbodiimide was used for covalent attachment of the sample to an aryl amine PVDF membrane disc.
  • the amino acid assignment for the first 15 residues was Tyr-Ala- Ile-Arg-Ala-Ser-Asn-Ile-Glu-Lys-Pro-Leu-Gly-Tyr-Phe (SEQ ID No. 1).
  • a search for identities with the Protein Identification Resource at the National Center for Biotechnology Information revealed 73% identity with residues 1340-1354 of ROS 1 transmembrane tyrosine kinase (Birchmeier et al., 1990, Proc. Natl. Acad. Sci. USA 87: 4799-4803).
  • the 170 kDa receptor was obtained in the following manner.
  • the 170 kDa protein was isolated by methods described in Example XIV and peptides were produced by Endoproteinase Glu-C digestion in 50 mM ammonium acetate, pH 4.0, at room temperature for 5 min.
  • the peptides were separated by reversed-phase HPLC on a Delta-Pak C j g column (Waters Corp.). A single seemingly well-resolved peak was selected for amino acid sequence analysis (Laursen et al., 1989, supra).
  • the amino acid assignment for the first 20 residues was Lys-Gly-Val-Thr-Val- Leu-Ile-Val-Asn-Gln-Gln-Glu-Phe-Xaa-Arg-Ala-Leu-Ala-Ala-Phe (SEQ ID No. 2).
  • a search for identity revealed 55% identity with residues 1894-1915 with a gap of 2 residues at positions 1908 and 1909 of ROS 1 transmembrane tyrosine kinase (Birchmeier et al., 1990, supra).
  • a cDNA library of HUVE cells was constructed in the following manner. HUVE cells were cultured at a cell density of 5 x lOVcm 2 , in HE-SFM containing 10% FBS and 20 ng/ml of bFGF at 37 °C under 5% CO 2 for 24 hr. The cells were washed 3 times with prewarmed HE-SFM and serum-starved in HE-SFM for another 24 hr. Cell culture medium was removed and the cells were washed once with PBS and collected by scraping with a rubber cell scraper. Experiments described in examples IX and X have demonstrated that the 170 kDa angiogenin receptor was expressed maximally under these conditions.
  • mRNA from 4.7 x 10 7 HUVE cells was extracted with a Poly A Tract System 1000 Kit from Promega Corp. (Chirgwin et al., 1979, Biochemistry 18: 5294-5299). A total of 23 ⁇ g mRNA was obtained and 2 ⁇ g of which was used for cDNA synthesis with the Universal Riboclone cDNA synthesis system from Promega Corp., which is based on the methods of Okayama and Berg (Okayama and Berg, 1982, Mol. Cell Biol. 2: 161- 170) with modifications by Gubler and Hoffman (Gubler and Hoffman, 1983, Gene 25, 263-269).
  • First strand synthesis was achieved by Avian Myeloblastosis Virus reverse transcriptase and an oligo (dT) primer, followed directly by second strand replacement synthesis with RNase H and DNA polymerase I.
  • the double-stranded cDNA were flushed at both ends by T 4 DNA polymerase, fractionated to remove small ( ⁇ 500 bp) fragments, and ligated with an EcoR I adaptor at both ends.
  • a total of 300 ng of cDNA was obtained.
  • a cDNA library was constructed by inserting the synthesized cDNA into the EcoR I site of ⁇ gt 1 1 vector (Watson and Jackson, 1985, DNA Cloning, Vol 1 (ed. Glove DM): IL, Oxford, 79-88).
  • the EcoR I site on ⁇ gt 11 is located within the Lac Z gene, upstream from the ⁇ -galactosidase translation termination codon. Because insertion disrupted the Lac Z gene, recombinant phages were identified as colorless plaques in E. Coli. Strain Y1090 in the presence of X-gal and IPTG.
  • the cDNA library prepared as described above had a titer of 3.8 x 10 7 pfu/ml.
  • Oligonucleotide probes to be used for screening the cDNA encoding the 170 kDa angiogenin receptor was obtained in the following manner. Since SEQ ID No. 1 and No. 2 showed 73 and 55% identity, respectively, with residues 1340-1354 and 1894-1915 of ROS 1 transmembrane tyrosine kinase (Birchemeier et al., 1990 supra), and the SEQ ID No. 3 is not homologous to any known sequences. The following strategy was used to obtain the cDNA for angiogenin receptor. The cDNA library of HUVE cells was first screened with a ROS 1 cDNA probe.
  • Clones that are positive to ROS 1 were then screened with an oligonucleotide probe that was designed based on the SEQ ID No. 3. Clones that are positive both to ROS 1 cDNA and the oligonucleotide probe would be most likely the candidates for angiogenin receptor.
  • the ROS 1 cDNA probe was prepared from a phagemid clone of human avian UR2 sarcoma virus oncogene (v-ros) homolog ROS 1 (ATCC 65238).
  • the plasmid DNA was isolated by using a Wizard Midiprep DNA Isolation System from Promega Corp. (Brinboin, 1983, Meth.
  • Enzymol, 100, 243) and the cDNA insert of 3.62 kb was excised by Not I digestion and purified by agarose gel electrophoresis.
  • the isolated cD ⁇ A insert was labeled radioactively by a Nick Translation Kit from Boehringer Mannheim (Rigby et al., 1977, J. Mol. Biol. 113: 237-251) to give a specific activity of ⁇ 1 x 10 9 cpm/ ⁇ g.
  • the degenerated oligonucleotide probe based on SEQ ID No. 3 was chemically synthesized. Since one amino acid can be encoded by more than one codons, e.g.
  • the synthesized probe has the following sequences: CA(U,C)UGGUA(C,U)CC(A,C,G,U)AA(C,U)UA, which is a mixture of 32 nucleotide.
  • This probe was radioactively labeled at the 5'-end by [ ⁇ 32 P]ATP and T 4 polynucleotide kinase.
  • the 5'-end labeled Oligo probe No. 1 has a specific activity of 4-8 x 10 8 cpm/ ⁇ g.
  • Screening the library for the cDNA encoding the 170 kDa angiogenin receptor was performed in the following manner. Three plates (150 mm), each containing 1 x 10 5 recombinant phages in the top agarose layer, were prepared and incubated at 37 °C for 4 hr until the plaques were pinpoint in size. The plates were then put at 4 °C for 1 hr to harden the agarose. DNAs from the plaques were transformed to NYTRAN butterfly membranes (Schleicher & Schuell) at room temperature for 10 min. Two replicates were prepared from each plate.
  • the membranes were dried at room temperature for 10 min and washed once for 2 min successively with 0.2 M NaOH containing 1.5 M NaCl, 0.4 M Tris-HCl, pH 7.6, containing 0.3 M NaCl and 30 mM sodium citrate, and 30 mM sodium citrate, pH 7.0, containing 0.3 M NaCl.
  • the membranes were baked at 80 °C under vacuum for 2 hr and prehybridized at 68 °C for 3 hr in a buffer system containing 75 mM sodium citrate, pH 7.0, 0.75 M NaCl, 10% dextran sulfate, 0.3% tetrasodium pyrophosphate, 0.1% BSA, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, and 100 ng/ml sonicated salmon sperm DNA.
  • 32 P-labeled ROS 1 cDNA probe was denatured by boiling and snap-cooling on ice and added to the prewarmed hybridization solution to a final concentration of - 1 x 10 6 cpm/ml.
  • the membranes were incubated in this solution at 68 °C overnight with gentle shaking. After hybridization, the membranes were washed at room temperature twice for 5 min in 30 mM sodium citrate, pH 7.0, containing 0.3 M NaCl, followed by washing in 3 mM Sodium citrate, pH 7.0, containing 30 mM NaCl and 0.1 % SDS once for 5 min at room temperature, twice for 15 min at 42 °C and twice at 68 °C for 15 min. Autoradiography identified 10 clones that appeared positive in both replicates. They were selected and screened further with the same probe (ROS 1 cDNA) until all the plaques in the plate gave positive signals.
  • ROS 1 cDNA the same probe
  • the lamda phage DNAs from the 10 clones were prepared with the use of Wizard lamda DNA Isolation Kit from Promega Corp.
  • the insert cDNAs were excised by EcoR I digestion.
  • the size of the inserts from clones 1 to 10 were determined by agarose electrophoresis to be 1.4, 3.5, 0.8, 3.0, 1.5, 0.7, 2.1, 1.7, 2.0, and 3.0 kb, respectively.
  • the membrane was baked at 80 °C for 30 min to fix the DNAs and incubated with 32 P-labeled ROS 1 cDNA (final concentration 5 x 10 5 cpm/ml) in 15 mM phosphate buffer, pH 7.7, containing 10% PEG, 7% SDS, 0.3 M NaCl, and 1.5 mM EDTA at 65 °C overnight.
  • the membrane was washed once at room temperature for 15 min with 30 mM sodium citrate, pH 7.0, containing 0.3 M NaCl and 0.1 % SDS, once at 65 °C for 20 min with 1.5 mM sodium citrate, pH 7.0, containing 30 mM NaCl and 0.1% SDS.
  • Autoradiography revealed that all the insert cDNA hybridized to ROS 1 cDNA, whereas the vector DNA did not.
  • 32 P-labeled Oligo probe No. 1 was used in another Southern blotting experiment to identify the double positive clones. DNAs were transferred to the nylon membrane and fixed as described above. After incubation at 48 °C for 2 hr in a prehybridization solution that is 10 mM phosphate, pH 6.8, containing 3M TMAC (tetramethylammonium chloride), 1 mM EDTA, 0.5% SDS, 0.1% Ficoll, 0.1% Polyvinyl pyrrolidone, 0.1% BSA, and 100 ng/ml denatured salmon testes DNA, the membrane is hybridized with 2 P- labeled Oligo probe No.
  • a prehybridization solution that is 10 mM phosphate, pH 6.8, containing 3M TMAC (tetramethylammonium chloride), 1 mM EDTA, 0.5% SDS, 0.1% Ficoll, 0.1% Polyvinyl pyrrolidone, 0.1% BSA, and 100 ng/ml de
  • the nucleotide sequence of the cDNA insert from clone 8 was determined in the following manner.
  • the lamda DNA from clone 8 was isolated as the template for PCR reaction.
  • Two oligonucleotides that match the sequences flanking the EcoR I insertion site of ⁇ gt 11 genome were synthesized as the forward and reverse primers, respectively.
  • the primers were end-labeled by 32 P with the use of T 4 polynucleotide kinase and [ ⁇ 32 P] ATP and the sequencing reactions were carried out with the use o ⁇ frnol DNA Cycle Sequence System from Promega Corp.
  • Two nucleotide sequences of 544 bp (SEQ ID No. 4) and 395 bp (SEQ ID No. 6), respectively, have been determined and shown as follows.
  • the angiogenin receptor DNA fragment can be amplified and isolated from the deposited clone 8 by PCR technique with two oligonucleotide primers that match the sequence flanking the EcoR I insertion site of lambda gtl l genome.
  • the sequence of these two primers are 5'-d(GGTGGCGACGACTCCTGGAGCCG)-3'and 5*-(TTGACACCAGACCAACTGGTAATG)-3', respectively.
  • AACCTCATCC GTGTCAACGC CACCAAGGCC TACGAGATGG CCCTCAAGAA GTACCATGGC 360

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention a trait à un nouveau récepteur d'angiogénine isolé, exprimé par des cellules endothéliales, ainsi qu'à des fragments de celui-ci, en particulier ceux qui conservent une activité de fixation d'angiogénine. L'invention a également trait à des acides nucléiques, p. ex. des acides nucléiques codant pour le récepteur d'angiogénine, qui peuvent être utilisés comme sondes pour détecter un acide nucléique codant pour le récepteur d'angiogénine, et/ou qui peuvent être utilisés dans des procédés antisens pour inhiber l'expression du récepteur. L'invention concerne également des anticorps présentant une immunoréactivité spécifique aux récepteurs en question et des cellules exprimant le récepteur de façon ectopique, des procédés d'isolation du récepteur ou de ses fragments, des techniques de criblage de médicaments, des procédés thérapeutiques et diagnostiques, et des compositions associées.
PCT/US1998/005176 1997-03-14 1998-03-13 Recepteur d'angiogenine, compositions et procedes associes WO1998040487A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU65603/98A AU6560398A (en) 1997-03-14 1998-03-13 Angiogenin receptor, compositions and methods related thereto

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US4075997P 1997-03-14 1997-03-14
US60/040,759 1997-03-14
US4094597P 1997-03-17 1997-03-17
US60/040,945 1997-03-17

Publications (1)

Publication Number Publication Date
WO1998040487A1 true WO1998040487A1 (fr) 1998-09-17

Family

ID=26717401

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1998/005176 WO1998040487A1 (fr) 1997-03-14 1998-03-13 Recepteur d'angiogenine, compositions et procedes associes

Country Status (2)

Country Link
AU (1) AU6560398A (fr)
WO (1) WO1998040487A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1114860A1 (fr) * 1998-09-18 2001-07-11 Kyowa Hakko Kogyo Co., Ltd. Procede servant a diagnostiquer une maladie a proliferation cellulaire
WO2002025286A2 (fr) * 2000-09-20 2002-03-28 The President And Fellows Of Harvard College Procedes de detection du cancer de la prostate
US6803448B1 (en) 1998-07-22 2004-10-12 Vanderbilt University GBS toxin receptor
US8609614B2 (en) 1998-07-22 2013-12-17 Vanderbilt University GBS toxin receptor compositions and methods of use
US20140370087A1 (en) * 2011-10-06 2014-12-18 Chung-Ang University Industry-Academic Cooperation Foundation Novel use of angiogenin

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
ABE, A. ET AL.: "Primary structure of glycolipid transfer protein from pig brain.", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 265, no. 17, 15 June 1990 (1990-06-15), pages 9634 - 7, XP002072675 *
CHAMOUX, M. ET AL.: "Characterization of angiogenin receptors on bovine brain capillary endothelial cells.", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 176, no. 2, 30 April 1991 (1991-04-30), pages 833 - 9, XP002072676 *
DATABASE EMBL - EMEST10 1 January 1997 (1997-01-01), LIN, B. ET AL.: "Human clone 17N11 mRNA sequence.", XP002072679 *
DATABASE EMBL - EMEST12 29 April 1996 (1996-04-29), MARRA, M. ET AL.: "ma08h05.r1 Soares mouse p3NMF19.5 Mus musculus cDNA clone 303993 5' similar to SW:GLTP_PIG P17403 GLYCOLIPID TRANSFER PROTEIN ;.", XP002072680 *
DATABASE EMBL -EMHUM2 8 July 1996 (1996-07-08), LEVY-LAHAD, E. ET AL.: "HUMAN FAMILIAL aLZHEIMER'S DISEASE (stm2) GENE, COMPLETE CDS.", XP002072776 *
HU, G-F. ET AL.: "A putative angiogenin receptor in angiogenin-responsive human endothelial cells.", PROC.NATL.ACAD.SCI.USA, vol. 94, 18 March 1997 (1997-03-18), pages 2204 - 9, XP002072678 *
LEVY-LAHAD, E. ET AL.: "Genomic structure and expression of STM2, the chromosome familial Alzheier disease gene.", GENOMICS, vol. 34, 1996, pages 198 - 204, XP002072677 *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6803448B1 (en) 1998-07-22 2004-10-12 Vanderbilt University GBS toxin receptor
US7410640B2 (en) 1998-07-22 2008-08-12 Vanderbilt University GBS toxin receptor antibodies
US8609614B2 (en) 1998-07-22 2013-12-17 Vanderbilt University GBS toxin receptor compositions and methods of use
EP1114860A1 (fr) * 1998-09-18 2001-07-11 Kyowa Hakko Kogyo Co., Ltd. Procede servant a diagnostiquer une maladie a proliferation cellulaire
EP1114860A4 (fr) * 1998-09-18 2002-12-18 Kyowa Hakko Kogyo Kk Procede servant a diagnostiquer une maladie a proliferation cellulaire
US6699666B1 (en) 1998-09-18 2004-03-02 Kyowa Hakko Kogyo Co., Ltd. Method for the diagnosis of cell proliferative disease
WO2002025286A2 (fr) * 2000-09-20 2002-03-28 The President And Fellows Of Harvard College Procedes de detection du cancer de la prostate
WO2002025286A3 (fr) * 2000-09-20 2002-08-01 Harvard College Procedes de detection du cancer de la prostate
US20140370087A1 (en) * 2011-10-06 2014-12-18 Chung-Ang University Industry-Academic Cooperation Foundation Novel use of angiogenin
US9855320B2 (en) * 2011-10-06 2018-01-02 Chung-Ang University Industry-Academic Cooperation Foundation Angiogenin for treatment of glaucoma

Also Published As

Publication number Publication date
AU6560398A (en) 1998-09-29

Similar Documents

Publication Publication Date Title
US7223563B2 (en) Fibroblast growth factor (FGF23) nucleic acids
AU743490B2 (en) NTN-2 member of TNF ligand family
US6524799B1 (en) DNA encoding sparc-related proteins
US6451523B1 (en) Detection of a leptin receptor variant and methods for regulating obesity
US6455042B1 (en) Method of treating ulcerative colitis or crohn's disease by administering an antibody toαEβ7 integrin
US20130236889A1 (en) Vascularization Inhibitors
CA2292899A1 (fr) Element ntn-2 de la famille des ligands du tnf
AU2001273323A1 (en) Novel fibroblast growth factor (FGF23) and methods for use
EP1019502A2 (fr) Nouveau recepteur orphelin
US7176180B2 (en) Type 2 cytokine receptor and nucleic acids encoding same
JP2001503984A (ja) Ｒｈｏ―ＧＴＰａｓｅのグアニン交換因子、およびこれをコードする核酸
WO1998040487A1 (fr) Recepteur d'angiogenine, compositions et procedes associes
JP2000502246A (ja) 脊椎動物Ｄｅｌｔｅｘタンパク質、核酸および抗体ならびに関連方法および組成物
CA2316545A1 (fr) Nouvel acide nucleique et nouveau polypeptide
WO1999026980A1 (fr) Reactifs et procedes d'utilisation de proteines de la famille sap, nouveaux regulateurs de transduction de signaux
WO1999007854A2 (fr) Serine/threonine kinase et ses utilisations
US20070128595A1 (en) Novel polynucleotide and polypeptide sequences and uses thereof
WO1999029860A1 (fr) Polypeptides de type cadherine, procedes et compositions associes
US20030119024A1 (en) Genes and proteins associated with T cell activation
JPH10117791A (ja) ヒトｇタンパク質結合受容体ｈｌｙａｚ６１

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: CA

NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 1998539896

Format of ref document f/p: F

122 Ep: pct application non-entry in european phase