WO1998015626A2 - Molecule mutante ciita et ses utilisations - Google Patents

Molecule mutante ciita et ses utilisations Download PDF

Info

Publication number
WO1998015626A2
WO1998015626A2 PCT/GB1997/002751 GB9702751W WO9815626A2 WO 1998015626 A2 WO1998015626 A2 WO 1998015626A2 GB 9702751 W GB9702751 W GB 9702751W WO 9815626 A2 WO9815626 A2 WO 9815626A2
Authority
WO
WIPO (PCT)
Prior art keywords
ciita
polypeptide
human
leu
cells
Prior art date
Application number
PCT/GB1997/002751
Other languages
English (en)
Other versions
WO1998015626A3 (fr
Inventor
John William Fabre
Kenth Tomas Gustafsson
Sheng Yun
Original Assignee
Institute Of Child Health
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB9620940.8A external-priority patent/GB9620940D0/en
Priority claimed from GBGB9705911.7A external-priority patent/GB9705911D0/en
Application filed by Institute Of Child Health filed Critical Institute Of Child Health
Priority to AU45675/97A priority Critical patent/AU4567597A/en
Publication of WO1998015626A2 publication Critical patent/WO1998015626A2/fr
Publication of WO1998015626A3 publication Critical patent/WO1998015626A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4713—Autoimmune diseases, e.g. Insulin-dependent diabetes mellitus, multiple sclerosis, rheumathoid arthritis, systemic lupus erythematosus; Autoantigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies

Definitions

  • MHC Major Histocompatibility Complex
  • CIITA Class II Trans Activator
  • CIITA DNA binding proteins, suggests that it might bind to the proteins in the promoter region (5) .
  • the amino terminus of CIITA has an acidic region, with 30% glutamate or aspartate residues between amino acids 26-137. This is followed by three regions rich in proline, serine and threonine (amino acids 163- 195, 209-237 and 261-322) (5). Transcription activators have been shown to have acidic, proline rich or glutamine rich regions (for review see 12) , and it was therefore suggested that CIITA might consist of an acidic amino terminal activation domain and a carboxy terminal domain for binding to MHC class II region promoter proteins (5) .
  • Steimle et al. (5) and EP-0648364-A disclose the amino acid sequence of a human CIITA, the nucleic acid encoding it and a plasmid comprising the nucleic acid.
  • the nucleic acid and amino acid sequences of human CIITA are set out in Figure 5 of the accompanying drawings and in SEQ.ID.NO.l and SEQ.ID.N0.2, respectively.
  • the present invention is based on the observation that deletion of a region of a DNA sequence encoding an N-terminal portion of a CIITA molecule results in reduced expression of MHC class II antigens.
  • the present invention provides a polypeptide that comprises the amino acid sequence of a class II trans activator (CIITA) protein from the N-terminus of which amino acid residues are absent such that the resulting polypeptide reduces the expression of MHC class II antigens.
  • a polypeptide of the present invention may be referred to herein as a "deletion mutant CIITA polypeptide" .
  • the present invention also provides a nucleic acid molecule that encodes a polypeptide of the present invention.
  • a nucleic acid molecule of the present invention may be referred to herein as a "deletion mutant CIITA nucleic acid”.
  • the deletion polypeptide was expressed from a mutated cDNA which incorporated the first six codons i.e. the start codon and the 5 codons corresponding to amino acids 2 to 6 of native human CIITA at the 5-end of the construct followed by a codon for isoleucine.
  • the native codon for a leucine residue at position 151 was replaced by a codon for isoleucine.
  • the remainder of the construct i.e. from the codon for amino acid 152 to the end of the sequence is an shown in Figure 5.
  • We consider the mutant polypeptide to have the first 151 amino acids deleted.
  • the amino acid sequence of the deletion mutant CIITA polypeptide and the nucleic acid sequence encoding it are set out in Figure 14 and in SEQ.ID.N0S.4 and 3, respectively.
  • Hela cells, in which class II MHC antigen expression is induced by interferon gamma were stably transfected with constructs comprising a cDNA encoding the 151 amino acid deletion mutant polypeptide in the pcDNA3 vector or were transiently transfected with constructs comprising the cDNA encoding the 151 amino acid deletion mutant CIITA polypeptide in the pCEP4 vector.
  • the 151 deletion mutant polypeptide is described in detail in Example.
  • the transfected cells showed a 50-90% suppression of MHC class II antigen induction by interferon gamma as assessed by flow cytometry and a suppression of HLA-DR mRNA expression by RT-PCR.
  • Transient transfection studies using constructs comprising the cDNA encoding the 151 amino acid deletion mutant CIITA polypeptide with the B-cell line DoHH2, which expresses MHC class II antigens constitutively at high levels resulted in an up to 89% reduction of cell surface expression of MHC class II antigens over 5 days, and an almost complete suppression of HLA-DR mRNA synthesis.
  • Transfection with an empty expression vector or with a modified version of the deletion construct having no initiation codon revealed no reduction of MHC class II antigen expression in either cell type.
  • deletion mutant CIITA polypeptide may be either unable to form multimers, or dimers or multimers incorporating a mutant CIITA are functionally compromised. In such circumstances, the suppressive effect of mutated CIITA molecules would be far greater than would be expected from the relative concentrations of the endogenous and mutated forms.
  • deletion of the first 151 amino acids from the N-terminus of a human CIITA molecule results in a polypeptide that reduces the expression of MHC class II antigens.
  • the acidic activator domain is deleted but the proline/serine/threonine rich domains are retained.
  • CIITA polypeptide of the present invention it appears to be preferable to delete all or most of the acidic activator domain from the N-terminus of a CIITA protein. As indicated above, all or most of the transcription activation activity has been ascribed to amino acids 1-125 (13) or 1-114 (14) . It is therefore preferable to delete the amino acids in that region, for example, it may be advantageous to delete at least amino acids 1-114, for example, at least amino acids up to and including amino acid 125. If too little of the acidic activator domain is deleted, transcription activation activity may be retained.
  • proline/serine/threonine rich domains may play a critical role in the conformation of the remainder of the protein and/or they may themselves be directly involved in critical protein/protein interactions. It is therefore preferable that a deletion does not extend into the proline/- serine/threonine rich domain.
  • the first proline/serine/- threonine rich domain appears to start at around amino acid 163 to 166. It is preferable, therefore, that a deletion does not extend to the first amino acid of the first proline/serine/- threonine rich domain, for example, does not extend beyond amino acid 165, for example not beyond amino acid 162. It may be preferable that a deletion does not extend too close to the proline/serine/threonine rich domains, for example it may be preferable that a deletion does not extend beyond about an amino acid 164, for example, not beyond amino acid 160 for example, not beyond amino acid 156.
  • deletion of 151 amino acids from the N-terminus results in a deletion mutant CIITA polypeptide having the ability to reduce expression of MHC class II antigens.
  • more than 151 amino acids or fewer than 151 amino acids may be deleted from the N-terminus, provided the desired activity is retained, that is to say, expression of MHC class II antigens is reduced.
  • the N-terminus the deleted polypeptide may start at amino acid 114 or at any amino acid downstream from amino acid 114 for example, amino acid 125 or downstream thereof, for example, amino acid 135 or downstream thereof, for example, amino acid 140 or downstream thereof.
  • the N-terminus should not extend beyond amino acid 164, for example not beyond amino acid 160, for example not beyond amino acid 156.
  • An N-terminus in the region of from amino acid 140 to 152 may be particularly useful.
  • a non-human CIITA for example, a porcine CIITA
  • an equivalent number of amino acids may be deleted, or a different number may be deleted, provided a reduction in the expression of MHC class II antigens is achieved.
  • the deletion should preferably encompass the acidic activator region but not extend far into, and preferably should not extend into the proline/serine/threonine rich domains.
  • Any candidate deletion mutant CIITA polypeptide or deletion mutant CIITA nucleic acid encoding such a polypeptide may be readily tested for its ability to reduce expression of MHC class II antigen activity, either constitutive expression or induced expression, by any of the methods known in the art, for example, by any of the methods described herein.
  • General examples using inducible expression in Hela cells and constitutive expression in B cells are given above. Detailed protocols are given in the Example below.
  • a CIITA protein may be of any animal origin, for example, a human, porcine, bovine, rodent or baboon CIITA, or may be a variant thereof in which there are substitutions, deletions or additions to the amino acid sequence that do not substantially affect the transcription activation activity of the protein.
  • a deletion mutant CIITA polypeptide of the invention comprises part of the amino acid sequence of a CIITA protein, the amino acid sequence of the deletion mutant CIITA polypeptide will reflect any such substitutions, deletions and additions.
  • a nucleic acid molecule of the present invention is any molecule that encodes a deletion mutant CIITA polypeptide of the present invention. It may be DNA, for example, genomic or preferably cDNA, or may be RNA, for example, mRNA or may have the same nucleic acid sequence as genomic DNA, cDNA or mRNA. Such a molecule may be derived, directly or indirectly, from a naturally occurring sequence that encodes a CIITA or from a degenerate version of such a sequence. It may be derived, directly or indirectly, from an allele of naturally-occurring CIITA sequence or from a sequence that hybridises to a sequence that encodes a CIITA. It may be obtained from natural sources or it may be recombinant or synthetic.
  • Nucleic acid sequences encoding CIITA polypeptides may be obtained from other species by standard methods, for example, as described in Sambrook J, Fritsch EF and Maniatis T, Molecular Cloning: A laboratory manual, Cold Spring Harbor 1989 using primers and/or probes derived from the human sequence. Examples of human-derived PCR primers capable of detecting porcine CIITA cDNA are given in Example 3 herein.
  • the invention accordingly provides nucleic acid that hybridises selectively to a nucleic acid of figure 14 (SEQ. ID.NO.3)
  • the present invention also relates to ribozymes directed at CIITA mRNA.
  • Ribozymes are RNA enzymes that cleave RNA at preferred triplet sequences, for example, NUX for hammerhead ribozymes.
  • the specificity of a ribozyme for any particular RNA is dictated by the sequence of the ribozyme' s antisense regions (usually 7-10 bases at the 3' and the 5' ends), which enable the ribozyme to bind to complementary regions of the target RNA and then to cleave it. Cleavage can disrupt mRNA function, but more importantly it results in rapid mRNA degradation, and thereby diminishes the expression of the protein product.
  • ribozymes including the so-called hammerhead ribozyme. Ribozymes and methods for their production are well known see, for example, Tanner et al (24) , Ellis et al (31) and Larsson et al (32).
  • the present invention provides a ribozyme directed at bases 1159-1161 (GUA) of human CIITA mRNA.
  • the ribozyme is, for example, a hammerhead ribozyme.
  • the antisense arms of the ribozyme are TGTTGGA at the 5* end and ACGTGTC at the 3 ' end.
  • the present invention also provides a ribozyme targeted at a non-human CIITA mRNA.
  • the target base sequence may be at the position in that mRNA equivalent to bases 1159-1161 (GUA) of human CIITA mRNA or at another sequence.
  • the human ribozyme of the invention markedly suppresses induced MHC class II expression in transfected human cells, in contrast to ribozymes directed against other human CIITA sequences.
  • MHC class II antigen molecules are of fundamental importance in graft rejection processes and also in autoimmune diseases. Some cells, for example, interstitial dendritic cells, express MHC class II antigens constitutively, whereas others are susceptible to MHC class II antigen induction following lymphokine stimulation.
  • MHC Class II molecules may play a crucial role in allotransplantation as activators of recipient CD4+ T cells via the direct pathway, i.e., T cell recognition of intact donor MHC class II molecules on donor antigen presenting cells (APC) .
  • Donor MHC class II molecules may also contribute to the pool of allogeneic donor peptides for activation of recipient CD4+ T cells via the indirect pathway, i.e., T cell recognition of donor peptides presented by recipient APC (for review see ref . ) .
  • xenogeneic MHC class II molecules might play a crucial role in xenograft rejection by activation of the recipient's direct T cell recognition pathway.
  • Direct T cell recognition is weak or absent in some species combinations, presumably as a consequence of physiological incompatibilities for vital co-receptor, costimulator, adhesion or cytokine interactions (e.g. reference 2 ) . It had been hoped that such incompatibilities would reduce or abolish the strength of direct T cell recognition responses in clinical xenotransplantation. However, the accessory interactions for direct T cell recognition by human T cells of porcine APCs are largely intact 3.
  • interstitial dendritic cells the migratory leucocytes known as interstitial dendritic cells and MHC class II positive VEC 29-'.
  • VECs are present for the life time of the graft.
  • MHC class II positive VECs of allografted organs represent a strong, constant stimulus for direct T cell allorecognition in clinical transplantation, and that the suppression of MHC class II expression on VECs in allografted organs might markedly reduce the strength of rejection response, in particular chronic rejection responses 32.
  • VECs MHC class II positive porcine vascular endothelial cells
  • VECs are permanent components of grafts, and because both the pig 6 and human7 express MHC class II antigens on their VECs, this species difference in CD86 expression is likely to result in greater long-term immunogenicity of porcine xenografts as compared to allografts in the clinical situation. We therefore consider that class II molecules therefore potentially represent important targets for immune regulation.
  • deletion mutant CIITA polypeptides and ribozymes of the present invention strongly suppress the expression of polymorphic MHC class II antigen molecules. Accordingly, the expression of a deletion mutant CIITA polypeptide or of a ribozyme of the invention in the vascular endothelium or other cells of transplanted tissues and organs will markedly suppress rejection reponses, whether in human-to-human allografts or in xenografts, for example, pig-to-human xenografts.
  • the present invention accordingly enables the production of transgenic animals having reduced expression of MHC class II antigens.
  • Such animals may be used as a source of organs or tissue for xenogenic transplantation and/or of cells, for example, for universal cell transplants.
  • Pigs are particularly useful as donor animals for xenografts but other animals are also used as donors for cells, tissues and organs, for example, foetal calf cells and baboon bone marrow cells are useful in transplantation.
  • Other animals, for example, rodents may be also be used as donor animals.
  • the present invention accordingly provides a transgenic animal, for example, a transgenic pig, at least some of the cells of which comprise a stably incorporated, functional DNA sequence that encodes a polypeptide that comprises the amino acid sequence of a class II trans activator (CIITA) protein from the
  • the invention also includes progeny of such a transgenic animal.
  • the present invention further provides a method for producing a transgenic animal of the invention, which comprises stably incorporating a functional DNA sequence that encodes a polypeptide that comprises the amino acid sequence of a class
  • CIITA trans activator
  • the nucleic acid should generally encode a CIITA polypeptide of the same species as the host animal.
  • the nucleic acid sequence should generally encode a porcine CIITA polypeptide.
  • the deletion mutant CIITA polypeptide appears to be effective across species, for example, human deletion mutant CIITA is effective in the pig.
  • a nucleic acid may encode a deletion mutant CIITA polypeptide of the same species or of a different species.
  • a ribozyme of the present invention is unlikely to be effective in a different species because of species differences in the target site.
  • the target base sequence in the mRNA of a different species may be at the position in that mRNA equivalent to bases 1159-1161 (GUA) of human CIITA mRNA, or it may be at a different site.
  • MHC class II antigen expression may be suppressed globally according to the present invention, but the resulting immune deficiency in a potential doner animal is generally undesirable. It is therefore advantageous to incorporate the nucleic acid sequence under the control of a tissue-specific promoter in order to down-regulate MHC class II antigen production in a specific tissue only. It is particularly advantageous to suppress MHC-II expression on the vascular endothelial cells of a xenograft. Accordingly, a vascular endothelial cell-specific promoter is preferably used in a transgenic animal. Alternatively, there may be used a promoter specific for the organ to be transplanted, for example, a cardiac-specific promoter may be used for a heart or heart valve xenograft.
  • Tissue-specific and organ-specific promoters are well known.
  • An example of a vascular endothelial cell-specific promoter is the ICAM-2 promoter, see Kowan et al (33) for the human promoter and Xu et all (34) for the mouse ICAM-2 promoter.
  • the ICAM-2 promoter region from one species, for example, the human or mouse ICAM-2 promoter region may be used as such or may be modified for use in another species, for example, a pig.
  • An example of a modified mouse ICAM-2 promoter suitable for use in a pig may be prepared by PCR using, the mouse sequence -676 to -645 as the 5 'primer and the mouse sequence -44 to -74 as the 3' primer.
  • the present invention also provides a cell, tissue or organ that comprises a stably incorporated DNA molecule that encodes a polypeptide that comprises the amino acid sequence of a class II trans activator (CIITA) protein from the N-terminus of which amino acid residues are missing such that the resulting polypeptide reduces the expression of MHC class II antigens, or that encodes a ribozyme of the present invention.
  • CIITA class II trans activator
  • Such a transgenic cell, tissue or organ may have been obtained from a transgenic animal of the present invention or may have been produced directly by the stable introduction of a nucleic acid molecule of the present invention that is to say, a nucleic acid molecule that encodes a polypeptide that comprises the amino acid sequence of a class II trans activator (CIITA) protein from the N-terminus of which amino acid residues are missing such that the resulting polypeptide reduces the expression of MHC class II antigens, or that encodes a ribozyme of the present invention.
  • CIITA class II trans activator
  • a transgenic cell of the present invention is especially in the form of a cell line that can be maintained in vitro.
  • a cell or cell line of the invention is especially a cell or cell line suitable for use in transplantation.
  • a transgenic tissue or organ for example skin, may be in a form that can be grown or maintained in vitro.
  • transgenic pigs that express human complement receptors have been produced (23) . It is particularly advantageous to produce double transgenic pigs that express both human complement receptors and a deletion mutant CIITA polypeptide of the present invention.
  • the present invention provides a transgenic animal, for example, a transgenic pig, at least some of the cells of which comprise a stably incorporated, functional DNA sequence that encodes a polypeptide that comprises the amino acid sequence of a class II trans activator (CIITA) protein from the N-terminus of which amino acid residues are absent such that the resulting polypeptide reduces the expression of MHC class II antigens, or that encodes a ribozyme of the present invention, and at least some of the cells of which, for example, the same cells, comprise a stably incorporated functional DNA sequence that encodes a human complement receptor.
  • CIITA class II trans activator
  • Double transgenic pigs involving a human regulator of complement (to prevent hyperacute rejection) and a mutated human CIITA construct of the present invention preferably under the control of a constitutive VEC specific promoter (to suppress direct T cell xenorecognition) , will provide an important advance in the development of porcine xenografts for clinical transplantation.
  • the present invention also comprises such double transgenic cells, organs and tissues, and methods for the production of such cells, organs, tissues and animals.
  • the DNA sequence encoding a human complement receptor may be introduced independently of the DNA sequence encoding a deletion mutant CIITA polypeptide of the present invention, or both may be introduced together.
  • the method described 23 or in reference 37 may be used for introduction of DNA sequence of present invention and/or for the introduction of the DNA sequence encoding the human complement receptor.
  • a DNA construct or vector may comprise both DNA sequences, generally arranged such that each polypeptide is expressed separately rather than as a fusion protein.
  • a polypeptide or ribozyme of the present invention may be expressed in vivo in an animal.
  • a polypeptide or ribozyme of the present invention may be expressed by a prokaryotic or eukaryotic host cell in vitro.
  • the polypeptide may then be isolated and purified for use, for example, in a pharmaceutical composition.
  • the present invention provides a pharmaceutical composition that comprises a deletion mutant CIITA polypeptide of the present invention or a nucleic acid encoding a deletion mutant CIITA polypeptide of the present invention, in admixture or conjunction with a pharmaceutically suitable carrier.
  • the invention also provides a pharmaceutical composition that comprises a ribozyme of the present invention or a nucleic acid encoding a ribozyme of the present invention, in admixture or conjunction with a pharmaceutically suitable carrier.
  • the present invention accordingly provides a construct that comprises a nucleic acid molecule of the present invention suitable for incorporation in a vector or suitable for direct insertion into a host cell .
  • the present invention also provides a vector, especially an expression vector, that comprises a nucleic acid of the present invention operably linked to appropriate control sequence (s) .
  • the vector may be suitable for incorporation into a prokaryotic or eucaryotic host for expression of the polypeptide or ribozyme in vitro.
  • the vector may be suitable for incorporation into a host cell, tissue, organ or animal for - 11
  • tissue-specific promoter especially a vascular endothelial cell- specific promoter may be present.
  • Vectors, host cells and methods for the production of constructs, vectors and transformed host cells are well known in the art, see for example, Sambrook J. Fritsch EF and Maniatis T, Molecular Cloning: A laboratory manual, Cold Spring Harbor 1989. Methods for introducing DNA into animals to produce functional transgenic animals, including DNA constructs and vectors for the stable incorporation of DNA sequences into cells for use in the production of transgenic animals are also well known, see for example, Hogan B, Constantini F, Lacy E, Manipulating the mouse embryo: A laboratory manual, Cold Spring Harbor 1986. methods for producing transgenic pigs are described in McCurry et al. and in Logan & Martin . The standard pronuclear microinjection technique, described for mice by Hogan et al . may be used successfully in pigs ? ⁇ 3- , '-3"7.
  • NLS nuclear localisation signal
  • the present invention provides the use of a nucleic acid molecule of the present invention in the production of a transgenic cell, tissue, organ or animal.
  • the present invention further provides a nucleic acid of the present invention for use in the manufacture of a construct or vector for use in the production of a transgenic cell, tissue, organ or animal.
  • the nucleic acid may encode a CIITA polypeptide from the same species to which it will be introduced, or it may be from a different species, for example, a construct for use in the production of a transgenic pig may comprise nucleic acid encoding a human deletion mutant CIITA polypeptide or encoding a porcine deletion mutant CIITA polypeptide.
  • CIITA has recently been shown to play a role in upregulating the expression of HLA class I heavy chain genes, but not the other genes involved in the cell surface expression of MHC class I molecules (eg. ⁇ 2 microglobulin, TAP, LMP) 35 ' .
  • MHC class I molecules eg. ⁇ 2 microglobulin, TAP, LMP
  • suppression of CIITA did not influence porcine MHC class I expression.
  • CIITA independent expression of HLA-DQ has been demonstrated m EBV transformed B cells 13 , we did not see a differential effect on SLA-DR or SLA-DQ in our studies.
  • MHC class II antigens are also implicated in autoimmune disease.
  • the down-regulation of MHC class II antigen expression is therefore useful in the treatment of autoimmune disease as well as in the production of transgenic material for xenografts.
  • the present invention provides a method of reducing the expression of MHC class II antigens in a human or non-human animal, which comprises administering to the human or other animal an effective amount of a polypeptide or ribozyme of the present invention.
  • the present invention also provides a pharmaceutical composition which comprises a deletion mutant CIITA polypeptide or ribozyme of the present invention of admixture or conjunction with a suitable carrier.
  • the human or other animal to be treated may have an autoimmune disease.
  • a non-human animal to be treated may be intended for use as a xenograft donor.
  • a nucleic acid molecule of the present invention encoding either a mutant CIITA polypeptide or a ribozyme of the invention may be used in gene therapy for reducing the expression of MHC class II antigens, for example, in the treatment of an autoimmune disease in a human or in a non-human animal.
  • Administration of an appropriate amount of the nucleic acid to a subject will result in reduction of the expression of MHC class II antibodies and hence a reduction in the undesirable immune response.
  • the nucleic acid may be administered in a targeted manner such that local immune response suppression is achieved.
  • local immune response suppression For example, in the case of arthritis, it may be useful to suppress the immune response in a selected joint, for example, a knee wrist or neck joint.
  • tissue-specific promoters may also be advantageous, for example, it may be appropriate to use an insulin-specific promoter in the treatment of diabetes.
  • Suitable methods for administering nucleic acids for gene therapy are known, as are suitable constructs and vectors. Such a method of gene therapy is part of the present invention.
  • the present invention also provides a pharmaceutical composition which comprises a nucleic acid molecule of the present invention in a suitable form for use in gene therapy.
  • the present invention further provides the use of a nucleic acid molecule of the present invention in the reduction of the expression of MHC class II antigens, for example, in the treatment of an autoimmune disease.
  • the present invention also provides a nucleic acid molecule of the present invention for use in the manufacture of a medicament for use in gene therapy, for example, in the treatment of an autoimmune disease, or for use on the production of a transgenic animal.
  • the present invention further provides the use of a deletion mutant CIITA polypeptide or a ribozyme of the present invention in the reduction of the expression of MHC class II antigens, for example, in the treatment of an autoimmune disease.
  • the present invention further provides an antibody to a polypeptide of the present invention, either polyclonal or monoclonal .
  • the present invention further provides a method of animal-to- human transplantation, wherein the transplanted material, for example, cells, tissue or organ, is derived from a transgenic animal of the present invention.
  • the transplanted material for example, cells, tissue or organ
  • a deletion mutant CIITA polypeptide of the present invention appears to function across species. Accordingly, for any of the embodiments of the present invention the deletion mutant CIITA polypeptide as such or as encoded by a nucleic acid may be of the same species as the intended recipient or may be of another species.
  • the pcDNA3mutCIITA2 construct was made by inserting a subclone from the original full-length cDNA, between a NotI site at position 1340 and a Xhol site at position 4543, followed by the insertion of a PCR product incorporating an introduced EcoRV site at position 567 and the NotI site at position 1340. This is a control construct, without an initiation codon, and would not yield CIITA protein.
  • the pcDNA3mutCIITA3 and pcDNA3mutCIITA4 constructs were made by inserting synthetic double stranded oligonucleotides between the EcoRI and EcoRV sites.
  • ATG means initiation codon
  • NLS means Nuclear Localisation signal.
  • the pCEP4mutCIITA2 was made by subcloning the fragment from EcoRI to Xhol from pcDNA3mutCIITA2 into pCEP4. Similarly, pCEP4mutCIITA3 and pCEP4mutCIITA4 were made by transferring the EcoRI/Xhol fragment from pcDNA3mutCIITA3 and pcDNA3mutCIITA4 respectively.
  • the Hela and DoHH2 cell lines were studied by RT-PCR (A) and flow cytometry (B) before and 24 hours after interferon gamma treatment.
  • the cells used for the RT-PCR studies in A were from the same cultures used for flow cytometry studies in B.
  • A Hela cells before (lane 1) and after (lane 2) interferon gamma treatment and DoHH2 cells before (lane 3) and after (lane 3) interferon gamma treatment (lane 4) .
  • B Blow cytometry profiles with the irrelevant antibody true are given for Hela cells in panel 2 and for DoHH2 cells in panel 3.
  • Fig. 3 Suppression of class II induction in Hela cells
  • Hela cell clones stably transfected with the pcDNA3mutCIITA2 (clone 1) , pcDNA3mutCIITA3 (clone 2) and pcDNA3mutCIITA4 (clone 3) Hela cell cultures transiently transfected with pCEP4CIITA2 (culture 1) and pCEP43mutCIITA4 (culture 2) were studied by RT-PCR (A) and flow cytometry (B) .
  • the cells used for the RT-PCR studies in A were from the same cultures used for flow cytometry studies in B.
  • the DoHH2 B lymphoblastoid cell line was transiently transfected with empty pcDNA3 vector (1), pcDNA3mutCIITA2 containing a non-functional CIITA gene (2) , pcDNA3mutCIITA3 (3) and pcDNA3mutCIITA4 (4.)
  • RT-PCR A
  • flow cytometry studies B
  • the cells used for the RT-PCR studies were from the same cultures used for flow cytometry.
  • the cultures as indicated were stained for class II MHC antigens.
  • the profile for the control antibody naked is given for cells transfected with the empty pcDNA3 vector shown. Profiles for class I expression were the same for all cultures (not shown) .
  • the ATP/GTP binding cassette is double underlined.
  • the sequences and their description are taken from Steimle V, Otten
  • Figure 6 Suppression of induced class II express ion in ECV-304 cells by a ribozyme A.
  • Class II antigen synthesis was induced in ECV-304 by human interferon gamma using 500 and 1,000 unites.
  • Flow cytometry was carried out 24,48 and 72 hours after the interferon treatment. In the legend to the Figure 24, 48 and 72 denotes the number of hours.
  • 500U and 1000U respectively denote 500 and 1000 units of human interferon gamma.
  • ECV-304 cells were transfected with the pcDNA3 VECTOR CONTAINING THE GUA ribozyme under the control of the CMV promoter. The transfected cells were treated with interferon and flow cytometry was carried out as in A.
  • Figure 7 Suppression of induced class II expression in ECV-304 cells by a ribozyme
  • MHC class II expression is shown 72 hours after stimulating non-transfected ECV-40 cells (ECV stimulated with gIFN) and ribozyme-transfected ECV-40 cells (ECV+rzn+glFN) with 1000 units of human interferon gamma. Expression in untreated cells is also shown (ECV untreated) .
  • FIG. 8 Human CIITA constructs
  • the full length construct in pcDNA3 is illustrated in (a) .
  • the control mutCIITA2 construct, lacking an initiation codon, is illustrated in (b) .
  • the mutCIITA3 and mutCIITA4 constructs, containing synthetic oligonucleotides to support translation of the mRNA (by the ATG initiation codon) and translocation of the protein to the nucleus (by the nuclear localisation signal of the large T antigen of SV40) are illustrated in (c) .
  • the PIEC cell line was transfected with the full length human CIITA construct and studied by flow cytometry (A) and RT-PCR (B) .
  • the cultures used for the RT-PCR studies in (B) were the same cultures used for the flow cytometry studies in A.
  • A normal PIEC (upper panel) ; PIEC transiently transfected with full length human CIITA (middle panel) ; a representative PIEC clone stably transfected with full length human CIITA (lower panel) .
  • the transiently transfected culture was placed in selective medium at day 2, and examined at day 7.
  • the antibodies used were: control IgGi ( ⁇ .) , SLA-DR (grey) , SLA-DQ
  • the porcine endothelial cell line (PIEC) and the porcine B cell line L23 were studied by flow cytometry (A) and RT-PCR (B) .
  • the cultures used for the flow cytometry studies in A were the same as those used for the RT-PCR studies in B.
  • A PIEC cells before (upper panel) and 72 hours after (middle panel) treatment with recombinant porcine interferon gamma.
  • Normal L23 cells are shown in the lower panel.
  • the antibodies used were: control IgG ⁇ _ strict, SLA-DR (grey), SLA-DQ ( ) , SLA class Iêt • « seemingly ) .
  • B lanes 1, 2 and 3 represent the normal PIEC, the interferon gamma treated PIEC, and normal L23 cells respectively. 50ng of mRNA from each culture was used for the RT-PCR studies.
  • PIEC clones stably transfected with empty vector (clone 1) , control pcDNA3mutCIITA2 (clone 2) , pcDNA3mutCIITA3 (clone 3) and pcDNA3mutCIITA4 (clone 4) were studied by flow cytometry (A) and semi-quantitative RT-PCR (B) .
  • the cells used for the RT-PCR and flow cytometry studies came from the same cultures. All cultures had been exposed to recombinant porcine interferon gamma for 72 hours.
  • A The cells were analysed for SLA-DR (left hand column) , SLA-DQ (middle column) and SLA class I (right hand column) .
  • the antibodies used were: control IgGi (....), SLA-DR (grey), SLA-DQ (
  • Lane 1 corresponds to clone 1, and so on for the other lanes.
  • the L23 cell line was transiently transfected with empty pcDNA3 vector (culture 1) , pcDNA3mutCIITA2 (culture 2) , pcDNA3mutCIITA3 (culture 3) and pcDNA3mutCIITA4 (culture 4).
  • Human CD4+ T cells were incubated for 4-6 days with normal porcine PIEC cells or PIEC cells which had previously been treated for 3 days with rpoIFN ⁇ , as indicated. To check APC depletion, unfractionated PBL and CD4+ T cells were incubated with 5 ⁇ g/ml of PHA and harvested 3 days later. H thymidine was added for the last 18 hours of culture. The values represent means + SEM of triplicate values.
  • the nucleic acid sequence encoding the 151 deletion mutant described in Example 1 and the deduced amino acid sequence are set out.
  • the nucleic acid sequence forms SEQ.ID.N0.3 and the amino acid sequence forms SEQ.ID.N0.4.
  • the Hela cell line was maintained in DMEM and the DoHH2 human B lympho a cell line in RPMI 1640 (both media from Gibco BRL, Paisley, UK) . In each case the medium was supplemented with 10% foetal calf serum (FCS) , 2mM glutamine, 100 units/ml penicillin and 100 ⁇ g/ml streptomycin. For passaging and all other manipulations, the Hela cells were recovered by scraping. All cultures were at 37 C in 95% air/5% CO2.
  • FCS foetal calf serum
  • RT PCR reverse transcriptase-polymerase chain reaction
  • the 16-27-12 (previously called NFKI) mouse IgGl monoclonal antibody to HLA-DR was the kind gift of Dr S Fuggle (Oxford) (21)
  • the W6/32 mouse IgGl monoclonal antibody to human class I MHC antigens was the kind gift of Professor AF Williams (Oxford) (22)
  • the control F16-4-4 mouse IgGl monoclonal antibody to rat class I MHC antigens has previously been described in detail (23) .
  • the percentage suppression of MHC class II expression was calculated on the basis of the mean channel of fluorescence for class II of the test cells, standardised to the profile of the test cells with the negative control antibody as the zero point.
  • the mean channel of fluorescence of interferon gamma treated normal cells was taken as 100%.
  • the mean channels of fluorescence with the control antibody and the antibody to HLA-DR were 2.6 and 4.9 respectively.
  • the corresponding figures for the control Hela clone were 2.7 and 88.1.
  • the percentage suppression was calculated as
  • pcDNA3mutCIITA2 (Fig. 1A) This was constructed in 2 steps. First, the pcDNA3 CIITA construct was cut with NotI and Xhol, and the resulting fragment (representing position 1340 to the 3' end of the CIITA) was subcloned into NotI and Xhol sites of pcDNA3. Next, PCR was used to synthesise the fragment from amino acid 152 to the NotI site. The upstream primer,
  • 5 'ACTCGATATCATTCCGGCAGACCTGAAGCAT3 ' SEQ . ID . NO .5 contained an introduced EcoRV site (underlined) at position 567 of the original sequence, while the downstream primer, 5 » GCTCACTGCCCCAGCCCAATA3 ' SEQ . ID. NO .6 was complementary to the CIITA sequence immediately downstream of the NotI site.
  • the amplified product was cut with EcoRV and NotI, purified on Chromaspin+TE-100 column (Clontech Lab, Inc, USA) and inserted at the EcoRV and NotI sites, resulting in pcDNA3mutCIITA2.
  • This pair of oligonucleotides contained (in addition to the ATG initiation codon, the Eco RI site and the blunt end) the nuclear localisation signal (NLS) of the SV40 large T antigen (Lys Lys Lys Arg Arg Lys Val) (19,20). These were ligated into pcDNA3mutCIITA2 at the EcoRI and EcoRV sites, resulting in pcDNA3mutCIITA4.
  • NLS nuclear localisation signal
  • pCEP4 vectors (Fig. 1C) The pcDNA3mutCIITA 2,3 and 4 vectors were cut by EcoRI, treated with Klenow large fragment DNA polymerase to create blunt ends, and subsequently cut with Xhol. These fragments were purified using QiaexII Gel Extraction (Qiagen, Germany) and cloned into the expression vector pCEP4 in the PvuII and Xhol sites, to create respectively pCEP4mutCIITA2 , 3 and 4.
  • the pcDNA3mutCIITA 2,3 and 4 constructs were sequenced between the EcoRI and NotI sites, using four oligonucleotide primers.
  • One primer was complementary to the sequence of the pcDNA3 CMV promoter, 5 'ATACGACTCACTATAGG3 ' .
  • SEQ.ID.NO.il The other 3 primers were complementary to the original CIITA cDNA sequence (Steimle et al . , 1993) from positions 819 to
  • Hela and DoHH2 cells were washed twice in 0PT1-MEMI serum-free medium (Gibco BRL, Paisley, UK) , and 1 x 10 6 cells in 0.8ml of OPT1-MEMI were seeded into each well of 6 well tissue culture plates (Falcon or Becton-Dickinson, New Jersey, USA).
  • 0PT1-MEMI serum-free medium Gibco BRL, Paisley, UK
  • OPT1-MEMI OPT1-MEMI
  • the Hela cells were passaged into medium containing 500 ⁇ g/ml G418 (Gibco BRL, Paisley, UK)
  • the medium was changed every 2 days. Colonies were picked after 2-4 weeks in the selective medium, and were maintained in flasks in selective medium.
  • the DoHH2 cells (which grow as a suspension culture) were taken 48 hours after transfection and maintained with 500 ⁇ g/ml of G418 in the medium.
  • RNA was prepared from Hela and DoHH2 cells using an mRNA Purification System (Pharmacia Biotech, Uppsala, Sweden) , and the amount of mRNA recovered was established spectrophotometrically using a GeneQuant (Pharmacia Biotech, Uppsala, Sweden) .
  • Complementary DNA was synthesised using 320ng mRNA and the First-Strand cDNA Synthesis Kit (Pharmacia Biotech, Uppsala, Sweden) according to the manufacturer's instructions.
  • the solution was denatured at 95°C for 5 minutes and different amounts of template (equivalent to 200ng, 50ng, lOng, 2ng and 0.4ng mRNA) were amplified in the presence of primers specific for actin, endogenous CIITA, HLA-DRA and mutated CIITA, as follows:
  • HLA-DRA chain upstream primer: 5 ' CGAGTTCTCTATCTGAATCCTG3 » SEQ. ID. NO.12 (From exon 1) downstream primer: 5 'GTTCTGCTGCATTGCTTTTGC3 ' SEQ. ID. NO.13
  • endogenous CIITA upstream primer: 5 ' ACTCCGGGAGCTGCTGCCCTGGC3 ' SEQ . ID. NO .14 downstream primer: 5 ' CCTGGAAGACATACTGGTCC3 ' SEQ. ID.NO.15 transfected CIITA: upstream primer: 5 ' AATTCTACACAATGCGTTGCCTGGCTCCA
  • downstream primer 5 ' GTTGGGAGGCCGTGGACAGTG
  • actin upstream primer 5 'GGGCATGGGTCAGAAGAATT3 ⁇
  • the upstream primer for the transfected CIITA is from the inserted synthetic oligonucleotide. It therefore cannot recognise endogenous CIITA but is specific for mutCIITA3 and mutCIITA4.
  • the upstream primer for endogenous CIITA is from the regions deleted in all mutant constructs. It therefore cannot recognise the mutated CIITAs, but is specific for endogenous CIITA.
  • pcDNA3mutCIITA2 was constructed in 2 steps, involving first the transfer of a subclone (bases 1340-4543) of the full length cDNA, followed by a PCR product encompassing bases 567-1340 (Fig. la.) Following insertion into pcDNA3 , the PCR product was sequenced between the CEORI and NotI sites, and confirmed to correspond exactly to the published sequence (5) . This construct was used as a control since it lacked an initiation codon and would not give rise to CIITA protein.
  • an oligonucleotide containing an initiation codon, followed by 5 codons corresponding to amino acids 2 to 6 of native CIITA followed by a codon for isoleucine was incorporated at the 5' end of the construct.
  • the native codon for a leucine at position 151 was replaced by a codon for isoleucine.
  • the remainder of the sequence was the same as human native CIITA, including the 3 1 UT sequence.
  • pcDNA3 and pCEP4 All 3 mutated CIITA constructs were placed in the expression vectors pcDNA3 and pCEP4 , in both of which transcription is controlled by the CMV promoter (Fig.lC).
  • the pCEP4 vector has the potential to support episomal growth in human cells, via an EBV origin of replication. Base-line studies
  • RT-PCR experiments demonstrated that neither CIITA nor HLA- DR ⁇ mRNA could be detected in Hela cells prior to stimulation with interferon gamma. However, these were readily detectable within 24 hours of stimulation (Fig.2A, lanes 1 and 2) .
  • the DoHH2 cell line had readily detectable mRNA for both CIITA and HLA-DRA, which was not obviously influenced by exposure to interferon gamma (Fig.2A, lanes 3 and 4).
  • HLA-DR protein was readily detectable by flow cytometry after, but not before, interferon gamma stimulation of Hela cells (Fig.2B, panel 1) .
  • Hela cells strongly express MHC class I molecules, which are further upregulated by interferon gamma (Fig.2B, panel 2) .
  • This provides an excellent control for the class II expression studies.
  • the DoHH2 cell line strongly and constitutively expressed both HLA-DR and class I molecules (Fig.2B, panel 3), and these were not upregulated by interferon gamma (data not shown) .
  • HLA-DRA, CIITA and mutant CIITA mRNA expression by semi- quantitative RT-PCR All 28 clones transfected with the empty pcDNA3 vector, and all 27 clones transfected with the control CIITA construct without the initiation codon (pcDNA3mutCIITA2) had normal class II MHC induction by flow cytometry. In excess of 10 clones with each construct were also tested by semi- quantitative RT-PCR and all gave essentially the same result.
  • a representative clone transfected with pcDNA3mutCIITA2 and analysed by flow cytometry (Fig.3B, clone 1) and by semi-quantitative RT-PCR (Fig.3A, clone 1) showed normal class II and class I MHC antigen induction, as well as normal induction of mRNA for CIITA and HLA-DRA.
  • Fig.3B clone 1
  • Fig.3A clone 1
  • Fig.3A clone 1
  • Fig.3A clone 1
  • Thirty six of 62 Hela clones transfected with pcDNA3mutCIITA3 (with initiation codon) and 54 of 95 Hela clones transfected with pcDNA3mutCIITA4 (with initiation codon and nuclear localisation signal) showed clear (>35%) suppression of class II MHC induction.
  • the flow cytometry demonstrated a down regulation in mean fluorescence for class II of 97% (previously 55% with pcDNA3mutCIITA3 , and (previously 60%) 98% with pcDNA3mutCIITA4 , without any reduction in class I expression.
  • the RT-PCR studies showed normal induction of endogenous CIITA mRNA in clones 2 and 3 but, in spite of this, a substantial ( ⁇ 20 fold) suppression of HLA-DRA mRNA expression. There was no consistent advantage pcDNA3mutCIITA4 (with initiation codon and nuclear localisation signal) over pcDNA3mutCIITA3 (with initiation codon only) .
  • the vector pCEP4 was also used. Transiently transfected Hela cell cultures were used, but hygromycin selection was applied to remove non-transfected cells.
  • Hela cells were transfected with the control mutCIITA2 and the mutCIITA4 constructs in pCEP4. Five to 11 days after selection with hygromycin, the bulk cultures were stimulated with interferon gamma and subjected to flow cytometry and semi-quantitative RT-PCR analysis. The experiment was repeated on 11 occasions.
  • the control cultures transfected with the empty pCEP4 vector (data not shown) or the control pCEP4mutCIITA2 construct (Fig.3B, culture 1 and Fig.3A, culture 1) showed the expected normal pattern of MHC class I and class II protein expression, and CIITA and HLA-DRA mRNA expression.
  • the cultures transfected with pCEP4mutCIITA4 constructs showed >60% suppression of class II MHC expression, the suppression being >93% in 4 of these 7 cultures.
  • the results for one of the transfections with the mutCIITA4 construct are given in Fig.4A and B, culture 2.
  • the down-regulation in mean fluorescence for class II was 99% for this culture, and HLA- DRA mRNA was substantially reduced ( ⁇ 20 fold).
  • Transfection of the mutant CIITA genes did not affect the induction of endogenous CUUTA mRNA by interferon gamma in any of the cultures. However, HLA-DR ⁇ mRNA was reduced, either partially as shown in Fig. 3A, culture 2, or almost completely in some cultures. Expression of the mutant CIITA construct was readily visible.
  • MHC class II expression by these mutant CIITA proteins has potentially important applications for regulating clinically relevant immune responses, especially in autoimmunity and transplantation.
  • class II MHC expression on vascular endothelial cells plays a critical role in the long-term immunogenicity of transplanted human organs (28) .
  • the suppression of this expression might substantially reduce the incidence of chronic rejection and the requirement for long-term immunosuppression.
  • human T cells can respond directly to porcine MHC class II molecules (29) and these molecules therefore present potentially important targets for immune regulation. It is important to note, from studies down-regulating MHC expression in B cells by antisense oligonucleotides, that partial suppression of MHC expression on antigen presenting cells can have major effects on the efficacy of antigen presentation.
  • a hammerhead ribozyme targeted against bases 1159-1161 (GUA) of human CIITA mRNA was constructed according to the methods described in Tanner et al (24) and in Larsson et al (32) .
  • the antisense arms of the ribozyme are
  • the ECV-40 human vascular endothelial cell line maintained in Medium 199, non HEPES with 10% foetal calf serum, and the
  • Hela cell line maintained in DMEM were transfected with the various ribozyme constructs or with an empty construct and then exposed 500 or 1000 units of human interferon gamma to induce class II MHC expression, as described for Hela cells in Example 1.
  • MHC induction was measured 24, 48 and 72 hours after the addition of the interferon.
  • FIG. 6A shows class II MHC induction in ECV-40 cells at 24, 48 and 72 hours using 500 and 1000 units of human interferon gamma.
  • Figure 6B shows induction in ECV-40 cells transformed with the ribozyme. The ribozyme markedly suppresses the induction of class II MHC expression. Suppression of class II MHC expression is also shown in Figure 7, which demonstrates levels of expression in untreated ECV-40 cells and in non-transfected and ribozyme-transfected ECV-40 cells stimulated with interferon. Class II MHC expression was determined 72 hours after interferon stimulation.
  • the suppression of class II expression by the ribozyme targeted at bases 1159-1161 has the same potentially important clinical applications for the ribozyme in regulating clinically relevant immune responses, especially in autoimmunity and transplantation as does the suppression by the deletion mutant CIITA polypeptide.
  • the pcDNA3mutCIITA2 construct, the pcDNA3mutCIITA3 construct and the pcDNA3mutCIITA4 construct were produced as described in Example 1. DNA seguence analysis
  • the pcDNA3mutCIITA 2 , 3 and 4 constructs were sequenced between the EcoRI and NotI sites to confirm the sequence of the PCR product.
  • Ten ⁇ l plasmid DNA (1.5 ⁇ g/ ⁇ l) was subjected to sequencing reactions and run on an A.L.F TM System (Pharmacia Biotech, Sweden) according to the manufacturer's instructions.
  • porcine CIITA fragment was sequenced directly from the RT-PCR product from L23 cells, using a fluorescein-labelled primer and the sequenase fluorescent labelled primer cycle sequencing kit (Amersham International, Amersham, Bucks, UK) .
  • the porcine B cell line L23 17 was obtained from the European
  • L23 and PIEC cells were washed twice in OPTIMEM I serum-free medium (Gibco, Paisley, UK) and 1 x 10 cells in 0.8ml of OPTIMEM I were seeded into each well of 6 well plates (Becton-Dickinson Labware Europe, Meylan, France) .
  • Transfection complexes were formed by mixing 3 ⁇ g of the DNA construct and 10 ⁇ g of lipofectamine (Gibco, Paisley, UK) in 200 ⁇ l of OPTIMEM I. This was incubated for 30 minutes at room temperature to allow DNA-lipofectamine complexes to form, and then added to the cells. The cells were incubated for 5 hours at 37°C in 5% C ⁇ 2/95% air, after which 4ml of the appropriate growth medium with 12.5% foetal calf serum was added to each well.
  • the cells were passaged into selective medium containing 500 ⁇ g/ml of G418 (Gibco, Paisley, UK) .
  • the medium was changed every 2 or 3 days.
  • Stable PIEC clones were selected after a minimum of 3 weeks in the selective medium, and thereafter maintained in selective medium.
  • Recombinant porcine interferon ⁇ (rpoIFN ⁇ ) 19 was a kind gift of Dr. R. Steiger (Ciba-Geigy, Basel, Switzerland) .
  • PIEC cells in 6 well plates were cultured for 72 hours with 800 units/ml of rpoIFN ⁇ .
  • G418 was not added to the medium during rpoIFN ⁇ treatment.
  • the cells were harvested by vigorous pipetting, and divided into aliquots for flow cytometry, reverse transcriptase- polymerase chain reaction (RT-PCR) and T cell proliferation studies.
  • RT-PCR reverse transcriptase- polymerase chain reaction
  • mice monoclonal antibodies The H42A IgG2a antibody to SLA-DQ antigens, the MSA3 IgG2a antibody to SLA-DR antigens and the PT85A IgG2a antibody to SLA class I antigens were all purchased from VMRD (Pullman, WA) .
  • the control F15-42-1 IgGl antibody to human Thy-1 has been described previously
  • the pellet of the second wash was resuspended in 1 ml of 2% formalin in PBS and 5000 cells were analysed at room temperature in a FACScalibur flow cyto eter (Becton Dickinson, San Jose, California, USA) .
  • the data were analysed on CellQuest software (Becton Dickinson) .
  • Cells were initially analysed using forward and right angle scatter. With both PIEC and L23 cells, the large majority of cells formed a tight cluster which was gated for the fluorescence studies.
  • the percentage suppression of MHC class II expression was calculated on the basis of the mean channel of fluorescence for class II of the test cells, with the profile of the test cells with the negative control antibody as the zero point.
  • the mean channel of fluorescence of IFN- ⁇ treated normal cells was taken as 100%.
  • the mean channels of fluorescence with the control antibody and the antibody to SLA-DR were 1.9 and 2.1 respectively.
  • the corresponding figures for the control PIEC clone were 1.9 and 110.8.
  • the percentage suppression was calculated as:
  • RNA was prepared from PIEC and L23 cells using an mRNA Purification System (Pharmacia Biotech, Cambridge, UK) .
  • mRNA recovered was established spectrophotometrically using a GeneQuant (Pharmacia Biotech) .
  • Complementary DNA was synthesized using approximately 1 ⁇ g of mRNA and the First-Strand cDNA Synthesis Kit (Pharmacia Biotech) according to the manufacturer's instructions. The solution was denatured at 95°C for 5 min and different amounts of template (equivalent to 50, 10, 2 and 0.4ng of mRNA) were amplified in the presence of primers specific for actin, endogenous porcine CIITA, ⁇ LA-DRA and mutated human CIITA as follows:
  • SLA-DRA chain upstream primer: 5 ' -GATCAAGCGCTCCAACAACACC-3 SEQ. ID. NO.20 (from exon 1) downstream primer: 5 ' -GATGCCCACCAGAGCCACAAT-3 ' SEQ. ID. NO.21 (from exon 2)
  • Endogenous porcine CIITA upstream primer: 5 ' -TACACAATGCGTTGCCTGGCTCCA-3 '
  • SEQ. ID. NO.17 Actin: upstream primer: 5 ' -GGGCATGGGTCAGAAGGATT-3 ' SEQ. ID. NO.18
  • downstream primer 5 ' -TACATGGCTGGGGTGTTGAA-3 ' SEQ. ID. NO.19
  • the upstream primer for endogenous porcine CIITA is from the region deleted in all mutated human constructs. It therefore cannot recognize the mutated human CIITA, and is specific for endogenous porcine CIITA in the pig cells transfected with mutated human CIITA. (However, the primer cannot distinguish full length porcine from full length human CIITA) .
  • the upstream primer for the transfected human CIITA is from the inserted synthetic oligonucleotide. It therefore cannot recognize endogenous porcine (or human) CIITA, but is specific for mutCIITA3 and mutCIITA4.
  • PBLs Peripheral blood mononuclear cells
  • EDTA anticoagulated blood by centrifuging for 25 min at 600g at room temperature with Nycoprep (Nycomed Pharma, Oslo, Norway) .
  • the PBLs were washed twice by centrifugation and resuspended in 1.5ml of 15mM Hepes buffered RPMI 1640 medium (Gibco) with 1% FCS.
  • the 1.5ml of PBL was applied to a column containing 10-12ml of sterile G10 beads (Pharmacia, Uppsala, Sweden) previously equilibrated in Hepes buffered RPMI 1640 medium with 1% FCS at 37°C. After 45 minutes at 37°C, the non-adherent cells were eluted with 10-20 ml of medium, centrifuged, and resuspended in 1.5ml. This was applied to a second G10 column as above, to ensure full removal of adherent cells. The cells were then centrifuged
  • CD4 coated Dynabeads (Dynal, Oslo, Norway). Seven hundred ⁇ l
  • the detached cells were washed twice and resuspended to 2.5 x 10 6 CD4+ T cells/ml in RPMI 1640 with 10% FCS, 2mM glutamine, 150 units/ml of penicillin and 150 ⁇ g/ml of streptomycin.
  • the PIEC cells were washed three times in fresh medium, irradiated with 3,500 rads (IBL437C Irradiator, CIS Biointernational) , and harvested by vigorous pipetting. Five x 10 PIEC cells in 100 ⁇ l of culture medium were added to individual wells of U-bottomed 96 well plates (Falcon,
  • Monocyte contamination was assessed by culturing with 5 ⁇ g/ml of phytohaemagglutinin (PHA) for 3 days.
  • PHA phytohaemagglutinin
  • pcDNA3mutCIITA3 and pcDNA3mutCIITA4 constructs can suppress both constitutive and interferon gamma induced MHC class II expression in human cell lines 14 .
  • Human CIITA is able to induce MHC class II antigens in the mouse .
  • the mutated human constructs was examined in the pig, because of the potential importance of this species in clinical xenotransplantation.
  • PIEC cell line (Fig. 9A, top profile) normally expresses neither SLA-DR nor SLA-DQ antigens, but strongly expresses SLA class I antigens. Both transient (Fig. 9A, middle profile) and stable (Fig. 9A, lowest profile) PIEC transfectants strongly express both SLA-DR and SLA-DQ antigens. SLA-Class I antigen expression is unaffected in the CIITA transfectants. It is important to note that the level of expression of SLA-DR and SLA-DQ by human CIITA was similar to that induced by rpo IFN ⁇ (see later) .
  • Fig. 9B The RT-PCR studies (Fig. 9B) demonstrated that normal PIEC express neither CIITA nor SLA-DRA mRNA (lane 1) , but that both transient (lane 2) and stable (lane 3) PIEC transfectants expressed SLA-DRA mRNA.
  • the CIITA primers do not distinguish full length human from full length porcine CIITA, the CIITA mRNA seen in lanes 2 and 3 presumably represents the human CIITA mRNA transgene product .
  • FIG. 10A Upper and middle panels demonstrate that treatment of the PIEC cell line with recombinant porcine interferon gamma strongly induced both SLA-DR and SLA-DQ antigens, and further increased expression of SLA class I antigens.
  • the L23 porcine B cell line (Fig. 10A, lower panel) has much higher constitutive expression of SLA-DQ as compared to SLA-DR antigens and very high levels of SLA class I antigens.
  • the RT-PCR studies in Fig. 10B show that the interferon gamma induced porcine CIITA and SLA-DRA mRNA in the PIEC line, and that the L23 B cell line expresses these mRNAs constitutively.
  • a series of stably transfected PIEC clones was established, using the empty pcDNA3 vector (24 clones) , the control construct pcDNA3mutCIITA (24 clones) , the experimental construct with the initiation codon pcDNA3mutCIITA3 (24 clones) and the experimental construct with both initiation codon and NLS pcDNA3mutCIITA4 (48 clones) . All 120 clones were screened by flow cytometry for MHC class II antigen induction by recombinant porcine interferon gamma. All clones transfected with the empty vector or the control construct had normal SLA-DR and SLA-DQ induction, and representative flow cytometry profiles are shown in Fig.
  • Fig. 11B Semiquantitative RT-PCR studies are given in Fig. 11B.
  • the clones transfected with the control constructs (lanes 1 and 2) or pcDNA3mutCIITA3 (lane 3) showed normal induction of porcine CIITA and SLA-DRA mRNA.
  • the pcDNA3mutCIITA4 transfected clone (lane 4) showed marked suppression of SLA-DRA mRNA in spite of normal levels of induction of porcine CIITA.
  • the L23 cell line was transfected with the empty vector, and with the 3 mutated human CIITA constructs. After 2 days, selection medium was applied and the cells were analysed 3, 5, 7, 9 and 11 days later by flow cytometry and RT-PCR. In initial experiments, optimal suppression of MHC class II expression was found at days 5 and 7, and subsequent experiments were therefore performed at days 5 and 7 only. The experiment was performed on 12 occasions. On none of these occasions was there any suppression of MHC class II expression in cultures transfected with the empty pcDNA3 vector or with the control pcDNA3mutCIITA2 construct. Similarly, as was to be expected from the results in the preceding section, pcDNAmutCIITA3 also had no effect.
  • Human CD4+ T cells were purified from peripheral blood and shown to be thoroughly depleted of APC by their failure to respond to PHA (Fig. 13, day 3).
  • PIEC cells The capacity of PIEC cells to stimulate direct recognition by human CD4+ T cells was tested using normal and interferon gamma stimulated PIEC. It can be seen that normal PIEC did not stimulate pure human CD4+ T cells (as expected) , but that interferon gamma treated PIEC did so, the peak response being at day 5 (Fig. 13).
  • Interferon gamma treated PIEC clones carrying the empty vector, the pcDNA3mutCIITA2 construct or the pcDNA3mutCIITA3 construct behaved like normal PIEC cells.
  • the PIEC clones carrying the pcDNA3mutCIITA4 construct failed completely to stimulate the CD4+ T cells.
  • the suppression of MHC class II expression profoundly inhibited the functional capacity of the PIEC clones to stimulate direct human T cell xenorecognition.
  • the longer term survival of transgenic porcine organ xenografts in old world monkeys requires high levels of lmmunosuppression 33.
  • the suppression of SLA-DR and SLA-DQ expression on the VECs of porcine organ xenografts with the mutant human CIITA constructs of the present invention enable the reduction and even complete abolition of the direct T cell recognition response in human recipients of porcine xenografts, This will facilitate the long-term acceptance of porcine xenografts with clinically acceptable levels of immunosuppression.
  • pcDNA3mutCIITA3 The inability of pcDNA3mutCIITA3 to suppress porcine MHC class II expression was unexpected, in view of its established ability to suppress human MHC class II expression , and the effectiveness of pcDNA3mutCIITA4.
  • the absence of mutCIITA3 mRNA in the pcDNA3mutCIITA3 transfected cells indicates that the problem with this construct might rest with the stability of the mRNA in porcine cells, and not with any specific requirement in the pig for the NLS of the large T antigens of SV40, which is present in mutCIITA4.
  • CIITA has recently been shown to play a role in upregulating the expression of HLA class I heavy chain genes, but not the other genes involved in the cell surface expression of MHC class I molecules (e.g. ⁇ 2 microglobulin, TAP, LMP) 35 ' 36 .
  • MHC class I molecules e.g. ⁇ 2 microglobulin, TAP, LMP
  • suppression of CIITA did not influence porcine MHC class I expression.
  • CIITA independent expression of HLA-DQ has been demonstrated in EBV transformed B cells , we did not see a differential effect on SLA-DR or SLA-DQ in our studies.
  • Double transgenic pigs involving a human regulator of complement (to prevent hyperacute rejection) and a mutated human CIITA construct of the present invention preferably under the control of a constitutive VEC specific promoter (to suppress direct T cell xenorecognition) , will provide an important advance in the development of porcine xenografts for clinical transplantation.
  • CTGCTCCCTC CGGGGGCTGC TGGCCGGCCT TTTCCAGAAG AAGCTGCTCC GAGGTTGCAC 1740
  • GGGTGTCTCG CAGCTCTCAG CCACCTTCCC CCAGCTGAAG TCCTTGGAAA CCCTCAATCT 3180
  • GCAGCCCCAT TCTGCCTGCC CAGGCCCCTG CCACCCTGGG GAGAAAGTAC TTCTTTTTTT 3900
  • Gin Glu Pro Ala Ser Gly Gin Met Arg Leu Glu Lys Thr Asp Gin lie
  • Glv Pro lie Gin Phe Val Pro Thr lie Ser Thr Leu Pro His Gly Leu
  • Glu Glu Ala Gly lie Trp Gin His Val Val Gin Glu Leu Pro Gly Arg 820 825 830
  • Gin Glu Pro Ala Ser Gly Gin Met Arg Leu Glu Lys Thr Asp Gin He 195 200 205
  • Class II transactivator (CIITA) is sufficient for the inducible expression of major histocompatibility complex class II genes. J Exp Med 180:1367-11374.
  • HLA-DM An in vivo facilitator of MHC class II peptide loading. Immunity 3:259-262. 11. Kara CJ and Glimcher LH (1993) . Promotor accessibility within the environment of the MHC is affected in class II-deficient combined immunodeficiency.
  • Attardi LD Von Seggern D and Tijian R (1993). Ectopic expression of wild-type or a dominant-negative mutant of transcription factor NTF-1 disrupts normal Drosophila development. Proc Natl Acad Sci USA 90:10563-10567.
  • T cells direct presentation of MHC antigens and costimulation by ligands for human CD2 and CD28. Immunity 1, 57-63 (1994).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Rheumatology (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Rehabilitation Therapy (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Diabetes (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Polypeptide contenant la séquence d'acides aminés d'une protéine de trans-activateurs de classe II (CIITA), la terminaison N de cette séquence étant caractérisée par l'absence de résidus d'acides aminés, de manière que le polypeptide résultant réduit l'expression d'antigènes CMH de classe II. Ce polypeptide est utile dans le traitement des maladies auto-immunes et dans la production d'animaux donneurs transgéniques pour les xénogreffes et dans le traitement de maladies auto-immunes. Les ribozymes ayant pour cible les bases 1159-1161 du CIITA humain sont également utiles, ainsi que les acides nucléiques codant le polypeptide et le ribozyme.
PCT/GB1997/002751 1996-10-08 1997-10-08 Molecule mutante ciita et ses utilisations WO1998015626A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU45675/97A AU4567597A (en) 1996-10-08 1997-10-08 Mutant ciita molecule and uses thereof

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GBGB9620940.8A GB9620940D0 (en) 1996-10-08 1996-10-08 Mutant ciita molecule and uses thereof
GB9620940.8 1996-10-08
GB9705911.7 1997-03-21
GBGB9705911.7A GB9705911D0 (en) 1997-03-21 1997-03-21 Mutant CIITA molecule and uses thereof

Publications (2)

Publication Number Publication Date
WO1998015626A2 true WO1998015626A2 (fr) 1998-04-16
WO1998015626A3 WO1998015626A3 (fr) 2000-08-17

Family

ID=26310180

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB1997/002751 WO1998015626A2 (fr) 1996-10-08 1997-10-08 Molecule mutante ciita et ses utilisations

Country Status (2)

Country Link
AU (1) AU4567597A (fr)
WO (1) WO1998015626A2 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004009801A1 (fr) * 2002-07-19 2004-01-29 Genethor Gmbh Cellules non presentatrices de l'antigene utilisees pour la selection de lymphocytes t
WO2004047860A2 (fr) * 2002-11-28 2004-06-10 Genethor Gmbh Cellules non presentatrices d'antigene pour supprimer des reactions immunitaires pathologiques
GB2434578A (en) * 2006-01-26 2007-08-01 Univ Basel Transgenic animals
US7745690B2 (en) * 2004-03-09 2010-06-29 Nagoya Industrial Science Research Institute Transgenic nonhuman mammal representing the pathologic conditions of human rheumatoid arthritis
US20140017215A1 (en) * 2011-02-14 2014-01-16 David Ayares Genetically Modified Pigs for Xenotransplantation of Vascularized Xenografts and Derivatives Thereof
US9999609B2 (en) 2009-06-22 2018-06-19 Sk Biopharmaceuticals Co., Ltd. Methods for treating or preventing fatigue

Non-Patent Citations (11)

* Cited by examiner, † Cited by third party
Title
BONTRON S ET AL: "Efficient repression of endogenous major histocompatibility complex class II expression through dominant negative CIITA mutants isolated by a functional selection strategy." MOLECULAR AND CELLULAR BIOLOGY, (1997 AUG) 17 (8) 4249-58., XP002055140 *
CHANG C H ET AL: "Class II transactivator ( CIITA ) is sufficient for the inducible expression of major histocompatibility complex class II genes." JOURNAL OF EXPERIMENTAL MEDICINE, (1994 OCT 1) 180 (4) 1367-74., XP002055137 cited in the application *
CHANG C H ET AL: "Mice lacking the MHC class II transactivator ( CIITA ) show tissue-specific impairment of MHC class II expression." IMMUNITY, (1996 FEB) 4 (2) 167-78., XP002055135 cited in the application *
CHIN K C ET AL: "Importance of acidic, proline/serine/threonine-rich, and GTP-binding regions in the major histocompatibility complex class II transactivator: generation of transdominant-negative mutants." PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, (1997 MAR 18) 94 (6) 2501-6., XP002055139 *
RILEY J L ET AL: "Activation of class II MHC genes requires both the X box region and the class II transactivator (CIITA)." IMMUNITY, (1995 MAY) 2 (5) 533-43., XP002051560 cited in the application *
SCHLAEGER T M ET AL: "VASCULAR ENDOTHELIAL CELL LINEAGE-SPECIFIC PROMOTER IN TRANSGENIC MICE" DEVELOPMENT, vol. 121, no. 4, 1995, pages 1089-1098, XP000604125 *
STEIMLE V ET AL: "Complementation cloning of an MHC class II transactivator mutated in hereditary MHC class II deficiency (or bare lymphocyte syndrome)." CELL, (1993 OCT 8) 75 (1) 135-46., XP002051559 cited in the application *
TOTH C R ET AL: "A dominant-negative mutant of the class II MHC transactivator CIITA." 9TH INTERNATIONAL CONGRESS OF IMMUNOLOGY, ABSTRACT BOOK PAGE 695, ABSTRACT 4124, XP002055136 & THE 9TH INTERNATIONAL CONGRESS OF IMMUNOLOGY;MEETING SPONSORED BY THE AMERICAN ASSOCIATION OF IMMUNOLOGISTS AND THE INTERNATIONAL UNION OF IMMUNOLOGICAL SOCIETIES, SAN FRANCISCO, CALIFORNIA, USA, JULY 23-29, 1995, *
YUN S ET AL: "Suppression of MHC class II expression by human class II trans-activator constructs lacking the N-terminal domain." INTERNATIONAL IMMUNOLOGY 9 (10). 1545-1553., October 1997, XP002055141 *
ZHOU H ET AL: "CIITA -dependent and -independent class II MHC expression revealed by a dominant negative mutant." JOURNAL OF IMMUNOLOGY, (1997 MAY 15) 158 (10) 4741-9., XP002055138 *
ZHOU H ET AL: "Human MHC class II gene transcription directed by the carboxyl terminus of CIITA, one of the defective genes in type II MHC combined immune deficiency." IMMUNITY, (1995 MAY) 2 (5) 545-53., XP002051590 cited in the application *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004009801A1 (fr) * 2002-07-19 2004-01-29 Genethor Gmbh Cellules non presentatrices de l'antigene utilisees pour la selection de lymphocytes t
WO2004047860A2 (fr) * 2002-11-28 2004-06-10 Genethor Gmbh Cellules non presentatrices d'antigene pour supprimer des reactions immunitaires pathologiques
WO2004047860A3 (fr) * 2002-11-28 2004-08-05 Genethor Gmbh Cellules non presentatrices d'antigene pour supprimer des reactions immunitaires pathologiques
US7745690B2 (en) * 2004-03-09 2010-06-29 Nagoya Industrial Science Research Institute Transgenic nonhuman mammal representing the pathologic conditions of human rheumatoid arthritis
GB2434578A (en) * 2006-01-26 2007-08-01 Univ Basel Transgenic animals
US9999609B2 (en) 2009-06-22 2018-06-19 Sk Biopharmaceuticals Co., Ltd. Methods for treating or preventing fatigue
US20140017215A1 (en) * 2011-02-14 2014-01-16 David Ayares Genetically Modified Pigs for Xenotransplantation of Vascularized Xenografts and Derivatives Thereof
US11179496B2 (en) * 2011-02-14 2021-11-23 Revivicor, Inc. Genetically modified pigs for xenotransplantation of vascularized xenografts and derivatives thereof

Also Published As

Publication number Publication date
AU4567597A (en) 1998-05-05
WO1998015626A3 (fr) 2000-08-17

Similar Documents

Publication Publication Date Title
AU2020281158B2 (en) Methods and compositions for adoptive cell therapy
US20220125837A1 (en) Methods for controlled elimination of therapeutic cells
JP5706225B2 (ja) Ｔ細胞同時刺激シグナル２（ｂ７／ｃｄ２８相互作用）を遮断することによる免疫抑制
AU2016366226B2 (en) Immune cell compositions and methods of using same
CN108884140A (zh) 修饰的嵌合受体及相关组合物和方法
US9150635B2 (en) ILT3 polypeptides and uses thereof
JPH09500788A (ja) Ｂ７−２：ｃｔｌａ４／ｃｄ２８カウンターレセプター
JP2001517425A (ja) Ｔ細胞共同刺激性ポリペプチド、モノクローナル抗体、ならびにその製法および使用
Stepp et al. Gene structure of the murine NK cell receptor 2B4: presence of two alternatively spliced isoforms with distinct cytoplasmic domains
Rosinski et al. DDX3Y encodes a class I MHC–restricted HY antigen that is expressed in leukemic stem cells
WO2000052022A1 (fr) Proteines secretees et acides nucleiques codant pour elles
JP2022533092A (ja) アセチルコリン受容体キメラ自己抗体受容体細胞の組成物および方法
MXPA02002624A (es) Composiciones farmaceuticas y metodos de uso de proteinas secretadas relacionadas con la familia "frizzled".
WO1998015626A2 (fr) Molecule mutante ciita et ses utilisations
Yun et al. SUPPRESSION OF HUMAN ANTI-PORCINE T-CELL IMMUNE RESPONSES BY MAJOR HISTOCOMPATIBILITY COMPLEX CLASS II TRANSACTIVATOR CONSTRUCTS LACKING THE AMINO TERMINAL DOMAIN1
Yun et al. Suppression of MHC class II expression by human class II trans-activator constructs lacking the N-terminal domain.
EP0920502B1 (fr) Procedes et moyens de modification de l'activation du complement
US7235631B2 (en) ICOS mutants
WO1997035004A1 (fr) Stimulation cellulaire
Choi et al. Molecular cloning, expression and functional characterization of miniature swine CD86
KR101261005B1 (ko) 신규한 ｔｌｔ-6 단백질 및 그 응용
NZ535708A (en) Immunosuppression by blocking T cell co-stimulation signal 2 (B7/CD28 interaction)

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH KE LS MW SD SZ UG ZW AT BE CH DE DK ES FI FR GB GR IE IT LU MC

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 1998517308

Format of ref document f/p: F

122 Ep: pct application non-entry in european phase
AK Designated states

Kind code of ref document: A3

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG