GB2434578A

GB2434578A - Transgenic animals

Info

Publication number: GB2434578A
Application number: GB0601600A
Authority: GB
Inventors: Daniela Finke
Original assignee: Universitaet Basel
Current assignee: Universitaet Basel
Priority date: 2006-01-26
Filing date: 2006-01-26
Publication date: 2007-08-01
Also published as: GB0601600D0

Abstract

A non-human double transgenic animal having a genome comprising at least one copy of an IL-7 transgene construct and at least one copy of a CIITA transgene construct is obtained by intercrossing a relevant MHC class II IL-7transgenic male with a SR a CIITA transgenic female. The double transgenic animal model, preferably a mouse model develops osteoporosis spontaneously. Therefore no external treatment of the animals is required to induce said disease. In addition, ectopic lymphoid tissue develops spontaneously in multiple organs of the transgenic animals. This model allows therefore to study immune responses, lymphocyte homeostasis and autoimmunity in lymphoid tissues and to test new drugs to prevent osteoporosis, ectopic lymphoid tissue development and autoimmune diseases.

Description

I I t I I I I I * I II I I I I. :: :, :. :: :: 2434578 1/156 Model

Transgenic Animal for Interleukin-7 related diseases

FIELD OF THE INVENTION

The present invention relates to an animal model for Interleukjn-7 (IL-7) related diseases. The model is based on a non-human vertebrate, preferably a non-human mammal, having a genome comprising at least one copy of a MHC class II IL-7 transgene construct and at least one copy of a CIITA transgene construct and methods of making said double transgenic animals and cell lines thereof. More specifically, the mammal is a double transgenic mouse. The model facilitates the characterization of the pathogenic mechanisms of a) IL-7 related induced bone loss, b) IL- 7 related auto immune diseases and c) the role of Peyers Patches for oral infection with pathogens and the development of diagnostics, therapies and therapeutic compounds.

BACKGROUND OF THE INVENTION

Intereukin-7 (IL-7) is a member of a cytokine family that signals through the common cytokine gamma chain (gc) and the Interleukin- 7 Receptor alpha (IL-7Ra) chain. It plays an important role in B and T cell hematopoiesis as well as homeostasis of T cells. Studies in IL-7 and IL-7R--deficient mouse models reveales that IL-7/IL-7R is not only important for lymphopoieses but also for the organogenesis of lymph nodes and Peyer's patches. Secondary lymphoid organs are sites of antigen presentation, clonal expansion of B and T lymphocytes, and affinity maturation of B lymphocytes. In the intestine, these * 0 0 f 0 I I I * I SI I S I II P2540GB00:: : * : * 16 January 2006 2/156 immune functions occur mainly in Peyer's patches (PP) . PP develop through the interplay of two main cell types, haematopoietic cells and mesenchymal cells. For a successful PP organogenesis, the crucial molecular components involved in the crosstalk of inducer cells and their mesenchymal target cells are adhesion molecules, lymphotoxin (LT) family members, and cytokines. In particular, the interleukin 7 receptor (IL-7R) expressed on inducer cells is absolutely required.

Morphology of Peyer's patches Peyer's patches (PP) are organized lymphoid aggregates in the intestinal wall, which form part of the so-called gut-associated lymphoid tissue (GALT) (1, 2). Different numbers and localization of PP are observed in the intestinal tract of different species (1). In mice, PP are exclusively found in the antimesenteric wall of the small intestine. The number of PP is dependent on the mouse strain, for example with an average of 6.8 PP in C57BL/6 (B6) and 10.3 PP in BALB/c mice (3) . Although the microbial content of the intestine may influence the size of PP, their number and position are already defined before birth.

PP were first described in humans by the Swiss anatomist and naturalist Johannes Conrad Peyer (1653-1712). Further studies allowed more detailed insights into the anatomy of PP providing evidence that the morphology of PP is similar to other secondary lymphoid organs, such as peripheral lymph nodes (LN) and spleen.

However, unlike peripheral LN, GALT does not contain afferent lymphatics, which allow antigen-loaded dendritic cells (DC) or macrophages (M ) to drain from sites of infection to the LN.

Instead, the mucosal immune system evolved a highly specialized epithelium for antigen sampling, the follicular-associated epithelium (FAE) . The following components can be distinguished * I I a * * i a a a II I I It * * a, I I P2540GB00 It I: IS II 16 January 2006 3/156 in PP. A follicle-associated epithelium (FAE), a dome region, follicles, and interfollicular areas. The FAE overlies the GALT and can be distinguished from the absorptive epitheliuxn by numerous differences, such as the absence of receptors for polymeric immunoglobulin and the reduced production of membrane-associated digestive hydrolases. Instead, the FAE contains highly specialized antigen-sampling membranous or microfold (N) cells (4, 5) M cells have unique features to capture, traffic, and transfer molecules and particles from the gut lumen to phagocytes on their basolateral surface (4, 6, 7) . The basolateral surface of N cells forms intraepithelial pockets, which facilitate the uptake of the transported materials by antigen-presenting cells (APC. Fewer M cells are found on intestinal villi, where they are independent of FAE. These intestinal villous N cells serve also as an Ag gateway and can subsequently induce Ag-specific immune responses in a PP-independent manner (8) . A second mechanism for capturing Ag is the direct sampling of Ag from the gut lumen by transepithelal dendrites of intestinal DC (9, 10) The region between the follicles and the FAE is called the dome, where DC are the main APC. The predominant DC in the dome region have been described as CDllb-DC8a-CDl1c cells. Moreover, M , T lymphocytes, and plasma cells are present in the dome region.

Follicles are preferentially hosting recirculating B cells, follicular dendritic cells (FDC), and a small number of follicular CD4 helper T cells. The interfollicular area, is consequently rich in recirculating T cells and major histocompatibility complex (MHC) class I1 CD1lc CD11bCD8 DC.

Upon a T-dependent immune response, secondary follicles bearing

I I I I

I II * I II P25400B00. . II 16 January 2006 4/156 GC are formed. GC themselves have two distinct zones based on their histological appearance, a dark and a light zone, which are each associated with different functions (11, 12) . In the dark zone, closely packed large centroblasts (antigen-specific B cell blasts) undergo rapid cell division. As these cells mature, centroblasts become small centrocytes moving out into the light zone, which in addition contains follicular helper T cells and a complex network of FDC that sequester Ag.

PP contain specialized venules, the high endothelial venules (HEV), predominantly found in the interfollicular area, but some are also located in the periphery of B-cell follicles.

Anatomically, HEV are postcapillary venules and have unique characteristics, distinct from ordinary venules, tall and plump endothelial cells, thick basal lamina, and a prominent perivascular sheath (13) . HEV are important in controlling lymphocyte entry into PP. Lymphocytes migrating preferentially into the gut express integrin cL47, which binds to mucosal vascular addressin cell-adhesion molecule-i (MAdCAN-l) expressed by venules of the intestinal lamina propria (LP) and REV of PP (14, 15). Naive lymphocytes traffic to PP via extravasation from the bloodstream across the HEV in a multi-step process: tethering and rolling along the endothelium, firm adhesion to the endothelium in response to chemokinemediated integrin activation, and subsequent transmigration through the HEV into the tissue (16) Function of Peyer's patches PP are the inductive sites for gut mucosal adaptive immune responses containing the specialized FAE for luminal Ag sampling (17, 18) . A particular function of the mucosal immune system is ô -f I $ I It S I II P2540GB00. St 16 January 2006 5/156 the production of IgA. Secretory IgA is the major mucosal immunoglobulin that helps to eliminate harmful molecules (e.g. cholera toxin) and invading microorganisms. The GC of the PP preferentially support specific class switching to IgA. The intestinal, inductive huinoral immune response is described as follows (12, 18, 19) . After Ag sampling via M cells, DC process the assembled Ag in the subepithelial dome region and migrate to the T cell area, where they present Ag to recirculating naïve T cells. After priming, the activated CD4 T cells clonally expand, while some of these activated T cells migrate to the follicles. B cells present the antigen as a peptide: MHC complex on the cell surface. The primed helper T cells that recognize the appropriate peptide:MHC complex provide activating signals to the B cell in order to proliferate by cell-cell interaction via the CD4OL and by producing soluble factors, such as transforming growth factor beta (TGF-13), IL-5, IL-6, and IL-lO.

These antigen-specific activated B cells home to the follicles and form GC.

Activated B cells undergo several important modifications in GC, including somatic hypermutation, affinity maturation, isotype class switching, and memory B cell and plasma cell formation.

The follicular helper T cells deliver again soluble factors, such as TGFIL IL-5, IL-6, and IL-10. Whereas IL-5 and IL-6 act to promote expansion of IgA-con'imitted B cells, TGFI3 is known as a switch factor for B cell differentiation from 1gM to IgA.

Following IgA switch and affinity maturation, positively selected centrocytes exit the GC as long-lived plasma cells or memory B cells. Plasma cells migrate from PP to the mesenteric LN (MLN) via the efferent lymphatic system, which enters into * I I I I I I * It I I II P2540GB00 1 * It 16 January 2006 6/156 the thoracic duct and are finally released into the systemic circulation at the large venous trunks (20) . The plasma cells home back via flat walled venules to the intestinal LP, where they undergo final differentiation. The homing properties of the plasma cells back to the LP is dependent on changes in the expression of adhesion molecules and chemokine receptors, namely integrin a437 which bind to NadCAN-1 and the chemokine CCR9, which respond its ligand CCL25 (21) . Studies have demonstrated that IgA plasma cells at the LP "effector site" can be observed in significant numbers even in the complete absence of GC in the GALT. Yamamoto and colleagues (22) reported that PP- deficient mice still elicited OVA-and cholera toxin B subunit-specific mucosal IgA responses after oral immunization. Furthermore, Fagarasan et al. (23) have shown that isotype switch from IgM to IgA B cells apparently occurs in a T-independent manner in murine LP without GC involvement, suggesting that LP might function as both inductive and effector sites of immune responses. It was reported that 40 to 50% of murine LP IgA plasma cells were derived from the peritoneal cavity (24). The peritoneal cavity is a major source of self-renewing Bl cells, which are mainly responsible for polyreactive 1gM autoantibodies and antibodies to T-independent Ag. Fagarasan and colleagues propose that the IgM LP B cells might be B1 cells, which under the influence of cytokines derived from LP stromal cells, differentiate to IgA-producing plasma cells. However, whether B1 cells contribute to the production of mucosal IgA has been discussed controversially (17, 25, 26) . These PP-independent generated IgA-producing plasma cells in the LP might be a result of the presence of multiple isolated lymphoid follicles (ILF), which can form small GC in the gut (27). ILF are overlaid by FAE.

* t I I V I I I * I Il I I I II

I I I I I I I I I

* I I I I I I I P2540GB00 * 16 January 2006 7/156 It has to be mentioned that Ag uptake by FAE in PP and ILF is probably not the only route, as intraepithelial DC protruding through the villous epithelial layer and distributed along the entire intestine are able to process luminal Ag (8-10).

In contrast to the induction of an adaptive immune response to potentially harmful antigens, the gut immune system induces tolerance against harmless antigens from dietary proteins and no n-pathogenic resident commensal bacteria (28). This lack of response to gastrointestinal harmless antigens is termed oral tolerance'. There are three principal factors for intestinal tolerance to coinmensal bacteria (29) . First, the commensal bacteria themselves have an impaired ability to adhere and invade the epithelial barrier. Activation of Toll-like receptor (TLR) signaling of proepithelial cells by pathogens results in the production of inflammatory cytokines and chemokines, such as interleukin 1 (IL-l), IL-8, IL-6, tumor necrosis factor alpha (TNFu), CCL5, and CCL2O. Therefore, as a second point, the mucosal epithelium might participate in tolerance by ignorance, the TLR machinery of epithelial cells might be defective at the level of the epithelial surface, most of which is exposed to the bacterial microflora. This has been shown for some intestinal epithelial cell lines, which express detectable amounts of mRNA encoding TLR4, but the production of TLR4 protein is negligible (30). Third, specialized cells, such as tolerogenic DC and regulatory T cells that produce anti-inflammatory cytokines, such as IL-10 and transforming growth factor beta (TGF-3), in response to commensal bacteria, contribute to oral tolerance.

There are several types of regulatory T cells. The first identified population of such T cells thought to be involved in I * I U V I I I I II t I P2540GB00 V.,. . 16 January 2006 8/156 oral tolerance were CD8 suppressor T cells (31) . However, their functions and characteristics have not been clearly identified, yet. Another population consists of intrathymically derived CD4 CD25 regulatory T cells, which were shown to have the potential to prevent autoreactivity in vivo. One study has identified OVA specific CD4 CD25 T cells with regulatory activity after feeding tolerogenic doses of Ag to mice (32) . Other types of T cells, such as Th3 and Tn cells, have been found to play a regulatory role in peripheral tolerance by the secretion of the cytokines mentioned above (IL-lO, TGF-13) . yöT cells were shown to play an important role in some models of oral tolerance, for example by injection of yöT cells, isolated from orally tolerant mice, tolerance can be transferred to normal mice (33) Tolerogenic DC are found in PP and in the LP and are defined as IL1O-producing DC. All these components and mechanism are involved suppressing an immune response against harmless antigens. However, whether PP and M cells are essential for mucosal immune responses and tolerance to soluble antigens is still controversial, because by using PP-deficient mice, such as lymphotoxin alpha (LTa)-deficient mice, several groups produced conflicting results. Fujihashi and colleagues (34) showed that PP-deficient mice did not develop normal oral tolerance after feeding a single high dose of ovalbuxnin (OVA), whereas others have reported that entirely normal oral tolerance to either low or high doses of OVA could be induced in PP null' mice (35).

Prior to the use of knock-out animals, it had been shown that surgical removal of PP from rats had no effect on oral tolerance (36) . Therefore, it seems that PP might not be the only site for the uptake and processing of antigens and for the induction of f ii I 4 4 I I t I I I

I I I I I I I

P2540G300 1 16 January 2006 9/156 oral tolerance, other sites, such as ILF, LP, and MLN are also contributing to these processes (37) Peyer's Patch development Cellular components: The concept that cell - cell interactions are required for pattern formation and organ development was first described experimentally over a hundred years ago by H.V.

Wilson (38). Hans Spemann and Hilde Mangold defined a region of the early (gastrula stage) embryo as organizer, published in 1924 (39). They could show by transplanting the dorsal lip tissue into the presumptive belly skin region of another gastrula that the donor tissue had the capacity to direct the development of other parts of the embryo. This was the first publication proving clear evidence for the concept of Ilinductionli, which is described as an interaction between two groups of cells, by which one group influences the developmental fate of the other. Not only in Developmental Biology, but also in Neurobiology, Cancer Research, and Immunology, cell communication was identified as an important step in cellular differentiation.

Yoshida and colleagues (40) used this concept of organizer and inducer to predict a model for PP development. They proposed that in mice the earliest hematopoietic cells migrating to the developing gut are "inducer cells" collaborating with mesenchymal "organizer cells" (40, 41) . The interplay of these two different cell types via ligand/ receptor interactions is followed by a cascade of signaling events, gene induction and differentiation resulting in the formation of an organizing center, the PP anlage. The importance of cell-to-cell contact could be demonstrated using mouse models, whereby specific

I I I I

I I II I I I II

I I I I I I I I I

I I I I I 1 I I P2540G300 * 16 January 2006 10/ 15 6 ligand/ receptor interactions were inhibited through genetic deletion or antibody (Ab)-mediated inhibition. The existence of inducer cells could be confirmed by adoptive transfer experiments of fetal haematopoietic cells as well as by knockout studies of genes necessary for the generation or the function of these cells (42-45) . The corresponding partners, the organizer cells, have the capacity to establish lymphoid tissue compartments and to recruit mature lymphocytes. In the following two sections, the phenotype and function of both, PP inducer and organizer cells, will be described.

Organizer cells: By using whole-mount immunohistochemistry, Adachi and coworkers (46) could detect clusters of vascular cell adhesion molecule 1 (VCAM-1, CD1O6)-expressing cells in the embryonic murine gut as early as embryonic day 15.5 (El5.5) VCAN-1, an Ig-like transmembrane adhesion molecule, well-known as an important factor for the process of leukocyte emigration, is weakly expressed by most resting vascular endothelial cells, but expression is induced during inflammatory responses (47-49) Additionally, VCAN-l has been found to be constitutively expressed by BM stromal/endothelial cells (50), and can also be detected on myeloid cells residing in haematopoietic tissue, whereas peripheral blood cells do not express VCAM-l (51). The major ligand of VCAN-1 is the integrin a431. Other ligands with less affinity include the integrins a4137, a9f1 and cxDI32 (52-54) Approximately two clusters of VCAN-l positive cells were reported in the proximal part of the small intestine at E16.5, whereas at the day of birth (E20) up to nine clusters were visible along the whole small intestine, suggesting that PP formation progresses from the cranial to the caudal part of the * *, I It I * I I I I * I P2s400Boo: : :. : : : 16 January 2006 a I I * I I I I * I III I I 11/156 intestine (46) . Honda and coworkers (55) characterized these VCAM-lcells in more detail. The authors could detect coexpression of VCAN-l with other adhesion molecules, such as the intercellular adhesion molecule (ICAN-1) and MAdCAN-1 on these cells. Two different findings suggest that these ICAN-l VCAN-l cells are of mesenchymal origin. First, Honda and colleagues (55) detected mesenchymal-specific cellular surface markers, namely platelet-derived growth receptor alpha (PDFGRU) and PDFGRI3. Although PDFGRcX and PDFGRI3 are individually expressed by different cell lineages, coexpression rarely occurs in non mesenchymal lineages, suggesting a mesenchymal origin of these VCAN-l cells (56, 57) . This conclusion is supported by their finding that no cell surface molecules specific for haematopoietic lineages (CD45, B220, CD4, CDllc) or endothelial cells (VE-cadherin) could be detected on VCAN-lce1ls. Second, morphological analysis revealed that these cells share characteristics of stromal cells found in the thyrnus or BM.

Importantly, these cells express the lymphotoxin 13 receptor (LTJ3R), a member of the TNF receptor family. Stimulation of LT13R induces the expression of several chemokines as well as VCAN-1 (58) . By reverse transcriptase polymerase chain reaction (RT-PCR), Honda and coworkers (55) detected the expression of the homeostatic chemokines CCL19, CCL21, and CXCL13 in ICAN VCAN mesenchymal cells. These chemokines are normally expressed in the lymphatic system and in secondary lymphoid organs, allowing circulating naïve leukocytes to colonize the organ. In particular, CCL1 9 and CCL 21, highly expressed within the T cell zones of secondary lymphoid organs, retain T cells and attract activated B cells to this microenvironment. By contrast, CXCL1 3 expressed by FDC and stromal cells within B cell * I, S ci * I I I S S * I p254oGBoo: : :. , : : * 16 January 2006 * I I a I I I I * S III a I 12/156 follicles, attracts B cells and subsets of T cells into the B cell area (59, 60). Another member of the TNF family expressed by ICAN-l VCAN-l mesenchymal cells is tumor necrosis factor-related activation-induced cytokine (TRANCE). The role of TRANCE for secondary lymphoid organ development is further discussed below. Finally, ICAN-1 VCAN-l mesenchymal cells could be identified as Interleukin 7 (IL-7) mRNA producing cells (61) Recent studies of LN development showed two different types of mesenchymal cells in mesenteric or peripheral LN of newborn mice, that differ in their levels of VCAN-l and ICAN-l expression (62) It is to note that organs consist of parenchyma and stroma, where the parenchymal cells are the specialized cells of the tissue (e.g. lymphocytes) (63). The stroma is of mesenchymal origin and composed of fibroblasts, reticulum cells, multiple fibers, collagen fibers, and FDC. The origin and development of FDC are still not well understood. FDC and fetal organizer cells share several surface molecules such as VCAN-]. suggesting a common origin (64, 65). In addition, both organizer and FDC need LTR stimulation for maintenance and survival (60, 66,67).

Inducer cells: By studying neonatal LN in mice with respect to emigrating T cells, Kelly and Scollary identified for the first time a cell population positive for CD4, but negative for CD3, CD8, B220 and Mac-l (68) . At this time, the origin and function of this cell type was unknown. Five years later, Mebius and colleagues (69) characterized CD4 CD3 cells derived from MLN of newborn mice in more detail and showed that they were negative for other lymphoid, myeloid, and erythroid lineage markers supporting the idea that this cell population did not belong to previously characterized haematopoietic lineages. In a series of * ft * * ft * I I I I I I I P254oGBoo: : :. , : : :. 16 January 2006 * I I I I I I I * I III I I 13/156 studies using whole mount immunostaining, the group of Nishikawa described a similar haematopoietic cell type localized in the developing gut of mice. They discovered, in addition to the already described VCAN-1 organizer cells, CD45 haematopoietic cells positive for IL-7R and CD4 in the developing gut (46) . At E15.5, CD45 cells were found to be spread over the whole embryonic gut and only one to two days later, cluster formation of CD45 IL-7R cells was detectable. Interestingly, CD4 cells were even present one day after the detection of IL-7R (46) However, by fluorescence-activated cell sorter (FACS) analysis, IL-7R CD4 double positive cells could already be detected at E14.5 in the intestine, mesentery and spleen, but not in the liver and thymus (40). In mutant mice with no mature lymphocytes due to a block in lymphocyte development, such as recoinbination activating gene (RAG) -deficient or severe combined immune deficiency (SCID) mice, VCAN-1 and IL-7R cluster formation was still detectable, suggesting that in the absence of T and B lymphocytes PP anlage formation can occur (70) . Further analysis of different surface markers underlined the similarity of the fetal gut CD4 CD3cells to the CD4 CD3cells found in LN.

Additionally, the integrins a4137 and a4J31, CD117 (c-kit), the receptor for stem cell factor (SCF), normally expressed on hematopoietic progenitors, could also be detected on these cells (40, 42). These CD4 CD3cells were clearly negative for L-selectin (CD62L), the adhesion molecule known to mediate homing of naïve lymphocytes to lymphoid tissue. Four different categories of molecules expressed by inducer cells can be distinguished. First, TNF family members, such as LTa and 3, and TNF-related activation-induced cytokine receptor (TRANCER, RANK). Second, chemokine receptors (CXCR5, CCR7, CXCR4), known V It a a SI * I I a a a a a P2s4oGBoo: : :. .. : : :. 16 January 2006 * I a S S S S a I I III a I 14/ 156 to mediate homing to and retention in specific lymphoid microenvironments. Third, adhesion molecules (a41, a437 integrins, ICAN, CD44), and fourth, several surface antigens with diverse functions (CD4, CD32).

Two different approaches provided strong evidence that IL-7R CD4 CD3cells were crucial for PP development in mice. Yokota and colleagues (44) generated mice lacking 1d2, a basic helix-loop-helix (bHLH) protein that is able to inhibit the function of transcription factors, such as E-proteins. E-proteins also belong to the bHLH protein family and play a role in coordinating cell proliferation especially from lymphoid cells (71). In Id2-mice, PP as well peripheral and mesenteric LN were absent. IL-7Ra CD4 CD3cells from Id2-mice were undetectable, suggesting a link between the lack of PP and the absence of these cells. The second approach that showed an inductive property of the IL-7Ra CD4 CD3cells was an adoptive transfer experiment accomplished by several groups. CD4 CD3 cells were isolated from WT fetal spleen and transferred into newborn CXCR5'mice (42), which have a reduced number of PP (59). Two to six weeks after transfer, approximately 30 PP-like follicles were identified on the antimesenteric wall of the small intestine showing a similar organization to that of WT.

Based on the above data, IL-7Ra CD4 CD3fetal cells were termed lymphoid tissue inducer cells', or termed here from now on inducer cells.

Two groups have identified precursor cells for CD4 CD3cells in the fetal liver. Mebius et al. (72) have characterized an IL-7Rcz+Sca_lb0c_kitb0w fetal liver population, a cell with a similar phenotype to the so-called common lymphoid-restricted a at a a a.

* a S $ I * a a P2540GBO: :. aa: : :. 16 January 2006 a a a a a a a a a a Ia. I a 15/ 156 progenitors (CLP) in adult bone marrow (BM). CLPs, defined as LinIL-7R Thyl.l Scal1" c_kitb0 cells in the BM have the capacity to generate both T and B cells (73) . In contrast to CLPs, LinIL-7R cells from the fetal liver were reported to differentiate in vitro into lymphoid lineages, such as B cells and natural killer (NK) cells, CD8a and CD8a DC and M@ (72). In contrast to adult BM CLP5, lineage negative (Lini IL-7R cells from the fetal liver had the capacity to generate CD4 CD3cells both in vitro and in vivo. In another study, Yoshida and colleagues (74) reported that fetal liver LinIL-7R a4J37 cells generated inducer cells, NK and DC, but not B or T cells. Thus, the phenotype of LinIL-7R progenitor cells seems to fit into a diverse framework of early haematopoietic cells in the fetal liver, reported as common myelolymphoid progenitors (75).

Like 1d2, the retinoid-related orphan receptor gamma (ROR'y) is essential for inducer cell development. RORy, a transcription factor belonging to the sub-family of nuclear orphan receptors, is important for regulating development and differentiation (43, 76). The expression of its isoform RORTt, differing in the N-terminal sequence, is restricted to immature double positive CD4 CD8 thymocytes (77) . During early embryonic development, however, ROR7t was found to be expressed by the inducer cells exclusively (78). ROR'[ and RORyt' mice failed to develop PP and LN due to the absence of inducer cells (43, 78, 79).

Furthermore, Eberl and colleagues (76) used an elegant way to visualize inducer cells in the mouse. They generated a knock-in mouse by replacing RORyt with green fluorescent protein (GFP) (76). ROR'yt-expressing cells in heterozygous ROR('t) were found in LN anlagen, the submucosal region of the intestine and P2540GB0: :: 16 January 2006 16/156 around large central blood vessels in the spleens of E16.5 embryos, supporting the idea of a common inducer cell for all secondary lymphoid organs.

Molecular factors involved in PP formation The TNF family: Members of the tumor necrosis factor (TNF) and the TNF receptor (TNFR) superfamilies are involved in different pathways important for lymphoid organogenesis, cell death, proliferation, differentiation, and survival (80) . Currentlymore than 40 members of the TNF/TNFR superfamily (for overview see: http: //www.gene.ucl.ac.uk/nomenclature/ genefamily/tnftop.html) have been characterized, which regulate developmental and physiological processes in bone, neuronal, and ectodermal organs as well as in the immune system, where they have their central biological role in host defence, inflammation, and autoimmunity (81). Four closely related ligands define a TNF sub-family, which include lyrnphotoxin alpha (LTa), LTD, TNFa, and LIGHT (homologous to LT, inducible expression, competes with herpes simplex virus (HSV) glycoprotein D for HSV entry mediator (HVEM), a receptor expressed on T lymphocytes), and their specific receptors LTI3R, TNFR1 (or TNFR55), TNFR2 (or TNFR75), HVEM, and decoy receptor 3 (DC3) (82) . These molecules are important mediators of secondary lymphoid organ development.

LTc43-LTR interaction: First evidence of a defective lymphoid organ development in the absence of a TNF family member molecule was given by the study of de Togni and colleagues (84), who generated LTa - deficient mice. These mice do not form PP and LN, and show a severely disturbed splenic white pulp architecture t II I I II P2540GB0:: 16 January 2006 17/ 15 6 with the absence of B and T cell segregation, GC, and FDC networks (85) . LTa molecules lack a transmembrane domain and can therefore either be released as a homotrimer (LTa3) or be retained on the cell surface in two distinct heterotrimeric complexes with LTI3, (86), LTa1132 (predominant form) and LTa2I31 heterotrimer (minor form). Similar to LTa -deficient mice, LTt3 gene-deleted mice lack PP, but 75% of mice develop MLN (87-89) LTI3 alone does not bind any known receptor. Therefore, a signaling function of LT by itself could not be assigned so far. The LTa12 heterotrimer exclusively signals via the LT R (90). In contrast, LTa2131 binds TNFR1 and TNFR2, but its biological role has not been identified yet. The LTaf3 heterotrimer is only expressed by haematopoietic cells, such as inducer cells (74), a subset of follicular B cells (60), and mature T cells (86, 91). During embryogenesis, LT mRNA expression is restricted to hematopoietic cells in lymphoid organs and the intestine (92) . Using a conditional knock-out mouse, where LT3 was only deleted in B cells, Tumanov and colleagues (93) could show that LN and PP developed normally.

This result indicates that B cells are dispensable for LN and PP development, and inducer cells are sufficient to trigger the LTI3R signaling pathway during ontogeny. LTa3 expression by inducer cells is increased by a panel of different cytokines and chemokines. IL-7 and RANKL are able to stimulate LT43 on inducer cells (94) . In addition, cell-specific expression of LTUf3 is found by stimulation of T cells with IL-4, IL-7 and CCL19/ CCL21 in vitro (95), and by ligating CXCR5 on B cells through the corresponding chemokine CXCL13 (83).

4 4. 4 4 4t P2540GB0D 16 January 2006 18/156 In the developing gut of WT mice (E17.5), LTI3R was found to be expressed on ICAN-l VCAN-l mesenchymal cells (55). Using in situ hybridization on frozen sections of embryos, Browning and French (92) showed that LTf3R mRNA in the gut was already weakly expressed at E12.5 and El4.5, and moderate to high levels were detectable between El6.5 and E18.5. The importance of the LTf3R for PP development is reflected by the phenotype of LTRmice, which completely fail to develop PP (96). This has been underlined by experiments using blocking Ab (a soluble LTR IgG fusion protein or an anti-LT monoclonal Ab (mAb)) specific for binding to the membrane LTaf3 and thus inhibiting the LTcL-LTR interaction. By treating mice with these Ab, Rennert and colleagues (97) could prevent LN and PP development. The completeness of LN deficiency was strictly dependent on whether or not the Ab was injected between Ell and El6. For blocking PP development, the Ab had to be injected before El6.5. Conversely, in utero injection of agonistic Ab specific for LTR was able to restore LN development in LTamice demonstrating the important function of the LTa1132-LTI3R interaction in PP development (98).

The second known ligand binding LTI3R is LIGHT, a membrane-bound homotrimeric molecule expressed by activated T cells and immature DC (83) . LIGHT also binds to T cell-expressed herpes-virus entry mediator (HVEM) and to the decoy receptor 3 (DC3).

Transgenic mice, where LIGHT is expressed under the control of a T cell lineage-specific promoter, spontaneously develop severe autoimmune disease (99) . These mutant mice reveal typical signs of autoimmune disease, such as splenomegaly, lymphadenopathy, glomerulonephritis, elevated titers of autoantibodies, and severe infiltration of numerous peripheral organs. This result I *1 I I ft P2540GB0J s:: 16 January 2006 19/ 156 suggests that an increased or sustained expression of LIGHT by activated T cells contributes to the induction and persistence of inflammation and subsequently leads to autoimmunity. Although LIGHT exerts its action on the LTR stromal cells (100), its contribution to PP formation seems to be minor, because PP develop normally in LIGHT mice (101). However, it was shown that the presence of LIGHT transgene in LTamice leads to the restoration of the chemokine CCL21, T/B cell zone segregation, DC homing, FDC networks, and GC (100).

TNF/LTa3-TNFR interactions: Whether or not TNFR activation is essential for PP organogenesis has not been completely clarified, because reports about TNFa-and TNFR-deficient mice are contradictory. The secreted LTa3 and TNFct and the membrane-bound TNFa homotrimer share the same cell surface receptors, TNFR1 and TNFR2. Two different TNF-deficient mice show a discrepancy for the presence of PP. Pasparikis and colleagues (102) detected PP and LN in TNFamice. In contrast, a recent report showed a complete absence of PP in a second novel TNFa mouse (103). The authors argue that the discrepancy of the two mutant mice could be due to differences in the configuration of the targeted locus. An actively retained neo cassette could cause compensatory up-regulation of the neighbouring LT genes.

This secondary effect of the retained neo cassette has previously been reported (104) . A similar discrepancy is seen for the TNFR1. A previous study has shown that TNFR1-deficient mice, which were generated by Pfeffer et al. (105), lack PP development (106), whereas others have reported PP in TNFR1' mice, although in a reduced number with an average of 2-4 per mouse compared to 6-8 in WT controls (107) . In this second I!I I q It P2540GBQJ: 16 January 2006 20/156 study, TNFR1- deficient mice generated by Rothe and colleagues (108) were used.

Other members of the TNF superfamily: Tumor necrosis factor-related activation-induced cytokine (TRANCE), another member of the TNF superfamily, is a type II membrane protein that also exists as a soluble factor (109). TRANCE has been independently cloned by several groups and alternatively named receptor activator of NF-KB ligand (RANKL), osteoclast differentiation factor (ODF), and osteoprotegerin ligand (OPGL). TRANCE was originally characterized as a T lymphocyte specific protein (110). Recently, it has been reported that TRANCE signaling is involved in DC function, in particular, acting as a survival factor for activated DC (111). However, TRANCE is more widely expressed, especially in osteoblasts and bone stroma (112, 113), leading to an additional function, namely as a key cytokine involved in osteoclast differentiation and activation. TRANCE is crucial for proper bone homeostasis, which is maintained by the balanced functions of two cell types: osteblasts, which build bone, and osteoclasts, which resorb bone. Osteoblasts are derived from a mesenchymal lineage, whereas osteoclasts differentiate from myeloid haematopoietic precursor cells.

TRANCE has been shown to be both necessary and sufficient for the complete differentiation of osteoclast precursor cells into mature osteoclasts (112, 113) . Furthermore, it has been demonstrated that TRANCE is involved in LN development. Mice deficient in TRANCE completely lack all LN, while PP develop normally (114, 115). The same picture has been found for the corresponding receptor TRANCER (or RANK) (116). Both receptor and ligand are expressed on inducer cells within fetal LN, suggesting that they may act in an autocrine or paracrine manner P2540GBc0: 16 January 2006 21/ 15 6 (115). TRANCE is capable of inducing in vitro LTaf3 on inducer cells isolated from the intestine or mesenteries (94) Taken together, the expression of LT a1132 by inducer cells migrating to the fetal gut is mandatory for PP formation.

Different stimuli can trigger LT a1132 expression by the inducer cells and help engage the LTR expressed by intestinal stoma and epithelium. This molecular crosstalk plays a fundamental role in further tissue maturation, chemokine production and development of lymphoid cell clusters. Other members of the TNF family, such as LIGHT and TRANCE are dispensable for PP formation, whereas they play a critical role in lymphoid structure architecture maintenance and in the formation of LN, respectively.

Signaling pathways: Two separate signaling pathways, the classical' and the alternative' pathway, are induced after LTI3R stimulation leading to the activation of the transcription factor nuclear factor-kappaB (NF-KB) that controls expression of important immunoregulatory genes (117-119) . The classical' NF-KB signaling pathway leads to the induction of VCAN-1 and other genes, which are mainly involved in the process of inflammation and in the innate immune response. In contrast, the alternative' pathway activates the expression of a panel of genes coding for chemokines, such as CCL19, CCL21, CXCL12, CXCL13 (58), and other molecules (e.g. BAFF, PNAd, G1yCAN-l), known to play a central role in development and maintenance of secondary lymphoid organs. This is reflected in NFKB1 -and NFKB2-deficient mice, because NFKB1-deficient mice have a much milder phenotype than their NFKB2-deficient partner. Thus, the latter mutant mouse contains no PP, whereas the former shows I It I I II * I a I I I I a * a a I I II P2540GB30' a a I a 16 January 2006 * I I I I I * $ I S lIt I * 22/156 only a reduced number and size of PP. These results support the importance of the alternative NFKB activation pathway for PP organogenesis.

IL-7 receptor and its signaling pathways The IL-7Rct subunit is expressed by CD4 CD3inducer cells (40, 69) , Pre-B cells, thymocytes (120, 121), human intestinal epithelial cells (122), human BM-derived M (123), and thymic NK.1.1 T cells (124). The lack of PP in IL-7Ra-(70) and the common gamma chain (yc)-(l25) deficient mice revealed the importance of the IL-7R complex in PP organogenesis. Signaling through the IL-7R complex requires both the IL-7Ra (CD127) and the yc (CD117) subunit (126, 127) . yc is a component of several cytokine receptors, such as the receptors for IL-2, IL-4, IL-7, IL-9, IL-15, and IL-2l. yc is expressed constitutively on lymphoid cells. Mutations in the IL2RG gene encoding for the yc molecule cause the most common form of severe combined inimunodeficiency (SCID) disease in humans, named X-linked SCID (128). Patients with X-linked SCID lack mature T cells and NK cells, whereas B cells have normal phenotype and are present in increased numbers (129). Like in patients with X-linked SCID, in yc-deficient mice severe cellular abnormalities occur (125) . The GALT and peripheral LN are absent, whereas MLN are still detectable, although smaller in size and without any GC.

Similar to yc-deficient mice, IL-7Ra mutant mice show a profound reduction in thymic and peripheral lymphocyte numbers, in both T and B cell compartments affecting both CD4 and CD8 T cell subsets (130) . Regarding B cell development, a block at the Pre-I I * P254oGB0J: . :: 16 January 2006 23/156 Pro B cell stage has been observed. T cell development is affected before the surface expression of CD4 and C]J8 and before the initiation of T cell receptor f3 chain rearrangement in IL- 7Ra-deficient mice. In addition, IL-7Rc['mice lack y T cells (131). These findings suggest that efficient lymphoid development in mice is critically dependent upon IL-7R signaling..

Interestingly, single injection of a blocking anti-IL-7Ra antibody into pregnant mice before gestation day 15.5 abolished the development of PP, but not when injected at a later time point, indicating that IL-7Ra is required within a narrow early time window (40) . In addition, in the gut of anti-IL-7RcL antibody-treated mice LTa and LT mRNA were not detectable anymore (40).

In contrast to the complete absence of PP in IL-7Ra'mice, MLN and some peripheral LN (mainly brachial and facial) are still (although reduced in size) detectable in these mice (132, 133) Luther and colleagues (132) studied CD4 CD3 cells in the remaining MLN of IL-7Ra mice. The authors detected a decreased number of CD4 CD3 a437 cells in the developing MLN at birth as well as a strongly decreased LTctf3 expression on these cells.

These results suggest that although IL-7Ra signals play a major role in LTa induction on inducer cells, a minimal level of LTa expressed on a minimal number of inducer cells is sufficient to initiate MLN formation. This further implicates the involvement of other LT43-inducing signals, such as TRANCE and TRANCER, which are both expressed on inducer cells and play a role in LN development.

I I I 1* I * I I I I I I It I I I II P2540GB0: : * 16 January 2006

I III I I

24/ 156 IL-7, the ligand for the IL-7R complex, can trigger at least three different signaling pathways. 1) The most prominent, the Janus kinase (Jak)/signal transducer and activator of transcription (STAT) pathway, is described here in more detail (Fig. 5). 2) Phosphoinoside-3 kinases (PI3Ks). 3) Ras and mitogen-activated protein kinase (MAPK) / extracellular signal-related kinase (ERK) pathway (126) . Jakl and Jak3 are associated with the IL-7Ra and yc chain. Following binding of IL-7 to the IL-7R, Jakl and Jak3 get activated and transphosphorylate the receptor. Several genes including genes, which code for the T cell receptor gamma (TCRy), the anti-apoptotic B cell leukemia (Bcl)-2, and the cytokine-induced suppressor 1 (CIS1), are induced after IL-7R stimulation.

Jakl and Jak3 are members of the Janus family of tyrosine kinases (134) . Jak3 binds exclusively to yc and is absolutely required for cytokine mediated signaling through yc (135).

Similar to yc'mice, Jak3-deficient mice exhibit severe defects in the development of lymphoid cells (136) . In these mice, the thymus, spleen, and LN are reduced in size. Furthermore, PP are undetectable in Jak3mice. In the fetal intestine of Jak3-deficient mice, Adachi and colleagues (70) found IL-7Ra cells, but these cells were unable to form cluster, indicating an important role of the IL-7R signaling pathway in the early step of PP development, but not in the generation of IL-7Ra cells migrating to the fetal gut. In contrast to Jak3, which is expressed predominantly by haematopoietic cells, Jakl is ubiquitously expressed and interacts via IL-7Ra with other cytokine receptor subunits (137). Jakl-deficient mice show a I I!

I I I I I

I I I I

P2540GB0I:: :: 16 January 2006 25/ 156 perinatal lethality, but lack other gross developmental abnormalities (138) STAT5-deficient mice (compound STAT5a' b) show a critical requirement of this transcription factor for fetal thymocyte production and PP genesis, in contrast STAT5 is not necessary for adult T and B cell development (139, 140) . Interestingly, unlike IL-7R-mice, adult STAT5'mice have normal LN. Kang and colleagues (140) further reported to detect a reduced number of inducer cells by 3-fold in E17/18 STAT5fetal intestines. The absence of PP in STAT5-deficient mice supports the proposal that STAT5 is an essential mediator of IL-7R function during fetal lymphoid lineage maturation and PP development.

Taken together, IL-7R signaling with its components IL-7Ra, c, Jak3, and STAT5 is absolutely crucial for PP development.

Although reduced in numbers, inducer cells, which express all these IL-7R signaling components, are still detectable in mice lacking one of them. These findings suggest that the IL-7R signaling is not necessary for the development of inducer cells and is not the only factor involved in the maintenance of inducer cells. Finally, IL-7R triggers the expression of the LTa complex on inducer cells.

IL-7R ligands: IL-7 and TSLP: IL-7 is classified as a type 1 short-chain cytokine of the haematopoietin family, a group that also includes IL-2, IL-3, IL-5, granulocyte macrophage-colony-stimulating factor (GM-CSF), IL-9, IL-13, IL-15, M-CSF, and stem cell factor (SCF) . IL-7, initially called lymphopoietin-l, was originally discovered based on its activity to promote the proliferation of murine pro-B cells in vitro (142, 143). Further * I. * * It I * S I * I P2540GB00 * . it * 16 January 2006 I I I * S * I I I S I I I * I III * I 26/ 156 analysis revealed an important role in T cell development, function of mature T cells, and T cell homeostasis (144). The regulation of the IL-7 gene is not well understood. There are no apparent upstream TATA or CAAT sequences, which are typical for inducible genes (143). However, studies in keratinocytes identified some upstream regulatory regions, including constitutive promoter and inhibitor region and an interferon (IFN) inducible region containing an IFN-y specific response element (ISRE) (145). The murine IL-7 locus exhibits 5 exons and its cDNA is 462 base pair (bp) long encoding 154 amino acids, which display a molecular weight of 14.9 kDa (127) . Nurine IL-7 does not render activity on human cells, whereas human IL-7 is active on mouse cells.

The main source of IL-7 are mesenchymal and epithelial cells in the gut (146), the thymus (147), and the BM. Additional sites of IL-7 production include murine and human keratinocytes (148), adult human liver (149), human DC (150), and human FDC (151).

Importantly, IL-7 mRNA has not been detected in lymphocytes.

Except human DC, no other haematopoietic cells have been found to express IL-7, suggesting that IL-7 is mainly produced by non-hematopoietic cells (144). In the murine embryo, IL-7 is expressed in the thymus, in the liver and in the intestine (152). Nishikawa and colleagues (61) detected IL-7 mRNA in sorted VCAN-l ICAN-l gut embryonic mesenchymal cells by RT-PCR.

Nevertheless, they were unable to localize IL-7 in the gut using immunohistochemistry or in situ hybridization (40).

In vivo studies in adult mice injected with a neutralizing anti-mouse IL-7 monoclonal Ab (designated as M25; neutralizes both human and mouse IL-7 in vitro) have shown a striking reduction

I II I I II

P2540GB00 a a 16 January 2006 e a a I S I S S I I III I a 27/ 156 of pre-and pro-B cells in the BM, whereas the number of mature IgD B cells remained normal (153). In addition, all thymic T cell subpopulations were reduced, but the Ab-treatment had no effect on peripheral T cells. In utero administration of the M25 anti-IL-7 Al) from ElO onwards, completely inhibited the development of IgM B in neonates, indicating that IL-7 was also required during fetal B cell development. IL-7 deficient mice are highly lymphopenic in the peripheral blood and lymphoid organs (154). Macroscopic analysis of adult IL-7mice showed that LN or PP were not detectable (154). A detailed analysis of LN deficiency in IL-7mice has not yet been established. In the spleen, a reduction in absolute numbers of mature B and T cells has been detected (154). Data obtained from IL-7mice confirmed studies using neutralizing Ab and showed a block of B lymphopoiesis at the transition between pro-and pre-B cells. In the thymus, the remaining thymocyte subpopulations (only 5% of normal thymocyte numbers) were present at normal ratio. In IL-7 mice, VCAM-l PP organizing centers are still detectable at birth, but PP are completely absent in adult mutant mice (61).

It is a surprising observation that in IL-7-deficient mice VCAN-l PP organizing centers are present, since in IL-7Ra-deficient mice or in with IL-7R blocking Ab in utero-treated mice these organizer centers are not detectable (40, 70) . One explanation may be the redundancy of cytokines. Simply, the function of IL-7 could be replaced during the fetal and neonatal period by another ligand (61). A candidate could be thymic stromal lymphopoietin (TSLP). Human and murine TSLP was cloned a few years ago as a member of the IL-2 family of cytokines (155-157).

It has been originally defined in vitro as a growth factor supporting for a pre-B cell line (158) . In mice, TSLP appears to exert different age-dependent functions. In particular, while * 88 8 * If * * * 4 8 8 8 P2540GB00 * : :. a 16 January 2006 * a 8 8 I I 8 S * I Itt I I 28/ 156 both fetal and adult pre-B cells proliferation are sensitive to TSLP, only fetal pro-B cells grow upon TSLP stimulation (159, 160). TSLP binds to the IL-7Ra chain, but instead of yc, uses the TSLPR as a second receptor component (161, 162) . Similar to the IL-7/IL-7R signaling pathway, binding of TSLP to IL- 7Ra/TSLPR heterodimer results in phosphorylation of STAT5, although this event is not involved in inducing genes important for cell proliferation, as seen in the IL-7Ra/ yc pathway (163, 164). Interestingly, TSLPR signals independently of Jak3 and the other three known Jak family members in mice (161, 163, 165).

Since Jak3 is absolutely required for PP anlagen formation, an unknown third ligand for IL-7R may be required for stimulating the Jak3 signaling pathway in the absence of IL-7. The role of IL-7 in LN development was investigated using TRANCE' and TRP1F6 mice. TRAF6 is a downstream molecule in the TRANCE receptor signaling pathway. In both mutant mice, PP develop normally, whereas LN are absent (166). Yoshida and colleagues (94) analyzed TRAF6mice to determine whether IL-7 can substitute for the absence of TRANCE in vivo. Indeed, intra-embryonic injection of IL-7 into E13.5-14.5 fetal TRAF6mice rescued LN genesis, indicating that IL-7 and TRANCE were functionally equivalent, although their receptors activate distinct signaling pathways. The activity of IL-7, a secreted soluble protein, may be restricted locally. It is known that heparin-like molecules, components of the extracellular matrix (ECM), bind IL-7 to compartmentalize this growth factor to specific niches of the microenvironment, where IL-7 expression is initiated (167, 168) Several IL-7 transgenic mouse models have been generated, where IL-7 is either expressed by circulating haematopoietic cells or under a tissue-specific promoter. The first IL-7 transgenic * I. S It * I I * S I I I P2540GB00: : :. 1 16 January 2006 $ I I I I I I I * * III I I 29/156 mouse was generated by Samaridis and colleagues (169) in 1991.

In this transgenic mouse, the IL-7 cDNA is under the control of an immunoglobulin (Ig) kappa light chain promoter and a heavy (H) chain enhancer. The IL-7 transgene expressing cells are circulating B and T cells. This IL-7 over-expression results in an expanded population of mature and immature BM and splenic B cells and increased nurrthers of thymic and peripheral T cells.

Rich and colleagues (121) generated an IL-7 transgenic mouse, where the transgene is under the Ig H chain promoter and enhancer. Again, B and T cells are the source of ectopic IL-7.

Three major points were reported studying this transgenic mouse.

First, severe dermatological perturbations were present, due to T cells infiltration of the dermis. Second, there is an absence of double positive thymocytes in the thymus. Third, a lymphoproliferation progressing to malignancy was reported. In the IL-7 transgenic mouse generated by Mertsching and colleagues (170), IL-7 transgene is produced by MHC class II positive cells, namely APC5, but also non-migrating cells, such as cortical thymic epithelial cells (for more detail concerning MHC II IL-7TG mice and MHC II expression see under point 6). Two groups were using tissue-specific promoters to express IL-7. The first group used the human K14 promoter, which leads to the over-expression of IL-7 in basal keratinocytes (171). This keratinocyte-specific over-expression causes a lymphoproliferative skin disease by infiltrating T cells. The second group generated a mouse model with an ectopic IL-7 over-expression in the intestine by using the tissue-specific intestinal fatty acid binding protein (iFABP) promoter (172) The transgenic expression of IL-7 within intestinal enterocytes can partially restore defective PP development in IL-7'mice.

Finally, a mouse model with transgene expression on both * ft S I *,

I I I I S I I I

P2540GB00. 16 January 2006 * I I I S

I I I I I S S S

a a SI* S I 30/ 156 migrating and non-migrating cells was generated with IL-7 expressed under the control of the ubiquitous SRa promoter (173, 174). These transgenic mice developed chronic colitis.

Each IL-7 transgenic mouse shows characteristic features dependent on the activation site of the promoter. Transgenic IL- 7 produced by tissue specific promoters, revealed its action only on the resident lymphocytes. These findings underline the importance of the location of IL-7 production, and its tight regulation in the microenvironment of its action.

Chemokines and chemokine receptors: The constitutive and inducible expression of chemokines in secondary lymphoid organs and their corresponding chemokine receptors expressed by circulating leukocytes is critical for the formation of the lymphoid organ architecture (176, 177). Chemokines have been classified by structural and genetic differences. Members of the two major subfamilies consist of a C-terminal a-helix, three 3-pleated sheets and four cysteines in highly conserved positions.

The nomenclature for chemokines is based on the motifs presented by the two cysteines nearest the N-termini, which are either separated by a single residue, giving rise to the CXC chemokines (e.g. CXCL1O), or side by side, giving rise to the CC chemokines (e.g. CCL21) (178, 179). Chemokines can further be categorized into two classes as constitutive (developmentally regulated) or inducible (inflammatory) molecules, although a clear division is

debatable (180).

Chemokines and chemokine receptors are involved in different aspects of cell function, such as lymphoid trafficking, wound healing, angiogenesis, inflammation, and metastasis. The subset P2540GB00: : : : ; : P 16 January 2006

P I P P I I P

P I I I I I I I

I * III I I 31/ 156 of the chemokine family involved in the organization and function of secondary lymphoid tissues (also referred to as lymphoid or homeostatic chemokines) includes CCL19 (old nomenclature ELC) and CCL21 (SLC), which share the receptor CCR7. This subset further includes CXCL13 (BLC) that binds to CXCR5 and the ligand-receptor pair CXCL12 (SDF-l)-CXCR4 (176, 181, 182). Lymphocyte passage is a multistep process, which includes lymphocyte rolling along endothelial cells, adhesion of lymphocytes to HEV followed by signaling through the Gi protein-coupled chemokine receptors that induce integrin-dependent firm adhesion. The involvement of Gi protein-coupled signaling during T and B cell homing was discovered by the inhibitory effect of pertussis toxin on G proteins (183, 184) . HEy, the lymphocyte entry sites in PP and LN, express most prominent CCL21 (185) and to a lesser extent CCL19 (186), but also CXCL12 (187), and CXCL13 (188). CXCL13 and its receptor CXCR5 contribute mainly to B cell migration and thus to the organization of B cell follicles (59, 60) . CD4 T cells, which provide help for B cells in the GC, upregulate CXCR5 after their activation and are therefore capable to migrate to B cell follicles (189) . CXCR5 is upregulated during B cellmaturation in the BM and is expressed by all mature B cells (recirculating follicular B cells, marginal zone (MZ), and peritoneal Bl B cells) (190) . CXCL13 is expressed within follicles by radiation-resistant stromal cells (63). Recently, the involvement of CXCR4 and CXCR5 in the dark and light zone organization within GC5 has been described (191) T cell and DC migration to the T cell zone in lymphoid organs is dependent on CCR7 and its ligands CCL19/ CCL21 (192, 193). CCL19 and CCL21 are expressed by radiation-resistant stromal cells in the T cell zone, which appear to correspond to fibroblastic I 1 8 II I I I 8 * * I P2540GB00:. : 16 January 2006

I I I I I I I I

I $I I 8 32/ 156 reticular cells (194). CCL19 can also be produced by some types of DC (195) Inducer cells express different chemokine receptors, such as CCR7, CXCR4, and CXCR5 and show in vitro chemotactic activity towards homeostatic and inflammatory chemokines indicating a synergistic activity of several chemokines in lymphoid organ development (55). Ectopic overexpression of CXCL13 using the pancreas-specific rat insulin promoter (RIP) causes lymphoid neogenesis (196) In the pancreas of RIP-CXCL13 transgenic mice at E18.5, CD4 CD3 IL-7R high cells were detected (132) Therefore, CXCL13 may play a role in promoting the accumulation of inducer cells in secondary lymphoid organ formation.

Surprisingly, CXCL13 failed to up-regulate LTaI3 expression by inducer cells in vitro (132), whereas it has the capacity to induce LTaI3 expression by B cells (197).

Fetal ICAN-l VCAN-1 intestinal mesenchymal organizer cells are identified as CXCL13, CCL19, and CCL21 producing cells, (55) underlining the cellular crosstalk which may be established between inducer and organizer cells during organogenesis. The contribution of chemokines to PP formation has been studied in chemokine-and chemokine receptor-deficient mice. The most striking phenotype was found in mice deficient for CXCL13 or its corresponding receptor CXCR5. Most LN (except for cervical, facial, axillary, and mesenteric LN) and the majority of PP are absent in both CXCL13-and CXCR5deficient mice (59, 60). In contrast, CCR7-or CCL19-/CCL21-deficient mice have a normal phenotype concerning secondary lymphoid organs (192) . Mice deficient for both CXCR5 and CCR7 have a more severe phenotype than single deficient mice (198) . These results reveal a II, f I I I I I I * P2540GB00 i i. 16 January 2006

I I I I I I I

I I II I I

33 /156 cooperative function between CXCR5 and CCR7 during LN development. Regarding PP development, no difference has been reported comparing both CXCR5'and double deficient CXCR5'CCR7 mice. Because of a defect in vascularitation, CXCR4 mice are embryonic lethal (199). Taken together, the factors involved in the migration of inducer cells to the developing gut have still to be identified.

Adhesion molecules: VCAM-l, ICAN-l, and MAdCAN-l expressed by endothelial cells, mesenchymal organizer cells, and FDC are members of the immunoglobulin superfamily and represent, as previously reported, the ligands for integrins (200) . Integrins exist on the cell surface in a non-activated state until intracellular signals induce a conformational change thereby resulting in their activation. Inducer cells express integrins and hence, attachment of both inducer and organizer cells can occur. Since adhesion molecules play an important role in tissue-specific migration of leukocytes, studies were performed to investigate which panel of adhesion molecules might control the migration of inducer cells to putative sites of lymphoid tissue development. Inducer cells were shown to express LFA-l (own unpublished observation) but were negative for L-Selectin (CD62L) (133) (Fig. 3) . Inducer cells also express a437 integrin, the ligand for MAdCAN-1. MAdCAN-1, a vascular addressin, is transiently expressed by the endothelium of peripheral and mucosal lymphoid organs of fetal mice before its expression becomes restricted to mucosal sites (201) . This molecule is a target of the NKX2.3 homeodomain protein, a transcription factor implicated in controlling cell type specification, growth, and proliferation (202). Having identified a41 integrin as an additional adhesion molecule expressed by inducer cells, by in * ** I I It * I I * I * I P2540GB00: : :. * : : :-16 January 2006 * I * * I I I I * I lit I I 34/ 156 vivo Ab-blocking experiments we studied its role in colonization of the gut. Our laboratory could show that a4131 integrin is dispensable for the homing of inducer cells to the gut, but activated a41 integrin is crucial for the high affinity attachment to and clustering with VCM1-1 organizer cells (42) Model for lymphoid organ development: The process of PP formation is a consequence of the molecular crosstalk between mesenchymal organizer cells and haematopoietic inducer cells.

The following model for lymphoid-organ development has been proposed: a) LTXI3 -expressing inducer cells, stimulated by IL-7 or another IL-7Ra ligand, bind via activated integrin a4131 to VCAN-1 organizer cells, which express the LT3R. LT3R triggering induces the expression of several chemokines, such as CCL19, CCL21, CXCL12, and CXCL13. b) Chemokines attract more haematopoietic cells, which are now in contact with enlarging stromal cell cluster. More incoming LTc43-expressing inducer cells results in an increased LT3R stimulation and thereby a positive feedback loop is created. c) A larger cluster develops and the formation of high endothelial venules (HEV), which allows cells to enter from the bloodstream, occurs (adapted from (133)).

LinIL-7R precursors with multilineage capacity are generated in the fetal liver. These cells can give rise to inducer cells (72, 74). Upon differentiation into inducer cells, they migrate to the developing gut as well as to the spleen, the nasopharynx and to putative sites of LN formation. IL-7R cells are detectable in the fetal gut at E15.5. Activation of the IL-7R signaling pathway can induce the expression of CD4 and LTUI3 on inducer * .* * e It P2540GB00: : :. : : :. 16 January 2006 a * * a S $ S I * * $5. S * 35/ 156 cells. Cluster formation of both the inducer and mesenchymal VCAM-l organizer cells is strictly dependent on the interaction between LTaf on the inducer cells and LTI3R on the organizer cells. Adhesion of inducer cells with organizer cells is mediated by activation of a41 integrin expressed by the inducer cells. This leads to a conformational change in the integrin and high affinity attachment to VCAN-l. The activation of a41 integrin can be mediated by inside-out following signaling by CXCR5 expressed by the inducer cells. The attachment of LTa inducer cells to LTfR organizer cells leads to the stimulation of the LTR signaling pathway, resulting in NF-KB-dependent gene expression. The continuous activation of this pathway enhances VCAN1 expression by organizer cells and induces the production of chemokines, such as CXCL13. The production of this chernokine results in the attraction and subsequent accumulation of inducer cells. Increased inducer cell numbers within the PP anlagen enhances the stimulation of organizer cells, thereby generating a positive-feedback loop. During PP anlage formation, HEV develop, which allow mature T cells, B cells, DC and other cell types to exit circulation and to colonize the PP anlage. The full maturation of PP with segregated B and T cell compartments as well as FDC is not completed before several days after birth.

FDC and mesenchymal stromal cells produce chemokines, which maintain the organization of PP throughout life.

Alternative lymphoid structures in the intestine Besides PP in the small intestine, other types of aggregated lymphoid structures are present in the intestinal wall, such as isolated lymphoid follicles (ILF) and cryptopatches (CP).

* a. I I II I I I I I I * I P2540GB00 * . * : : :. 16 January 2006 * I I I * a * * * a *IS * I 3 6/156 ILF have been described in numerous species including man (203), rabbit (204), guina pig (205), and mouse (27) . In the small murine intestine, approximately 100-200 ILF are present in the antimesenteric wall. A significant difference in ILF numbers between mouse strains has been reported (27, 89) . Their cellular composition is similar to that of a single dome of a PP, namely the presence of B cell-containing follicles, which are capable of forming GC, and FAE harboring M cells, whereas interfollicular PP regions containing mainly T cells are missing (27, 206). Three discrete, non-overlapping populations, are distinguishable in ILF, each composed of B220, c-kit IL-7R, or CD1lc cells. The similarity in cellular composition of PP and ILF may reflect a similar function, namely inductive sites for intestinal immune reactions. No ILF are detectable in neonatal intestines. They appear in BALB/c mice at the postnatal day (preferentially in the duodenal and proximal jejunal mucosa), whereas they cannot be identified in B6 mice until day 25 of postnatal life (27). ILF are generated in T and B cell deficient mice (RAG2, um, TCRf3') indicating that they develop independently of mature lymphocytes. As for PP, they are absent in LTa or aly/aly mice and are drastically reduced in numbers and size in IL-7Ra-deficient animals (27) . In athymic flu/flu mice, the development and cellularity of ILF remained normal.

Interestingly, ILF formation was not disturbed by LTI3R blockade during E14 and E17 (27), but was inhibited by the continuous administration of LTI3R blocking Ab after birth (206) Furthermore, by BM transfer experiment, Lorenz and colleagues (206) showed the requirement for a LTa-sufficient B lymphocyte in the development of ILF. Analysis of germ-free mice showed the presence of ILF, indicating an independence of luminal stimuli * at I a Is * I I I I I I I P2540G300 a * ** 1 16 January 2006 * I I I I I I a a I I I a I I * I *I* I a 37/ 156 (27). This observation is in contrast to the hypothesis by Newberry that ILF may enlarge or regress in response to changes in luminal bacterial flora. Therefore, it is questionable whether ILF formation may have an inducible component in response to environmental challenges (207, 208) CP have only been described in mice so far. They were first identified by Kanamori and colleagues (209) upon their search for the origin of intracellular epithelial lymphocytes (IEL) They reported that these clusters of lymphocytes are clearly distinguishable from ILF and PP by histology and functionality.

CP are smaller in diameter than ILF and are not colonized by significant numbers of mature B or T cells (27) . Numerous lymphoid cell clusters (ca. 1,000 cells/ cluster), which are located between the crypts in the LP of the small intestine (ca. 1,500 clusters! small intestine) and to lesser extent in the colon (ca. 150 clusters! colon), have been detected in B6 mice (209). Based on immunohistological studies, two distinct cell types are predominantly present in CP, which are CDlic DC (20- 30%) and IL-7Rc-kit (60-70%) cells. The predominant IL-7Rc-kit cells express Thy-i and CD44, but no T-cell receptor (TCR) or markers specific for B cells, M s, DC, or granulocytes (78, 209, 210) . Overall, less than 2% of the cells express CD3 or B220. It has been discussed that these IL-7Rc-kitCD44 CP cells are identical with the inducer cells in PP since they share phenotypic markers (78). It has been further suggested that these cells are precursor cells for IELs (210) . In contrast to PP. which become detectable as VCAN-l cell clusters during embryogenesis, CP populated by IL-7Rc-kit lymphocytes are first detectable around 2-wk after birth. Interestingly, the cellularity of CP remained the same in germfree mice (209) I St S I II P2540GB00 16 January 2006 38/ 156 Various mutant strains, including athymic nude, SCID, RAG-2, PP- deficient (aly/aly), IL-7R-deficient, c-kit-deficient, and SCF-deficient mice were analyzed for the presence of CP. In every mutant mouse, except IL-7Rmice, CP with their specific cellularity are almost comparable with that of normal B6 mice.

As already mentioned CP were thought to represent the sites of extrathymic P cell development generating intestinal intraepithelial T cells (IEL) (209, 211) . The majority of intestinal IELs are CD8 belonging to two main categories. The first group expresses TCRa and CD8a coreceptor and these cells are generated in the thymus before they home to the intestine.

The second group of IELs expresses CD8aa homodimers and frequently the TCRy6 instead of the TCRaI3 (212) . These CD8aa IELs are surprisingly found in athymic nude and neonatally thymectomized mice, suggesting that they are generated outside of the thymus. Further studies have shown that c-kit lin marker negative cells isolated from CP, give rise to TCRat3 and TCRy after in vivo transfer into SCID mice (211) . In contrast, cells from PP or MLN failed to develop these P cell subpopulations.

This result provides evidence for a local T cell precursor that develops in the CP. Nevertheless, recent studies argue against the notion that CP are the major site of IEL differentiation and that CP cells are the immediate precursors of the CD8aa IEL5 (89, 213, 214) Guy-Grand and colleagues (214) used a transgenic mouse, which was generated by Yu et al. (215), where the GFP reporter gene is under the control of the RAG promoter. RAG proteins are crucial for gene rearrangement in P and B cells. RAG-GFP transgenic mice can therefore be used to identify cells, which are in the I, S S t$ P2540GB00: :: * 16 January 2006 39/ 156 process of or about to rearrange Ig or TCR genes. This system allows the identification of the sites of extrathymic T lymphopoiesis in athymic and euthymic mice. In RAG-GFP transgenic mice with an athymic genetic background, GFP T cells are found mainly in MLN and to a lesser extent in PP (214) . In contrast, no GFP T cells can be isolated from cryptopatches and IELs are GFP, suggesting no evidence for a lymphopoietic process involving cryptopatch cells alone (214). Eberl and coworkers (213) showed that in ROR'yt-deficient mice, in which CP, ILF, PP and all LN are absent, TCRy IELs are present. Also Papst and colleagues (89) analyzing LTa-deficient mice for lymphocyte aggregates, found that in the absence of CP, ILF, PP, and all LN, TCR7S IELs are detectable.

Several theories concerning function and appearance of ILF and CP have been proposed. Lorenz and colleagues (206, 208) claim that in B6 mice no spontaneous formation of isolated lymphoid aggregates occurs. Therefore they suggest, that ILF represent inducible aggregates. They conclude that ILF are tertiary lymphoid structures that can be formed in response to luminal stimuli, including normal gut flora and TNFRI (206, 208) Similar to this notion, Eberl and coworkers (216) propose that cryptopatches are immature' ILF, which develop into ILF through activation by pro-inflammatory signals. By analyzing serial sections of the whole intestine, Papst and colleagues (89) pointed out that the assembly of lymphoid aggregations is rather heterogeneous in terms of size, location and cellular content, and that therefore a strict classification into ILF and CP is difficult. Therefore, they prefer referring to these structures I II a a a * a a a a I I a P2540GB00 a a ii * : : :. 16 January 2006 a a a a I I I I a a II. I a 40/ 156 as solitary intestinal lymphoid tissue (SILT), characterized by plasticity and rapid responsiveness to external stimuli.

The process of lymphoid neogenesis During the process of chronic inflammation, ectopic lymphoid aggregates termed tertiary lymphoid structures' accumulate in the inflamed tissue. The whole process is named lymphoid neogenesis'. Tertiary lymphoid organs have been described in chronic organspecific inflammation associated with several autoimmune diseases, such as rheumatoid arthritis (RA) (217- 219), Sjogren's syndrome (220), Hashimoto's thyroiditis (221), Crohn's disease (222), and multiple sclerosis (MS) (223) . In addition to autoimmune syndromes, chronic infections with Helicobacter pylon (224), hepatitis C (225), and Borrelia burgdorfeni (226) can also be associated with the formation of ectopic lymphoid tissue. Based on both mouse models and patients with chronic inflammatory diseases, these tertiary lymphoid organs have certain characteristics usually found in secondary lymphoid organs (see also morphology of PP) . These morphological features include compartmentalization of B cells and T cells, DC, GC formation and the presence of HEy. In addition, some of the molecular factors, namely TNF family members, adhesion molecules, and chemokines, important for lymphoid organ development are also involved in the process of lymphoid neogenesis. An example of such a disease is rheumatoid arthritis (RA) . RA is an immune-mediated disease characterized by a chronic inflammation causing tissue damage in the small and large joints leading to pain and joint failure (227). The inflammation may also affect other organs, such as eyes, lungs, or heart. RA is further characterized by a disordered synovial microenvironment, in which hyperplasia of resident stromal cells * I S I It P2540GB00 16 January 2006 41/ 156 and a striking infiltration of haematopoietic cells, such as T and B cells, occurs. The initiation of autoimmunity is a complex field and not discussed in detail. In brief, self-reactive lymphocytes exist always in the natural immune repertoire, but mechanism of tolerance, such as deletion of self-reactive lymphocytes in the BN and thymus, peripheral anergy, and the action of regulatory cells. Loss of self-tolerance mechanisms may cause autoiinmune diseases. However, the three major forms of RA, based on the lymphoid organization, are diffuse synovitis (Non-organized infiltrate), aggregate synovitis (T cell-B cell aggregate), and GO synovitis (Germinal center) . There is only in GC synovitis (ectopic GO formation) evidence for LT, CCL21, and CXCL13 involvement, whereas the formation of diffuse and aggregate synovitis does not correlate with these mediators of secondary lymphoid organ development (228). The appearance of the second form, the aggregate synovitis, requires CCL21.

Ectopic GO formation is dependent on the presence of FDC.

Furthermore, the contribution of Ag-recognizing CD8 T cells is central for sustaining functional GO. It has been proposed that the generation and complexity of lymphoid neoorganization correlates with the increase of disease severity and the breakdown of tolerance mechanisms (227, 229). Both the B cell and T cell repertoires that are selected against high affinity recognition of autoantigens, and it is difficult to reach sufficient signal density to activate the immune cascade.

Therefore, the highest form of lymphoid neogenesis, the formation of ectopic GO, improves the conditions for successful immune activation, predisposes at a particular ectopic tissue site for autorecognition and autoimmune responses. Both LTa and TNFcL were known to be involved in inflairimation, and they were 4t I I P25400B00 16 January 2006 42/156 therefore designated as inflammatory cytokines (230).

Experimentally, Kratz and colleagues (231) showed in a transgenic mouse model, in which LTa is over-expressed under a pancreasspecific rat insulin promoter (RIP), a direct correlation between LTct expression, chronic inflammation, and ectopic lymphoid tissue neo-formation. The LTa transgene resulted in stimulation of the LTf3R, which is expressed ubiquitously. As a consequence, the expression of VCAN-l, ICAN- 1, MAdCAN-1, and PNAd on endothelial cells as well as the production of chemokines (CCL2, CCL5, CXCL19) in inflamed tissue of the pancreas (231, 232) was observed. Other groups used the same strategy to over-express other TNF family member molecules or chemokines in the pancreas. In mice, where CXCL13, CCL19, or CCL21 have been over-expressed as transgenes in the pancreas, lymphoid-like structures with distinct B and T cell zones, but no FDC networks were found (95, 196, 233) From an evolutionary point of view, inflammation may have occurred before the development of highly specialized tissue, the secondary lymphoid organs. It may therefore be a possibility that organogenesis of secondary lymphoid organs may utilize mechanisms, which are similar to inflammation (234, 235) I'fflC class II-IL-7 transgenic mice Nertsching and colleagues (170) published in 1995 IL-7 transgenic mice, in which the expression of mouse IL-7 cDNA is under the control of the mouse MHC class II Ea promoter. To generate this transgenic mouse, a fragment of the pDOI 5 vector plasmid bearing the cDNA of IL-7 was used. The original pDOI-5 plasmid has been widely used in producing transgenic mice and is P2540GB00: : * 16 January 2006 43/156 composed as follows (The schematic structure of the construct is shown in Fig. 1): (I) A large fragment of the murine MHCII Eu promoter region. (II) A fragment from the rabbit 3-globin gene.

This DNA segment provides an intron as well as a polyadenylation signal. It is thought that the use of an intron would stabilize the mRNA and facilitate the export of the spliced mENA into the cytoplasm. The cDNA of IL-7 was inserted into the second exon of the rabbit 3-globin gene. The Structure of the MHC class II Eu-IL-7 transgene as shown in Figure 1 comprises an Eu promoter sequence, sequences from the rabbit 3-globin gene, the mouse IL- 7 cDNA, and the SV4O polyA tail (polyadenylation signal). The IL-7 cDNA was inserted in the rabbit 3-globin Exon II.

Phenotypically, an enlargement of LN and spleen, but not of the thymus, was seen in IL-7 TG mice (170, 236) . The transgenic IL-7 transcript is detected in the fetal thymus as well as in the fetal liver from El4 onwards (170). Although a clear over-expression of transgenic IL-7 transcript is depicted in the adult thymus of IL-7TG mice by RT-PCR, no dramatic effect on thymocyte development has been noted. Further analysis of the cellularity in the LN of these mice showed that CD4:CD8 ratio is altered in the way that there are 1.5 to 2-times more CD8 than CD4 cells, the contrary what is seen in the WT mouse.

Furthermore, a massive expansion of pro/pre-B cell (CDll7b0w/B220b0w) and immature B cell (B220/IgW) numbers are present in the BM, LN, spleen, and blood of young IL-7TG mice (236). These pro/pre-B cells in the spleen! LN may either be derived from endogenous precursors or represent the progeny derived from the BM. Recently, Bosco et al. (237) showed an effect of IL-7 on the lymphopenia-induced T cell proliferation.

P2540GB00; J 16 January 2006 44/156 CIITA transgenic mice CIITA and its action on MHC class II expression: MHC class II transactivator (CIITA) regulates the expression of multiple genes involved in antigen presentation, especially it is believed to be the master regulator' for MHC class II (238, 239) . CIITA was identified as one of the defective genes in the bare lymphocyte syndrome (BLS) in humans. BLS is a rare form of inherited immunodeficiency characterized by the lack of M}-IC class II expression (238) . MHC class II molecules are heterodimeric cell surface glycoproteins, critical for the development of CD4 T cells and important in initiating an adaptive immune response (240). MHC class II is constitutively expressed by BM-derived APC5 (B cells, M , DC), which take up, process, and present Ag to CD4 T cells. MI-IC class II molecules are also expressed on cortical thymic epithelial cells (cTEC) or BM-derived thymic DC, which are mainly localized in the medulla of the thymus (241) . In addition, MHC class II expression can also be induced in non-BMderived cell types by several stimuli, the most effective and prominent is interferon gamma (IFNy) Both constitutive and induced MHC class II expression can be further modulated by additional signals. MHC class II expression is regulated mainly at the level of transcription. Factors binding to the cisregulatory elements of MHC class II promoters are required for MHC class II expression. They bind cooperatively to the promoter to form a highly stable macromolecular nucleoprotein complex referred to as the MHC class II enhanceosome (242) . CIITA is a part of this complex serves as a non-DNA-binding coactivator, the master control P2540GB00 16 January 2006 45/ 156 factor for MHC class II expression. The other factors, regulatory factor X (RFX), X2 box binding protein (X2BP), and nuclear transcription factor Y (NF-Y) are ubiquitously expressed, whereas CIITA can either be activated or silenced by different factors (239) . For example, CIITA expression is up-regulated by IFNy in most other cell types and this induced expression is down-regulated by numerous other stimuli, such as TGF-, IL-4, and IL-b.

CIITA Transgenic mice: CIITA transgenic mice were generated by Otten et al. (243) . Expression of the transgene is under the control of the ubiquitous SRa promoter. The SRa promoter is a fusion promoter containing the SV 40 early promoter and the R segment and part of the J. J5 sequence of the long terminal repeat derived from human T cell leukemia virus type I (244). It is ubiquitous in its ability to drive expression of the target gene. It is reported that in CIITA transgenic mice the CIITA transgene is expressed in skin, liver, kidney, lung, and various lymphoid organs (243) . CIITA transgenic mice show a bias of CD4+ T cells towards IL-4-secreting T helper 2 cells. Furthermore, MHC class II expression levels induced by the transgene are variable. As an example the T cell compartment was examined.

There was an increase of MHC class II expression from double positive to single positive thymocytes detectable. T cell activation showed a further increase in MHC class II expression.

The authors suggest that the efficiency of transgene expression is modulated as a function of developmental stage and activation status.

Knowledge of secondary lymphoid organ development contributes to a better understanding of organ formation in developmental P25400B00: 16 January 2006 46/ 156 biology, and thereby provides insights into the process of chronic inflammation and cancer immunosurveillance. For example, at sites of a chronic inflammation ectopic lymphoid structures are found. Interestingly, several molecules have been identified to play a role in both lymphoid organogenesis and ectopic lympoid neogenesis' However, the animal models currently available are not sufficient for the investigation of the role of cytokines in the formation of secondary and tertiariy lymphoid organs, the development of Peyer's patches (PP) and the induction of autoimmune diseases. Although previously, the inventors laboratory has shown that IL-7R CD4 CD3 fetal haematopoietic cells have the capacity to induce PP-like structures in the newborn intestine a suitable model for the eludication of the particular the influence of IL7 in vivo on IL-7R CD4 CD3 fetal haematopoietic cells and for the study of the role of IL-7 in lympho-organogenesis was still lacking. In order to address these questions, a novel genetic approach was necessary.

SUMMARY OF THE INVENTION

Double transgenic non-human animals were generated to study the role of Interleukin 7 (IL-7) i) for PP and lymph node development in fetal and adult animals, ii) in lymphoid tissue neo-formation and autoimmunity and iii) in bone metabolism. The invention comprises a non-human double transgenic (double TG) animal, preferably a mouse, having a genome comprising at least one copy of a MHC class II IL-7 transgene construct and at least one copy of a CIITA transgene construct. The double transgenic animals are produced by intercrossing MHC class II transactivator transgenic (CIITA TG) animals with MHC class II * * I I * * I I P2540GB00. * ** * * 16 January 2006 * I I I I I * I I I I I I I

I I III I I

47/156 IL-7TG animals, preferably mice as indicated in Figure 2. CIITA is known as a master regulator of MHC class II gene expression.

In known-classical NHC class 1I cells, CIITA gene expression can be initiated by several stimuli. However, in double TG mice, CIITA transgeneexpression is under the control of the constitutively and ubiquitously SRa promoter. This lead to an dramatic increase in IL-7 expression which was not only unexpected in its magnitude, but also in its early onset in embryogenesis compared to single IL-7TG littermates. IL-7 doubleTG animals, especially mice, show a dramatic increase in immature B cell numbers, activated T cells, PP numbers in the gut, ectopic lymphoid organs and they further show multiple lymphoid infiltrates in peripheral organs as well as a severe bone resorption phenotype similar to Paget disease. The animal model as well as cell lines derived from this model serve as a useful tool to study the mechanism of bone loss, especially of osteoporosis and Paget disease, of in vivo lyrnpho-organogenesis as found in Sjogren syndrome and the role of increased numbers of Peyer's patches for oral infection with pathogens.

The mechanism of bone resorption is likely a result of strong TRANCE (RANKL) expression in the novel double transgenic animals, preferably mice. TRANCE is a molecule important for osteoclast differentiation and inductions in proinflamnmatory cytokines. For example, reduced levels of oestrogen lead to higher levels of IL-l and TNFa. In addition, during postmenopause the numbers of activated T cells expressing TRANCE and secreting TNFa is increases thus leading to osteoporosis. Altogether, T cells and cytokines appear to play a role in osteoclast formation and function. Interestingly, it was previously reported that IL-7 can induce bone loss through activation of T cells (PNAS 2003, * ft * a, * a a I * I * I P2540GB00 a * a. : :. 16 January 2006 * I I * I * a S * a a I I * eIS * 48/ 156 Toraldo, G., 100, 125-130; PNAS 2005, Ryan MR, 102, 16735-16740).

The new mouse model can be used to test if, in addition to T cells, other cellular subsets such as lymphoid tissue inducer cells are involved in osteoclast differentiation and bone resorption.

The formation of ectopic lymphoid tissue in chronically inflamed tissue as a supportive factor for the development of an autoirnmune disease through generation of an LN-like environment where autoantigens are presented to T and B cells. In order to address this question, the development and prevention of autoimmune diseases can be studied in IL-7 double transgenic mice according to the invention. In addition, the role of IL-7 for regulatory T cells, which can prevent autoimmune diseases, can be studied.

The role of increased numbers of PP for oral infection with pathogens, for example with prions, bacteria and viruses can be investigated using the animal model, the cell lines and the methods according to the present invention. Since the new mouse model shows not only a dramatic increase in PP but also LN numbers, the consequence for oral tolerance and peripheral homeostasis of lymphocytes can be investigated, Several cell lines, comprising osteoblast and osteoclast cell lines, stromal cell lines, hematopoietic cell lines, epithelial cell lines can be generated to answer these questions in vitro.

Double TG and single IL-7TG littermates were analyzed with respect to phenotype, lymphocyte repertoire, inducer cells, PP * I. , It

I I I I I I I I

P2540GB00. . -. : :. 16 January 2006 : : : ; ; * a III I I 49/ 156 and LN number and morphology, and expression of LTD, TRANCE, TRANCER and chemokines.

According to one preferred embodiment of the invention, the animal model is derived from the intercross of MHC class II IL- 7transgenic with SRa CIITA transgenic mice. The SRa promoter is a fusion promoter containing the SV 40 early promoter and the R segment and part of the U5 sequence of the long terminal repeat derived from the human T cell leukaemia virus type I. It is ubiquitously expressed in all types of cells and organs such as skin, liver, kidney, lung, and various lymphoid organs. CIITA is a non-DNA-binding activator of MHC class II expression. MHC class II is expressed on antigen presenting cells (B cells, dendritic cells, macrophages) and on thymic epithelial cells. In CIITA IL-7tg mice the SRa promoter drives the syntheses of CIITA which, by binding to the MHC class II promoter, will increase transcription of both the endogenous MHC class II gene as well as that of the MI-IC class II promoter-driven IL-7 transgene. In CIITA IL-7tg mice, IL-7 transgene is ubiquitously expressed. IL- 7 transcripts were found as early as embryonic day 14.5.

The genotype and the phenotype of the novel double transgenic CIITA IL-7 animals is unique. The present invention provides an animal model, especially a mouse model, using alternative promoters which achieve levels of IL-7 transgene expression which were not possible in known model systems.

The function of cytokine is strongly dependent on the threshold of gene expression. In normal individuals, cytokine expression is restricted to sites of molecular crosstalk between immune cells an the environment. The new model allows to discover new * ft * I ft * * I I * I * I P25400B00: : :. * : : :. 16 January 2006 * $ I I I S I I * * I.. I I 50/ 156 aspects of IL-7 function due to the high levels of transgene expression in vivo. This new transgenic model provides us with information that were undiscovered in studies using knock-out models, due to the redundancy of cytokines in normal and knockout mice which can partially replace the function of each other.

There are currently no transgenic mouse models available demonstrating the direct link between IL-7 and lympho-organogensis or osteoporosis. The known models used to study the role of IL-7 in vivo are based on injecting recombinant IL-7 into mice or alternatively, neutralizing 11-7 with monoclonal antibodies. Both approaches are time consuming and expensive, In addition, it is unclear if sufficient levels of IL-7 are produced to test therapeutic strategies which either prevent or inhibit the development of osteoporosis and ectopic lymphoid tissue development.

The novel double transgenic animal model develops bone malformation spontaneously. Therefore no external treatment of the animals is required to induce said disease. In addition, ectopic lymphoid tissue develop spontaneously in multiple organs of the transgenic animals according to the present invention.

The model according to the present invention is the first model showing amplification of secondary and tertiary lymphoid organs.

This model allows therefore to study immune responses, lymphocyte homeostasis and autoimmunity in lymphoid tissues and to test new drugs to prevent osteoporosis, ectopic lymphoid tissue development and autoimmune diseases.

* I. I I * I I I I I ? I P2540GB00: :. . : : . 16 January 2006 * I $ * I I I I * . I.. I I 51/ 156 Inbred mice and mouse cell lines derived from the present invention are useful tools to study new drugs for safety and therapeutic efficiency. New mouse lines can be generated by crossing IL-7 double transgenic mice to other mouse strains (for example T cell deficient mice, B cell deficient mice, diabetes-developing models, lupus erythem.-developing mice) The present invention allows to test IL-7 in the context of generating protective immune responses against human pathogens or preventing autoimmune diseases or curing osteoporosis.

To investigate the contribution of the ligand for the IL-7R, the cytokine IL-7, in the process of PP formation, double transgenic (TG) fetal and adult mice were analyzed. These mice resulted from an interbreeding of an IL-7TG mouse strain where the transgene is under the control of the MHC class II promoter with a second transgenic mouse strain, which overexpresses a transactivator for MHC class II genes. Double TG offsprings revealed higher levels of IL-7 mRNA occuring earlier in embryogenesis. Consequently, double TG mice showed a striking phenotype with a 3-to 5-fold increase in PP numbers compared to single IL-7TG or control littermates. Analysis of embryonic double TG intestines demonstrated that the process of PP development was already elevated during development as early as the embryonic day 16.5. Importantly, inducer cells were significantly increased in numbers in these embryonic intestines.

Furthermore, the expression of LTI3 mRNA, which at this early time point is exclusively expressed by inducer cells, was also increased in double TG animals. These data clearly indicate a direct influence of IL-7 on the expansion of lymphoid tissue I *I I I * I I * * I I I P2540GB00. I 16 January 2006 * I I I t I I I I * II* I I 52/156 inducer cells and on the availability of LT3 leading to a higher frequency of developing PP in fetal life.

The IL-7 double transgenic animals show a dramatic increase in immature B cell numbers, activated T cells, PP numbers in the gut, ectopic lymphoid organs and multiple lymphoid infiltrated in peripheral organs as well as a severe bone resorption phenotype. The mechanism of bone resorption is likely a result of strong TRANCE (RANKL) expression in double transgenic animals.

TRANCE is a molecule important for osteoclast differentiation and inductions in proinflanimatory cytokines. Our animal model as well as cell lines derived from this model will serve as a useful research tool to further study the mechanism of lympho-organogenesis in vivo. The formation of ectopic lymphoid tissue in chronically inflamed tissue of humans has been considered as a supportive factor for the development of an autoimmune disease through generation of an LN-like environment where autoantigens are presented to T and B cells. In order to address this question, the development and prevention of autoinimune diseases should be studied in IL-7 transgenic mice. Thirdly, the role of increased numbers of PP for oral infection with pathogens, for example with prions, bacteria and viruses should be investigated.

It is obvious for the person skilled in the art, that based on the double TG animal model cell lines can be generated to answer these questions in vitro.

It can be summarized, that in addition to an enhanced frequency of PP development, in double TG mice, three additional striking phenotypic differences are observed: i) Lymphocyte infiltration in various non-lymphoid organs, such as stomach, salivary gland, * ft * I

I I I I I I I I

P2540G300: : : * : : I, 16 January 2006 * I * I I I I I * I I** I 53/ 156 and liver. Subsequent analysis demonstrated that B lymphocytes were predominant within these tertiary lymphoid structures. ii) Multiple ectopic LN containing both regular B and T cell zones were found. iii) Double TG mice had a severe bone resorption syndrome most likely as a consequence of the pro-osteoclastic effect of IL-7.

Taken together, these results show that IL-7 plays a key role in the homeostasis of inducer cells, in the generation of PP in the gut, in the formation of ectopic lymphoid tissue, and in bone resorption.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGURE 1A shows the structure of a MHC class II Ea-IL-7 transgene construct, and FIGURE lB shows the structure of a CIITA transgene construct (reproduced from 243).

FIGURE 2 illustrated the genetic approach to study the role of Interleukin 7 for IL-7 related diseases.

FIGURE 3 shows the early function of the transgenic CIITA in double TG embryos.

FIGURE 4 shows phenotypic observatins in double TG animals.

FIGURE 5 shows the increased size of the spleen and lymph nodes in double TG animals.

FIGURE 6 is a comparison of secondary lymphoid organ architecture of double TG animals and negative litter mates.

FIGURE 7 shows increased B-cell lymphopoiesis in double TG and in single IL-7TG animals.

I I II

I I I I I I V I

P2540GB00: :1. , : 16 January 2006

I I S I I S S I

* . III I * 54/ 156 FIGURE 8 shows increased number of both B and T lymphocytes and subsequently increased percentage of CD44 CD62U T cell numbers in the spleen of double TG mice.

FIGURE 9 shows increased numbers of PP in double TG mice.

FIGURE 10 shows increased number of VCAN-l cell clusters in double TG neonates.

FIGURE 11 shows determinationof IL-7 MRNA levels in double TG and single IL-7TG mice.

FIGURE 12 shows colocalization of CD4 and MHC class II on double TG.

FIGURE 13 shows increased inducer cell numbers in newbourn double TG mice.

FIGURE 14 shows increased level of LTa transcript in IL-7 TG mice.

FIGURE 15 shows IL-7-dependent up-regulation of a pattern of chemokines in the embryonic intestione of transgenic mice.

FIGURE 16 shows that IL-7 induces lymphocyte infiltration in non-lymphoid organs of double TG mice.

FIGURE 17 shows that IL-7 induces LN-like structures at ectopic sites.

FIGURE 18 shows the timing of transgenic IL-7 transcript expression in PP development.

FIGURE 19 shows a model of tertiary lymphoid structure formation in double TG animals.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

IL-7 double transgenic mice were generated to study the role of Interleukin 7 (IL-7) for Peyer's patch and lymph , ,

I I I I

P25400B00: I * , : 16 January 2006 I I I I I 3 I I

I I III I I

55/156 node development in fetal and adult mice. Secondly, for studying if IL-7 was involved in lymphoid tissue neo-formation and autoimmunity. Thirdly, to investigate the effect of IL-7 in bone metabolism.

Materials: Mice: The generation of IL-7TG (170), CIITA TG (243), IL-7' (154), Z/EG (293), and Rosa26R (294) mice has been previously reported. The whole content of said references (170, 243, 154, 293 and 294) is incorporated herein by reference. IL-7' mice were back-crossed 8 times onto the C57BL/6 background. All animals were housed and bred under standard conditions in a pathogen free mouse facility.

Cell lines: The ST-2 adult EM stromal cell line was kindly provided by T Rolink, Basel. Fetal (Ell) stromal cell lines from fetal liver (FL, 1828), urogenital ridges (13G. 26.1B6), and two cell lines (29.2B4, 2125) from gastrointestinal region (GI) were kindly provided by E Dzierzak, Rotterdam (295, 296) PCR machines: T personal PCR machine was used (BioMedia). Two real time PCR thermal cyclers were used: light cycler from ROCHE and Rotor-Gene RG3000 from Biolabo.

Oligonucleotides: Oligonucleotides were designed by the primer design program (LightCycler Probe Design (2), ROCHE) or OLIGO 6.7.1 and intron-spanning primers were used to avoid amplification of genomic DNA. All nucleotides were from Microsynth. Below is a list of all primers used: Genotyping: * I I P2540GB00: 16 January 2006 I S I I I * I S I IS 1 5 56/ 156 IL-7TG mice (anneal. temp.: 50 C; amplicon: 450 bp): 5' primer (j3-globin): TGGTTATTGTGCTGTCTCATC 3' primer (IL-7 transgene): ATTCTTTTTCTGTTCCTTTAC IL-7' mice (anneal. temp.: 60 C; amplicon: Neo: 256 bp, IL-7): mIL-7.gt5': GCTGCTTTTCTAAATCGTGCT mIL-7. gt3': ACCAGTGTTTGTGTGCCTTG Neo5': AGCACGTACTCGGATGGAAG Neo3': AATATCACGGGTAGCCAACG Quantitative real time PCR: XL-7 (anneal. temp.: 62 C; amplicon: 162 bp) IL-7. ql 5': ATTGCCCGAATAATGAACCA IL-7. ql 3': GTGTGCCTTGTGATACTGTTAG LT3 (anneal. temp.: 62 C; amplicon: 133 bp): LT3. q2 5': AATGCTTCCAGGAATCTAGCC LT3.q2 3': CCAAGCGCCTATGAGGT CCL5 (RANTES; anneal. temp.: 60 C; amplicon: 71 bp): 5': ACTCGGTCCTGGGAAAATGG 3': AATGCTGATTTCTTGGGTTTGCT CCL19 (ELC; anneal. temp.: 60 C; amplicon: 69 bp) : 5': CCTTCCGCTACCTTCTTAATGAAG 3': AGCCCCTTAGTGTGGTGAACA CCL21 (SLC; anneal. temp.: 60 C; amplicon: 67 bp): 5': GGCAA.AGAGGGAGCTAGAAAACA 3': TGGACGGAGGCCAGCAT CXCL1O (IPlO; anneal. temp.: 60 C; amplicon: 65 bp) 5': GACGGTCCGCTGCAACTG 3': GCTTCCCTATGGCCCTCATT CXCL13 (BLC; anneal. temp.: 60 C; arnplicon: 76 bp): 5': TGCTCAAGCTCCGTTGCA 3': TCACTAAATGCCTGTTCTCAAATAGC House keeping genes: P25400B00 16 January 2006 57/156 TBP (for real time PCR; Ref: (243)) 5': ACTTCGTGCAAGAAATGCTGAA 3': TGTCCGTGGCTCTCTTATTCTCA GAPDH (for real time PCR): 5: CCACCCCAGCAAGGACACT 3': GAAATTGTGAGGGAGATGCTCAGT Conventional PCR: GM-CSF (anneal. temp.: 55 C; amplicon: 200 bp): 5':

TTCCTGGGCATTGTGGTCTACAGC 3': TGAAATCCGCATAGGTGGTAACTTG SCF (anneal. temp.: 55 C; amplicon: 250 bp): 5': GACTTTATGGTGGCATCTGACACTA 3': CTGCCCTTGTAAGACTTGACT TGF-(anneal. temp.: 55 C; amplicon: 300 bp): 5': ATTCAGCGCTCACTGCTCTT 3': AGTTGGCATGGTAGCCCTTG CXCL12 (anneal. temp.: 55 C; amplicon: 120 bp): 5': CTCTGCATCAGTGACGGTAA 3': CACAGTTTGGAGTGTTGAGGA IL-7 (anneal. temp.: 55 C; amplicon: 250 bp) 5': CATATGAGAGTGTACTGATGATCAGCA 3': CTTACTTGTGCAGTTCACCAGTGTT House keeping gene: -actin (anneal. temp.: 55 C; amplicon: 350 bp) 5': TGACGGGGTCACCCACACTGTGCCCATCTA 3': CTAGAAGCATTGCGGTGGACGATGGAGGG Cloning: IL-7 (anneal. temp.: 55 C; amplicon: 496 bp) 5': AG?AGATCTTCGCCACCATGTTCCATGTTTCTTTT Bgl II (restriction enzyme) P2540GB00: 16 January 2006 58/ 156 3': GAGGAAGATCTTCCTTATATACTGCCCTTCAA Bgi II Antibodies: Antibody Speci clone pplicati Coz1any Dilution; es on Conc.

cD3c-pE hamst 145-2c11 FACS biolegen 1:30; 0.2 CD3biot hamst 145-2c11 1-listo Pharming 1:50; 0.5 CD4-APC rat RM4-5 FACS biolegen 1:500; 0.2 CD4 (supernat.) H129-19.6 Histo -no CD45-FITC rat 30-F11 FACS biolegen 1:2,000; 0.5 MHCII-PE rat M57114,15 FACS biolegen 1:1,000; 0.2 2 ma/mi MHCII-biot rat 11.54.3 Histo OMS 1:100 TCRc43-FITC haxnst H57-597 FACS biolegen 1:200; 0.5 er d ma/mi CD44-FITC rat 1M7 FACS biolegen 1:200; 0.5 c1 ma/mi CD45R-APC rat RA3-632 FACS biolegen 1:200; 0.2 r9 ma/mi CD45R rat RA3-6B2 Histo Pharming 1:75; lml CD45R-PE rat RA3-6B2 FACS biolegen 1:4,000; 0.2 d ma/mi CIJ62L-PE rat MEL-14 FACS biolegen 1:3,000; 0.2 ri ma/mi CD117-APC rat Ack2 FACS bioscien 1:200, 0.2 ma/mi CD127-FITC rat A7R34 FACS bioscien 1:30; 0.5 ma/mi CD127-PE/Cy5 5 rat A7R34 FACS bioscien 1:30; 0.2 ma/mi CDl27biot rat B12-1 FACS bioscien 1:30, 0.5 ma/mi VCAN-1 rat 429 Histo Pharming 1:200; 0.5 en ma/mi Anti-AAVbiot mouse A20 Histo PROGEN 1:5; 0.5 Secondary antibodies! proteins Antibody Species clone Application Company Dilution Anti-rat-HRP goat Histo BIOSOURCE 1.300: 1 ml Anti-rat-Cy3 goat Histo Jackson 1-50 Strept-AP Histo Roche 1.1,000, 1 000U ml Strept-HRP Histo Amersham 1 300; 0.5 mg/mI Strept-FITC Ilisto Mol. Probes 1:200; 0.5 mgml * ,I * * I, * * I I I I I I P2540GB00 * * *. * * * 16 January 2006 * I I I I * I I I * * I I * I III I S 59/ 156 Methods Breeding strategies: CIITA IL-7 double transgenic mice were generated by crossing heterozygous CIITA TG females with heterozygous IL-7TG males in order to avoid excess placental IL- 7 transfer from the mother. The Fi generation of this intercross was always used for analysis, mice were either double positive for the CIITA and the IL-7 transgenes (double TG), single positive for the IL-7 transgene (single IL-7TG), single positive for the CIITA transgene (single CIITA TG), or negative for both transgenes (neg. littermates) Mouse anesthesia: Mice were weighed and anesthetized by i.p.

injection with the appropriate volume of a 1:1 mixture containing 10 mg/kg Xylazinium (Rompun, solution to 2%, BAYER) and 90 mg/kg Ketamin (GRAEUB).

Peripheral blood lymphocytes (PBL) isolation: Blood (6 drops from the tail vein) was collected into 5 ml centrifuge tubes containing 0.5 ml PBS and 10 p1 of the anticoagulant Heparin (5,000U/ml). After blood collection, a further 0.5 ml of PBS was added. Then, 3 ml of Lymphoprep (Axon lab) was slowly underlayered with a Pasteur pipette. Viable cells were then isolated following a 30 mm centrifugation at 750xg at room temperature (RT) in a swing-out rotor without break. After centrifugation, mononuclear cells (distinct white band at the sample/medium interface) were removed from the interface and washed in PBS.

Genotyping and screening of transgenic mice: Genomic DNA extraction from tail biopsies: Digestion buffer: 100 mM NaC1; 50mM Tns- HC1 pH 8; 100mM EDTA; 1% SDS. 0.5 cm of tail was P2540GB00 16 January 2006 * a a * S S I I S * a a S I I I I I *I* * I 60/ 156 removed and incubated in 700 p1 digestion buffer containing 250 pg/mi proteinase K (20 mg/mi, ROCHE) at 56 C for at least 3 hours (hs) with gentle shaking. 250 p1 saturated NaCl was added and the tube gently inverted. After centrifugation at 13,000 x g for 10 mm at RT, 750 p1 of supernatant was transferred into a new tube containing 500 p1 Isopropanol. The tube was inverted for mixing and centrifuged at 13,000 x g for 5 mm at RT. The pellet was washed in 500 p1 of 75% EtOH and centrifuged at 13,000 x g for 5 mm at RT. After removing the supernatant, the pellet was air-dried for 5 mm at RT and dissolved in 100 p1 ddH2O. The genomic DNA was stored at 4 C.

Genotyping of IL-7 transgenic mice: The genotyping of IL-7 transgenic mice was performed by PCR of extracted genomic DNA.

PCR products were amplified with the Taq Pol PCR System (ROCHE).

The sequence of the following primer pair was obtained from (170): forward (3-giobin): 5' -TGGTTATTGTGCTGTCTCATC-3'; reverse (IL-7): 5' -ATTCTTTTTCTGTTCCTTTAC-3' The PCR reaction mixture (total volume SOp1) was composed of the lOx PCR buffer, 0.2 pM of each primer (10 uM stock each), 0.2 mM of each dNTP (10 mM each, ROCHE) and 1 U Taq polymerase. The cycling parameters were: 1 cycle at 95 C for 2 mm followed by 35 cycles at 95 C for 30s, 50 C for 30s and 72 C for 30s. This primer pair produced an amplicon of 450 bp in length.

Genotyping of IL-T mice: Identical protocols to that used for IL-7TG mice were used, except that the annealing temperature for the specific primer pairs was as indicated for each pair.

Screening ofCIITA transgenic mice: After crossing CIITA TG female with MHC-II IL-7TG male, littermates were screened for * S* I II I I I I I ( I I P2540GB00: . : : 16 January 2006

I I I I

* * a.. I I 61/156 the IL-7 transgene by PCR (see above) and for the CIITA transgene by FACS analysis. The following antibodies were used (purchased from biolegend): anti-CD45-FITC (1:2000); anti-NHC-lI-PE (1:1000); anti-TCRc43-FITC (1:200) . CIITA TG mice were identified by detecting MHC-II expression on adult PBL TCR ci/f3 positive lymphocytes or in the case of embryos by MHC-II expression on CD45 neg. liver cells. Normal WT C57BL/6 mice, where T cells do not express MHC-iI, were used as control.

mRNA Detection: Isolation of RNA from tissues: After organ removal, homogenization was immediately performed in 1 ml of TRIZOL reagent (INVITROGEN) by using a homogenizer (POLYTRON, KINEMATICA AG). RNA isolation was processed in accordance with the manufacturer's protocol. Homogenized samples were passed twice through a 26 gauge needle to reduce viscosity and kept for mm at RT to permit the complete dissociation of nucleoprotejn complexes. Then, 0.2 ml of Chloroform was added, samples vigorously shaken by hand for 15 sec, and incubated for 2 mm at RT. Samples were further centrifuged at 12000 x g for 15 mm at 4 C. Following centrifugation, the aqueous phases were transferred to fresh tubes containing 0.5 ml Isopropanol, mixed, and kept for 10 mm at RT to precipitate the RNA. Samples were then centrifuged at 12000 x g for 10 mm at 4 C, supernatants removed, and RNA pellets washed with 0.8 ml RNA5e-free 75% EtOH.

Samples were mixed by vortexing and then centrifuged at 7500 x g for 5 mm at 4 C. After removing supernatants, pellets were air-dried for 5 mm and RNA dissolved in 20-50 p1 DEPC-treated H2Q by incubating for 10 mm at 55-60 C. Isolated RNA was stored at -70 C.

P2540GB00: 16 January 2006 62/15 6 Genomjc DNA removal: Isolated total RNA was treated with RNAse-free DNase I (DNA-free System, Ambion) to avoid genomic DNA contamination. io pg of RNA was incubated with 2 U DNase I in lOx DNase I buffer at 37 C for 30 mm (total volume of 2Opl).

0.1 volume of the total volume of DNase inactivation reagent was added and incubated for 2 mm at RT. Samples were centrifuged at 10000 x g for 90 sec at 4 C and supernatants transferred to new tubes.

10.5.3 Total RNA Isolation of sorted cells: Sorted cells were centrifuged at 250 x g for 5 mm and immediately resuspended in 350 cell lysis buffer RA1 containing 3.5 p1 -mercaptoethano1 Further processing used the MACHEREY-NAGEL RNA isolation kit.

The lysate was filtrated through NucleoSpin Filter units by centrifugation at 11000 x g. 350 p1 EtOH (70%) was added to the homogenized lysate and mixed by vortexing. The lysate was then loaded onto the NucleoSpin RNA II column and centrifuged at 8000 x g for 30 sec. 350 p1 MDB buffer was added to the column and centrifuged at 11000 x g for 1 mm. 95 p1 DNase reaction mixture was applied onto the center of the silica membrane of the column and incubated for 15 mm at RT. 200 p1 buffer RA2 was added to the column and centrifuged at 8000 x g for 30 sec.

After adding 600 p1 of buffer RA3, the column was centrifuged at 8000 x g for 30 sec. The final wash step was performed by adding 250 p1 buffer RA3. The column was then centrifuged at 11000 x g.

RNA was eluted by adding 30 p1 RNase-free H20 and the column was centrifuged at 11000 x g for 1 mm.

Reverse Transcription (RT)-PCR: 2 pg of total RNA was used to synthesize cDNA by Superscript iii RNase H-reverse transcriptase (RT) (INVITROGEN). The following components were * I. * 9.9 P2540G300: : , * 16 January 2006 : . * . . . * I III S I 63/156 mixed: 2 jig total RNA, 1 p1 oligo (dT)20, 1 p1 dNTP mix (10 mM each dATP, dGTP, dCTP, and dTTP), and RNase-free H20 was added to a final volume of 14 p1. The mixture was then heated at 65 C for 5 mm and incubated on ice for at least 1 mm. After a brief centrifugation, a mixture of 4 p1 5x buffer, 1 p1 0.1 M DTT, and 1 p1 of superscript III RT (200 UI p1) was added and mixed by pipetting gently up and down. The reaction mixture was incubated at 50 C for 60 mm and inactivated by heating at 70 C for 15 mm.

p1 ddH2O was added to a final volume of 100 p1. As a control, a reaction was processed without the superscript III RT (RT minus control) PCR analysis: PCR was performed by the AmpliTaq Gold System (Applied Biosystems) . This System was used to detect TGF-3 (25 mM MgCl2 stock: 3 mM), GM-CSF (3 mM), SCF (1 inN), CXCL12 (3 inN), IL-7 (3 mN), and -actin (3 mM) . MgC12 concentration for each primer pair was adjusted (indicated in brackets). The reaction mix (total volume of 2Opl) was composed of lOx PCR buffer, 0.2 uN of each primer (10 uM stock each), 0.2 mM of each dNTP (10 mM each, ROCHE) and 1 U AmpliTaq Gold polymerase. 1 p1 of cDNA (approximately 20 ng) was applied to the reaction. The cycling parameters were: 1 cycle at 95 C for 2 mm followed by 40 cycles at 95 C for 30s, 56 C for 30s and 72 C for 30s.

Quantitative real time PCR with LightCycler: Quantitative real time PCR (qRT-PCR) was performed using the LightCycler FastStart DNA SYBR green I technology (ROCHE, Rotkreuz, Switzerland). The appropriate NgCl2 concentration for each primer pair was optimized. The following reaction mixture was prepared: 2 mM for the LTI3 primer pair or 3 mM for the IL-7 primer pair of MgCl2 e.T I It * I I * * I I I P2540GB00: : . : : 16 January 2006 * I I I I I I I

I I III I I

64/ 156 (25 mM stock), 0.5 pM primer each (10 uM stock each), 2 p1 DNA Master SYBR Green I mix, ddH2O was added to a final volume of 19 p1. Reaction mixture was gently mixed and added to pre-cooled LightCycler Capillary. 1 p1 of cDNA was added to the Capillary.

The cycling conditions were: 10 mm at 94 C, followed by 40 cycles of 10 sec at 95 C, 5 sec at 60 C and 6 sec at 72 C.

The specificity of the PCR product was verified using a melting curve procedure and by electrophoresis through a 2% agarose gel.

Quantitative analysis was performed using LightCycler Software ver. 3.5 (ROCHE Diagnostics), with real time fluorogenic detection. The relative expression level of target genes was measured in triplicate and thennormalized to the expression level of a housekeeping gene. In this study, the TATA box-binding protein (TBP) was used as housekeeping gene (243). The fold difference (as relative mENA transgene expression) between transgenic and WT (or neg. littermate) samples was calculated by the comparative CT method (AACT) and the received values were illustrated.

Quantitative real time PCR II: The quantitative real time brilliant SYBR Green master mix System (Stratagene) was used to determine chemokines mRNA levels in the embryonic small intestine. The Rotor-Gene RG 3000 (Biolabo) was utilized. The reaction mix was prepared as follows: (total volume of lOp1) 2x Brilliant SYBR Green master mix, 0.3 pM of each primer for CCL5, CCL21, GAPDH, CXCL1O; 0.3 pM of 5' primer and 0.9 pM of 3' primer for CCL19; 0.9 pM of each primer for CXCL13 (10 pM stock each). 1 p1 of cDNA (approximately 20 ng) was applied to the reaction. The cycling parameters were: 1 cycle of 95 C for 2 mm followed by 40 cycles of 95 C for 30s, 60 C for 30s and 72 C for 30s. Analysis was followed as described above.

* *5 I I it * I I S I t 4 P2540GB00: : 16 January 2006 * I I * I I U S * S II. S S 65/ 156 PCR analysis with Vent Polymerase containing proof reading System: The Vent polymerase contains a proofreading exonuclease activity and was therefore used to clone the IL-7 ORF. The following reaction mixture was performed: 1 p1 cDNA of adult thymus was incubated with a specific primer pair for IL-7 (each primer 0.4 pM; 10 pM stock) (for the sequences see above under oligonucleotides), 200 pM of each c1NTP, 4 mM MgSO4 (100 mM stock, biolabs), Ix ThermoPol reaction buffer (lOx, biolabs), and 0.4 U VentR DNA polymerase (2000 U/mi; biolabs) . The cycling parameters were: 1 cycle of 95 C for 2 mm followed by 30 cycles of 95 C for 30s, 60 C for 30s and 72 C for 30s. This primer pair produced an amplicon of 496 bp in length.

Single cell suspensions of gut lymphocytes: Coliagenase type I solution: HBSS (GIBCO) containing 10mM Hepes, 25mM CaCl2 and 0.5 mg/mi collagenase I (10 mg/mi stock solution, Sigma) . E16.5 or E17.5 embryos were sacrificed, intestines removed, and separated from the mesenteries. Individual intestines were homogenized between two microscope slides (76x26mm, cut edges, frosted end, MENZEL, Germany) in 2 ml collagenase type I solution, transferred to a 15 ml Falcon tube, and digested for 30 mm at 37 C with agitating. To remove large clumps, samples were passed several times trough a 2lG needle.

ml PBS containing 3% FCS and 2 mM EDTA was then added and samples were filtered through a 40 pm nylon mesh filter into a 50 ml Falcon tube. After a 10 mm centrifugation at 290 x g, pellets were resuspended in 1 ml PBS/ 3% FCS/ 2 mM EDTA and filtered again. Cells were then centrifuged with 290 x g for 5 mm and incubated for 30 mm on ice in 100 p1 PBS/ 3% FCS/ 2 mM EDTA containing the following antibody mix: CD127-FITC (IL-7R); I, , I, * , * I I I I I P2540GB00: : :. * 16 January 2006 * I I I I I I I

I I III I I

66/ 156 CD3-PE; CD4-APC. Cells were further prepared for sorting, washed, and resuspended in 500 il PBS, 3% FCS and filtered trough a nylon mesh filter. Cells were gated as IL-7R CD3' CD4 cells and collected in 500 p1 PBS containing 3% FCS, centrifuged, and further processed for RNA isolation.

Flow cytometry: Cells were homogenized in PBS containing 3% FCS by using microscope slides. Cells were counted and lxlO6 cells were incubated in 50 p1 PBS containing 3% FCS and the mixture of Ab for 30 mm on ice. Ab used for flow cytometry (FACS) analysis are listed above. After washing with PBS-3% FCS, cells were resupended in 200 p1 PBS-3% FCS. Flow cytometric analysis was performed with a FACS Calibur (Bectonflickinson) and data were analyzed with Cell Quest Software. For cell sorting a FACS aria was used (BectonDickinson) Hematoxylin Eosin staining: Slides were incubated in hematoxylin (medite) for 4 mm, rinsed briefly with tap water, incubated 3-5 sec in 70% ETOH containing 0.5% HC1, rinsed again in tap water until nuclei became blue, incubated in eosin (medite), and then in ddH2O for 5 mm. Slides were dehydrated in 70%, 95%, and 100% ethanol and incubated in xylene. Slides were embedded in Entellan (Merck) for microscopical analysis.

Iminunohistochemical analysis: Whole-mount irnmunohistochemistry: PBSMT: PBS containing 1.5% skim milk (M), and 0.1% Triton X-lOO (T); PBS-T: PBS containing 0.1% Triton X-100; TBS: 0.05 M Tris-HC1, pH 7.6; DAB/MC12 solution: 0.05%: 50mg NiCl2x6 H20 in 100 ml TBS. One DAB tablet (Sigma) was dissolved in 15 ml TBS-NiC12 by stirring, filtered, * ci S V Si S V $ * V S P2540GB00 * ; :. : : 16 January 2006

I I I I I I I

* * SI, * I 67/ 156 aliquoted in 800 p1, and stored at -20 C. 1.5 p1 of H202 was added before use.

Small intestines of newborn mice were removed, the organs separated from the mesenteries, and fixed in PBS containing 4% paraformaldehyde (PFA) for 30 mm at 4 C. After absorbing excess PFA with 4% glycine in PBS for 30 mm at 4 C, intestines were dehydrated by incubating with 50%, 75%, and twice with 100% methanol in PBS for 12 mm each at 4 C. To block endogenous peroxidase, the fixed intestines were bleached (methanol: 30% H202; 20:1) for 30 mm at RT. Specimens were further blocked by incubating 2x in PBSMT each time for 30 mm at 4 C and then incubated with PBSMT containing rat anti-VCAN--1 mAb (1:250) overnight at 4 C on a rotor. After washing 4x in PBSMT each time for 15 mm at 4 C, incubation with HRP-conjugated goat anti-rat Ig antibody (1:300) was performed overnight at 4 C on a rotor.

After incubation, the following wash steps were performed: 2x in PBS-T each 12 mm at 4 C, two times in PBS-T each 12 mm at RT, and the final wash in TBS for 20 mm at RT. After the final washing, intestines were incubated in DAB/NiC12 solution until dark spots appeared (expected time: circa 20 mm) . The Reaction was stopped by rinsing intestines with TBS and 2x in PBS for 10 mm at RT.

Immunohistochemistry on cryo-sections: Organs of different strains and different ages were removed and embedded in OCT (SAKURA), gently frozen in liquid nitrogen, and stored at -80 C.

8-10 pm cryostat sections were cut and slides were stored at - 20 C. After thawing slides for 20 mm at RT, sections were fixed with cold acetone (100%) f or 5 mm, air-dried for an additional mm, and washed twice with PBS for 5 mm. After blocking with I I? II

I I

P2540GB00! . I 1 16 January 2006

S I I S I

S * SI, I 68/156 1% BSA/ 0.2% normal goat serum in PBS for 30 mm, sections were incubated with the first Ab in PBS 1% BSA for one hour at RT.

Sections were 2x washed in PBS each time for 5 mm and incubated with the second Ab for 30 mm at RT. All incubation steps were performed in a moist chamber. HRP conjugates were developed as described above. Slides were mounted in Aquamount (Gurr , BDH, England).

Irnmunofluorescence analysis: Double staining with two antibodies of the same species: 10 pm cryo-sections were fixed in cold acetone for 10 mm, air-dried for 10 mm, and then rehydrated in PBS for 5 mm. Sections were incubated with primary Ab in PBS containing 1% BSA, 5% normal goat serum (NGS) in a humidified chamber at RT for 2 hs. After, slides were washed 2x in PBS for 5 mm, sections were then stained in PBS containing 1% BSA and the secondary Ab for 45 mm at RT. Slides were washed 2x in PBS for 5 mm and incubated in 5% NGS in PBS blocking solution for 30 mm at RT. Sections were then incubated with the second 1st Ab in PBS containing 5% NGS and 1% BSA for 2 hs at RT. After 2x washing with PBS for 5 mm, the second 2 Ab diluted in PBS containing 1% BSA were added to the slides and 45 mm incubated at RT. After Ix wash with PBS and a final wash with H20, sections were embedded in Moviol.

The following Ab were used: staining I: 1st Ab: rat anti-VCAN-l (1:200), 2 Ab: goat anti-rat-Cy3 (1:50); and l Ab: rat anti- MHC class lI-biotinylated (1:100), 2 Ab: streptavidin-conjugated FITC (1: 200) . Staining II: 1st Ab: rat anti-CD4 (hybridoma, H129-19.6), 2 Ab goat anti-rat Cy3 (1:50); and 1st Ab: MI-IC class II biot. (1:100), 2 Ab: streptavidin-FITC (1:200) , I t I

I I I I I

P2540GB00 1 16 January 2006

I I I I P I I

I I III I I

69/ 156 Visualization of LN in adult mice: 20 p1 of 1% Chicago blue ink in PBS was injected into the hind footpads of mice. One to two days later mice were sacrificed, analyzed for ectopic LN-like structures and documented by using a digital camera.

Example 1: Stromal factor transcripts expressed in the murine enthryonic intestine Previous data from the inventors laboratory indicated that IL-7 and BN stromal cells are essential for supporting growth! survival of inducer cells in vitro. BM stromal cells provide a wide range of factors important for haematopoietic progenitor cells (HPC), such as interleukins, SCF, GM-CSF, and N-CSF. These components are haematopoietic growth factors sharing a number of properties important for proliferation and survival of haematopoietic cells. For instance, SCF has been shown to be essential for the continued viability of multipotent stem cells and IL-7 is a crucial proliferation! survival factor for lymphocytes during the early stages of B and T cell lineage development. In addition, BM stromal cells produce chemokines, for example CXCL12, which can mediate the homing and localization of HPC. In analogy to cell-to-cell interactions between BM stroma and HPC, stromal cells in developing secondary lymphoid organs may also provide factors crucial for recruitment and survival of fetal inducer cells. Inducer cells are known to express CXCR4, the corresponding receptor of CXCL12, c-kit, the receptor for SCF, and IL-7R, the receptor for IL-7 (40, 42) To test whether SCF, GN-CSF, TGF-f3, CXCL12, and IL-7 transcripts were expressed in the fetal intestine, reverse transcriptase PCR (RT-PCR) were performed. Specific, intron-spanning primers were designed to distinguish amplification of genomic DNA. RNA from P2540GB00 16 January 2006 70/ 156 embryonic total gut (E16.5) were compared with RNA from adult BM cells and from a BN stromal cell line (ST-2) . The amplicons showed the expected size. GN-CSF mRNA was weakly detected in ST- 2 cells and adult BM, whereas GM-CSF rn.RNA was stronger expressed in the fetal intestine. TGF-3, SCF, CXCL12, and IL-7 were expressed in the fetal intestine, in the ST-2 cells, and in the adult BM. In order to test whether these growth factors were produced in stromal cells, mRNA expression of the same genes were analyzed in several fetal stromal cell lines, which were isolated from Ell mouse embryos. These were stromal cell lines from the fetal liver (FL), the gastrointestinal tract (GI), and the urogenital tract (UG) (295, 296). No expression of GM-CSF was observed in the ST-2 cells in the second experiment, whereas weak expression was detected in one of the GI stromal cell lines, and in the UG stromal cell line. All other examined genes, TGF-, SCF, CXCL12, and IL-7 were expressed in the 4 fetal stromal cell lines.

The data show that fetal murine gut contains transcripts for factors, which may contribute to the recruitment and maintenance of fetal inducer cells. In addition, these factors are produced by stromal cells in the early embryonic life. The detection of IL-7 transcripts in the GI stromal cell line is in accordance with the finding that VCAN-l mesenchymal stromal cells (organizer cells), which are involved in the process of PP organogenesis, express IL-7 transcripts. It was not tested whether intestinal epithelial cells might also be a source of IL-7.

Figure 13 Detection of growth factor transcripts in the fetal intestine and in fetal stromal cell lines P2S40GBO0:: : :: . 16 January 2006 71/ 156 (A) Total RNA from fetal gut, adult BM, and BM stromal cell line (ST-2) were isolated and reverse transcribed. PCR with specific primers for GM-CSF (amplicon size: 200 bp), TGF-3 (300 bp), SCF (250 bp), CXCL12 (120 bp), and IL-7 (250 bp) was performed. 13-actin (350 bp) expression is shown as control. (B) As in A, PCR was performed to detect indicated transcripts in different fetal stromal cell lines isolated from Eil embryos. FL, fetal liver; GI, gastrointestinal region (2 different clones); UG, urogenital ridges. PCR reaction products were amplified with 40 cycles.

Following PCR, a sample of each reaction was run on a 1% agarose gel, which was then stained with ethidium bromide and photographed. These results were obtained from one experiment with one individual cDNA each.

Example 2: Generation of CIITA IL-7 double tranagenic mice Two different transgenic mice, MHC class II IL-7TG and CIITA TG mice were intercrossed. NHC class II IL-7TG mice contain the mouse IL-7 cDNA driven by the mouse NRC class II EcL promoter (description of the construct in Fig. lA) (170) . In CIITA TG mice, comprising a CIITA transgene construcht according to Fig.lB, the MHC class II transactivator is under the control of the ubiquitous SRa promoter (243). The CIITA transgene construct consists of the mouse CIITA cDNA (mCIITA), the SRa viral promoter, the locus control region of the metallothionein gene (MT5' and NT3'), and the 3' untranslated region derived from the SV4O early poly(A) site (SV4O polyA). The intron (V shape) in the coding region (filled box) is derived from the mouse CIITA gene. According to one preferred production method, female CIITA TG mice were crossed with male IL-7TG mice to avoid the risk of placental IL-7 transfer. The mechanism of transgenic IL-P2540GB00 16 January 2006 72/156 7 expression in double TG offspring is described in Fig. 2. In brief, in CIITA TG x IL-7TG (double TG) offspring, the SRa promoter drives the synthesis of CIITA. The non-DNA-binding CIITA coactivator binds to transcription factors, which bind to the MHC class II promoter sequence and hence induce transcription. The SRa promoter is ubiquitously active.

Therefore the transgene interaction resulted in an increase in MHC class II antigen expression and an increase in levels of IL-7 transcripts and protein which was totally unexpected in its magnitude and can only be explained by a synergistic effect of both transgenes. In addition, the SRa promoter is active during embryogenesis, which consequently leads to increasing levels of both MHC class II and IL-7 molecules early in embryonic life.

This early onset in embryogenesis compared to single IL-7TG was another unexpected effect of the two transgenes. In double transgenic matings, the litter size and the survival rate were comparable to normal B6 WT mice. For mouse genotyping, CIITA-mediated MHC class II expression and IL-7 transcription were tested by flow cytometry and PCR, respectively, as described in materials and methods. In double TG mice, MHC class II was expressed by non-haematopoietic (CD45) fetal liver cells as well as in a fraction of haematopoietic cells (Fig. 3A) . In adult mice, MHC class II expression was found in haematopoietic as well as in non-haematopoietic cells. Also TCRa3+ T cells expressed MHC class II, which allowed screening by FACS.

A critical phase in the organogenesis of PP is as early as at the embryonic day 14 (El4.5), when inducer cells Start to colonize the embryonic gut (40) . Therefore, we wanted to elucidate in double TG mice, first, whether the SRa promoter was * S I I I C S I P2540GB00. a. a * . 16 January 2006 * S I I I I S I I * I I S I I I I

I I III I S

73/156 active at El4.5 and second, whether IL-7 mRNA levels were above single IL-7TG and neg. littermates. As shown in Fig. 3A, in the fetal liver at E14.5, CD45 MHC class I1 cells were detectable in double TG, but not in the single IL-7TG or in neg. littermate animals. Note the relatively low percentage (14.9% in El4.5 and 16.7% in El6.5 fetal liver CD45 cells) of NHC class II positive cells. However, the results were above that seen in single IL- 7TG or neg. littermates.

To determine whether at E14.5 IL-7 mRNA levels in double TG compared to single IL-7TG and neg. littermates were increased, quantitative real time PCR (qRT-PCR) was established. Total RNA was isolated, treated with DNase I to eliminate the remaining genomic DNA, and reverse transcribed as described in materials and methods. qRT-PCR with specific IL-7 primers was performed.

In this regard both endogenous and transgenic IL-7 mRNA were measured. IL-7 cycle threshold (CT) values were normalized to TBP and the fold increase was calculated by the MCT method using neg. littermate values as calibrator. Double TG El4.5 liver revealed a 6-fold increase in IL-7 mRNA expression level, whereas no increase was found in single IL-7TG. To monitor that IL-7 mRNA expression level was retarded in single IL-7TG compared to double TG animals, qRT-PCR with cDNA from newborn livers was performed. A 57-fold increase of IL-7 mRNA in double TG and a 8-fold increase in single IL-7TG liver samples were detected. No amplification was detected in samples for which reverse transcriptase was left out of the cDNA synthesis reaction.

These data show that in double TG animals total IL-7 transcript is increased as early as E14.5, whereas no such increase is P25400B00:: i 16 January 2006 74/ 156 found in single IL-7TG mice, suggesting an early activity of the Srcxpromoter and its product the CIITA. In single IL-7TG animals, increased IL-7 mRNA level compared to neg. littermate is detected later in the developing liver.

The early function of the transgenie CIITA in double TG embryos is shown in Figure 3: (A) Fetal liver cells (El4.5 and E16.5) of double TG (left panels), single IL-7TG (middle panels), and neg.

littermates (right panels) were stained for CD45 and MHC class II. The numbers in each panel represent the percentage of cells in the live gated liver leukocyte cell population. In double TG mice, CD45" liver cells expressed MHC class II compared to single IL-7TG and neg. littermates indicating a funetional transgenie CIITA molecule at this early stage of development.

This is a representative result for at least 5 independent experiments. (B) To detect IL-7 mRNA levels in double TG and single IL- 7TG embryos and newborns compared to neg. littermates, qRT-PCR was performed. Total RNA from E14.5 and newborn livers were extracted and treated with DNase I. cDNA were prepared and qRT-PCR was used to detect total IL-7 mRNA expression levels.

Samples were normalized to murine TBP and fold increase of transgenie normalized IL-7 mRNA levels to neg. littermates were calculated using the AACT method. A 6-fold increase of IL-7 mRNA level was calculated for double TG sample, whereas no increase was detected in single IL-7TG animals at El4.5 (left graph). In the livers of newborns (right graph), IL-7 mRNA levels were increased in both double TG (57-fold) and in single IL-7TG (8-fold) . The results are from one experiment with one individual of each group.

Example 3: Morphology of double transgenic mice p2540GB00:: 16 January 2006 75/ 156 Surprisingly, double TG adult mice were much smaller in size compared to Single IL-7TG and neg. littermates. Fig. 4A shows a six week (6-wk) old double TG mouse (weight, 10 g) and its neg.

littermate (20 g) . To perform a growth curve, body weight was measured weekly and results depicted in Fig. 4B. Female mice from two litters were used to accomplish the growth curve. At 4-wk of age, double TG mice weighed about 30% less than their neg.

littermates. The Student's t test revealed no significant difference (P=0.l6) of body weight between double TG (9.55 g 1.57, n=4) and neg. littermates (11.2 g 1.37, n=4) at 3-wk of age, whereas at 4-wk of age the P value of 0.0006 clearly indicates a significant difference between double TG (10.2 g 1.15, n=4) and neg. littermates (15 g 0.86, n=4). There was no difference of body weight between neg. and single IL-7TG littermates (data not shown) . Double TG mice survived as smaller sized-animals. To further understand the different size of double TG mice, we questioned whether a malformation of the teeth might be a reason for the growth retardation. The inspection of teeth revealed no difference, suggesting that double TG animals were capable to get a normal ingestion.

Another possible explanation might be a malformation of the skeleton in double TG mice. Therefore, we analyzed the bone morphology of double TG animals and compared it to single IL-7TG and neg. littermates.

Indeed, a remarkable deformation in bone structure of all analyzed double TG animals were observed. Typical femurs of 6-wk old mice of all three types are shown in Fig. 4C. No difference in bone structure of single IL-7TG and neg. littermates were present, whereas the double TG femur showed a massive increase in the long bone diameter. After Proteinase K treatment, femur * It I I It * I I I I I I I P2540G300 a a a. * 16 January 2006 * I I I I I I I I I I I I I * a * I III I I 76/156 and tibia of double TG animals showed a spongelike structure of the bone mass (Fig. 4E, F). The diameter of each examined bone was measured in the middle. The diameter of the double TG femur (0.35 cm) was double the size than the diameter of the neg.

littermate femur (0.15 cm) . The same increase in bone diameter was measured for the tibia, namely 0.2 cm for the double TG compared to 0.1 cm for the neg. littermate. In length, both femur and tibia were shorter in double TG compared to neg.

littermate, namely for the femur of double TG 0.8 cm and of neg.

littermate 1 cm, and for the tibia, 1.2 cm and 1.4 cm, respectively. The spongelike structure leads to higher bone fragility in double TG mice. Interestingly, no gross difference in weight of femur (double TG, 18.3 mg; neg. littermate, 15.6 mg) and of tibia (double TG, 14 mg; neg. littermate, 15.5 mg) were measured indicating the presence of a bone malformation rather than a loss of bone mass. Examination of bone from newborn mice revealed no malformation at this stage of development and diameters of the examined bones were the same for all animals (Fig. 4D) . This result suggests that a malformation appears during the growth period after birth. In 2-wk old mice, the diameter of bone cavities was severely enlarged (not shown) although absolute cell numbers in the BM were only increased by 30% (6.9x105 cells in double TG vs 4.8x105 cells in control mice) Taken together, double TG animals are smaller in size and display a significantly reduced body weight from 4-wk of age onwards. Furthermore, a severe malformation of the long bones is present in these animals. However, whether this bone malformation is responsible for the smaller double TG adult mice has further to be analyzed. For instance, it has to be * St S V VS * V I V 5 4 5 I P2540GB00. . s * 16 January 2006 * I I V I I S I S * I U S I I S I * I III S I 77/156 determined whether different growth hormone levels contribute to this phenotypic appearance.

Figure 4 illustrates the phenotypic observations in double TG animals: (A) Different size of 6-wk old adult double TG and neg.

littermates. Double TG animals were smaller in size and weight.

(B) Growth curves of female double TG (red Symbols) and neg.

littermates (blue Symbols) . Body weight was measured weekly over a 5-wk period. Each data point represented the mean SD of values from 2-4 animals of two litters in each group. Double TG littermates showed a reduction in body weight of approximately 30% of the neg. littermates from 4-wk of age onwards. (C) Representative picture of the bone abnormality in double TG animals. The femur diameter of double TG was massively enlarged, whereas femurs of single IL-7TG and neg. littermates showed normal bone diameters. (D) Representative picture of two double TG femurs (left) and two single CIITA TG femurs (right) from 2.5 day old neonates. Closer look of double TG femur (E) and tibia (F) revealed a spongelike morphology after proteinase K digestion. No gross differences in weight of femur and tibia from double TG and control mice were found.

To further characterize morphological differences in double TG animals, secondary lymphoid organs were analyzed. Phenotypically, no difference in size of thymus from double TG animals was seen (data not shown) . Architecture and cellularity were not further analyzed in the thymus. A massive enlargement of the spleen was detected in 8-wk old double TG animals compared to Single IL-7TG and neg. littermates (Fig. 5A). This striking phenotype was already present in double TG neonates. Fig. SB shows two spleens of double TG newborns (weight of spleen from mouse 1: 8.3 mg; I It * I P2540GB0O 16 January 2006 78/ 156 mouse 2: 10 mg), which were double in weight, compared to spleens of single CIITA TG littermates (mouse 3: 4 mg; mouse 4: 4.4 mg) . After homogenization of the spleen, cells were counted using a microscope counting chamber, and FACS analysis performed.

Percentage of a live gate, which discriminate leukocytes from dead cells and erythrocytes, were used to calculate the absolute splenic leukocyte cellularity. In adult double TG animals, the splenic cellularity was increased approximately 9-fold (mean number of cells 15.7 x 108 7.2 x 108, n=4) above the total number of spleen cells from neg. littermates (1.7 x 108 2.4 x 1O7, n=6) (P0.0012) (Fig. 16C, left graph) . Single IL-7TG littermates revealed a mean number of 6.8 x 108 1.5 x 108, n=6, which was also significantly above the cell number of neg.

littermates (P0.0001). The increase of splenic cellularity in double TG animals was with aP value of less than 0.029 also significant higher than the cellularity of single IL-7TG animals.

The enlarged spleens of double TG newborn animals displayed likewise an increased cellularity. Spleens of double TG newborns revealed a mean of 3.4 x 106 1.5 x 106 cells, n=ll, whereas single CIITA TG had a mean of 1.6 x 106 8.9 x l0 cells, n=12 (P0.0017) (Fig. 5C, right graph) . The total cell numbers of newborn mice presented here were the result of spleens from 4 individual litters. Likewise, all LN were increased in size in single IL-7TG and even more pronounced in double TG animals.

Large inguinal LN (ILN) and the popliteal LN (P0LN) were shown in Fig. 5D as representatives for all peripheral LN.

Taken together, these results show that in double TG animals an increased level of IL-7 mRNA has an more dramatic effect on lymphohaematopoiesis than the one reported in single IL-7TG animals.

S VS t 5 ft P2540GB00: 16 January 2006 79/ 156 The increased size of the spleen and lymph nodes from IL-7TG animals are shown in Figure 5: (A) Different sizes of adult spleens from neg., single IL-7TG, and double TG littermates (8-wk old). (B) Photograph of spleens from newborn double TG mice (1,2) and single CIITA TG mice (3, 4) . Double TG newborn spleens were double the weight of single CIITA TG control spleens. (C) Listed were calculated and live gated absolute cell numbers of adult (left graph) and newborn (right graph) spleens from double TG (dots in red), single IL-7TG, and neg. littermates, and double TG and single CIITA TG littermates, respectively. (D) Increased size of LN, shown are representative for all LN and illustrated by arrows, inguinal (ILN) and popliteal (P0LN) of an 8-wk old double TG animal.

Example 4: Cellular architecture of secondary].ymphoid organs To determine whether the architecture of the enlarged secondary lymphoid organs in double TG mice was disturbed, immunohistochemical analyses of frozen sections were performed.

Ab specific for B cells (anti-B220) and T cells (anti-CD3) were used to detect the segregation of B and T cell areas in the examined organs. Sections of spleen, small intestine, and LN of 4-wk old double TG animals (pictures on the left hand side) were compared with sections of neg. littermates (pictures on the right hand side) (Fig. 6) . The demonstratedsections are representative for the examined slides. As shown in Fig. 6A and 6C (higher magnification), the T cell area in the white pulp of the spleen from a double TG animal showed three major differences compared to the T cell area of a neg. littermate shown in Fig. 6B and 6D (higher magnification) . First, the T cell area was smaller in size. Second, the T cell zone was less I t ** P2540GB00: :: 16 January 2006 80/ 156 compact and infiltrated by B220 B cells. Third, the T cell area was displaced from the central arteriole (indicated by arrows) The disturbance of the T cell area in the double TG spleen might be due to the increased number of B cells. This is further reflected by the numerous B220 B cells found in the red pulp of the double TG spleen. B220 B cells were found in follicles of double TG sections, which were not significantly larger compared to follicles in neg. littermate sections. In addition, B cells were diffusely arranged around T cell areas. The analysis of ILN revealed again not an increased size of follicles in double TG animals (Fig. 6E) compared to the neg. littermates (Fig. 6F) Further analyzed were two sections of the total intestine from double TG animals or neg. littermates. Labeling of frozen sections of PP with anti-CD3 and anti- B220 Ab showed that PP of double TG animals contained normal segregated B and T cell zones (Fig. 6G). Fig. 6H showed a representative PP from a neg.

littermate mouse. Interestingly, in double TG mice, the numbers of follicles per examined PP (n=20) compared to neg. littermates PP (n=3) were increased. The average number of detected follicles in PP was 6.2 2.5 compared to 2.67 0.6 from neg.

littermates (P = 0.0025) . Although only two sections were analyzed the number of follicles per PP was 2.3-fold increased and the follicles per se were larger in size in double TG animals, which reflects the overall observation that PP are increased in size in these mice.

Figure 6 shows a comparison of secondary lymphoid organ architecture of double TG and neg. littermates: Shown are double immunohistologically stained representative sections of the spleen, ILN, and PP from 4-wk old double TG or neg. littermate a a

I I I I I I I I

P2540GB00 a a a a 16 January 2006 I I I I a I I I a a a a I I I I

I I III I I

81/ 156 animals. B and T cells were identified by staining with anti-B220 (brown) and anti-CIJ3 (blue) Ab, respectively. In the spleen, double TG mice (A) showed a smaller and less compact T cell area, which was not arranged around a central arteriole (indicated by arrows) compared to neg. littermates (B) (original magnification xlOO). The B cell area was less closed and the transition to the surrounded area more diffuse such as seen in the neg. littermate.

Panels (C) and (D) display a higher magnification (x200) of the spleen sections from double TG and neg. littermates, respectively. ILN of double TG (E) compared to neg. littermate (F) showed no gross differences in the size of follicles (original magnification xlOO). (G) Section of PP architecture from double TG and (H) from neg. littermate (original magnification xlOO).

Example 5: Increased B lymphopoiesis in bone marrow of double TG mice IL-7 is crucial for the development of B and T cells. IL-7 mice show a dramatically impaired lymphocyte development, whereas in IL-7TG mice, a massive increase in numbers of both B and T lymphocytes was reported (154, 170). To test whether double TG mice have even a more dramatic effect on lymphocyte development, FACS analysis was performed. The absolute cell numbers of different subsets of B cells in the BM were calculated (not shown), and the ratios of double TG to neg. and single IL-7TG to neg. littermates were depicted in Fig. 18. B cell subpopulations were gated out of the CDl9 population.

Total CDl9 B cells were increased 3.4-fold in single IL-7TG and 11.5-fold in double TG mice. IgM cells include immature, mature, and re-circulating B cells and the ratios of these subsets were for single IL-7TG 7.9 and for double TG 19.

PP I P P1 P254OGBO0 16 January 2006 82/156 CDl17' cells, which are revealed as Pro-B and Pre-BI cells, were augmented 7.4-fold in single IL-7TG and strikingly 76-fold in double TG animals. The CD25' cell subset contains large Pre-B cells and small Pre-B cells. The ratios of this B cell subpopulation were for single IL-7TG 13.2 and for double 25.7.

CD93' cells (493, AA4.l) revealed a ratio of 12.2 in single IL-7TG and a ratio of 36.6 in double TG animals. This subpopulation includes all stages of B cell development except mature cells. Finally, CD23' mature and recirculating B cells were 5.2-fold increased in single IL-7TG and 13.9-fold in double TG mice.

Taken together, as shown by the ratio in each subpopulation obtained from these mice, there is a progressive increase of all immature stages of B cell development from neg. littermates through single IL-7TG to double TG mice. This indicates that the double TG animals are behaving as predicted, namely increasing even further IL-7 gene transcription and indirectly IL-7 protein availability. In conclusion, the combination of two transgenes, IL-7TG and CIITA, results in a phenotype with increased absolute cell numbers of IL-7-sensitive B cell subsets in the BM.

Figure 7 illustrates the increased B cell lymphopoiesis in double TG and in single IL-7TG animals: BM cells of 4-wk old double TG, single IL-7TG, and their neg. littermates were stained with the initiated markers for the different B cell subpopulations, which were gated on CD19 cells. Shown are the ratio of the absolute cell numbers of each subpopulation in single IL-7TG vs neg. littermate (black bars) and double TG vs neg. littermate (diagonal pattern bars) . Results are representative of two independent experiments.

t I I I a a I t P2540GB00 a at: 16 January 2006 I a a a a a a a a I ait I a 83/156 Example 6: Phenotypic characterization of peripheral T cells The increase in size of the spleen and cell number prompted us to further investigate the B and T lymphocytes and subsequently T cell subpopulations in double TG, Single IL-7TG, and neg.

littermates. A dramatic increase of both peripheral B and T cells in IL-7TG mice was already reported (170) . Therefore, we wanted to determine whether in double TG mice the peripheral T cell pool is even more affected. The ratio of B cells (B220 cells) and T cells (CD3 cells) in the spleen remained the same in double TG compared to single IL-7TG and neg. littermates, whereas the absolute cell number of both B and T cells increased 6-fold and 4.5-fold in single IL-7TG and 27-fold and 20-fold in double TG, respectively (Fig. 8 A, B). Typical Absolute B and T cell numbers of the three types are listed in Fig. 8A. To characterize in more detail the splenic T cell pool, additional markers were used, namely CD44 and CD62L. These two markers can distinguish naive T cells, which are CD441OW and from effector and memory cells, which are considered as CD44h1t CD62L and/or CD44h1 CD62L cells (297, 298) . Several reports described that after homeostasis-driven proliferation naïve T cells acquired a Imemorylikeu T cell phenotype without passing the classical way of activated to memory T cells (299-301). Data presented in Fig. 8B clearly demonstrate an increased percentage of the CD3 CD44' CD62U T cell subset in the spleen of double TG animals (49%) compared to their neg. littermates (12%) Although to a lesser extend this T cell subset is also increased in the spleen of single IL-7TG animals (31%) . This is similar to the results obtained from IL-7TG mice, where it was reported that the expansion of memory CD8 CD44' cells was due to the overexpression of IL-7 in an IL-15-independent way (302) P2540GB00 16 January 2006 84/'156' However, further analysis of this CD3 CD44" CD62L T cell subset using T cell activation markers, such as CD69 and CD25, which are known to be induced on antigen-activated effector T cells, revealed no classical activation Status of these cells (data not shown).

In conclusion, this expression profile reflects that the IL-7 transgene increases the pool of CD44h1 CD62L cells even more dramatically in double TG than in single IL-7TG animals. There are no signs of an acute activation of this T cell subset in double TG mice, suggesting that this cell population might reflect the umemoryliket phenotype population, rather than activated cells.

Figure 8 shows the increased number of both B and T lymphocytes and subsequently increased percentage of CD44 CD62L T cell numbers in the spleen of double TG mice: Spleens of 4-wk old were collected and homogenized cells stained for B220, CD3, CD44, and CD62L and analyzed by flow cytometry. (A) Absolute B22O B and CD3 T cell numbers of double TG, single IL-7TG, and neg.

littermates (in brackets fold difference to neg. control) are indicated. (B) Expression of CD44 and CD62L on gated CD3 cells.

Numbers indicate the percentage of total live cells in each gated box. Increase in percentage of CD44 CD62L T cells in double TG (49%) compared to Single IL-7TG (31%) and neg. (12%) littermates. CD62L CD44b0 T cells are considered naive; CD62L CD44t1 and CD62L CD44' cells are considered activated or memory cells (297) . These data are representative for two independent experiments.

P2540GB00 16 January 2006 85/ 156 Example 7: Double tranagenic mice show an increase in Peyer's patch nu.nibers The influence of an increased IL-7 level on the development of PP was studied. We first examined the small intestine of double TG, single IL-7TG, and neg. adult littermates under a dissecting microscope with respect to PP numbers. All examined mice were between 4-wk and 4 months of age. A significant 3-to 4-fold increase in Pp numbers was observed, namely between 20 and 28 pp (mean 23.3 2.5, n=l4) in double TG compared to 6 to 9 (mean 7.5 1, n=l4) in neg. littermates (Fig. 9) . The numbers of PP of IL-7TG mice (mean 8.25 1, n=8) were similar to neg.

littermates. A comparison with Student's f-test in these two groups revealed a p value of >0.15, indicating that the number of PP was not significantly different. These data clearly indicate that one allele of the IL-7 transgene is not sufficient to increase the number of PP in adult single IL-7TG mice, whereas the coexpression of the IL-7 transgene and the CIITA transgene was followed by an increase in IL-7 transcripts and a significant higher number of PP. In Figure 9 the increased numbers of PP in double TG mice are illustrated: PP numbers were counted in double TG (mean SD, number of mice) (23.3 2.5, n=l4), single IL-7TG (8.25 1, n=8), and neg. (7.5 1, n=14) littermates. The box and whiskers plot shows range and quartiles. The box extends from to the 75th percentile, with a line at the median (the 50th percentile) The whiskers extend above and below the box to show the highest and lowest values.

Example 8: Increased number of VCN-l organizing centers in double tranagenic mice a ii I V II * * I * I * I I P2540GB00 a a a e I * a. 16 January 2006 * I I I I I I I I e I I I I I I I

I I III I I

86/ 15 6 Since it could not be exclude that the higher number of PP was due to an effect occurring during adult life, we analyzed PP formation in newborn mice. Performing whole mount immunohistochemistry of embryonic gut, Adachi and colleagues (46) reported that VCAN-1 cell clusters (designated as VCAN clusters) are sites where PP develop. As early as E16.5, one to two VCA.N clusters are found exclusively in the proximal part of the small intestine, whereas at birth, up to 8 VCAN clusters can be detected distributed over the whole small intestine of B6 mice (46). Using flow cytometry, we observed a significant increase in the number of VCAN-1iCA'i-l organizer cells in the intestine of E16.5 double TG mice.

Using whole mount inimunohistochemistry, we analyzed VCAN-1 cluster in the small intestine of newborn double TG, single IL- 7TG, single CIITA TG, and neg. littermates. Fig. bA and B show representative pictures of newborn small intestines from double TG and neg. littermates, respectively. A clear increase in number of VCAM clusters on the double TG small intestine was detectable. These VCAN clusters were randomly distributed over the whole small intestine with an accumulation of clusters in the middle part, the jejunum of the small intestine. In neg.

littermates, two VCAM clusters were found in the proximal part (duodenum), in the middle part (jejunuin) were two clusters found, whereas in the distal part (ileum) four clusters were detectable.

The distribution of VCAN clusters in the neg. littermates is in accordance to the literature. A closer look to representative clusters designated as type 1 from double TG and neg. littermate revealed a comparable size and form (Fig. 1OC) . Occasionally, in double TG mice, two additional forms of clusters mostly found in the proximal part were detected and shown in Fig. bUD. Type 2 of a at I It * I I I I I I I P2540GB00: : : : : : 16 January 2006 * I I I I I I I * , elI I I 87/ 156 VCAN clusters was not included in the statistics shown in Fig. bE. Type 3 resembles closely accumulated VCAN clusters. Type 3 VCAN cluster was counted as one cluster.

The result of all examined small intestines is illustrated in Fig. 1OE. The mean number of VCAN clusters from double TG mice was 31.2 9.4, which was significantly higher (4.5-fold) compared to the mean 6.6 1.3 number detected on small intestines of double neg. littermates (P<0.0001; n=8 and 10 for double TG and neg. littermates, respectively) . No such increase was found in single IL-7TG (mean 8 2, n=12) or in single CIITA TG (mean 7.3 2, n=9) littermates.

Interestingly, at E16.5, VCAN-l cells were distributed in several zones over the whole small intestine of double TG embryos, as shown in Fig. bE. One litter with three individual double TG and two individual control littermate embryos were analyzed. Surprisingly, and in contrast to the literature mentioned above, in the small intestine of the neg. littermate, VCAN-l clusters were even present in the distal part.

Taken together, an increased number of VCAN-1 organizer cells is detectable at E16.5. At this early step of differentiation, the cells form segregated zones all over the gut rather than isolated cluster. The fold increase in PP numbers of double TG mice was comparable in neonatal and adult animals. These data demonstrate that in double TG animals, the effect of transgene expression during embryonic development determined PP numbers already before birth. Moreover, these data show that one allele of the IL-7 transgene was not sufficient to amplify significantly the number of VCAM clusters in newborn mice.

* ** I * *I * I I I S I I I P2540GB00: : . . : : : 16 January 2006 * I I I I I S I * I III I S 88/ 156 Figure 10 shows the increased number of VCAN-1 cell clusters in double TG neonates Macroscopic view of representative whole mount immunohistochemical staining with anti-VCAN-1 antibodies from newborn double TG (A) and neg. littermate (B). VCAM clusters are indicated by arrowheads. (C) Comparable size and shape of clusters from double TG and single CIITA TG littermates (Type 1). (D) Occasionally, particular clusters in double TG animals were found (Type 2 and 3) . (E) Graph with dots (horizontal lins indicate means of each group, mean SD, n=numbers of animals) represents the calculated numbers of VCAN clusters in the intestine of double TG (31.2 9.4, n=8), single IL-7TG (8 2, n=l2), single CIITA TG (7.3 2, n=9), and neg.

(6.6 1.3, n=lO) littermates. Type 2 of clusters was not included in the counting and type 3 was counted as one cluster.

(F) VCAN-l staining of embryonic small intestines from double TG (top panel) and neg. littermate (lower panel) (E16.5) . Zones of VCAM-1 cells (indicated by arrows) were identified over the whole small intestine of the double TG embryo, whereas in the neg. littermate (lower panel), a view single VCAN-1 cell clusters were present.

Example 9: IL-7 niRNA expression level in double transgenic mice To test whether the enormous increase in numbers of VCAN-l organizer centers and PP correlates with an increased IL-7 mRNA level in the gut, real time PCR was carried out. The SRa promoter was previously reported to be active in different organs of the CIITA TG mouse, such as skin, liver, kidney, lung, and various lymphoid organs as well as in early embryonic life (243). As we have previously shown in Fig. 3B, IL-7 mRNA levels were already increased in the liver of double TG animals at * ,* I I II * I I I I I I I P2540GB00 1 * : : :. 16 January 2006 * I I I * * 4 I * I III * I 89/ 15 6 E14.5. IL-7 mPNA levels in the fetal gut of double TG, single IL-7TG, and neg. littermates were compared. Intestines were dissected at E16.5, total ERA extracted, and treated with DNase I to remove contaminatiog genomic DNA. Because the IL-7 transgene is a cDNA having an identical sequence to that of cDNA generated by RT-PCR, a rigorous DNase treatment of ERA samples is essential in order to exclude amplification of genomic DNA.

The RT-minus control assures absence of DNA contamination of ERA samples. qRT-PCR with specific IL-7 primers was performed. In this regard, total (endogenous and transgenic) IL-7 mRNA was measured. IL-7 CT values were normalized to TBP and the fold difference was calculated by using negative litter values as calibrator. 5.6-, 6.6-, and 10-fold increase of IL-7 mRNA in double TG mice compared to litter controls was observed. In contrast, only a 2-fold difference of IL-7 mRNA level was found in single IL-7TG mice compared to neg. littermates (Fig. 11) These results show a significant increase of IL-7 mRNA in the intestine of double TG animals at E16.5.

Figure 11 illustrates the determination of IL-7 mRNA levels in double TG and single IL-7TG mice ERA from three individual El6.5 intestines of double TG, one single IL-7TG, and two neg.

littermates were isolated and qRT-PCR performed. Values were normalized to TBP and fold difference between TG and the average of two neg. littermate values calculated by the ACT method. A 5.8-fold, 6.6-fold, and 10-fold increase of IL-7 mRNA levels in double TG mice and a 2-fold increase in single IL-7TG mice were determined.

Example 10: Immunohistocheinical analysis of the embryonic gut I, , I, * I I * S I I I P2540GB00: : . * : : : 16 January 2006

I S I I I S S

I I Ill $ I 90/ 15 6 The increased number of VCAN-l cells found over the whole small intestine of double TG embryos and the increased level of IL-7 mRNA prompted us to analyze the embryonic gut at E16.5 in more detail. Therefore, inimunohistological stainings of cryo-sections from double TG compared to single IL-7TG embryonic gut were performed. As shown in Fig. l2A (right panel), more VCAN-1 cells were found clustering together compared to single IL-7TG in Fig. l2B, which was representative for all clusters found in the three individual examined animals of each group. This is in accordance with the finding obtained from the whole mount experiment. To test whether this finding was due to a higher number of CD4 cells found within the VCAM-1 clusters, anti CD4 Ab were included in the analysis. As shown in Fig. 12C (right panel), an increased number of CD4 cells were detected in sections of double TG gut compared to sections of single IL-7TG littermates. As shown in Fig. l2A (lower panel), in double TG sections, occasionally colocalization of VCAN-1 and class II was detectable, whereas almost all MHC class II cells coexpressed CD4 (Fig. 12C, lower panel). In single IL-7TG mice, only a view MHC class 1I cells were detected (Fig. l2B, D), which did not coexpress VCAN or CD4.

Taken together, in the embryonic small intestine of double TG animals, higher numbers of VCAN-l cells and CD4 cells were present at El6.5. Furthermore, the data obtained by confocal microscopy indicate that NHC class II molecules are mainly found on CD4 cells and although to a lesser extend on VCAN-l cells in the embryonic intestine of double TG mice, whereas in analyzed sections of single IL-7TG intestine no such coexpression occurred. This result might suggest that in double TG embryonic I I. I I P2540GB00: 16 January 2006 91/156 intestines, one source of the IL-7 transgene are CD4 cells.

Another source of IL-7 transgene might be VCAN-l stromal cells.

In Figure 12 the colocalization of CD4 and MHC class II on double TG is shown: Sections of E16.5 intestine of double TG (left) and single IL-7TG (right) animals were stained either for MHC class II (green) and VCAN-l (red) (A, B) or MHC class II (green) and CD4 (red) (C, D) . Analysis was performed by confocal microscopy. In double TG mice, colocalization of class II and CD4 (seen as yellow cells), and of class II and VCAN-1 was depicted, whereas in single IL-7TG mice no colocalization of these two combinations of Ab were detected. This is representative of three different individual mice.

Example 11: Inducer cells are dependent on IL-7 Lymphoid tissue inducer cells are crucial for the formation of PP. Although detectable in IL-7Ramice, these cells are unable to form clusters in the absence of a functional IL-7R signaling pathway (40, 132) . At the time of birth, secondary lymphoid organs contain various types of haematopoietic cells.

Phenotypically, we could distinguish inducer cells as IL-7Rc.C CD4 CD3 CDllc cells from CD11c cells, which have a subset of CD4 CD3 cells, in newbom mice (data not shown) To study whether IL-7 has a direct effect on inducer cell (IL- 7R CD4 CD3) numbers, we determined total inducer cell numbers in both spleen and intestine of newbom mice by flow cytometry.

As shown in Fig. l3A, an approximately 30-fold increase in the number of inducer cells from double TG animals (mean 11,250 1,060, n=2) compared to neg. littermates (mean 352 265, n=2) or single CIITA TG mice (mean 412.5 371, n=2) was detected. t.t

I I $ I * P2540GB00. : : 16 January 2006 92/156 Surprisingly, although it was reported that in IL-7TG mice have an increased level of IL-7 rnRNA, the mean of the inducer cell numbers detected in the single IL-7TG animals (mean 420 100, n=4) were comparable to the numbers of the neg. littermates at day of birth. In a second experiment, only double TG and single CIITA TG newbom animals were analyzed (Fig. 13B) . A significant 60-fold increase of inducer cells in the spleen of double TG (rnean=6,400 4,155, n=7) compared to single CIITA TG littermates (mean 106 25, n=3) was calculated (P<0.035) . In addition, a significant 5-fold increase in the intestines of double TG newborns (mean 110,317 61,700, n=7) compared to single CIITA TG littermates (mean 24,424 3,393, n=3) was detected (P<0.048) . Importantly, inducer cell numbers were already remarkably increased at E16.5, in spleen and gut of double TG embryos (data not shown) Taken together, these data show that transgenic IL-7 can regulate lymphoid tissue inducer cell numbers in developing secondary lymphoid organs. Remarkable is the enormous number of inducer cells found in the spleen of newborn double TG animals, suggesting that the neonatal spleen is the preferential organ for homing, retention, expansion or survival of inducer cells.

Figure 13 shows increased inducer cell numbers in newborn double TG mice: Dots represent individual mice and bars means of the four different groups. (A) Inducer cells (IL-7R CD4 CD31 within the spleen of newborn double TG (mean 11,250 1,060, n=2), single IL-7TG (mean 420 100, n=4), single CIITA TG (mean 412.5 371, n=2) , and neg. (mean 352 265, n=2) littermates were enumerated by flow cytometry analysis. (B) Absolute cell numbers of inducer cells within the spleen of double TG

I I I I t

I * If * I P2540GB00 16 January 2006

I I I I

I II I

93/156 (mean=6,400 4,155, n=7) was compared with numbers of single CIITA TG (mean 106 25, n=3) animals, and within the intestine of double TG (mean 110,317 61,700, n=7) compared to single CIITA TG (mean 24,424 3,393, n=3) littermates (log scale was used). The P values were calculated using the Student's t-test.

Example 12: IL-7 collaborates with LTI3 in lympho-organogenes is In order to test the effect of IL-7 on the expression level of LTI3 in the murine embryonic gut, RNA of total intestine of double TG, single IL-7TG, and neg. littermates was isolated and qRT-PCR with primers specific for LT was performed. We tested the intestine of El6.5 mice, since the majority of cells expressing LTc43 in the E16.5 embryonic intestine are inducer cells. CT values were normalized to CT values of TBP and the fold difference of TG and neg. littermates were calculated by the comparative CT method (LLCT). A 3.8-fold increase of LTI3 expression in single IL-7TG and a remarkable 14.8-fold increase in double TG animals compared to neg. littermates could be determined (Fig. 14) . Furthermore, by flow cytometry we could detect significantly increased expression levels of LT on individual inducer cells (data not shown) Figure 14 illustrates the increased level of LTI3 transcript in IL-7 TG mice: To determine whether the LT3 mRNA level in double TG and single IL-7TG compared to neg. littermates is increased in the fetal gut at E16.5 qRT-PCR was performed. CT values were normalized to TBP. Left bar represents the fold increase (3.8-fold) of single IL-7TG compared to neg. littermates and right

I I

I I I I I 1 III II III * P2540GB00 16 January 2006 94/ 156 bar (14.8-fold) of double TG mice, respectively. This is the result of one single experiment which one sample of each group.

Example 13: Influence of IL-7 on the expression level of several chemokines in E16.5 double TG mice We were interested to study whether IL-7 transgene expression in the fetal gut was followed by an increased chemokine mRNA expression level. CXCL13, CCL21, and CCL19 are constitutively produced in secondary lyrnphoid organs, whereas inflammatory chemokines are induced locally at site of inflammation. For example, CXCL9, CXCL1O, and CCL5 are induced during chronic inflammatory events, such as rheumatoid arthritis and Sjogren's syndrome, which are often associated with ectopic lymphoid follicle formation (228, 303) . There is more and more evidence that in addition to constitutively produced chemokines, also inflammatory chemokines might contribute to the formation of secondary lymphoid organs. Therefore, in addition to the four known chemokines, CCL19, CCL21, CXCL12, and CXCL13, which are expressed upon LTR triggering and are involved in lymphoid organ formation, we tested the expression levels of CCL5, CCL9, CCL2O, CCL25, CXCL9, CXCL1O, CXCL11, and CXCL12. mRNA isolated from double TG, single IL-7TG and neg. littermates E16.5 intestines were compared. In Fig. 15, the fold increase of the indicated chemokines of double TG to neg. littermates mRNA levels is shown. The expression levels of several chemokines were increased, namely CXCL13 (726-fold), CCL5 (4-fold), CCL19 (2.5-fold), CCL21 (3.4-fold) and CXCL1O (2.6-fold). These data indicate that the enhanced IL-7 expression have a positive effect on chemokines produced by LT3R stromal cells and the formation of additional PP. P2540GB00:. 16 January 2006 95/ 156 Figure 15 shows IL-7-dependent up-regulation of a pattern of chemokines in the embryonic intestine of transgenic mice: To determine the influence of IL-7 an the expression level of diverse chemokines in the developing gut, a quantitative comparison between double TG and neg. littermates was performed.

The fold difference was calculated by the ACT method. CXCL13 (726-fold), CCL5 (4-fold), CCL19 (2.5-fold), CCL21 (3.4-fold) and CXCL1O (2.6-fold). Results are representative of one single experiment with one sample of each group.

Example 14: Lymphocyte infiltration and aggregation in various organsIn order to study the effect of IL-7 on peripheral organs, we performed histological analysis of different non-lymphoid Organs, such as heart, pancreas, salivary gland, lung, liver, and stomach. Two individual litters, a 4-wk old litter with double TG (mouse 1), single IL-7TG, and neg. littermates, and a 8-wk old litter with double TG (mouse 2) and neg. littermates were tested and results listed in Table 1. There was no evidence of tissue damage or cell death in the examined organs. We observed diffuse collection of lymphocyte in the salivary gland (Fig. l6B), lung, liver (Fig. 16E), stomach, and in the heart of double TG mice, whereas single IL-7TG and neg. littermates showed no infiltrates in the examined sections (at least 3 sections per organ). In the salivary gland (submandibular gland) from double TG mice, perivascular infiltrates (Fig. 16B) and aggregation of lymphocytes under the capsule of the salivary gland (Fig. 16A) was detected. Perivascular lymphocyte infiltrates in the salivary gland are defined as sialadenitis.

They were described in the non-obese diabetic (NOD) mouse model, which provides a useful rodent model of human Sjogrens syndrome.

P2540GB00 16 January 2006 96/ 156 To further investigate the cellular components of infiltrating cells, consecutive sections of organs of 4-wk old mice were stained with anti-B22O (B cells) and anti-CD3 (T cells) b.

SurprisinglY only infiltrating B cells were present in the periductal and vascular region of the salivary gland (Fig. l6D) The large lymph node-like structure in the salivary gland was also mainly composed of B cells and only a few T cells were detectable (Fig. l6C) . It was difficult to distinguish a clear B and T cell zone. In the liver, the perivascUlar infiltrates were io only B220 B cells (Fig. 16F) . Altogether, these Eindings indicate that IL-7 overexpreSsiofl can cause the formation of lymphoid foci and can provoke diffuse B cell infiltrations ifl non-lymphoid organs of adult mice.

-.. Mouse I Mouse 2 * .* (4wk) (Bwk) Salivary gland V V Lung. V n.d.

Heart V n.d.

Uver: V Stomach n.d. V Pancreas * n.d. nd.

Wk. veek: ii d.. iiot detected: V. lymphocyte infiltratlol1 detected.

Table 1: Histological analysis of various organs in double TG mice Figure 16 shows that IL-7 induces lymphocyte infiltration in non-lympoid organs of double TG mice: Frozen sections of different organs (listed in table 1.) of double transgenic, single IL-7TG, and neg. littermates (4-wk and 8-wk of age) were prepared and a haematoXilifll eosin (H & E) staining was performed. H & E staining of salivary gland shows in (A) an P2540GB00 16 January 2006 97/ 156 encapsulated tertiary lymphoid structure and in (B) perivascular and periductal mononuclear infiltrates. (E) shows perivascular infiltrates in the liver. (C, D, and F) Double Immunohistological staining of continuous sections of double TG examined salivary gland and liver shows B cell (B220, brown) infiltrates in the perivascular and periductal region and perivascular region, respectively. A few T cells (CD3, blue) were found in the encapsulated region of the salivary gland (C) No such infiltrates were detected in single IL-7TG and negative littermates. 200 m bar indicates original magnification of xlOO, whereas the 100 jm original magnification of x200.

Example 15: IL-7 overexpression induces neo-formation of ectopic lyxnphoid structures Importantly, in double TG mice, tertiary lymphoid structures could be distinguished at ectopic sites. Chicago blue dye was injected into the footpad to visualize lymphoid structures connected with the blood circulation. Encapsulated lymph node-like structures near the ILN were found in at least 6 individual mice, which were older than 6-wk (Fig. l7A). A closer examination of two individual mice revealed one additional ectopic LN-like structure in the axillar region, one in the mediastinal, and one in the paravertebral region (data not shown). In addition, in the appendix of all examined double TG mice, several ectopic lymphoid structures were detected (Fig. 17B). To further characterize these ectopic lymphoid structures, immunohistochemical analysis of three individual LN-like structures and one appendix were performed. Anti-CD3 and anti-B220 Ab were used for detecting T and B lymphocytes, respectively. One representative section of an ectopic LN-like structure is shown in Fig. l7C and one section of an ectopic P25400B00:: : :: : 16 January 2006 98/156 lymphoid structure from the appendix are shown in Fig. l7D. In the ectopic LN-like structures, B cells formed follicles, whereas T cells were located in the appropriate T cell area. The staining in the ectopic LN-like structure revealed similar architecture that were seen in ILN of double TG and neg.

littermates shown in Fig. 17E, F. the ectopic lymphoid structure in the appendix contained primarily B220 B cells and only a view CD3 T cells (Fig. l7D). This architecture is similar to the one found in ILF, which are normally located in the small intestine. These results indicate that IL-7 overexpression might cause the formation of ectopic tertiary lymphoid structures.

Figure 17 shows that IL-7 induces LN-like structures at ectopic sites: (A) Double TG mice were footpad injected with Chicago blue ink to visualize LN. 48 hs post-injection, mice were is analyzed and ectopic LN-like structures were detected near the inguinal LN (ILN) . (B) Detection of ectopic lymphoid structures (indicated by arrows) in the caecum of double TG mice. Ectopic LN-like structure and caecum were isolated from double TG animals and staining of frozen tissue sections performed. B220 (blue) B cell follicles and CD3 (brown) T cell zone were detectable in the ectopic LN-like structure (C), whereas ectopic lymphoid structures in the caecum were mainly composed of B cells and a view T cells (D) (original magnification xlOO) The genetic approach according to the present invention was taken to elucidate the molecular and cellular mechanisms of secondary and tertiary lymphoid organ development. The approach was to establish a new transgenic mouse model expressing high P2540GB00:: :: 16 January 2006 99/156 levels of IL-7 under a ubiquitous promoter. This mouse model demonstrates that IL-7 is an important factor for the amplification of inducer cells, LTI3 transcription level, and chemokine expression in vivo and consequently, for controlling the number of PP in the murine small intestine. In addition, IL- 7 induces both mononuclear cell infiltration in non-lymphoid organs and the generation of additional lymphoid tissue in the gut and at peripheral sites suggesting a role for IL-7 in ectopic lympho-neogenesis during chronic inflammation. Finally, IL-7 overexpression causes a severe bone malformation syndrome, most likely as a result of the pro-osteoclastogenic effect of IL-7.

Example 16: CIITA IL-7 double transgenic mice Transgenic mice are useful to study the function of a gene of interest in vivo. Such a gain of function model gives more information about the interplay of particular cells and molecules than a loss of function model. In order to study the role of IL-7 for the development of PP formation a double TG mouse having higher expression levels of IL-7 as well as expression already early in development was generated. In this system, WT mice with IL-7 transgene low expressors and double TG high expressor mice were compared. Double TG mice revealed striking phenotypes in PP development, bone malformation, and ectopic lymphoid neogenesis. First and intriguingly, double TG mice show a massive 3-to 4-fold increase in PP numbers. The average number found in neg. littermates is in accordance to the literature (1, 3) . Interestingly, heterozygous littermates, which are positive for the IL-7 transgene (single IL-7TG), but negative for the CIITA transgene, had a similar PP number to neg.

P25400B00:: :. : :: :. 16 January 2006 100/156 littermates. What is the reason for this discrepancy of PP numbers in single IL-7TG and double TG animals? It was reported that MHC class II IL-7TG mice have an influence on the lymphopolesis, mostly seen in adult mice. In these TG mice, mouse IL-7 cDNA is under the control of the MHC class II Ea promoter (170) . The IL-7 transgene is therefore expressed by MHC class II positive cells. MHC class II is constitutively expressed by classical APCs, namely B cells, DC, and MOs, and in addition by thyniic and intestinal epithelial cells. These cells are not importantly involved in the early process of PP development, the initiation and formation of PP anlagen. One explanation might be that the availability of the IL-7 transgene in single IL-7TG littermates seems not to be elevated during the critical phase of PP formation. To increase the IL-7 mRNA level ubiquitously during early embryonic development, we intercrossed these mice with CIITA TG mice, which were generated by Otten et al. (243) . CIITA is a transcriptional coactivator interacting with factors bound to MHC class II promoters (239). Through the induction of CIITA expression by IFN-y, MHC class II expression can also be initiated in other cell types. In CIITA TG mice, CIITA transgene expression is under the control of the ubiquitously and constitutively active viral SRa promoter (243).

Consequently, in double TG mice, the SRa promoter drives CIITA expression early and ubiquitously in embryogenesis, which subsequently leads to an increased level of IL-7 transgene expression. Offsprings of this intercross which either one CIITA allele or with both alleles show MHC class II expression on CD45-cells in the fetal liver from E14.5 onwards. We could demonstrate that in the fetal liver at E14.5 the IL-7 mRNA levels were higher in double TG mice compared to single IL-7TG P2540GB00 16 January 2006 101/156 mice. This result reflects an active SRa promoter at E14.5 in the fetal liver. The consequence of this higher IL-7 mRNA level on the different progenitor cell populations present in the fetal liver has still to be elucidated. It might be conceivable that the early IL-7 overexpression has an influence on progenitor cells, which give rise to inducer cells. As expected adult mice single IL-7TG littermates show an increased B cell lymphopoiesis (170, 236). In the BM of double TG animals, the absolute cell numbers of IL-7 dependent B cell subpopulations were even more increased compared to single IL-7TG littermates.

That IL-7 has an influence on PP formation is in line with the finding that in adult mice deficient for one of the IL-7R receptor subunits (IL-7Ra and yc), Jak3, or IL-7, PP were undetectable (70, 172) . These results suggest an absolute requirement of the IL-7R for PP organogenesis. However, one important difference between IL-7 and IL-7RcL-deficient mice has to be reported. The initial clustering of VCAN-1 and IL-7R cells occurred normal in the embryonic intestine of IL-7 mice (61, 94), whereas in IL-7Ra-deficient mice, no cluster formation was observed. This suggests that in the absence of IL-7 PP develop normally during ernbryogenesis. The discrepancy between the absence of PP but normal formation of VCAN-l/IL-7R cell cluster during fetal development in IL-7mice could be due to an alternative ligand replacing the early function of IL-7.

Thymic stromal lymphopoetin (TSLP) has been recently identified as ligand for the TSLPR composed of the IL-7Ra chain and a TSLP- specific receptor subunit. We found that both TSLP and TSLP-specific receptor subunit were expressed in fetal mice (unpublished observation). In vitro studies have indicated that P25400B00:: : :: : 16 January 2006 I I 1102/156 TSLP signal transduction is independent of Jak3 (161, 163) Therefore, it is possible that a so far unidentified signalling pathway downstream of TSLPR may be active during VCA?I-1 cluster formation.

Several TG mouse models have been generated in order to study the function of IL-7 (Table 2) . In intestinal fatty acid binding protein (iFABP) promoter IL-7TG mice, the promoter directs constitutive expression of IL-7 to mature, villus-associated enterocytes but not to crypt epithelial cells beginning at El6 and continuing throughout life (305, 306). In these mice, the number of PP was reported to be normal (172). Interestingly, this is in contrast to the increased number of PP in the novel double TG mice according to the invention. One explanation might be that inducer cells have to be amplified before the cells colonize the embryonic gut. Therefore, the local IL-7 gene expression in the intestine of iFABP-IL-7TG mice is not sufficient to increase PP numbers. However, the authors could restore the normal number of PP after backcrossing iFABP-IL-7TG mice to IL-7mice indicating that in these mice, local production of IL-7 was sufficient to generate and maintain PP. IL-7 expression was restricted to the small intestine and acted locally. This notion was supported by the findings that in iFABP-IL-7TG backcrossed to IL-T'mice no restoration of haematopoiesis in the BM occurred nor did the iFABP-IL-7 transgene restore normal TCR-43 thymocyte development.

Other studies on IL-7TG mice did not include investigations on the number of PP or the influence of IL-7 on lymphoid organ development. In SRU-IL-7TG mice, IL-7 was expressed in the thymus, spleen, kidney, brain, lung and skin, but surprisingly P2540GB00: 16 January 2006 103/ 156 not in the liver or muscle. These IL-7TG mice developed an acute colitis at 1 to 3-wk of age with infiltrating neutrophils and lymphocytes in the colon (174). Infiltrating T cells were conventional c CD4 T cells and y T cells. Furthermore, at 6-lO-wk of age, these mice developed a chronic colitis, having the typical symptoms, such as diarrhea, weight loss, rectal prolapse, and remittent intestinal bleeding. The authors reported to detect no difference of the IL-7 mRNA expression between the colonic and small intestinal mucosa if no inflammation was observed. However, the inventors detected an increased IL-7 transgene expression in the inflamed colonic mucosa of SRa-IL- 7TG mice, which was a consequence of infiltrating mucosal lymphocytes, but not of IL-7 expressed by colonic epithelial cells. The data demonstrate that in the SRa-IL-7TG mice, increased IL-7 mRNA expression caused severe signs of inflammation in the gut. In contrast to SRa-IL-7TG mice, we could not detect any sign of acute or chronic colitis in double TG mice, whereas an increased formation of colonic patches and solitary B cell follicles were detected. Furthermore, CD3 T cells were only detectable in the colonic patches and were not present as infiltrates at other sites in the colon of 4-wk old double TG mice. However, the authors reported that the frequency of colitis in the one examined mouse line was approximately 60%.

In addition, for the onset of colitis in the different examined SRa-IL-7TG mouse strains, a wide time delay of 4-l2-wk was observed. To exclude that the development of chronic colitis occurs only later in life, a high number of double TG mice, which are older than 6 months should be analyzed for sign of colitis. Nevertheless, another explanation for this discrepancy might be the action of the CIITA transgene in the double TG P2540GB00: 16 January 2006 104/ 156 compared to SRa-IL-7TG mice leading to a different level of IL-7 transgene expression. A different IL-7 level or even CIITA itself might lead to a more suppressive or more active states of regulatory cells in one or the other TO mouse model.

Mice expressing IL-7 transgene under the control of the human K14 promoter revealed an ectopic IL-7 source in basal keratinocytes (171). These TG mice developed a lymphoproliferative skin disease with dermal and epidermal T cell infiltrates associated with alopecia. The infiltrates were predominantly composed of skin-associated yö T cells distinct from conventional epidermal T cells. The authors could show that these cells were derived from precursors normally resident in the skin supporting the notion that IL-7 is a cytokine, which might act more locally than systemically.

Table 2 Overview of XL-7 transgenic mice Ref Promoter Tissue, cells Phenotype PP no Ig L chain BM, spleen, thymus, Increase in mature and immature BM (169) promoter restricted expression in and splenic B cells, and thymic and nd and H chain lymphoid cells lymphoid I cells enhancer Ig heavy BM, LN, spleen, Reduction of OP thymocytes, (121) chain thymus skin cutaneous disorder, B and T cell nd lyrnphomas (170) MHC class II Increase in T arid immature B cells this work Skin disease, dermal and epidermal (171' Human k14 Keratinocytes in the infiltrates of I cells (mix of c3 and jô nd / epidermis of the skin I cells) with the characteristics of TCR cells (174), SRa ubiquitous Chronic colitis nd normal (172) iFABP villus-ass. enterocytes Restoration in lL-7 background number 1g. immunoglobulin, BM, bone marrow; LN, lymph node, DP, double positive; APC, antigen presenting cells; TCR; T cell receptor; SRa, fusion promoter containing the SV 40 early promoter and the R segment and part of the U5 sequence of the long terminal repeat derived from human I cell leukemia virus type I, iFABP, intestinal fatty acid binding protein, nd, not determined; PP no, Peyer's patch number.

I * I, P2540GB00 16 January 2006 105/ 156 In the present invention, it was taken into consideration that the augmented number of lymphoid follicles in the gut of double TG mice could be a result of the dramatic expansion of B cells in adult mice. Therefore, the formation of VCAN-l cluster in double TG, single IL-7TG, and neg. littermates was investigated at birth. Again, a dramatic increase of PP anlagen number was observed in double TG intestines, but not in single IL-7TG animals or neg. littermates. In WT animals, isolated lymphoid follicles (ILF) were reported to be undetectable until day 25 of postnatal life (27). However, it is not known whether anlagen for ILF are already formed during embryogenesis in the developing gut. In conclusion, we show here a clear phenotypic difference of double TG animals compared to single IL-7TG littermates concerning the development of PP. This difference is certainly generated during the critical embryonic phase of PP anlagen initiation. This notion is supported by immunohistological and whole mount analysis of El6.5 small intestines. Both approaches showed a higher number of VCAN-l cell cluster in double TG embryos. The development of LN and PP is strictly dependent on CD45 IL-7R CD4 CD3 lymphoid tissue inducer cells, as in the absence of these cells, no formation of LN and PP occurs (43, 44, 79). Inducer cells are found in secondary lymphoid organs, the spleen, PP, and LN. These cells are the first haematopoietic cell type detectable in the developing gut at around E15.5. At E17.5 CDllc DC are detectable, which are most probably the MHC class 1I cells found in the intestine during this period. This is supported by the notion that IL-7R cells in the fetal gut were negative for MHC class 11 (46) . By counting the absolute cell numbers of inducer cells in double TG, single IL-7TG, and neg. littermates, we revealed a 30-fold increase in the spleen and a 5-fold P2540GB00: :: 16 January 2006 106/ 156 increase in the gut of double TG, but not in single IL-7TG newborns. Several reasons may be considered for explaining the discrepancy of cell numbers increase in the spleen compared to the gut. The spleen may provide more IL-7 or additional factors which help increasing the number of inducer cells in situ. It is also possible that the IL-7TG has an effect on the profile of adhesion molecules followed by preferential homing to the spleen or retention in the spleen.

A critical phase in the induction of PP anlagen is between El6.5, when inducer cells are found to cluster in the developing gut, before mature B and T lymphocytes colonize the PP anlagen at El8.5 (41, 46, 70) . Hypothetically, to initiate the formation of PP anlagen, an appropriate number of inducer cells have to be present with the correct surface molecules expressed to perform the molecular crosstalk with organizer cells. A similar hypothesis was postulated for MLN development. Kim and colleagues (115) could show that a critical number of inducer cells was required for MLN formation, and this was dependent on TRANCE-TRANCER interactions. The authors claimed that as soon as the number of inducer cells reaches a critical point, the interaction between inducer cells and stromal cells via LTc4/ LT3R system led to the formation of cell clusters (115) Therefore, it could well be that in the two IL-7TG systems (double TG, single IL-7TG) we compared, the difference in the number of PP anlagen is due to the increase in inducer cell numbers at the critical time point of PP anlagen initiation.

Indeed, a 4-fold increase of inducer cells was detected in E 16.5 fetal gut of double TG animals, whereas in single IL-7TG, only a 1.6-fold increase compared to WT gut was found (data not P2540GB00 16 January 2006 107/ 156 shown). This is supported by immunohistochemical analysis in the E16.5 intestine. More zones of CD4 cluster formation and more CD4 cells were detected. It has been reported that at this developmental stage no other CD4 cells than inducer cells are present. However, we cannot exclude that in double TG mice other CD4 cells than inducer cells are present in the developing gut.

Therefore, additional immunohistological analyses, double staining with CD4 and CD3 Ab, and CD4 and CD11c Ab, should be investigated.

It seems that during embryogenesis and in the neonatal period, the gut can dramatically alter its phenotype in response to developmental signals. This was previously shown in our laboratory by adoptive transfer of inducer cells to CXCR5mice, which hardly develop PP (42). An increase in PP numbers up to an average of 33 could be achieved, when 2 x 104 inducer cells from WT fetal spleen were adoptively transferred into newborn CXCR5' recipients. These data further support the idea that PP numbers can be amplified by providing sufficient numbers of inducer cells.

The initiation of the PP anlagen during embryonic life could be described with at least two different models. Scenario I: a specialized mesenchymal organizer cell at particular sites of the intestine releases one or several chemokines, which form a chemotactic gradient to attract inducer cells. This gradient performed by the initial organizer cells defines the positioning of the PP anlagen. A critical number of inducer cells are required to induce cluster formation of organizer cells. If inducer cell numbers in the gut are augmented, such as in double TG mice or in adoptive transfer experiments, more neighbouring P2540GB00 16 January 2006 IS I 108/156 organizer cells are induced to form clusters. Scenario II: there is no defined positioning signal from mesenchymal cells to attract inducer cells. Instead, inducer cells randomly enter the gut via the mesenteries. After being seeded in the antirnesenteric wall of the intestine, inducer cells express activated adhesion molecules allowing attachment to organizer cells. An increased number of inducer cells seeding the developing gut leads randomly to an elevated number of positive hits' for inducing PP anlagen.

In addition, it is conceivable that in double TG mice, inducer cells are not only more frequent, but also exert an activated' phenotype by expressing high levels of LTc43 already before the cells colonize the intestine. Consecutively, the cells would more efficiently engage the LTI3R expressed by VCAM-l+ organizer cells followed by differentiation and cluster formation.

Therefore, it is also important to determine where and when inducer cells express LTc43, and where the inducer cell population receives a signal to expand. It was reported that IL- 7 is capable to induce LTc43 on inducer cells in vitro (94), suggesting that IL-7 might be a crucial activation' factor. The transmembrane protein LTI3 triggers LTI3R only in a heterotrimeric complex with LTa (80) . LT43 is expressed on haematopoietic cells, such as a subset of follicular B cells, activated T cells, and inducer cells. The absolute requirement of LTc43 is reflected in the fact that in LTa-or LTD-deficient mice no PP develop. It was further shown that inducer cells were still present, but widespread and not clustered, in the embryonic intestine of LTcL-deficient animals (40) . In order to test whether the IL-7 transgene had a positive effect on the expression levels of LTc43 P25400B00 16 January 2006 109/ 15 6 in the embryonic gut, we determined the LTI3 mRNA levels in double TG mice. To exclude that the source of LT3 rnRNA was coming from different subsets of haematopoietic cells, we analyzed mRNA from the total E16.5 gut. At this time point, neither CD3 T cells nor B220 B cells or DC were present in the fetal gut (41). Importantly, a 15-fold increase in LT mRNA was observed in double TG mice, whereas only a 4-fold difference was found in single IL-7TG mice compared to litter controls. These data suggest that in double TG E 16.5 intestine, more LT3 mRNA is provided.

A distinct population of fetal liver progenitor cells, which can give rise to inducer cells was described (69, 74) . In one report, progenitor cells were described as IL-7RcL Sca_lbow c_kitb0 fetal liver cells (69) and in a second report, as lineage IL-7RcC c-kit a437 population (74) . As previously mentioned, the SRcz promoter is active in the fetal liver at E14.5, and consequently increased level of IL-7 mRNA was detected in double TG, but not in single IL-7TG embryos. In double TG embryos the inducer progenitor cells were already amplified in the fetal liver (data not shown). This was not a result of proliferation as tested by studying the incrorporation of BrdU (Bromodesoxyuridine, BD PharMingen) . Therefore, we conclude that IL-7 increases the survival of fetal progenitor cells and lymphoid tissue inducer cells.

In normal WT mice, approximately 55% of IL-7R cells found in the fetal gut and mesenteries at E16.5 are CD4 negative, whereas in the spleen, around 79% are negative for CD4 (40), probably due to the presence of IL-7R B cell progenitor cells in the P2540GB00 16 January 2006 110/ 156 spleen. It seems likely that IL-7 is crucial for induction of surface molecules, such as CD4. The role of CD4 for inducer cells is unknown, and studies comparing CD4 IL-7R vs. CD4 IL- 7R cells with respect to PP formation are missing. CD4-deficient mice have no abnormalities in the development of secondary lymphoid Organs, suggesting that CD4 is not absolutely required for the function of inducer cells (307). It is more likely that the expression of LTc43 defines the real inducer cell regardless of other surface proteins, such as CD4. Analysis of the embryo by in situ hybridization revealed that LTcXI3 is not detectable in the fetal liver (40, 92) . In addition, we were unable to induce PP formation in CXCR5' mice using fetal liver cells as donors (42) . Therefore, we conclude that the fetal liver harbors, immature' IL-7R CD4 LTc43-progenitor for inducer cells. It would be of interest to analyze whether in the fetal liver of double TG animals, these progenitor cells express LT43 on their cell surface.

Using confocal microscopy, we found colocalization of NHC class II and CD4 on cryostat sections of the E16.5 gut from double TG, suggesting that one source of ectopic IL-7 in the gut might be the inducer cells. MHC class II flow cytometry analysis of the embryonic intestine demonstrated that half of the IL-7R cells coexpressed CD4, but none of them were MHC class II positive (70). Another source of ectopic IL-7 in the intestines of double TG animals might be VCAM-l cells, which, although to a less extend, coexpress MHC class II molecules. Although transgenic IL-7 and MHC class II genes are under the control of the same promoter, we cannot completely exclude that a lack of MHC class II expression really reflects no ectopic IL-7 production.

P2540GB00 16 January 2006 111/ 156 Interestingly, fetal gut epithelial cells of both double TG and single IL-7TG were negative for MHC class II.In adult mice, it was reported that epithelial cells lining the upper two thirds of villi constitutively express class II molecules on their basolateral surface (308) . However, class II molecules were absent in intestinal epithelium of fetal animals (308) . Since the majority of APC5 colonize the gut shortly after birth, the transgene in single IL-7TG mice was probably, due to the absence of potent IL-7 sources, not sufficiently expressed at the time when PP organogenesis started. This hypothesis was confirmed by our data obtained from real time PCR analysis of IL-7 mRNA levels in the gut at El6.5. No significant increase of IL-7 mRNA in single IL-7TG El6.5 gut was detected, whereas in three independent animals a significant 6-to 10-fold increase was calculated.

Another explanation for the elevated inducer cell number in the embryonic gut of double TG mice could be a specific recruitment of inducer cells to the intestine. Chemokines play a pivotal role in cellular homing and in the formation of secondary lymphoid organs. For instance, in CXCL13-deficient mice, the number of Pp is severely reduced (60). The stimulation of LTR-signalling in VCAN-l organizer cells through LTc4 expressing cells leads to the production of homeostatic chemokines, such as CCL19, CCL21, CXCL12, and CXCL13 (55, 58). The inducer cells express the corresponding receptors CCR7, CXCR4, and CXCR5 (309) The induction of chemokine release re-enforces the recruitment of haematopoietic cells to the developing organizer centers. We investigated whether in double TG animals, higher expression levels of homeostatic chemokines were found. Indeed, our results * : :.

* * * : * * P2540GB00. ** , 16 January 2006 * S *SS -112/ 156 obtained by qRT-PCR indicated significantly higher expression levels of CCL19 (2.5-fold), CCL21 (3.4-fold), and CXCL13 (726-fold) in the El6.5 gut of double TG mice. Inflammatory chemokines are expressed at sites of ectopic lyrnphoid tissue formation as for example in chronic inflammatory diseases (217- 223) . These structures are named "tertiary lymphoid organs". The fact that LTI3R signal transduction can induce the expression of chemokines found in inflammatory tertiary lymphoid structures, attempted us to test levels of inflammatory chemokines in double TG mice compared to neg. littermates. Interestingly, the two inflammatory chemokines CCL5 and CXCL1O were upregulated in the fetal gut of double TG mice. During inflammation, CCL5, CXCL9, and CXCL1O are known to play a role in the attraction of activated lymphocytes and monocytes. These results might suggest that inflammatory chemokines without causing inflammation have a possible role in the organogenesis of secondary lymphoid organs.

In conclusion, the major difference contributing PP development of double TG compared to single IL-7TG is the onset of transgenic IL-7 transcript expression in the developing gut and the origin of IL-7 expressing cells. Only in double TG mice, IL- 7TG is expressed before the critical PP anlagen formation, namely before E16.5. The increased level of IL-7 transcript in double TG mice leads to an increased inducer cell number resulting in more PP anlagen in double TG vs. single IL-7TG embryos. Whether the expansion of the inducer cell population takes already place in the fetal liver during commitment of progenitor cells has still to be tested. The source of transgenic IL-7 transcript in double TG animals may be by the inducer cells themselves, namely in an autocrine effect. However, a paracrine transgenic IL-7 source cannot be excluded.

* * : : :.

P2540GB00 s, 16 January 2006 113/156 In Figure 18 the timing of transgenic IL-7 transcript expression in PP development is shown: The CIITA-driven ectopic IL-7 expression in double TG mice is earlier initiated compared to single IL-7TG littermates resulting in an increased number of inducer cells. The expansion of inducer cells occurs before the critical time point (before E15.5) of PP anlagen formation.

The morphology of double TG animals was strikingly different from neg. littermates. With age, double TG mice were smaller in size than single IL-7TG or neg. littermates. An explanation may be the striking bone malformation detected in double TG mice.

The bones became larger in diameter, but smaller in length. In addition, the shape of either the femur or the tibia shows a spongelike structure. This phenotype could be a result of the expanded BM mass forcing expansion of the cavity by shear forces.

Indeed, we observed BN even outside of the cavity (data not shown) . However, the bone is a dynamic tissue in which osteoblasts synthesize bone matrix while osteoclasts resorb bone.

IL-7 could have induced osteoclastogenesis eroding the endostal surface and the epiphysis thus explaining why the mice were smaller. The weight of the bone in 6-wk old double TG mice were not different than the one in single CIITA TG mice, suggesting more a bone malformation rather than a bone loss. No malformation or size difference of the femurs from double TG compared to neg. littermates is observed at birth. Abnormalities in bone formation start around 2-wk of age. It might be possible that during the juvenile phase, the skeletal system in double TG mice does not growth normally and therefore, the animals remain smaller than their neg. littermates. A recent study showed that IL-7 could induce bone loss leading to the following model (310) The increased IL-7 production results in induction of B-4 S * ft * * I * * I S I * * P2540G300: s, : : * 16 January 2006 I S S **I * S 114/ 156 lymphopoiesis and an increase in the number of B220 Pre-B cells, a population reported to be capable of acting as osteclast precursors (311) . In addition, IL-7 induces TRANCE, an osteoclast differentiation factor (113, 114, 312), and TNFa secretion by activated T cells (310), which are also critical factors in the process of bone loss. We recently found increasing levels of TRANCE expression on both inducer cells and T cells. Interestingly, mice deficient for TRANCE or its cognate receptor, TRANCER, exhibit an osteopetrotic phenotype, reflected by an increased bone density due to a loss of osteoclast differentiation. These mice have also a retarded growth, which becomes apparent at around 3-wk after birth. These two different phenotypes show clearly that the balance between osteoclasts and osteoblasts is tightly regulated. TRANCE and IL-7 are involved in this process and a disturbance of either of these genes leads to a malformation of the bone and consequently to a severe growth retardation in the affected animals. The dramatic increase in the size of the spleen from double TG is amongst others a result of the elevated absolute cell number. B220 B cells and CD3 T cells were increased in numbers. At the day of birth, spleens of double TG animals were already double in weight, larger in size, and absolute cell numbers were significantly increased. Immunohistochemical analyses of sections from adult double TG spleens showed differences in the T cell zone compared to neg. littermate spleen sections. The T cell zones were clearly smaller in size and were displaced from the central arterioles. Finally, T cell zones in double TG mice were less compact arranged than in neg. littermates. B cell follicles were similar in size. Similar to the increased size of the spleen, we show here that LN of double TG mice are also increased in size. Interestingly, follicles in the ILN from a, a It: : : :.

P2540cB00: :. : : : 16 January 2006 * I I all 115/156 double TG compared to neg. littermates are similar in size. The cellular architectures in PP from double TG and neg. littermates showed no gross abnormalities. There were significantly more follicles per PP found in double TG compared to neg. littermates.

Interestingly, we have seen a similar increased number of follicles in adult single IL-7TG and double TG animals (data not shown). The follicles were visible after Chicago blue injection.

Overall, our results show that B and T cell zones are still distinguishable in secondary lymphoid organs of double TG mice.

However, the massive increase in number of B220 precursor B cells may disturb the T cell zone, whereas follicles remain intact. No difference in the size of the thymus was observed in both double TG and single IL-7TG mice.

Phenotypic analysis of T cells in the spleen of double TG mice revealed that considerable high percentage of T cells displayed a CD44 CD62L phenotype. CD44, a marker for effector and memory lymphocytes, is an adhesion molecule, which bind to hyaluronate and enables primary adhesion (rolling). Activation of T cells and direct stimulation through the T cell receptor results in CD44 capable of binding HA (313). However, memory T cells were also reported to express CD44 an their cell surface (298) . It was further reported that during homeostasis-driven proliferation, naive CD8 T cells upregulate CD44 without passing through a CD8 effector stage, and these naive CD8 CD44 T cells were termed memory-like' T cells (299). In single IL- 7TG mice, a marked increase of memory-like' CD8 T cells was found, suggesting IL-7 as the critical factor for the memory-like' T cell expansion (302) .

By including other T cell activation markers, such as CD69 and CD25, CD44h1 T cells of the spleen from double TG mice were negative for these markers ft * II * * I I I * t I * I I I P2540GB00: :. 16 January 2006 * I I III 116/156 (data not shown) . Therefore we conclude that the increased CD44 high T cell population in double TG animals displays more a memory-like' phenotype rather than an activated cell type. CD44 was found to be expressed by inducer cells (40) . Interestingly, at 4-wk of age, we detected lymphocyte infiltration in the salivary gland, liver, lung, and stomach. The Non-obese diabetic (NOD) mouse is a model for diabetes. These mice show not only lymphocyte infiltration in the pancreatic islets, but also in the salivary gland. Therefore these mice are used as a model system for the Sjogren's syndrome in humans. In contrast to the findings in NOD mice, where at early stages of disease, inflammatory infiltrates are mainly composed of T cells (CD4 T cells in particular), we observed a predominance of B220 B cells. Furthermore, in the salivary gland of double TG mice, a subcapsular aggregation of lymphocytes was detected also composed mainly of B cells.

Tissue infiltration with lymphocytes and MO occurs also in other chronic diseases, such as rheumatoid arthritis, inflammatory bowel disease, and Hashimoto's thyroiditis (220, 221). In patients with systemic juvenile rheumatoid arthritis (JRA), plasma IL-7 levels are significantly higher than those of healthy controls (314). Rheumatoid arthritis is a chronic inflammatory autoimmune disease, which results in the destruction of cartilage and bone. However, even more importantly, tertiary lymphoid organs occur at sites of chronic inflammation. These structures contribute to the pathology by enhancing the efficiency of autoantigen presentation and to the generation of autoreactive lymphocytes. Weynand and colleagues (229) described a model where the disease severity increases with distinct developmental stages from non-organized * a.

I * * 4 I I I P2540GB00: . : 16 January 2006 I I I *e * I 117/ 156 infiltrates, upon T cell B cell aggregates to the highly organized GC. Importantly, we observed no tissue damage in all examined organs of double TG mice at 8-wk of age. However, a severe tissue damage causing by autoreactive lymphocytes might develop at a later stage of adult life. In order to dissect the molecular mechanism of ectopic tertiary lymphoid organ development, TG mouse models have been established. In TG mice expressing LTa in the pancreas, ectopic lymphoid tissue formation could be detected (231) . The same approach was performed to overexpress chemokines, such as CXCL13, CCL19, CCL21, and CXCL12 in the pancreas (95, 196, 233) . All of these chemokines were able to induce lymphoid aggregates, although the severity of infiltrates and the level of organization were different (95). Furthermore, Luther et al. (132) showed that inducer cells appeared at El8.5, a time when only a few T or B lymphocytes were present in the circulation, in the pancreas of the MP-CXCL13 mice. Cupedo and colleagues (315) reported the generation of ectopic LN aggregates in adult mice through a single injection of newbom LN-derived cells under the skin of recipient mice. Taken together, these reports show that non-lymphoid organs are capable to support the neoformation of tertiary lymphoid organs, when molecular and cellular components normally involved in the formation of secondary lymphoid organs are present.

We observed that in double TG mice ectopic LN-like structures developed in dose proximity to blood vessels. The most prominent structure was detected near but clearly separated the ILN.

Additional LN were observed in the axillar, in the mediastinal, in the paravertebral, peritoneal and pancreatic region (data not shown). All ectopic structures were connected to blood and

I

* ,-, I t I V P2540GB00 -, 16 January 2006

I I I I $ I

118/ 156 lymphatic vessels, and were embedded in fat tissue. In this ectopic LN-like structure, B and T cells were detected and even a clear segregation into B and T cell zones was observed. It is likely that in double TG animals a higher number and a more activated' phenotype of inducer cells are responsible for the appearance of ectopic, tertiary lymphoid structures. In all existing IL-7TG models, no formation of ectopic lymphoid tissues has been reported. We show for the first time spontaneously developing ectopic LN-like structures in an IL-7TG model.

The ectopic lymphoid nodules found in the caecum of double TG mice reflect again the plasticity of the intestinal stroma to support formation of lymphoid tissue. Nevertheless, we could not detect lymphoid structures in all organs of TG mice randomly, suggesting that tissue-specific factors are required for the formation of tertiary lymphoid organs. It is still unclear, which factors support the ectopic lymphoid organ formation only in certain organs and whether or not these tissues play an active part in the pathology or whether their formation is beneficial for disease outcome of autoimmunity. There is evidence that inflammation is due to activities of inflammatory mediators (cytokines and chemokines) produced by the infiltrating cells. These observations suggest that the inflammatory and developmental roles of these molecules may have much in conunon and that inflammatory molecules could be the mediators of the process that eventually results in local antigen presentation in autoimmune disease. Beneath all similarities in these two processes, it should be noted that most chronic inflammations do not develop in lymphoid tissues indicating a complex network of inductive and suppressive event.

I

I I

P2540GB00: 16 January 2006 11 I *, I I 119/ 15 6 We propose the following model for explaining lymphoid organ formation in double TG animals (Fig. 19) . IL-7 acts on inducer cells as a differentiation and survival factor in an autocrine and paracrine manner. The expression levels of LTc4 and other TNF family member molecules including TRANCE as well as adhesion molecules will be increased on inducer cells. Therefore, the large number of activated' inducer cells do not only amplify PP numbers during fetal development, but are also capable to stimulate LTI3R on stromal cells in other organs. The LTI3R stimulation leads to the production of chemokines, attracting B and T lymphocytes to the site of lymphoid tissue neoformation.

In addition, IL-7 acts as pro-osteoclastic factor probably via the induction of TRANCE on hematopoietic cells. As a consequence, a severe bone resorption syndrome develops. It is conceivable that the tight regulation of cytokine production may be important to prevent the induction of tertiary lymphoid structures found in several chronic inflammatory diseases. This mouse model will be useful to design strategies how to prevent tertiary lymphoid organ formation and bone disease.

The striking phenotype of lymphoid neogenesis in double TG animals may be due to the continuing stimulation of inducer cells through autocrine and paracrine stimulation (1). The IL-7R triggering leads to the upregulation of LTc3, TRANCE, and adhesion molecules on inducer cells. IL-7 as a survival and differentiation factor increases the pool of inducer cells (2) These highly activated' inducer cells migrate to non-lymphoid organs finding even more an appropriate niche' to survive and expand. Resident LTR+stromal cells become stimulated (3), and chemokines attracting lymphocytes will be produced. Lymphocytes * *8 I * *I P2540GB00 * : : . 16 January 2006

I I I S I I I I I

I I I I I I I I

I S III I S

120/ 156 enter via blood vessels and form under the guidance of inducer cells tertiary lymphoid structures(4) * I. * * I. P2540GB00: : :. * : : : : 16 January 2006 * * * S I S I I * I S I S I S S * 121/156 List of abbreviations: AAV Adeno-associated virus Ab Antibody Ag Antigen(s) AIRE Autoimmune regulator APC Antigen presenting cell(s) B6 C57BL/6 (mouse strain) BAFF B-cell activating factor of the TNF family Bcl-2 B cell leukemia 2 BM Bone marrow Bp Base pair Cap Capsis CIS Cytokine-induced suppressor cDNA Complement deoxynucleotide amino acid CLP Common lymphoid-restricted progenitor CP Cryptopatch(es) DC Dendritic cell(s) ERK Extracellular signal-regulated protein kinase FACS Fluorescence-activated cell sorter FAE Follicle-associated epithelium FDC Follicular dendritic cell(s) GALT Gut-associated lymphoid tissue GAS Gamma interferon activated sequences GC Germinal center(s) GFP Green fluorescence protein G1yCAN Glycosylation dependent cell adhesion molecule GM-CSF Granulocyte macrophage-colony-stimulating factor HEV High endothelial venule(s) HSV Herpes simplex virus HVEM Herpes simplex virus entry mediator ICAN Intercellular adhesion molecule 1d2 Helix-loop-helix inhibitor iFABP Intestinal fatty acid binding protein IFN Interferon Ig Immunoglobulin IKK 1KB kinase IL Interleukin ILF Isolated lymphoid follicle(s) ISRE IFN gamma specific regulatory element ITR Inverted terminal repeats 1KB Inhibitors of kappa B Jak Janus kinase LIGHT Lymphotoxin, inducible expression, glycoprotein D, HVEN, T lymphocyte Lin Lineage negative LT Lymphotoxin LN Lymph node(s) LP Lamina propria M Microfold MAdCAN-1 Mucosal vascular addressin cell-adhesion molecule 1 MAPK Mitogen-activated protein kinase P2540G300:: 16 January 2006 122/156 M-CSF Macrophage-colony-stimulating factor MHC class II Major histocompatibility complex of class II M Macrophages MLN Mesenteric lymph node MZ Marginal zone NALT Nasal-associated lymphoid tissue Neo Neomycin NF-KB Transcription factor nuclear factor-KB NK Natural killer cell NLS Nuclear localization signal NOD Non-obese diabetic NPC Nuclear pore complex OPGL Osteoprotegerin ligand ORF Open reading frame PDFGR Platelet-derived growth factor receptor PECAN Platelet/ endothelial cell adhesion molecule PP Peyer's patch(es) PNAd Peripheral-node addressin qRT-PCR Quantitative real time PCR RAG Recoinbination activating gene RBE Rep binding element Rep Replication RFX Regulatory factor X RIP Rat insulin promoter ROR7 Retinoid-related orphan receptor gamma RT-PCR Reverse transcriptase polymerase chain reaction SCF Stem cell factor STAT Signal transducer and activator of transcription TCR T cell receptor TG Transgenic TGF-f3 Transforming growth factor beta TLR Toll-like receptor TNF Tumor necrosis factor TRAF-6 TNF receptor-associated factor 6 TRANCE Tumor necrosis factor-related activation-induced cytokine Trs Terminal resolution site Tyk2 Tyrosine kinase 2 VCAN Vascular cellular adhesion molecule WT Wild type P2540GB00 16 January 2006 123/156 References: 1. Makala, L.H., N. Suzuki, and H. Nagasawa. 2002.

Peyer's patches: organized lymphoid structures for the induction of mucosal immune responses in the intestine.

Pathobiology 70:55-68.

2. Azzali, G. 2003. Structure, lymphatic vascularization and lymphocyte migration in mucosa-associated lymphoid tissue. Immunol Rev 195:178-189.

3. Golovkina, T.V., M. Shlomchik, L. Hannum, and A. Chervonsky. 1999. Organogenic role of B lymphocytes in mucosal immunity. Science 286:1965-1968.

4. Mach, J., T. Hshieh, D. Hsieh, N. Grubbs, and A. Chervonsky. 2005. Development of intestinal M cells.

Immunol Rev 206:177-189.

5. Man, A.L., M.E. Prieto-Garcia, and C. Nicoletti. 2004.

Improving M cell mediated transport across mucosal barriers: do certain bacteria hold the keys? Immunology 113:15-22.

6. Owen, R.L. 1999. Uptake and transport of intestinal macromolecules and microorganisms by M cells in Peyer's patches--a personal and historical perspective.

Semin Immunol 11:157-163.

7. Neutra, M.R., N.J. Mantis, and J.P. Kraehenbuhl. 2001.

Collaboration of epithelial cells with organized mucosal lymphoid tissues. Nat: Immunol 2:1004-1009.

8. Jang, M.H., M.N. Kweon, K. Iwatani, M. Yamamoto, K. Terahara, C. Sasakawa, T. Suzuki, T. Nochi, Y. Yokota, P.D. Rennert, T. Hiroi, H. Tamagawa, H. lijima, J. Kunisawa, Y. Yuki, and H. Kiyono. 2004. Intestinal villous M cells: an antigen entry site in the mucosal epithelium. Proc Natl Acad Sci U S A 101:6110-6115.

9. Rescigno, M., G. Rotta, B. Valzasina, and P. Ricciardi-Castagnoli. 2001. Dendritic cells shuttle microbes across gut epithelial monolayers.

Immunobiology 204:572-581.

10. Niess, J.H., S. Brand, X. Gu, L. Landsman, S. Jung, B.A. McCormick, J.M. Vyas, M. Boes, H.L. Ploegh, J.G.

Fox, D.R. Littman, and H.C. Reinecker. 2005. CX3CR1-mediated dendritic cell access to the intestinal lumen and bacterial clearance. Science 307:254-258.

11. MacLennan, I.C. 1994. Germinal centers. Annu Rev Immunol 12:117-139.

12. Cozine, C.L., K.L. Wolniak, and T.J. Waldscbmidt. 2005.

The primary germinal center response in mice. Curr Opin Immunol 17:298-302.

13. Miyasaka, M., and T. Tanaka. 2004. Lymphocyte trafficking across high endothelial venules: dogmas and enigmas. Nat Rev Immunol 4:360-370.

I II I I It P2540GB00 16 January 2006 124/ 156 14. Kraal, G., and R.E. Mebius. 1997. High endothelial venules: lymphocyte traffic control and controlled traffic. Adv. Immunol. 65:347-395.

15. Butcher, E. C., M. Williams, K. Youngman, L. Rott, and M. Briskin. 1999. Lymphocyte trafficking and regional immunity. Adv Immunol 72:209-253.

16. Johnston, B., and E.C. Butcher. 2002. Chemokines in rapid leukocyte adhesion triggering and migration.

Semin Immunol 14:83-92.

17. Brandtzaeg, P., and R. Pabst. 2004. Let's go mucosal: communication on slippery ground. Trends Irnmunol 25:570-577.

18. Wittig, B.M., and M. Zeitz. 2003. The gut as an organ of immunology. mt j Colorectal Dis 18:181-187.

19. Newberry, R.D., and R.G. Lorenz. 2005. Organizing a mucosal defense. Immunol Rev 206:6-21.

20. Salmi, M., and S. Jalkanen. 2005. Lymphocyte homing to the gut: attraction, adhesion, and commitment. Immunol Rev 206:100-113.

21. Pabst, 0., L. Ohi, M. Wendland, M.A. Wurbel, E. Kremmer, B. Malissen, and R. Forster. 2004. Chemokine receptor CCR9 contributes to the localization of plasma cells to the small intestine. J Exp Med 199:411-416.

22. Yamamoto, M., P. Rennert, J. R. McGhee, M. N. Kweon, S. Yamamoto, T. Dohi, S. Otake, H. Bluethmann, K. Fujihashi, and H. Kiyono. 2000. Alternate mucosal immune system: organized Peyer's patches are not required for IgA responses in the gastrointestinal tract. J Immunol 164:5184-5191.

23. Fagarasan, S., K. Kinoshita, M. Muramatsu, K. Ikuta, and T. Honjo. 2001. In situ class switching and differentiation to IgA-producing cells in the gut lamina propria. Nature 413:639-643.

24. Brandtzaeg, P., E.S. Baekkevold, and H.C. Morton. 2001.

From B to A the mucosal way. Nat Immunol 2:1093-1094.

25. Shikina, T., T. Hiroi, K. Iwatani, M.H. Jang, S. Fukuyama, M. Tamura, T. Kubo, H. Ishikawa, and H. Kiyono. 2004. IgA class switch occurs in the organized nasopharynx-and gut-associated lymphoid tissue, but not in the diffuse lamina propria of airways and gut.

J Immunol 172:6259-6264.

26. Hamada, H., T. Hiroi, Y. Nishiyama, H. Takahashi, Y. Masunaga, S. Hachimura, S. Kaminogawa, H. Takahashi-Iwanaga, T. Iwanaga, H. Kiyono, H. Yamamoto, and H. Ishikawa. 2002. Identification of multiple isolated lymphoid follicles on the antimesenteric wall of the mouse small intestine. J. Immunol. 168:57-64.

27. Faria, A.M., and H.L. Weiner. 2005. Oral tolerance.

Irnmunol Rev 206:232-259.

P2540GB00:: 16 January 2006 125/156 28. Sansonetti, P.J. 2004. War and peace at mucosal surfaces. Nat Rev Immunol 4:953-964.

29. Abreu, M.T., P. Vora, E. Faure, L.S. Thomas, E.T.

Arnold, and M. Arditi. 2001. Decreased expression of Toll-like receptor-4 and MD-2 correlates with intestinal epithelial cell protection against dysregulated proinflarnrnatory gene expression in response to bacterial lipopolysaccharide. J Immunol 167:1609-1616.

io 30. Mowat, A.M., A.G. Lamont, S. Strobel, and S. Mackenzie.

1987. The role of antigen processing and suppressor T cells in immune responses to dietary proteins in mice.

Adv Exp Med Biol 216A:709-720.

31. Thorstenson, K.M., and A. Khoruts. 2001. Generation of anergic and potentially immunoregulatory CD25+CD4 T cells in vivo after induction of peripheral tolerance with intravenous or oral antigen. J Immunol 167:188-195.

32. Ke, Y., K. Pearce, J.P. Lake, H.K. Ziegler, and J.A.

Kapp. 1997. Gamma delta T lymphocytes regulate the induction and maintenance of oral tolerance. J Immunol 158:3610-3618.

33. Fujihashi, K., T. Dohi, P.D. Rennert, M. Yamamoto, T. Koga, H. Kiyono, and J.R. McGhee. 2001. Peyer's patches are required for oral tolerance to proteins.

Proc Na11 Acad Sci U S A 98:3310-3315.

34. Spahn, T.W., A. Fontana, A.M. Faria, A.J. Slavin, H.P.

Eugster, X. Zhang, P.A. Koni, N.H. Ruddle, R.A.

Flavell, P.D. Rennert, and H.L. Weiner. 2001.

Induction of oral tolerance to cellular immune responses in the absence of Peyer's patches. Eur J Immunol 31:1278-1287.

35. Enders, G., T. Gottwald, and W. Brendel. 1986.

Induction of oral tolerance in rats without Peyer's patches. Immunology 58:311-314.

36. Spahn, T.W., H.L. Weiner, P.D. Rennert, N. Lugering, A. Fontana, W. Domschke, and T. Kucharzik. 2002.

Mesenteric lymph nodes are critical for the induction of high-dose oral tolerance in the absence of Peyer's patches. Eur J Immunol 32:1109-1113.

37. Wilson, H.V. 1907. On some phenomena of coalescence and regeneration in sponges. J. Exp. Zool. 5:245-258.

38. Spemann, H., and H. Mangold. 2001. Induction of embryonic primordia by implantation of organizers from a different species. 1923. mt j Dev Biol 45:13-38.

39. Yoshida, H., K. Honda, R. Shinkura, S. Adachi, S. Nishikawa, K. Maki, K. Ikuta, and S.I. Nishikawa. 1999.

IL-7 receptor alpha+ CD3(-) cells in the embryonic intestine induces the organizing center of Peyer's patches. mt Immunol 11:643-655.

I I* I It * I I I I I I P2540GB00 u it * . * ** 16 January 2006 * I I I I * I $ I I I I I

I I III I I

126/ 156 40. Hashi, H., H. Yoshida, K. Honda, S. Fraser, H. Kubo, M. Awane, A. Takabayashi, H. Nakano, Y. Yamaoka, and S. Nishikawa. 2001. Compartmentalization of Peyer's patch anlagen before lymphocyte entry. J Immunol 166:3702-3709. 41. Finke, D., H. Acha-Orbea, A. Mattis, M. Lipp, and J. Kraehenbuhl.

2002. CD4 CD3-cells induce Peyer's patch development: role of alpha4betal integrin activation by CXCR5. Immunity 17:363-373.

42. Sun, Z., D. 1Jnutmaz, Y. R. Zou, M. J. Sunshine, A. Pierani, S. Brenner-Morton, R.E. Mebius, and D.R.

Littman. 2000. Requirement for RORgamma in thymocyte survival and lymphoid organ development. Science 288:2369-2373.

43. Yokota, Y., A. Mansouri, S. Mon1 S. Sugawara, S. Adachi, S. Nishikawa, and P. Gruss. 1999. Development of peripheral lymphoid organs and natural killer cells depends on the helix-loop-helix inhibitor 1d2. Nature 397:702-706.

44. Fukuyama, S., T. Hiroi, Y. Yokota, P.D. Rennert, M. Yanagita, N. Kinoshita, S. Terawaki, T. Shikina, M. Yamamoto, Y. Kurono, and H. Kiyono. 2002. Initiation of NALT organogenesis is independent of the IL-7R, LTbetaR, and NIK signaling pathways but requires the 1d2 gene and CD3(-)CD4(+)CD45(+) cells. Immunity 17:31-40.

45. Adachi, S., H. Yoshida, H. Kataoka, and S. Nishikawa.

1997. Three distinctive steps in Peyer's patch formation of murine embryo. mt Immunol 9:507-514.

46. Elices, M.J., L. Osborn, Y. Takada, C. Crouse, S. Luhowskyj, M.E. Hemler, and R.R. Lobb. 1990. VCAN-1 on activated endothelium interacts with the leukocyte integrin VLA-4 at a site distinct from the VLA-4/fibronectin binding site. Cell 60:577-584.

47. Rose, D.M., V. Grabovsky, R. Alon, and M.H. Ginsberg.

2001. The affinity of integrin alpha(4)beta(i) governs lymphocyte migration. J Immunol 167:2824-2830.

48. Irnhof, B.A., and M. Aurrand-Lions. 2004. Adhesion mechanisms regulating the migration of monocytes. Nat Rev Immunol 4:432-444.

49. Jacobsen, K., J. Kravitz, P.W. Kincade, and D.G.

Osmond. 1996. Adhesion receptors on bone marrow stromal cells: in vivo expression of vascular cell adhesion molecule-i by reticular cells and sinusoidal endothelium in normal and gamma-irradiated mice. Blood 87:73-82.

50. Ulyanova, T., L.M. Scott, G.V. Priestley, Y. Jiang, B. Nakamoto, P.A. Koni, and T. Papayannopoulou. 2005.

VCAM-1 expression in adult hematopoietic and nonhematopoietic cells is controlled by tissue-P2540GB00:: :: . . 16 January 2006 127/ 156 inductive signals and reflects their developmental origin. Blood 106:86-94.

51. Rott, L.S., M.J. Briskin, and E.C. Butcher. 2000.

Expression of alpha4beta7 and E-selectin ligand by circulating memory B cells: implications for targeted trafficking to mucosal and systemic sites. J Leukoc Biol 68:807-814.

52. Taooka, Y., J. Chen, T. Yednock, and D. Sheppard. 1999.

The integrin alpha9betai mediates adhesion to io activated endothelial cells and transendothelial neutrophil migration through interaction with vascular cell adhesion molecule-i. J Cell Biol 145:413-420.

53. Van der Vieren, M., D.T. Crowe, D. Hoekstra, R. Vazeux, P.A. Hoffman, M.H. Grayson, B.S. Bochner, W.M.

Gallatin, and D.E. Staunton. 1999. The leukocyte integrin alpha D beta 2 binds VCAN-1: evidence for a binding interface between I domain and VCAN-1. J Immunol 163:1984-1990.

54. Honda, K., H. Nakano, H. Yoshida, S. Nishikawa, P. Rennert, K. Ikuta, M. Tamechika, K. Yamaguchi, T. Fukumoto, T. Chiba, and S.I. Nishikawa. 2001.

Molecular basis for hematopoietic/mesenchymal interaction during initiation of Peyer's patch organogenesis. J Exp Med 193:621-630.

55. Schatternan, G.C., K. Morrison-Graham, A. van Koppen, J.A. Weston, and D.F. Bowen-Pope. 1992. Regulation and role of PDGF receptor alpha-subunit expression during ernbryogenesis. Development 115:123-131.

56. Takakura, N., H. Yoshida, Y. Ogura, H. Kataoka, and S. Nishikawa. 1997. PDGFR alpha expression during mouse embryogenesis: inimunolocalization analyzed by whole- mount immunohistostaining using the monoclonal anti-mouse PDGFR alpha antibody APA5. J Histochem Cytochem 45:883-893.

57. Dejardin, E., N.M. Droin, M. Ijeihase, E. Haas, Y. Cao, C. Makris, Z.W. Li, M. Karin, C.F. Ware, and D.R.

Green. 2002. The lymphotoxin-beta receptor induces different patterns of gene expression via two NF-kappaB pathways. Immunity 17:525-535.

58. Forster, R., A.E. Mattis, E. Krernmer, E. Wolf, G. Brem, and M. Lipp. 1996. A putative chemokine receptor, BLR1, directs B cell migration to defined lymphoid organs and specific anatomic compartments of the spleen. Cell 87:1037-1047.

59. Ansel, K.M., V.N. Ngo, P.L. Hyman, S.A. Luther, R. Forster, J.D. Sedgwick, J.L. Browning, N. Lipp, and J.G. Cyster. 2000. A chemokine-driven positive feedback loop organizes lymphoid follicles. Nature 406:309-314. I tf.

t I I * * . P25400B00; :. 16 January 2006 * I I I * I I I I *I, I I 128/ 156 60. Nishikawa, S., K. Honda, P. Vieira, and H. Yoshida.

2003. Organogenesis of peripheral lymphoid organs.

Immunol Rev 195:72-80.

61. Cupedo, T., F.E. Lund, V.N. Ngo, T.IJ. Randall, W. Jansen, M.J. Greuter, R. de Waal-Malefyt, G. Kraal, J.G. Cyster, and R.E. Mebius. 2004. Initiation of cellular organization in lymph nodes is regulated by non-B cell-derived signals and is not dependent on CXC chemokine ligand 13. J Immunol 173:4889-4896.

62. Cyster, J.G., K.M. Ansel, K. Reif, E.H. Ekiand, P.L.

Hyman, H.L. Tang, S.A. Luther, and V.N. Ngo. 2000.

Follicular stromal cells and lymphocyte homing to follicles. Immunol Rev 176:181-193.

63. Balogh, P., Y. Aydar, J.G. Tew, and A.K. Szakal. 2001.

Ontogeny of the follicular dendritic cell phenotype and function in the postnatal murine spleen. Cell Immunol 214:45-53.

64. Pihlgren, M., C. Tougne, P. Bozzotti, A. Fulurija, M.A.

Duchosal, P.H. Larnbert, and C.A. Siegrist. 2003.

Unresponsiveness to lymphoid-mediated signals at the neonatal follicular dendritic cell precursor level contributes to delayed germinal center induction and limitations of neonatal antibody responses to T-dependent antigens. J Immunol 170:2824-2832.

65. Mackay, F., and 1LL. Browning. 1998. Turning off follicular dendritic cells. Nature 395:26-27.

66. Endres, R., M.B. Alimzhanov, T. Plitz, A. Futterer, M.H. Kosco-Vilbois, S.A. Nedospasov, K. Rajewsky, and K. Pfeffer. 1999. Mature follicular dendritic cell networks depend on expression of lymphotoxin beta receptor by radioresistant stromal cells and of lymphotoxin beta and tumor necrosis factor by B cells.

J. Exp. Med. 189:159-168.

67. Kelly, K.A., and R. Scollay. 1992. Seeding of neonatal lymph nodes by T cells and identification of a novel population of CD3-CD4+ cells. Eur J Immunol 22:329-334.

68. Mebius, R.E., P. Rennert, and I.L. Weissman. 1997.

Developing lymph nodes collect CD4+CD3-LTbeta+ cells that can differentiate to APC, NK cells, and follicular cells but not T or B cells. Immunity 7:493-504.

69. Adachi, S., H. Yoshida, K. Honda, K. Maki, K. Saijo, K. Ikuta, T. Saito, and S.I. Nishikawa. 1998. Essential role of IL-7 receptor alpha in the formation of Peyer's patch anlage. mt Immunol 10:1-6.

70. Norton, J.D., R.W. Deed, G. Craggs, and F. Sablitzky.

1998. Id helix-loop-helix proteins in cell growth and differentiation. Trends Cell Biol 8:58-65.

71. Mebius, R.E., T. Miyamoto, J. Christensen, J. Domen, T. Cupedo, I.L. Weissman, and K. Akashi. 2001. The fetal 4 4, 4 1 4 4 II I I P2540GB00 i i. I 16 January 2006 : : $ 411 * I *, 4 4 129/ 156 liver counterpart of adult common lymphoid progenitors gives rise to all lymphoid lineages, C]J45 CD4+CD3- cells, as well as macrophages. J. Immunol. 166:6593-6601.

72. Kondo, M., I.L. Weissman, and K. Akashi. 1997.

Identification of clonogenic common lymphoid progenitors in mouse bone marrow. Cell 91:661-672.

73. Yoshida, H., H. Kawamoto, S. Santee, H. Hashi, K. Honda, S. Nishikawa, C. Ware, Y. Katsura, and S. Nishikawa. 2001. Expression of alpha(4)beta(7) integrin defines a distinct pathway of lymphoid progenitors committed to T cells, fetal intestinal lymphotoxin producer, NK, and dendritic cells. J. Immunol. 167:2511-2521.

74. Kawamoto, H., K. Obmura, and Y. Katsura. 1997. Direct evidence for the commitment of hematopoietic stem cells to T, B and myeloid lineages in murine fetal liver. mt Immunol 9:1011-1019.

75. Eberl, G., and D.R. Littman. 2003. The role of the nuclear hormone receptor RORgammat in the development of lymph nodes and Peyer's patches. Immunol Rev 195:81-90.

76. He, Y.W., M.L. Deftos, E.W. Ojala, and N.J. Bevan.

1998. RORgamnma t, a novel isoform of an orphan receptor, negatively regulates Fas ligand expression and IL-2 production in T cells. Immunity 9:797-806.

77. Eberl, G., S. Marmon, N.J. Sunshine, P.D. Rennert, Y. Choi, and D.R. Littman. 2004. An essential function for the nuclear receptor RORgamma(t) in the generation of fetal lymphoid tissue inducer cells. Nat Immunol 5: 64-73.

78. Kurebayashi, S., E. Ueda, M. Sakaue, D.D. Patel, A. Medvedev, F. Zhang, and A.M. Jetten. 2000. Retinoid-related orphan receptor gamma (RORgamma) is essential for lymphoid organogenesis and controls apoptosis during thymopoiesis. Proc Natl Acad Sci U S A 97:10132-10137.

79. Locksley, R.M., N. Killeen, and M.J. Lenardo. 2001.

The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell 104:487-501.

80. Hehlgans, T., and K. Pfeffer. 2005. The intriguing biology of the tumour necrosis factor/tumour necrosis factor receptor superfamily: players, rules and the games. Immunology 115:1-20.

81. Schneider, K., K.G. Potter, and C.F. Ware. 2004.

Lymphotoxin and LIGHT signaling pathways and target genes. Immunol Rev 202:49-66.

82. Gommerman, J.L., and J.L. Browning. 2003.

Lymphotoxin/light, lymphoid microenvironments and autoimmune disease. Nat Rev Immunol 3:642-655.

* I I I I * * I tI I I I II * I I * I S I I I I S I * I S I I P2540GB00 5 16 January 2006 130/ 156 83. De Togni, P., J. Goeliner, N.H. Ruddle, P.R. Streeter, A. Fick, S. Mariathasan, S.C. Smith, R. Carlson, L.P.

Shornick, and J. Strauss-Schoenberger. 1994. Abnormal development of peripheral lymphoid organs in mice deficient in lymphotoxin. Science 264:703-707.

84. Matsumoto, M., S. Mariathasan, M.H. Nahm, F. Baranyay, J.J. Peschon, and D.D. Chaplin. 1996. Role of lymphotoxin and the type I TNF receptor in the formation of germinal centers. Science 271:1289-1291.

85. Ware, C.F., T.L. VanArsdale, P.D. Crowe, and J.L.

Browning. 1995. The ligands and receptors of the lymphotoxin system. Curr Top Microbiol Immunol 198:175-218.

86. Koni, P.A., R. Sacca, P. Lawton, J.L. Browning, N.H.

Ruddle, and R.A. Flavell. 1997. Distinct roles in lymphoid organogenesis for lymphotoxins alpha and beta revealed in lymphotoxin beta-deficient mice. Immunity 6:491-500.

87. Alimzhanov, M.B., D.V. Kuprash, M.H. Kosco-Vilbois, A. Luz, R.L. Turetskaya, A. Tarakhovsky, K. Rajewsky, S.A.

Nedospasov, and K. Pfeffer. 1997. Abnormal development of secondary lymphoid tissues in lymphotoxin beta-deficient mice. Proc Nati Acad Sci U S A 94:9302-9307.

88. Pabst, 0., H. Herbrand, T. Worbs, M. Friedrichsen, S. Yan, M.W. Hoffmann, H. Korner, G. Bernhardt, R. Pabst, and R. Forster. 2005. Cryptopatches and isolated lymphoid follicles: dynamic lymphoid tissues dispensable for the generation of intraepithelial lymphocytes. Eur J Immunol 35:98-107.

89. Crowe, P.D., T.L. VanArsdale, B.N. Walter, C.F. Ware, C. Hession, B. Ehrenfels, J.L. Browning, W.S. Din, R.G.

Goodwin, and C.A. Smith. 1994. A lymphotoxin-beta-specific receptor. Science 264:707-710.

90. Gramaglia, I., D.N. Mauri, K.T. Miner, C.F. Ware, and N. Croft. 1999. Lymphotoxin alphabeta is expressed on recently activated naive and Thi-like CD4 cells but is down-regulated by IL-4 during Th2 differentiation. J Immunol 162:1333-1338.

91. Browning, J.L., and L.E. French. 2002. Visualization of lymphotoxin-beta and lymphotoxin-beta receptor expression in mouse embryos. J Imrnunol 168:5079-5087.

92. Tumanov, A., D. Kuprash, N. Lagarkova, S. Grivennikov, K. Abe, A. Shakhov, L. Drutskaya, C. Stewart, A. Chervonsky, and S. Nedospasov. 2002. Distinct role of surface lymphotoxin expressed by B cells in the organization of secondary lymphoid tissues. Immunity 17:239-250.

93. Yoshida, H., A. Naito, J. Inoue, M. Satoh, S.M.

Santee-Cooper, C.F. Ware, A. Togawa, and S. Nishikawa.

2002. Different cytokines induce surface lymphotoxin- * I II e t I II * I I * * I I I I a I I I * I I I I * *** a * P2540GB00 16 January 2006 131/156 alphabeta on IL-7 receptor-alpha cells that differentially engender lymph nodes and Peyer's patches. Immunil:y 17:823-833.

94. Luther, S.A., A. Bidgol, D.C. Hargreaves, A. Schmidt, Y. Xu, J. Paniyadi, M. Matloubian, and J.G. Cyster.

2002. Differing activities of homeostatic chemokines CCL19, CCL21, and CXCL12 in lymphocyte and dendritic cell recruitment and lymphoid neogenesis. J Immunol 169:424-433.

95. Futterer, A., K. Mink, A. Luz, M.H. Kosco-Vilbois, and K. Pfeffer. 1998. The lyrnphotoxin beta receptor controls organogenesis and affinity maturation in peripheral lymphoid tissues. Immunity 9:59-70.

96. Rennert, P.D., J.L. Browning, R. Mebius, F. Mackay, and P.S. Hochrnan. 1996. Surface lymphotoxin alpha/beta complex is required for the development of peripheral lymphoid organs. J Exp Med 184:1999-2006.

97. Rennert, P.D., D. James, F. Mackay, J.L. Browning, and P.S. Hochman. 1998. Lymph node genesis is induced by signaling through the lymphotoxin beta receptor.

Immunity 9:71-79.

98. Wang, J., J.C. Lo, A. Foster, P. Yu, H.M. Chen, Y. Wang, K. Tamada, L. Chen, and Y.X. Fu. 2001. The regulation of T cell homeostasis and autoirnmunity by T cell-derived LIGHT. J Clin Invest 108:1771-1780.

99. Wang, J., A. Foster, R. Chin, P. Yu, Y. Sun, Y. Wang, K. Pfeffer, and Y.X. Fu. 2002. The complementation of lymphotoxin deficiency with LIGHT, a newly discovered TNF family member, for the restoration of secondary lyrnphoid structure and function. Eur J Immunol 32:1969-1979.

100. Scheu, S., J. Alferink, T. Potzel, W. Barchet, U. Kalinke, and K. Pfeffer. 2002. Targeted disruption of LIGHT causes defects in costimulatory T cell activation and reveals cooperation with lymphotoxin beta in mesenteric lymph node genesis. J Exp Med 195:1613-1624.

101. Pasparakis, M., L. Alexopoulou, V. Episkopou, and G. Kollias. 1996. Immune and inflammatory responses in TNF alpha-deficient mice: a critical requirement for TNF alpha in the formation of primary B cell follicles, follicular dendritic cell networks and germinal centers, and in the maturation of the humoral immune response. J Exp Med 184:1397-1411.

102. Kuprash, D.V., A.V. Tumanov, D.J. Liepinsh, E.P.

Koroleva, M.S. Drutskaya, A.A. Kruglov, A.N. Shakhov, E. Southon, W.J. Murphy, L. Tessarollo, S.I.

Grivennikov, and S.A. Nedospasov. 2005. Novel tumor necrosis factor-knockout mice that lack Peyer's patches. Eur J Immunol 35:1592-1600.

* 1 II I I I 4 a I * * * I I I I * I I I I I I I I I Ie* I a P25400B00 16 January 2006 132/156 103. Scarff, K.L., K.S. Ung, J. Sun, and P.1. Bird. 2003. A retained selection cassette increases reporter gene expression without affecting tissue distribution in SPI3 knockout/GFP knock-in mice. Genesis 36:149-157.

104. Pfeffer, K., T. Matsuyama, T.M. Kundig, A. Wakeham, K. Kishihara, A. Shahinian, K. Wiegmann, P.S. Ohashi, M. Kronke, and T.W. Mak. 1993. Mice deficient for the 55 kd tumor necrosis factor receptor are resistant to endotoxic shock, yet succumb to L. monocytogenes infection. Cell 73:457-467.

105.Neumann, B., A. Luz, K. Pfeffer, and B. Holzmann. 1996.

Defective Peyer's patch organogenesis in mice lacking the 55-kD receptor for tumor necrosis factor. J Exp Med 184:259-264.

106. Pasparakis, M., L. Alexopoulou, M. Grell, K. Pfizenmaier, H. Bluethmann, and G. Kollias. 1997.

Peyer's patch organogenesis is intact yet formation of B lymphocyte follicles is defective in peripheral lymphoid organs of mice deficient for tumor necrosis factor and its 55-kDa receptor. Proc Natl Acad Sci U S A 94:6319-6323.

107. Rothe, J., W. Lesslauer, H. Lotscher, Y. Lang, P. Koebel, F. Kontgen, A. Aithage, R. Zinkernagel, M. Steinmetz, and H. Bluethmann. 1993. Mice lacking the tumour necrosis factor receptor 1 are resistant to TNF-mediated toxicity but highly susceptible to infection by Listeria monocytogenes. Nature 364:798-802.

108. Walsh, M.C., and Y. Choi. 2003. Biology of the TRANCE axis. Cytokine Growth Factor Rev 14:251-263.

109.Wong, B.R., J. Rho, J. Arron, E. Robinson, J. Orlinick, M. Chao, S. Kalachikov, E. Cayani, F.S. Bartlett, 3rd, W.N. Frankel, S.Y. Lee, and Y. Chol. 1997. TRANCE is a novel ligand of the tumor necrosis factor receptor family that activates c-Jun N-terminal kinase in T cells. J Biol Chem 272:25190-25194.

110. Kamath, A. T., S. Henri, F. Battye, D. F. Tough, and K. Shortman. 2002. Developmental kinetics and lifespan of dendritic cells in mouse lymphoid organs. Blood 100:1734-1741.

lii. Yasuda, H., N. Shima, N. Nakagawa, K. Yamaguchi, M. Kinosaki, S. Mochizuki, A. Tomoyasu, K. Yano, M. Goto, A. Murakami, E. Tsuda, T. Morinaga, K. Higashlo, N. Udagawa, N. Takahashi, and T. Suda. 1998. Osteoclast differentiation factor is a ligand for osteoprotegerin/osteoclastogenesi s-inhibitory factor and is identical to TRANCE/RANKL. Proc Natl Acad Sci U S A 95:3597-3602.

112. Lacey, D.L., E. Tirnrns, H.L. Tan, M.J. Kelley, C.R.

So Dunstan, T. Burgess, R. Elliott, A. Colombero, G. I I LI I $ I a i, t, I I I a a a a a a I I * a Iii I $ P25400B00 16 January 2006 133/156 Elliott, S. Scully, H. Hsu, J. Sullivan, N. Hawkins, E. Davy, C. Capparelli, A. Eli, Y.X. Qian, S. Kaufman, I. Sarosi, V. Shaihoub, G. Senaldi, J. Guo, J. Delaney, and W.J. Boyle. 1998. Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation. Cell 93:165-176.

113. Kong, Y.Y., H. Yoshida, I. Sarosi, H.L. Tan, E. Tirnms, C. Capparelli, S. Morony, A.J. Oliveira-dos-Santos, G. Van, A. Itie, W. Khoo, A. Wakeham, C.R. Dunstan, D.L.

Lacey, T.W. Mak, W.J. Boyle, and J.M. Penninger. 1999.

OPGL is a key regulator of osteoclastogenesis, lymphocyte development and lymph-node organogenesis.

Nature 397:315-323.

114. Kim, D., R.E. Mebius, J.D. MacMicking, S. Jung, T. Cupedo, Y. Castellanos, J. Rho, B.R. Wong, R. Josien, N. Kim, P.D. Rennert, and Y. Choi. 2000. Regulation of peripheral lymph node genesis by the tumor necrosis factor family member TRANCE. J Exp Med 192:1467-1478.

115.Dougall, W.C., M. Glaccum, K. Charrier, K. Rohrbach, K. Brasel, T. De Smedt, E. Daro, J. Smith, M.E. Tometsko, C.R. Maliszewski, A. Armstrong, V. Shen, S. Bain, D. Cosman, D. Anderson, P.J. Morrissey, J.J. Peschon, and J. Schuh. 1999. RANK is essential for osteoclast and lymph node development. Genes Dev 13:2412-2424.

116. Muller, J.R., and U. Siebenlist. 2003. Lymphotoxin beta receptor induces sequential activation of distinct NF-kappa B factors via separate signaling pathways. J Biol Chem 278:12006-12012.

117. Weih, F., and J. Caamano. 2003. Regulation of secondary lymphoid organ development by the nuclear factor-kappaB signal transduction pathway. Immunol Rev 195:91-105.

118. Bonizzi, G., and M. Karin. 2004. The two NF-kappaB activation pathways and their role in innate and adaptive immunity. Trends Immunol 25:280-288.

119. Park, L.S., D.J. Friend, A.E. Scbmierer, S.K. Dower, and A.E. Namen. 1990. Murine interleukin 7 (IL-7) receptor. Characterization on an IL-7-dependent cell line. J Exp Med 171:1073-1089.

120. Rich, B.E., J. Campos-Torres, R.I. Tepper, R.W.

Moreadith, and P. Leder. 1993. Cutaneous lymphoproliferation and lymphomas in interleukin 7 transgenic mice. J Exp Med 177:305-316.

121. Reinecker, H.C., and D.K. Podoisky. 1995. Human intestinal epithelial cells express functional cytokine receptors sharing the common gamma c chain of the interleukin 2 receptor. Proc Nati Acad Sci U S A 92:8353-8357.

122. Foxwell, B.M., D.A. Taylor-Fishwick, J.L. Simon, T.H.

Page, and M. Londei. 1992. Activation induced changes S, S S I f 1 I

I I I I I I I I

I I(f I I P2540GB00 16 January 2006 134/ 156 in expression and structure of the IL-7 receptor on human T cells. mt Imrnunol 4:277-282.

123. Miyaj i, C., H. Watanabe, Y. Osman, Y. Kuwano, and T. Abo. 1996. A comparison of proliferative response to IL-7 and expression of IL-7 receptors in intermediate TCR cells of the liver, spleen, and thymus. Cell Immunol 169:159-165.

124. Cao, X., E.W. Shores, J. Hu-Li, M.R. Anver, B.L.

Kelsall, S.M. Russell, J. Drago, M. Noguchi, A. Grinberg, E.T. Bloom, and et al. 1995. Defective lymphoid development in mice lacking expression of the common cytokine receptor gamma chain. Immunity 2:223-238.

125. Kang, J., and S. Der. 2004. Cytokine functions in the formative stages of a lymphocyte's life. Curr Opin Immunol 16:180-190.

126. Hofmeister, R., A.R. Khaled, N. Benbernou, E. Rajnavolgyi, K. Muegge, and S.K. Durum. 1999.

Interleukin-7: physiological roles and mechanisms of action. Cytokine Growth Factor Rev 10:41-60.

127. Buckley, R.H. 2000. Primary immunodeficiency diseases due to defects in lymphocytes. N Engl J Med 343:1313-1324.

128. Fischer, A. 2000. Severe combined immunodeficiencies (SCID). Clin Exp Immunol 122:143-149.

129. Peschon, J.J., P.J. Morrissey, K.H. Grabstein, F.J.

Ramsdell, E. Maraskovsky, B.C. Gliniak, L.S. Park, S.F.

Ziegler, D.E. Williams, C.B. Ware, and et al. 1994.

Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice. J Exp Med 180:1955-1960.

130. Maki, K., S. Sunaga, Y. Komagata, Y. Kodaira, A. Mabuchi, H. Karasuyama, K. Yokomuro, J.I. Miyazaki, and K. Ikuta. 1996. Interleukin 7 receptor-deficient mice lack gammadelta T cells. Proc Nati Acad Sci U S A 93:7172-7177.

131. Luther, S.A., K.M. Ansel, and J.G. Cyster. 2003.

Overlapping roles of CXCL13, interleukin 7 receptor alpha, and CCR7 ligands in lymph node development. J Exp Med 197:1191-1198.

132. Mebius, R.E. 2003. Organogenesis of lymphoid tissues.

Nat Rev Immunol 3:292-303.

133. Imada, K., and W.J. Leonard. 2000. The Jak-STAT pathway. Mol Immunol 37:1-11.

134. Giliani, S., L. Mon. G. de Saint Basile, F. Le Deist, C. Rodriguez-Perez, C. Forino, E. Mazzolari, S. Dupuis, R. Elhasid, A. Kessel, C. Galambrun, J. Gil, A. Fischer, A. Etzioni, and L.D. Notarangelo. 2005.

Interleukin-7 receptor alpha (IL-7Ralpha) deficiency: cellular and molecular bases. Analysis of clinical,

I

I I I I t

I I I I I I I

I I III I I

P2540GB00 16 January 2006 135/ 156 immunological, and molecular features in 16 novel patients. Immunol Rev 203:110-126.

135.Park, S.Y., K. Saijo, T. Takahashi, M. Osawa, H. Arase, N. Hirayama, K. Miyake, H. Nakauchi, T. Shirasawa, and T. Saito. 1995. Developmental defects of lymphoid cells in Jak3 kinase-deficient mice. Immunity 3:771-782.

136. O'Shea, J.J. 1997. Jaks, STATs, cytokine signal transduction, and imnmunoregulation: are we there yet? Immunity 7:1-11.

137. Rodig, S.J., M.A. Meraz, J.M. White, P.A. Lampe, J.K.

Riley, C.D. Arthur, K.L. King, K.C. Sheehan, L. Yin, ID.

Pennica, E.M. Johnson, Jr., and R.D. Schreiber. 1998.

Disruption of the Jaki gene demonstrates obligatory and nonredundant roles of the Jaks in cytokine-induced biologic responses. Cell 93:373-383.

138. Moriggl, R., D.J. Topham, S. Teglund, V. Sexl, C. McKay, D. Wang, A. Hoffmeyer, J. van Deursen, M.Y.

Sangster, K.D. Bunting, G.C. Grosveld, and J.N. Ihie.

1999. StatS is required for IL-2-induced cell cycle progression of peripheral T cells. Immunity 10:249-259.

139. Kang, J., B. DiBenedetto, K. Narayan, H. Zhao, S.D.

Der, and C.A. Chambers. 2004. STAT5 is required for thymopoiesis in a development stage-specific manner. J Immunol 173:2307-2314.

140. Boyle, W.J., W.S. Simonet, and D.L. Lacey. 2003.

Osteoclast differentiation and activation. Nature 423:337-342.

141. Namen, A.E., A.E. Schmierer, C.J. March, R.W. Overell, L.S. Park, D.L. Urdal, and D.Y. Mochizuki. 1988. B cell precursor growth-promoting activity. Purification and characterization of a growth factor active on lymphocyte precursors. J Exp Med 167:988-1002.

142. Namen, A.E., S. Lupton, K. Hjerrild, J. Wignall, D.Y.

Mochizuki, A. Scbmierer, B. Mosley, C.J. March, D. Urdal, and S. Gillis. 1988. Stimulation of B-cell progenitors by cloned murine interleukin-7. Nature 333:571-573.

143. Fry, T.J., and C.L. Mackall. 2002. Interleukin-7: from bench to clinic. Blood 99:3892-3904.

144. Ariizumi, K., Y. Meng, P.R. Bergstresser, and A. Takashima. 1995. IFN-gamma-dependent IL-7 gene regulation in keratinocytes. J Immunol 154:6031-6039.

145. Madrigal-Estebas, L., R. McManus, B. Byrne, S. Lynch, D.G. Doherty, D. Kelleher, D.P. O'Donoghue, C. Feighery, and C. O'Farrelly. 1997. Human small intestinal epithelial cells secrete interleukin-7 and differentially express two different interleukin-7 mRNA Transcripts: implications for extrathymic T-cell differentiation. Hum Immunol 58:83-90.

* ,* * P2540GB00: * ** * : : 16 January 2006 * . * -S * S S 551 * S 136/ 156 146. Wiles, M.V., P. Ruiz, and B.A. Imhof. 1992.

Interleukin-7 expression during mouse thymus development. Eur J Immunol 22:1037-1042.

147. Heufler, C., G. Topar, A. Grasseger, U. Stanzl, F. Koch, N. Romani, A.E. Namen, and G. Schuler. 1993.

Interleukin 7 is produced by murine and human keratinocytes. J Exp Med 178:1109-1114.

148. Golden-Mason, L., A.M. Kelly, 0. Traynor, G. McEntee, J. Kelly, J.E. Hegarty, and C. O'Farrelly. 2001.

Expression of interleukin 7 (IL-7) mRNA and protein in the normal adult human liver: implications for extrathymic T cell development. Cytokine 14:143-151.

149. de Saint-Vis, B., I. Fugier-Vivier, C. Massacrier, C. Gaillard, B. Vanbervliet, S. Ait-Yahia, J. Banchereau, Y.J. Liu, S. Lebecque, and C. Caux. 1998. The cytokine profile expressed by human dendritic cells is dependent on cell subtype and mode of activation. J Immunol 160:1666-1676.

150. Kroncke, R., H. Loppnow, H.D. Flad, and J. Gerdes.

1996. Human follicular dendritic cells and vascular cells produce interleukin-7: a potential role for interleukin-7 in the germinal center reaction. Eur J Immunol 26:2541-2544.

151. Murray, A.M., B. Simm, and K.W. Beagley. 1998.

Cytokine gene expression in murine fetal intestine: potential for extrathymic T cell development. Cytokine 10:337-345.

152.Grabstein, K.H., T.J. Waldschmidt, F.D. Finkelman, B.W.

Hess, A.R. Alpert, N.E. Boiani, A.E. Namen, and P.J.

Morrissey. 1993. Inhibition of murine B and T lymphopoiesis in vivo by an anti-interleukin 7 monoclonal antibody. J Exp Med 178:257-264. 153. von Freeden-Jef fry, U., P. Vieira, L.A. Lucian, T. McNeil, S.E.

Burdach, and R. Murray. 1995. Lymphopenia in interleukin (IL)-7 gene-deleted mice identifies IL- 7 as a nonredundant cytokine. J Exp Med 181:1519-1526.

l54.Sims, J.E., D.E. Williams, P.J. Morrissey, K. Garka, D. Foxworthe, V. Price, S.L. Friend, A. Farr, M.A. Bedell, N.A. Jenkins, N.G. Copeland, K. Grabstein, and R.J.

Paxton. 2000. Molecular cloning and biological characterization of a novel murine lyrnphoid growth factor. J Exp Med 192:671-680.

155. Quentmeier, H., H.G. Drexier, D. Fleckenstein, M. Zaborski, A. Armstrong, J.E. Sims, and S.D. Lyman.

2001. Cloning of human thymic stromal lymphopoietin (TSLP) and signaling mechanisms leading to proliferation. Leukemia 15:1286-1292.

156. Reche, P.A., V. Soumelis, D.M. Gorman, T. Clifford, M. Liu, M. Travis, S.M. Zurawski, J. Johnston, Y.J. Liu, H. Spits, R. de Waal Malefyt, R.A. Kastelein, and J.F.

I. , I I I

I I I I

P2540GB00 * **. * 16 January 2006 : : : :.. *. * I

137/156 Bazan. 2001. Human thymic stromal lymphopoietin preferentially stimulates myeloid cells. J Imrnunol 167:336-343.

157. Friend, S.L., 5. Hosier, A. Nelson, D. Foxworthe, D.E.

Williams, and A. Farr. 1994. A thymic stromal cell line supports in vitro development of surface IgM+ B cells and produces a novel growth factor affecting B and T lineage cells. Exp Hematol 22:321-328.

l58.Vosshenrich, C.A., A. Cumano, W. Muller, J.P. Di Santo, and P. Vieira. 2003. Thymic stromal-derived lymphopoietin distinguishes fetal from adult B cell development. Nat Immunol 4:773-779.

159.Vosshenrich, C.A., A. Cumano, W. Muller, J.P. Di Santo, and P. Vieira. 2004. Pre-B cell receptor expression is necessary for thymic stromal lymphopoietin responsiveness in the bone marrow but not in the liver environment. Proc Nati Acad Sci U S A 101:11070-11075.

160. Park, L.S., U. Martin, K. Garka, B. Gliniak, J.P. Di Santo, W. Muller, D.A. Largaespada, N.G. Copeland, N.A.

Jenkins, A.G. Farr, S.F. Ziegler, P.J. Morrissey, R. Paxton, and J.E. Sims. 2000. Cloning of the murine thymic stromal lymphopoietin (TSLP) receptor: Formation of a functional heteromeric complex requires interleukin 7 receptor. J Exp Med 192:659-670.

161. Pandey, A., K. Ozaki, H. Baumann, S.D. Levin, A. Puel, A.G. Farr, S.F. Ziegler, W.J. Leonard, and H.F. Lodish.

2000. Cloning of a receptor subunit required for signaling by thymic stromal lymphopoietin. Nat Immunol 1:59-64.

162. Isaksen, D.E., H. Baumann, P.A. Trobridge, A.G. Farr, S.D. Levin, and S.F. Ziegler. 1999. Requirement for stat5 in thymic stromal lymphopoietin-mediated signal transduction. J Immunol 163:5971-5977.

163. Isaksen, D.E., H. Baumann, B. Zhou, S. Nivollet, A.G.

Farr, S.D. Levin, and S.F. Ziegler. 2002. Uncoupling of proliferation and Stat5 activation in thymic stromal lymphopoietin-mediated signal transduction. J Irnmunol 168:3288-3294.

164. Fuj io, K., T. Nosaka, T. Koj ima, T. Kawashima, T. Yahata, N.G. Copeland, D.J. Gilbert, N.A. Jenkins, K. Yamamoto, T. Nishimura, and T. Kitamura. 2000.

Molecular cloning of a novel type 1 cytokine receptor similar to the common gamma chain. Blood 95:2204-2210.

165.Naito, A., S. Azuma, S. Tanaka, T. Miyazaki, S. Takaki, K. Takatsu, K. Nakao, K. Nakamura, M. Katsuki, T. Yamamoto, and J. Inoue. 1999. Severe osteopetrosis, defective interleukin-l signalling and lymph node organogenesis in TRAF6-deficient mice. Genes Cells 4:353-362. : :.

P2540GB00: : : 16 January 2006 * * . I * I * *I* 138/156 166. Borghesi, L.A., Y. Yamashita, and P.W. Kincade. 1999.

Heparan sulfate proteoglycans mediate interleukin-7-dependent B lymphopoiesis. Blood 93:140-148.

167. Banwell, C.M., K.M. Partington, E.J. Jenkinson, and G. Anderson. 2000. Studies on the role of IL-7 presentation by mesenchymal fibroblasts during early thymocyte development. Eur J Immunol 30:2125-2129.

168.Samaridis, J., G. Casorati, A. Traunecker, A. Iglesias, J.C. Gutierrez, U. Muller, and R. Palacios. 1991.

Development of lymphocytes in interleukin 7-transgenic mice. Eur J Immunol 21:453-460.

169. Mertsching, E., C. Burdet, and R. Ceredig. 1995. IL-7 transgenic mice: analysis of the role of IL-7 in the differentiation of thymocytes in vivo and in vitro.

mt Immunol 7:401-414.

170. Williams, I.R., E.A. Rawson, L. Manning, T. Karaoli, B.E. Rich, and T.S. Kupper. 1997. IL-7 overexpression in transgenic mouse keratinocytes causes a lymphoproliferative skin disease dominated by intermediate TCR cells: evidence for a hierarchy in IL-7 responsiveness among cutaneous T cells. J Immunol 159:3044-3056.

171. Laky, K., L. Lefrancois, E.G. Lingenheld, H. Ishikawa, J.M. Lewis, S. Olson, K. Suzuki, R.E. Tigelaar, and L. Puddington. 2000. Enterocyte expression of interleukin 7 induces development of garnmadelta T cells and Peyer's patches. J Exp Med 191:1569-1580.

172. Uehira, M., H. Matsuda, I. Hikita, T. Sakata, H. Fujiwara, and H. Nishimoto. 1993. The development of dermatitis infiltrated by gamma delta T cells in IL-7 transgenic mice. mt Immunol 5:1619-1627.

173. Watanabe, M., Y. Ueno, T. Yajima, S. Okamoto, T. Hayashi, N. Yamazaki, Y. Iwao, H. Ishii, S. Habu, M. Uehira, H. Nishimoto, H. Ishikawa, J. Hata, and T. Hibi. 1998. Interleukin 7 transgenic mice develop chronic colitis with decreased interleukin 7 protein accumulation in the colonic mucosa. J Exp Med 187:389-402.

174. Alpdogan, 0., and M.R. van den Brink. 2005. IL-7 and IL-15: therapeutic cytokines for immunodeficiency.

Trends Imrrzunol 26:56-64.

175.Cyster, J.G. 2005. Chemokines, sphingosine-1-phosphate, and cell migration in secondary lymphoid organs. Annu Rev Immunol 23:127-159.

176. Campbell, D.J., C.H. Kim, and E.C. Butcher. 2003.

Chemokines in the systemic organization of immunity.

Immunol Rev 195:58-71.

177. Rossi, D., and A. Zlotnik. 2000. The biology of chemokines and their receptors. Annu Rev Irnmunol 18:217-242. S * *

S * I S II P2540GB00. * : : : 16 January 2006 * S I -S S * S 5*5 139/156 178. Rollins, B.J. 1997. Chemokines. Blood 90:909-928.

179. Proudfoot, A.E. 2002. Chemokine receptors: multifaceted therapeutic targets. Nat Rev Immunol 2:106-115.

180. Cyster, J.G., V.N. Ngo, E.H. Ekland, M.D. Gunn, J.D.

Sedgwick, and K.M. Ansel. 1999. Chemokines and B-cell homing to follicles. Curr Top Microbiol Immunol 246:87-92; discussion 93.

181. Muller, G., U.E. Hopken, and M. Lipp. 2003. The impact of CCR7 and CXCR5 on lymphoid organ development and systemic immunity. Imrnunol Rev 195:117-135.

182. Spangrude, G.J., B.A. Braaten, and R.A. Daynes. 1984.

Molecular mechanisms of lymphocyte extravasation. I. Studies of two selective inhibitors of lymphocyte recirculation. J Immunol 132:354-362.

183. Bargatze, R.F., and E.C. Butcher. 1993. Rapid G protein-regulated activation event involved in lymphocyte binding to high endothelial venules. J Exp Med 178:367-372.

184. Gunn, M.D., K. Tangemann, C. Tam, J.G. Cyster, S.D.

Rosen, and L.T. Williams. 1998. A chemokine expressed in lymphoid high endothelial venules promotes the adhesion and chemotaxis of naive T lymphocytes. Proc Nati Acad Sci U S A 95:258-263.

185. Baekkevold, E.S., T. Yamanaka, R.T. Paiframan, H.S.

Carisen, F.P. Reinholt, U.H. von Andrian, P. Brandtzaeg, and G. Haraldsen. 2001. The CCR7 ligand elc (CCL19) is transcytosed in high endothelial venules and mediates T cell recruitment. J Exp Med 193:1105-1112.

186. Phillips, R., and A. Ager. 2002. Activation of pertussis toxin-sensitive CXCL12 (SDF-l) receptors mediates transendothelial migration of T lymphocytes across lymph node high endothelial cells. Eur J Immunol 32:837-847.

187. Okada, T., V.N. Ngo, E.H. Ekland, R. Forster, M. Lipp, D.R. Littman, and J.G. Cyster. 2002. Chemokine requirements for B cell entry to lymph nodes and Peyer's patches. J Exp Med 196:65-75.

188. Ansel, K.M., L.J. McHeyzer-Williams, V.N. Ngo, M.G.

McHeyzer-Williams, and J.G. Cyster. 1999. In vivo-activated CD4 T cells upregulate CXC chemokine receptor 5 and reprogram their response to lymphoid chemokines. J Exp Med 190:1123-1134.

189. Bowman, E.P., J.J. Campbell, D. Soler, Z. Dong, N. Manlongat, D. Picarella, R.R. Hardy, and E.C. Butcher.

2000. Developmental switches in chemokine response profiles during B cell differentiation and maturation.

J Exp Med 191:1303-1318.

* 60 * * * * * o 4 4 3 * 6 P2540G300: : : * . * 16 January 2006 * 3 6 *.* * * 6 140/ 156 190. Allen, C.D., K.M. Ansel, C. Low, R. Lesley, H. Tamamura, N. Fujii, and J.G. Cyster. 2004. Germinal center dark and light zone organization is mediated by CXCR4 and CXCR5. Nat Immunol 5:943-952.

191. Forster, R., A. Schubel, D. Breitfeld, E. Kremmer, I. Renner-Muller, E. Wolf, and M. Lipp. 1999. CCR7 coordinates the primary immune response by establishing functional microenvironments in secondary lymphoid organs. Cell 99:23-33.

192. Gunn, M.D., S. Kyuwa, C. Tam, T. Kakiuchi, A. Matsuzawa, L.T. Williams, and H. Nakano. 1999. Mice lacking expression of secondary lymphoid organ chemokine have defects in lymphocyte homing and dendritic cell localization. J Exp Med 189:451-460.

193. Luther, S.A., H.L. Tang, P.L. Hyman, A.G. Farr, and J.G. Cyster. 2000. Coexpression of the chemokines ELC and SLC by T zone stromal cells and deletion of the ELC gene in the plt/plt mouse. Proc Natl Acad Sci U S A 97:12694-12699.

194. Cyster, J.G. 1999. Chemokines and cell migration in secondary lymphoid organs. Science 286:2098-2102.

195. Luther, S.A., T. Lopez, W. Bai, D. Hanahan, and J.G.

Cyster. 2000. BLC expression in pancreatic islets causes B cell recruitment and lymphotoxin-dependent lymphoid neogenesis. Immuniby 12:471-481.

196. Ngo, V.N., H. Korner, M.D. Gunn, K.N. Schmidt, D.S.

Riminton, M.D. Cooper, J.L. Browning, J.D. Sedgwick, and J.G. Cyster. 1999. Lymphotoxin alpha/beta and tumor necrosis factor are required for stromal cell expression of homing chemokines in B and T cell areas of the spleen. J. Exp. Med. 189:403-412.

197.Ohl, L., G. Henning, S. Krautwald, M. Lipp, S. Hardtke, G. Bernhardt, 0. Pabst, and R. Förster. 2003.

Cooperative mechanisms of CXCR5 and CCR7 in development and organization of secondary lymphoid organs. J. Exp. Med. 197:1199-1204.

198. Tachibana, K., S. Hirota, H. lizasa, H. Yoshida, K. Kawabata, Y. Kataoka, Y. Kitamura, K. Matsushima, N. Yoshida, S. Nishikawa, T. Kishimoto, and T. Nagasawa.

1998. The chemokine receptor CXCR4 is essential for vascularization of the gastrointestinal tract. Nat:ure 393:591-594.

199. Rosen, S.D. 2004. Ligands for L-selectin: homing, inflammation, and beyond. Annu Rev Immunol 22:129-156.

200. Mebius, R.E., P.R. Streeter, S. Michie, E.C. Butcher, and I.L. Weissman. 1996. A developmental switch in lymphocyte homing receptor and endothelial vascular addressin expression regulates lymphocyte homing and permits CD4+ CD3-cells to colonize lymph nodes. Proc. Nati. Acad. Sci. US 93:11019-11024.

* It **. I I

I I I I I

P2540GB00 * : . * 16 January 2006 : * * * 141/ 156 201. Pabst, 0., R. Forster, M. Lipp, H. Engel, and H.H.

Arnold. 2000. NKX2.3 is required for MAdCAN-l expression and homing of lymphocytes in spleen and mucosa-associated lymphoid tissue. Embo J 19:2015-.

202. Moghaddami, M., A. Curnmins, and G. Mayrhofer. 1998.

Lymphocyte-filled villi: comparison with other lymphoid aggregations in the mucosa of the human small intestine. Gastroenterology 115:1414-1425.

203. Keren, D.F., P.S. Holt, H.H. Collins, P. Gemski, and S.B. Formal. 1978. The role of Peyer's patches in the local immune response of rabbit ileum to live bacteria.

J Irrimunol 120:1892-1896.

204. Rosner, A.J., and D.F. Keren. 1984. Demonstration of M cells in the specialized follicle-associated epithelium overlying isolated lymphoid follicles in the gut. J Leukoc Biol 35:397-404.

205. Lorenz, R.G., D.D. Chaplin, K.G. McDonald, J.S.

McDonough, and R.D. Newberry. 2003. Isolated lymphoid follicle formation is inducible and dependent upon lymphotoxin-sufficient B lymphocytes, lymphotoxin beta receptor, and TNF receptor I function. J Imrnunol 170:5475-5482.

206. Fagarasan, S., M. Muramatsu, K. Suzuki, H. Nagaoka, H. Hiai, and T. Honjo. 2002. Critical roles of activation-induced cytidine deaminase in the homeostasis of gut flora. Science 298:1424-1427.

207. Lorenz, R.G., and R.D. Newberry. 2004. Isolated lymphoid follicles can function as sites for induction of mucosal immune responses. Ann N Y Acad Sci 1029:44-57.

208.Kanamori, Y., K. Ishimaru, M. Nanno, K. Maki, K. Ikuta, H. Nariuchi, and H. Ishikawa. 1996. Identification of novel lymphoid tissues in murine intestinal mucosa where clusters of c-kit+ IL-7R+ Thyl+ lympho-hemopoietic progenitors develop. J Exp Med 184:1449-1459.

209. Suzuki, K., T. Olda, H. Hamada, 0. Hitotsumatsu, M. Watanabe, T. Hibi, H. Yamamoto, E. Kubota, S. Kaminogawa, and H. Ishikawa. 2000. Gut cryptopatches: direct evidence of extrathymic anatomical sites for intestinal T lymphopoiesis. Immunity 13:691-702.

210. Saito, H., Y. Kanamori, T. Takemori, H. Nariuchi, E. Kubota, H. Takahashi-Iwanaga, T. Iwanaga, and H. Ishikawa. 1998. Generation of intestinal T cells from progenitors residing in gut cryptopatches. Science 280:275-278.

211. Guy-Grand, TJ., N. Cerf-Bensussan, B. Malissen, M. Malassis-Seris, C. Briottet, and P. Vassalli. 1991.

Two gut intraepithelial CD8+ lymphocyte populations with different T cell receptors: a role for the gut * II * * I I * * , I I I * P25400B00 ** : : 16 January 2006 * I I **e * * 142/ 156 epithelium in T cell differentiation. J Exp Med 173:471-481.

212. Eberl, G., and D.R. Littman. 2004. Thymic origin of intestinal alphabeta T cells revealed by fate mapping of RORgammat cells. Science 305:248-251.

213. Guy-Grand, D., 0. Azogui, S. Celli, S. Darche, M.C.

Nussenzweig, P. Kourilsky, and P. Vassalli. 2003.

Extrathymic T cell lymphopoiesis: ontogeny and contribution to gut intraepithelial lymphocytes in athymic and euthymic mice. J Exp Med 197:333-341.

214.Yu, P., Y. Lee, W. Liu, R.K. Chin, J. Wang, Y. Wang, A. Schietinger, M. Philip, H. Schreiber, and Y.X. Fu.

2004. Priming of naive T cells inside tumors leads to eradication of established tumors. Nat: Immunol 5:141-149.

215. Eberl, G. 2005. Opinion: Inducible lymphoid tissues in the adult gut: recapitulation of a fetal developmental pathway? Nat Rev Immunol. 216. Young, C. L., T. C. Adamson, 3rd, J. H. Vaughan, and R. I. Fox. 1984. Immunohistologic characterization of synovial membrane lymphocytes in rheumatoid arthritis.

Arthritis Rheurn 27:32-39.

217. Schroder, A.E., A. Greiner, C. Seyfert, and C. Berek.

1996. Differentiation of B cells in the nonlymphoid tissue of the synovial membrane of patients with rheumatoid arthritis. Proc Nati Acad Sci U S A 93:221-225.

218.Han, S., S. Cao, R. Bheekha-Escura, and B. Zheng. 2001.

Germinal center reaction in the joints of mice with collagen-induced arthritis: an animal model of lymphocyte activation and differentiation in arthritis joints. Arthritis Rheum 44:1438-1443.

219. Amft, N., S.J. Curnow, D. Scheel-Toellner, A. Devadas, J. Oates, J. Crocker, J. Hamburger, J. Ainsworth, J. Mathews, M. Salmon, S.J. Bowman, and C.D. Buckley.

2001. Ectopic expression of the B cell-attracting chemokine BCA-l (CXCL13) on endothelial cells and within lymphoid follicles contributes to the establishment of germinal center-like structures in Sjogren's syndrome. Arthritis Rheum 44:2633-2641.

220. Kabel, P.J., H.A. Voorbij, M. de Haan-Meulman, S.T.

Pals, and H.A. Drexhage. 1989. High endothelial venules present in lymphoid cell accumulations in thyroids affected by autoimmune disease: a study in men and BB rats of functional activity and development.

J Clin Endocrinol Metab 68:744-751.

221. Kaiserling, E. 2001. Newly-formed lymph nodes in the submucosa in chronic inflammatory bowel disease.

Lymphology 34:22-29. * *

* * S * I * * P2540GB00 S. * 16 January 2006 * S I *qI 143/156 222. Prineas, J.w. 1979. Multiple sclerosis: presence of lymphatic capillaries and lymphoid tissue in the brain and spinal cord. Science 203:1123-1125.

223. Mazzucchelli, L., A. Blaser, A. Kappeler, P. Scharli, J.A. Laissue, M. Baggiolini, and M. Uguccioni. 1999.

BCA-l is highly expressed in Helicobacter pylon-induced mucosa-associated lymphoid tissue and gastric lymphoma. J Clin Invest 104:R49-54.

224. Freni, M.A., D. Artuso, G. Gerken, C. Spanti, T. Marafioti, N. Alessi, A. Spadaro, A. Ajello, and 0.

Ferrau. 1995. Focal lymphocytic aggregates in chronic hepatitis C: occurrence, immunohistochemical characterization, and relation to markers of autoimmunity. Hepatology 22:389-394.

225. Steere, A.C., P.H. Duray, and E.C. Butcher. 1988.

Spirochetal antigens and lymphoid cell surface markers in Lyrne synovitis. Comparison with rheumatoid synovium and tonsillar lymphoid tissue. Arthritis Rheurn 31:487-495.

226. Goronzy, J.J., and C.M. Weyand. 2005. Rheumatoid arthritis. Immunol Rev 204:55-73.

227. Takemura, S., A. Braun, C. Crowson, P.J. Kurtin, R.H.

Cofield, W.M. O'Fallon, J.J. Goronzy, and C.M. Weyand.

2001. Lymphoid neogenesis in rheumatoid synovitis. J Immunol 167:1072-1080.

228. Weyand, C.M., P.J. Kurtin, and J.J. Goronzy. 2001.

Ectopic lymphoid organogenesis: a fast track for autoirnmunity. Am J Pathol 159:787-793.

229. Ruddle, N.H. 1992. Tumor necrosis factor (TNF-alpha) and lymphotoxin (TNF-beta). Curr Opin Immunol 4:327-332.

230. Kratz, A., A. Campos-Neto, M.S. Hanson, and N.H.

Ruddle. 1996. Chronic inflammation caused by lymphotoxin is lymphoid neogenesis. J Exp Med 183:1461-1472.

231. Cuff, C.A., R. Sacca, and N.H. Ruddle. 1999.

Differential induction of adhesion molecule and chemokine expression by LTalpha3 and LTalphabeta in inflammation elucidates potential mechanisms of mesenteric and peripheral lymph node development. J Immunol 162:5965-5972.

232. Chen, S.C., G. Vassileva, D. Kinsley, S. Holzmann, D. Manfra, M.T. Wiekowski, N. Romani, and S.A. Lira. 2002.

Ectopic expression of the murine chemokines CCL21a and CCL21b induces the formation of lymph node-like structures in pancreas, but not skin, of transgenic mice. J Immunol 168:1001-1008.

233. Sacca, R., C.A. Cuff, and N.H. Ruddle. 1997. Mediators of inflammation. Curr Opin Immunol 9:851-857.

* I. * * I I I * * * S * * P2540GB00 * : * * 16 January 2006 * * *** * 1 * I 144/ 156 234. Nishikawa, S., K. Honda, H. Hashi, and H. Yoshida.

1998. Peyer's patch organogenesis as a programmed inflammation: a hypothetical model. Cytokine Growth Factor Rev 9:213-220.

235. Mertsching, E., U. Grawunder, V. Meyer, T. Rolink, and R. Ceredig. 1996. Phenotypic and functional analysis of B lyrnphopoiesis in interleukin-7-transgenic mice: expansion of pro/pre-B cell number and persistence of B lymphocyte development in lymph nodes and spleen.

Eur J Immunol 26:28-33.

236. Bosco, N., F. Agenes, and R. Ceredig. 2005. Effects of increasing IL-7 availability on lymphocytes during and after lymphopenia-induced proliferation. J Immunol 175:162-170.

237. Reith, W., and B. Mach. 2001. The bare lymphocyte syndrome and the regulation of MHC expression. Annu Rev Immunol 19:331-373.

238. LeibundGut-Lanclmann, S., J.M. Waldburger, M. Krawczyk, L.A. Otten, T. Suter, A. Fontana, H. Acha-Orbea, and W. Reith. 2004. Mini-review: Specificity and expression of CIITA, the master regulator of MHC class II genes.

Eur J Irnmunol 34:1513-1525.

239. Viret, C., and C.A. Janeway, Jr. 1999. MHC and T cell development. Rev Immunogenet 1:91-104.

240. Starr, T.K., S.C. Jameson, and K.A. Hogquist. 2003.

Positive and negative selection of T cells. Annu Rev Immunol 21:139-176.

241. Masternak, K., A. Muhlethaler-Mottet, J. Villard, M. Zufferey, V. Steimle, and W. Reith. 2000. CIITA is a transcriptional coactivator that is recruited to MHC class II promoters by multiple synergistic interactions with an enhanceosome complex. Genes Dev 14:1156-1166.

242. Otten, L.A., F. Tacchini-Cottier, M. Lohoff, F. Annunziato, L. Cosmi, L. Scarpellino, J. Louis, V. Steimle, W. Reith, and H. Acha-Orbea. 2003.

Deregulated M.HC class II transactivator expression leads to a strong Th2 bias in CD4+ T lymphocytes. J Immunol 170:1150-1157.

243. Takebe, Y., M. Seiki, J. Fujisawa, P. Hoy, K. Yokota, K. Arai, M. Yoshida, and N. Arai. 1988. SR alpha promoter: an efficient and versatile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Mol Cell Biol 8:466-472.

244.Linden, R.M., P. Ward, C. Giraud, E. Winocour, and K.I.

Berns. 1996. Site-specific integration by adeno- associated virus. Proc Nati Acad Sci U S A 93:11288-11294.

: * * * * I SI S I I I P2540G300. a * 16 January 2006 * S I I * 145/ 156 245. Weitzman, M.D., S.R. Kyostio, R.M. Kotin, and R.A.

Owens. 1994. Adeno-associated virus (AAV) Rep proteins mediate complex formation between AAV DNA and its integration site in human DNA. Proc Nal Acad Sci U S A 91:5808-5812.

246. Linden, R.M., E. Winocour, and K.I. Berns. 1996. The recombination signals for adeno-associated virus site-specific integration. Proc Natl Acad Sci U S A 93:7966-7972.

247. Samulski, R.J., X. Zhu, X. Xiao, J.D. Brook, D.E.

Housman, N. Epstein, and L.A. Hunter. 1991. Targeted integration of adeno-associated virus (AAV) into human chromosome 19. Embo J 10:3941-3950.

248. Srivastava, A., E.W. Lusby, and K.I. Berris. 1983.

Nucleotide sequence and organization of the adeno-associated virus 2 genome. J Virol 45:555-564.

249. Goncalves, M.A. 2005. Adeno-associated virus: from defective virus to effective vector. Virol J 2:43.

250. Rutledge, E.A., C.L. Halbert, and D.W. Russell. 1998.

Infectious clones and vectors derived from adeno-associated virus (AAV) serotypes other than AAV type 2.

J Virol 72:309-319.

251. Gao, G.P., M.R. Alvira, L. Wang, R. Calcedo, J. Johnston, and J.M. Wilson. 2002. Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy. Proc Natl Acad Sci U S A 99:11854-11859.

252. Mori, S., L. Wang, T. Takeuchi, and T. Kanda. 2004.

Two novel adeno-associated viruses from cynomolgus monkey: pseudotyping characterization of capsid protein, Virology 330:375-383.

253. Xiao, W., N. Chirmule, S.C. Berta, B. McCullough, G. Gao, and J.M. Wilson. 1999. Gene therapy vectors based on adeno-associated virus type 1. J Virol 73:3994-4003.

254. Gao, G., L.H. Vandenberghe, M.R. Alvira, Y. Lu, R. Calcedo, X. Zhou, and J.M. Wilson. 2004. Clades of Adeno-associated viruses are widely disseminated in human tissues. J Virol 78:6381-6388.

255. Ryan, J.H., S. Zolotukhin, and N. Muzyczka. 1996.

Sequence requirements for binding of Rep68 to the adeno-associated virus terminal repeats. J Virol 70:1542-1553.

256. Pereira, D.J., D.M. McCarty, and N. Muzyczka. 1997.

The adeno-associated virus (AAV) Rep protein acts as both a repressor and an activator to regulate AAV transcription during a productive infection. J Virol 71:1079-1088.

257. Yang, C.C., X. Xiao, X. Zhu, D.C. Ansardi, N.D.

Epstein, M.R. Frey, A.G. Matera, and R.J. Samuiski.

1997. Cellular recombination pathways and viral I * 4 I I * I I I I I * I *I * I I I P2540GB00: : * I 16 January 2006 146/ 156 terminal repeat hairpin structures are sufficient for adeno-associated virus integration in vivo and in vitro. J Virol 71:9231-9247.

258.Philpott, N.J., C. Giraud-Wali, C. Dupuis, J. Gomos, H. Hamilton, K.I. Berns, and E. Falck-Pedersen. 2002.

Efficient integration of recombinant adeno-associated virus DNA vectors requires a p5-rep sequence in cis. J Virol 76:5411-5421.

259. Philpott, N.J., J. Gomos, K.I. Berns, and E. Faick-Pedersen. 2002. A p5 integration efficiency element mediates Rep-dependent integration into AAVS1 at chromosome 19. Proc Nat1 Acad Sci U S A 99:12381-12385.

260. Trempe, J.P., and B.J. Carter. 1988. Alternate mRNA splicing is required for synthesis of adeno-associated virus VP1 capsid protein. J Virol 62:3356-3363.

261.Weger, S., A. Wistuba, D. Grimm, and J.A. Kleinschmidt.

1997. Control of adeno-associated virus type 2 cap gene expression: relative influence of helper virus, terminal repeats, and Rep proteins. J Virol 71:8437-8447.

262. Kronenberg, S., J.A. Kleinschmidt, and B. Bottcher.

2001. Electron cryo-microscopy and image reconstruction of adeno-associated virus type 2 empty capsids. EMBO Rep 2:997-1002.

263.Xie, Q., W. Bu, S. Bhatia, J. Hare, T. Sornasundaram, A. Azzi, and M.S. Chapman. 2002. The atomic structure of adeno-associated virus (AAV-2), a vector for human gene therapy. Proc Nati Acad Sci U S A 99:10405-10410.

264. Wistuba, A., S. Weger, A. Kern, and J.A. Kleinscbmidt.

1995. Intermediates of adeno-associated virus type 2 assembly: identification of soluble complexes containing Rep and Cap proteins. J Virol 69:5311-5319.

265. Kern, A., K. Schmidt, C. Leder, O.J. Muller, C.E.

Wobus, K. Bettinger, C.W. Von der Lieth, J.A. King, and J.A. Kleinschmidt. 2003. Identification of a heparin-binding motif on adeno-associated virus type 2 capsids. J Virol 77:11072-11081.

266. Bueler, H. 1999. Adeno-associated viral vectors for gene transfer and gene therapy. Biol Chem 380:613-622.

267. Monahan, P.E., and R.J. Samuiski. 2000. Adeno-associated virus vectors for gene therapy: more pros than cons? Mol Med Today 6:433-440.

268. Manning, W.C.., X. Paliard, S. Zhou, M. Pat Bland, A.Y.

Lee, K. Hong, C.M. Walker, J.A. Escobedo, and V. Dwarki. 1997. Genetic immunization with adeno-associated virus vectors expressing herpes simplex virus type 2 glycoproteins B and D. J Virol 71:7960-7962.

269. Suminerford, C., and R.J. Samulski. 1998. Membrane-associated heparan sulfate proteoglycari is a receptor

I S I I

* a I a I a I *. * a 5 P2540GB00 * . . 16 January 2006 5' ** a..

147/156 for adeno-associated virus type 2 virions. J Virol 72:1438-1445.

270.Qing, K., C. Mah, J. Hansen, S. Zhou, V. Dwarki, and A. Srivastava. 1999. Human fibroblast growth factor receptor 1 is a co-receptor for infection by adeno-associated virus 2. Nat Med 5:71-77.

271.Summerford, C., J.S. Bartlett, and R.J. Samuiski. 1999.

AlphaVbeta5 integrin: a co-receptor for adeno-associated virus type 2 infection. Nat Med 5:78-82. 272.Kashiwakura, Y., K. Tamayose, K. Iwabuchi, Y. Hirai, T. Shimada, K.

Matsumoto, T. Nakamura, M. Watanabe, K. Oshimi, and H. Daida. 2005. Hepatocyte growth factor receptor is a coreceptor for adeno-associated virus type 2 infection. J Virol 79:609-614.

273. Bartlett, J.S., R. Wilcher, and R.J. Samulski. 2000.

Infectious entry pathway of adeno-associated virus and adeno-associated virus vectors. J Virol 74:2777-2785.

274. Ding, W., L. Zhang, Z. Yan, and J.F. Engelhardt. 2005.

Intracellular trafficking of adeno-associated viral vectors. Gene Ther 12:873-880.

275.Duan, D., Y. Yue, Z. Yan, J. Yang, and J.F. Engelhardt.

2000. Endosomal processing limits gene transfer to polarized airway epithelia by adeno-associated virus.

J Clin Invest 105:1573-1587.

276. Hansen, J., K. Qing, and A. Srivastava. 2001. Adeno-associated virus type 2-mediated gene transfer: altered endocytic processing enhances transduction efficiency in murine fibroblasts. J Virol 75:4080-4090.

277. Hoque, M., K. Ishizu, A. Matsumoto, S.I. Han, F. Arisaka, M. Takayama, K. Suzuki, K. Kato, T. Kanda, H. Watanabe, and H. Handa. 1999. Nuclear transport of the major capsid protein is essential for adeno-associated virus capsid formation. J Virol 73:7912-7915.

278.Davidson, B.L., C.S. Stein, J.A. Heth, I. Martins, R.M.

Kotin, T.A. Derksen, J. Zabner, A. Ghodsi, and J.A.

Chiorini. 2000. Recombinant adeno-associated virus type 2, 4, and 5 vectors: transduction of variant cell types and regions in the mammalian central nervous system. Proc Natl Acad Sci U S A 97:3428-3432.

279. During, M.J., R. Xu, D. Young, M.G. Kaplitt, R.S.

Sherwin, and P. Leone. 1998. Peroral gene therapy of lactose intolerance using an adeno-associated virus vector. Nat Med 4:1131-1135.

280. Russell, D.W., and M.A. Kay. 1999. Adeno-associated virus vectors and hematology. Blood 94:864-874.

281.Halbert, C.L., E.A. Rutledge, J.M. Allen, D.W. Russell, and A.D. Miller. 2000. Repeat transduction in the mouse lung by using adeno-associated virus vectors with different serotypes. J Virol 74:1524-1532.

1 t I I I I I * * * * P2540G300 * : IS 16 January 2006 148/ 156 282.Kessler, P.D., G.M. Podsakoff, X. Chen, S.A. McQuiston, P.C. Colosi, L.A. Matelis, G.J. Kurtzrnan, and B.J.

Byrne. 1996. Gene delivery to skeletal muscle results in sustained expression and systemic delivery of a therapeutic protein. Proc Natl Acad Sci U S A 93:14082-14087.

283. Snyder, R.O., C.H. Miao, G.A. Patijn, S.K. Spratt, 0.

Danos, D. Nagy, A.M. Gown, B. Winther, L. Meuse, L.K.

Cohen, A.R. Thompson, and M.A. Kay. 1997. Persistent and therapeutic concentrations of human factor IX in mice after hepatic gene transfer of recombinant AAV vectors. Nat Genet 16:270-276.

284. Guy, J., X. Qi, N. Muzyczka, and W.W. Hauswirth. 1999.

Reporter expression persists 1 year after adeno-associated virus-mediated gene transfer to the optic nerve. Arch Ophthalrnol 117:929-937.

285. McCown, T.J., X. Xiao, J. Li, G.R. Breese, and R.J.

Samulski. 1996. Differential and persistent expression patterns of CNS gene transfer by an adeno-associated virus (AAV) vector. Brain Res 713:99-107.

286. Ferrari, F.K., T. Samulski, T. Shenk, and R.J.

Samulski. 1996. Second-strand synthesis is a rate-limiting step for efficient transduction by recombinant adeno-associated virus vectors. J Virol 70:3227-3234.

287. Fisher, K.J., G.P. Gao, M.D. Weitzman, R. DeMatteo, J.F. Burda, and J.M. Wilson. 1996. Transduction with recombinant adeno-associated virus for gene therapy is limited by leading-strand synthesis. J Virol 70:520-532.

288. Hauck, B., W. Zhao, K. High, and W. Xiao. 2004.

Intracellular viral processing, not single-stranded DNA accumulation, is crucial for recombinant adeno-associated virus transduction. J Virol 78:13678-13686.

289. Nakai, H., T.A. Storm, and M.A. Kay. 2000. Recruitment of single-stranded recombinant adeno-associated virus vector genomes and intermolecular recombination are responsible for stable transduction of liver in vivo.

J Virol 74:9451-9463.

290. Yang, J., W. Zhou, Y. Zhang, T. Zidon, T. Ritchie, and J.F. Engelhardt. 1999. Concatamerization of adeno-associated virus circular genomes occurs through intermolecular recombination. J Virol 73:9468-9477.

291. Duan, D., P. Sharma, J. Yang, Y. Yue, L. Dudus, Y. Zhang, K.J. Fisher, and J.F. Engelhardt. 1998.

Circular intermediates of recombinant adeno-associated virus have defined structural characteristics responsible for long-term episomal persistence in muscle tissue. J Virol 72:8568-8577.

P2540GB00, 16 January 2006 149/ 156 292. Novak, A., C. Guo, W. Yang, A. Nagy, and C.G. Lobe.

2000. Z/EG, a double reporter mouse line that expresses enhanced green fluorescent protein upon Cre-mediated excision. Genesis 28:147-155.

293. Soriano, P. 1999. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet 21:70-71.

294. Oostendorp, R.A., K.N. Harvey, N. Kusadasi, M.F. de Bruijn, C. Saris, R.E. Ploemacher, A.L. Medvinsky, and E.A. Dzierzak. 2002. Stromal cell lines from mouse aorta-gonads-mesonephros subregions are potent supporters of hematopoietic stem cell activity. Blood 99:1183-1189.

295. Oostendorp, R.A., A.J. Medvinsky, N. Kusadasi, N. Nakayama, K. Harvey, C. Orelio, K. Ottersbach, T. Covey, R.E. Ploemacher, C. Saris, and E. Dzierzak.

2002. Ernbryonal subregion-derived stromal cell lines from novel temperature-sensitive SV4O T antigen transgenic mice support hematopoiesis. J Cell Sci 115:2099-2108.

296. Seder, R.A., and R. Ahmed. 2003. Similarities and differences in CD4 and CD8+ effector and memory T cell generation. Nat Immunol 4:835-842.

297. Surh, C.D., and J. Sprent. 2000. Homeostatic T cell proliferation: how far can T cells be activated to seif-ligands? J Exp Med l92:F9-F14.

298. Goidrath, A.W., L.Y. Bogatzki, and M.J. Bevan. 2000.

Naive T cells transiently acquire a memory-like phenotype during homeostasis-driven proliferation. J Exp Med 192:557-564.

299. Cho, B.K., V.P. Rao, Q. Ge, H.N. Eisen, and J. Chen.

2000. Homeostasis-stimulated proliferation drives naive T cells to differentiate directly into memory T cells. J Exp Med 192:549-556.

300. Bourgeois, C., G. Kassiotis, and B. Stockinger. 2005.

A major role for memory CD4 T cells in the control of lymphopenia-induced proliferation of naive CD4 T cells.

J Immunol 174:5316-5323.

301. Kieper, W.C., J.T. Tan, B. Bondi-Boyd, L. Gapin, J. Sprent, R. Ceredig, and C.D. Surh. 2002.

Overexpression of interleukin (IL)-7 leads to IL-l5-independent generation of memory phenotype CD8+ T cells. J Exp Med 195:1533-1539.

302. Hjelmstrom, P., J. Fjell, T. Nakagawa, R. Sacca, C.A.

Cuff, and N.H. Ruddle. 2000. Lymphoid tissue homing chemokines are expressed in chronic inflammation. Am J Pathol 156:1133-1138.

303. Sternberg, N., and D. Hamilton. 1981. Bacteriophage P1 site-specific recombination. I. Recornbination between loxP sites. J Mol Biol 150:467-486.

V V

I I I I

I V II I

P2540GB00.. I I 16 January 2006 150/156 304. Sauer, B., and N. Henderson. 1988. Site-specific DNA recombination in mammalian cells by the Cre recombinase of bacteriophage P1. Proc Nati Acad Sci U S A 85:5166-5170.

305. Kaspar, B.K., B. Vissel, T. Bengoechea, S. Crone, L. Randolph-Moore, R. Muller, E.P. Brandon, D. Schaffer, I.M. Verma, K.F. Lee, S.F. Heinemann, and F.H. Gage.

2002. Adeno-associated virus effectively mediates conditional gene modification in the brain. Proc Nati Acad Sci U S A 99:2320-2325.

306. Debard, N., F. Sierro, J. Browning, and J.P.

Kraehenbuhl. 2001. Effect of mature lymphocytes and lymphotoxin on the development of the follicle-associated epithelium and M cells in mouse Peyer's patches. Gastroenterology 120:1173-1182.

307. Cohn, S.M., T.C. Simon, K.A. Roth, E.H. Birkenmeier, and J.I. Gordon. 1992. Use of transgenic mice to map cis-acting elements in the intestinal fatty acid binding protein gene (Fabpi) that control its cell lineage-specific and regional patterns of expression along the duodenal-colonic and crypt-villus axes of the gut epithelium. J Cell Biol 119:27-44.

308. Sweetser, D.A., S.M. Hauft, P.C. Hoppe, E.H.

Birker]meier, and J.I. Gordon. 1988. Transgenic mice containing intestinal fatty acid-binding protein-human growth hormone fusion genes exhibit correct regional and cell-specific expression of the reporter gene in their small intestine. Proc Nati Acad Sci U S A 85:9611-9615.

309. Rahemtulla, A., W.P. Fung-Leung, M.W. Schilham, T.M.

Kundig, S.R. Sambhara, A. Narendran, A. Arabian, A. Wakeham, C.J. Paige, R.M. Zinkernagel, and et al. 1991.

Normal development and function of CD8+ cells but markedly decreased helper cell activity in mice lacking CD4. Nature 353:180-184.

310. Bland, P. 1988. MHC class II expression by the gut epithelium. Irnmunol Today 9:174-178.

311. Finke, D. 2005. Fate and function of lymphoid tissue inducer cells. Curr Opin Immunol 17:144-150.

312. Toraldo, G., C. Roggia, W.P. Qian, R. Pacifici, and M.N. Weitzmann. 2003. IL-7 induces bone loss in vivo by induction of receptor activator of nuclear factor kappa B ligand and tumor necrosis factor alpha from T cells. Proc Natl Acad Sci U S A 100:125-130.

313. Sato, T., T. Shibata, K. Ikeda, and K. Watanabe. 2001.

Generation of bone-resorbing osteoclasts from B220+ cells: its role in accelerated osteoclastogenesis due to estrogen deficiency. J Bone Miner Res 16:2215-2221.

314. Kong, Y.Y., U. Feige, I. Sarosi, B. Bolon, A. Tafuri, S. Morony, C. Capparelli, J. Li, R. Elliott, S. McCabe, * a. * a It * * * * $ I $ P2540GB00: : :. 1* 16 January 2006 I * I * a I I I * I lIe I 1 151/ 156 T. Wong, G. Carnpagnuolo, E. Moran, E.R. Bogoch, G. Van, L.T. Nguyen, P.S. Ohashi, D.L. Lacey, E. Fish, W.J.

Boyle, and J.M. Penninger. 1999. Activated T cells regulate bone loss and joint destruction in adjuvant arthritis through osteoprotegerin ligand. Nature 402: 304-309.

315. DeGrendele, H.C., P. Estess, and M.H. Siegelman. 1997.

Requirement for CD44 in activated T cell extravasation into an inflammatory site. Science 278:672-675.

316. De Benedetti, F., M. Massa, P. Pignatti, M. Kelley, C.R. Faltynek, and A. Martini. 1995. Elevated circulating interleukin-7 levels in patients with systemic juvenile rheumatoid arthritis. J Rheumatol 22:1581-1585.

317.Cupedo, T., W. Jansen, G. Kraal, and R.E. Mebius. 2004.

Induction of secondary and tertiary lymphoid structures in the skin. Immunity 21:655-667.

Claims

* It * I **

I I S I

P2540GB00. . .* * * : :. 16 January 2006 : : : * * * * * * *I* S I 152/156

PATENT CLAIMS

1 A non-human double transgenic animal having a genorne comprising at least one copy of an Interleukin-7 (IL-7) transgene construct and at least one copy of a CIITA transgene construct.

2 A non-human double transgenic animal according to claim 1, wherein the IL-7 transgene construct is a MHC class II IL-7 transgene construct.

3 A non-human double transgenic animal according to claim 1 or 2, wherein the IL-7 transgene construct is a MHC class II EV-IL-7 transgene construct.

4 A non-human double transgenic animal according to any of claims 1 to 3, wherein CIITA transgene construct is a SRU CIITA transgene construct.

A non-human double transgenic animal according to claim 4, wherein the CIITA transgene construct is a SRcL CIITA transgene construct, wherein the SRa promoter is a fusion promoter containing the SV 40 early promotor and the R segment and part of the tJ5 sequence of the long terminal repeat derived from the human T cell leukaemia virus type I and wherein CIITA is a non-DNA-binding activator of MHC class II expression.

6 A non-human double transgenic animal according to any of claims 1 to 5, wherein the IL-7 transgene is ubiquitously expressed.

7 A non-human double transgenic animal of any of claims 1 to 6 wherein the animal is a vertebrate.

8 A non-human double transgenic animal of claim 7 wherein the animal is a mouse.

9 A method for making a non-human double transgenic animal as defined by any of claims 1 to 8 comprising: making an animal having a genome comprising at least one copy of an Interleukin-7 (IL-7) transgene construct and at least one copy of a CIITA transgene construct.

A method for making a non-human double transgenic animal according to claim 9 comprising intercrossing a relevant MHC class II IL-7transgenic with a SRcXCIITA transgenic mice.

It I It

I S S I I I I I

P2540GB00: :. , : 16 January 2006 * * * I I It, S I 153/ 156 ii. A method for making a non-human double transgenic animal according to claim 10 comprising intercrossing a relevant MI-IC class II IL- 7transgenic male with a SRaCIITA transgenic female.

12 A cell line derived from a non-human double transgenic animal according to any of claims 1 to 8.

13 The cell line according to claim 12 wherein the cells are chosen from the group comprising osteoblast and osteoclast cells, stromal cells, parenchyma cells, preferably hepatocytes or pancreatic islet cells, muscle cells, hematopoietic cells, epithelial cells and endothelial cells.

14 A screening method for a therapeutic agent for Interleukin-7 (IL-7) related diseases wherein a test substance is administered to the non-human double transgenic animal according to any of claims 1 to 8, or a test substance is contacted with a tissue, an organ, cell line or a cell derived from said animal.

A screening method according to claim 14 wherein the disease is an IL-7 related bone loss.

16 A screening method according to claim 15 wherein the disease is osteoporosis.

17 A screening method according to claim 15 wherein the disease is Paget disease.

18 A screening method according to claim 14 wherein the disease is an IL-7 related auto immune disease.

19 A screening method according to claim 14 wherein the disease is an IL-7 related dysregulation of T and B cell homeostasis.

A screening method according to claim 18 for a therapeutic agent for regulation of ectopic lymphoid tissue development.

2]. A screening method according to claim 18 for compounds having an effect on chronic inflammation disorders, with ectopic lymphoid aggregates or tertiary lymphoid structures' accumulating in the inf lamed.

22 A screening method according to claim 18, the compounds having an effect on chronic organspecif Ic inflammation associated with autoimmune diseases, selected from the group * .* . I I I * * a * I P2540G300. . .. -. 16 January 2006 : : : . ; ; * * a.. S S 154/ 156 of rheumatoid arthritis, Sjogrens syndrome, Hashimoto's thyroiditis, Crohn's disease and multiple sclerosis.

23 A screening method according to claim 18, the compounds having an effect on autoimmune syndromes, chronic infections with Helicobacter pylon, hepatitis C, and Borrelia burgdorferi associated with the formation of ectopic lymphoid tissue.

24 A screening method for a therapeutic agent for regulation of oral infections with pathogens via Peyers Patches wherein a test substance is administered to the non-human double transgenic animal according to any of claims 1 to 8, or a test substance is contacted with a tissue, an organ, or a cell derived from said animal.

A screening method according to claim 21 wherein the pathogen is selected from the group of prions, bacteria and viruses.

26 A screening method according to claim 16, 17 or 18 wherein organs or cells derived from double TG mice are transplanted into other mouse strains.

27 A therapeutic agent for Interleukin-7 (IL-7) related diseases which can be obtained by a screening method for a therapeutic agent according to one of claims 14 to 26.