WO1998001467A2 - Inhibitors of the interaction between p53 and mdm2 - Google Patents

Inhibitors of the interaction between p53 and mdm2 Download PDF

Info

Publication number
WO1998001467A2
WO1998001467A2 PCT/EP1997/003549 EP9703549W WO9801467A2 WO 1998001467 A2 WO1998001467 A2 WO 1998001467A2 EP 9703549 W EP9703549 W EP 9703549W WO 9801467 A2 WO9801467 A2 WO 9801467A2
Authority
WO
WIPO (PCT)
Prior art keywords
mdm2
peptide
derivative
acid
binding
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP1997/003549
Other languages
English (en)
French (fr)
Inventor
David Lane
Volker BÖTTGER
Angelika BÖTTGER
Stephen Picksley
Heinz-Kurt Hochkeppel
Carlos Garcia-Echeverria
Patrick CHÈNE
Pascal Furet
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis AG
Cancer Research Campaign Technology Ltd
Original Assignee
Ciba Geigy AG
Novartis AG
Cancer Research Campaign Technology Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB9614197.3A external-priority patent/GB9614197D0/en
Priority claimed from GBGB9707041.1A external-priority patent/GB9707041D0/en
Priority to JP10504775A priority Critical patent/JP2001500365A/ja
Application filed by Ciba Geigy AG, Novartis AG, Cancer Research Campaign Technology Ltd filed Critical Ciba Geigy AG
Priority to EP97935511A priority patent/EP0958305B1/en
Priority to DE69738754T priority patent/DE69738754D1/de
Priority to US09/214,371 priority patent/US7083983B2/en
Priority to NZ333609A priority patent/NZ333609A/xx
Priority to AU38479/97A priority patent/AU3847997A/en
Publication of WO1998001467A2 publication Critical patent/WO1998001467A2/en
Anticipated expiration legal-status Critical
Priority to US10/927,262 priority patent/US20050137137A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K7/00Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04Linear peptides containing only normal peptide links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide

Definitions

  • the present invention relates to compounds capable of binding to the oncogene protein MDM2, processes for the preparation of such compounds, pharmaceutical preparations comprising such compounds, and uses of said compounds, e.g. in the therapeutic (including prophylactic) treatment of an animal or especially of the human body
  • the present further relates to methods of and compounds for inhibiting the growth of tumor cells which comprise the wild type p53 suppressor by interfering with the interaction between human p53 and human MDM2
  • Inactivation of the p53 tumor suppressor is a frequent event in human neoplasia
  • Such inactivation of p53 may, for example, result from the binding of a cellular oncogene protein, such as MD 2
  • the protein encoded by the mdm2 gene which is also referred to as hdm2 (human double minute 2) gene in the art, is capable of forming a complex with p53 both in vitro and in vivo and inhibit p53-med ⁇ ated transactivation (J.
  • the MDM2 binding site is localized within the region of p53 represented approximately by ammo acids 13 to 31 (PLSQETFSDLWKLLPENNV, single letter code) of mature human p53 protein
  • PLSQETFSDLWKLLPENNV single letter code
  • peptide fragments of p53 which include the ammo acid motif FxxLW wherein F, L, and W represent the single letter codes for ammo acids phenylalanine, leucine and tryptophan, respectively, and X may be any ammo acid, would be particularly suitable for interfering with the binding between p53 and MDM2 (Picksley et al., Oncogene 9, 2523-2529 (1994)).
  • the present invention is based on the surprising finding that a peptide with the phage consensus amino acid sequence P-X-F-X-D-Y-W-X-X-L, wherein X is any naturally occurring L-amino acid, and P, F, D, W and L represent the L-amino acids of proline (P), phenylalanine (F), aspartic acid (D), tyrosine (Y), tryptophan (W) and leucine (L), respectively, given in the single letter code, is capable of blocking the interaction of MD 2 with p53, as determinable e.g. in an ELISA assay, and shows a significant increase in specific blocking activity over the wildtype p53 peptide sequence.
  • P proline
  • F phenylalanine
  • D aspartic acid
  • Y tyrosine
  • W tryptophan
  • L leucine
  • mdm refers to the oncogene and “MDM” refers to the protein obtainable as a result of expression of said gene. Even though in the strict sense “mdm” means “murine double minute gene2", as used herein it also refers to dm2 mutants, particularly interspecies mutants, such as hdm2 (human double minute gene2) in particular.
  • a preferred embodiment includes peptides and derivatives thereof, capable of binding to MDM2, particularly human DM2, and specifically inhibiting or blocking the binding of MDM2 to the p53 protein, particularly human p53, in vitro or in vivo.
  • the preferred peptides of the invention are better than the p53 wildtype peptide in inhibiting the hdm2 binding to p53 or a suitable p53 peptide, as can be determined e.g. in suitable ELISA-type assays, particularly the assays described in detail hereinafter, on the basis of the IC 50 , i.e. the concentration of peptide necessary to inhibit the hd ⁇ 2 or p53 binding by 50 %.
  • the peptides of the invention mimic the MDM2 binding site on p53.
  • the peptides provided herein consist of or comprise an amino acid motif (in N- to C- terminal order) of the formula
  • R,-X-F-X-R 2 -R 3 -W-X-X-R 4 (I), wherein is a proline (P), leucine (L), glutamic acid (E), cysteine (C) or glutamine (Q), X stands for one (any) natural amino acid,
  • R 2 is arginine (R), histidine (H), glutamic acid (E), cysteine (C), serine (S), or preferably aspartic acid (D),
  • R 3 is histidine (H), phenylalanine (F) or preferably tyrosine
  • R 4 is phenylalanine (F), glutamine (Q) or preferably leucine (L); and F and W (as well as the other capital letters given in brackets above) are used in accordance with the commonly used single letter code for amino acids and represent phenylalanine and tryptophan, respectively.
  • amino acid(s) includes the free (charged or uncharged) form, or the monovalent or bivalent radical, the latter also being referred to as "amino acid residue".
  • R i and R 4 are monovalent radicals, R- having a free amino group and R having a free carboxy group, and X, for example, is a bivalent amino acid radical.
  • Preferred peptides of the invention consisting of or comprising the amino acid motif of formula (I) are peptides consisting of no more than fifteen amino acids (15mers), particularly 10mer, 11 mer, 12mer, 13mer, 14mer or 15mer peptides.
  • natural amino acid residues may be attached to the 10mer motif of formula (I) at the N-terminus, i.e. such additional amino acids precede R 1, at the N- terminus; at the C-terminus, i.e. such amino acids follow R 4 ; or at both ends of a peptide of formula (I).
  • Sequences of exemplary 12mer and 15mer peptides are given e.g. in Example 8 hereinbelow.
  • a natural amino acid is a natural ⁇ -amino acid having the L- configuration, such as those normally occurring in natural proteins.
  • Unnatural amino acid refers to an amino acid, which normally does not occur in proteins, e.g. an epimer of a natural ⁇ -amino acid having the L-configuration, that is to say an amino acid having the unnatural D-configuration; or a (D.L)-isomeric mixture thereof; or a homologue of such an amino acid, for example a ⁇ -amino acid, an ⁇ , ⁇ -disubstituted amino acid, or an ⁇ -amino acid wherein the amino acid side chain has been shortened by one or two methylene groups or lengthened to up to 10 carbon atoms, such as an ⁇ -amino alkanoic acid with 5 up to and including 10 carbon atoms in a linear chain, an unsubstituted or substi tuted aromatic ( ⁇ -aryl or ⁇ -aryl lower alkyl), for example
  • the peptides of the invention, or derivatives thereof can significantly decrease or avoid the negative regulatory effects of MDM2 on p53 activity. Therefore, the peptides, or derivatives thereof, of the invention can be used to restore p53 tumor suppressor function, e.g. in the treatment of tumor diseases or viral infections when enhanced activity of p53 is desired or required.
  • the peptide sequences of the invention show some homology to the sequence on p53 required for MDM2 binding, however, additional homologies are present which are absent from p53.
  • R,, R 2 , R 3 and R 4 each have the meanings given for formula (I) above, X, is arginine, asparagine, alanine, threonine or valine; X 2 is methionine, isoleucine, threonine, arginine, alanine or serine; X 3 is glutamic acid, threonine, alanine, phenylalanine or serine; X 4 is glycine, glutamine, threonine, alanine or aspartic acid.
  • preferred peptides of the invention include the following (amino acid sequences are given in single letter code):
  • peptide of the invention refers to a linear compound comprising the amino acid motif of formula (I) and containing only natural amino acids which are linked by peptide bonds and which are in an unprotected form.
  • the present invention also provides derivatives of the peptides of the invention.
  • Such derivatives may be linear or circular.
  • Derivatives of the invention include molecules wherein a peptide of the invention is non-covalently or preferably covalently modified by substitution, chemical, enzymatic or other appropriate means with another atom or moiety including another peptide or protein.
  • An example of a derivative comprising a peptide linked to another protein is exemplified by binding element TIP12 1 as described in example 10 below.
  • the moiety may be "foreign" to a peptide of the invention as defined above in that it is an unnatural amino acid, or in that one or more, preferably one or two natural amino acid in the motif of formula (I) are replaced with another natural or unnatural amino acid.
  • Conjugates comprising a peptide or derivative of the invention covalently attached to another peptide or protein are also encompassed herein. Attachment of another moiety may involve a linker or spacer, e.g. an amino acid or peptidic linker. Derivatives of the invention also includes peptides wherein one, some or all potentially reactive groups, e.g. ammo, carboxy, sulfhydryl or hydroxyl groups are in a protected form.
  • the atom or moiety denvatizing a peptide of the invention may serve analytical purposes, e.g. facilitate detection of the peptide of the invention, favor preparation or purification of the peptide, or improve a property of the peptide which is relevant for the purposes of frie present invention.
  • Such properties include e.g.
  • Derivatives of the invention include a covalent or aggregative conjugate of a peptide of the invention with another chemical moiety, said derivative displaying essentially the same activity as the unde ⁇ vatized peptide of the invention, and a "peptide analogue" or “mimetic” which is modeled to resemble the three-dimensional structure of the ammo acid motif of formula (I). Examples of such mimetics are retro-inverso peptides (M Chorev, M Goodman, Ace. Chem. Res. 26, 266-273 (1993)).
  • the designing of mimetics to a known pharmaceutically active compound is a known approach to the design of drugs based on a "lead” compound This may be desirable e.g where the "original" active compound is difficult or expensive to synthesize, or where it is unsuitable for a particular mode of administration, e.g. peptides are considered unsuitable active agents for oral compositions as they tend to be quickly degraded by proteases in the alimentary channel
  • cyclic derivatives containing a disulphide bond will contain two cysteines, which may be L-cysteine or D-cysteine
  • the N-terminal ammo acid (e.g Ri in formula I) and the C-termmal ammo acids are both cysteines
  • penicill amme ⁇ , ⁇ -d ⁇ methyl-cyste ⁇ ne
  • Peptides containing thioether bridges are obtainable e.g.
  • cyclic lactam may be formed e.g. between the ⁇ -carboxy group of glutamic acid and the ⁇ -amtno group of lysme
  • cyclic lactams according to the invention have a Glu at the N-termmus (e.g.
  • R 1 in formula I) and a Lys at the C-terminus As an alternative to glutamic acid, it is possible to use aspartic acid As an alternative to lys e, ornithine or diaminobuty ⁇ c acid may be employed. Also, it is possible to make a lactam between the side chain of aspartic acid or glutamic acid at the C- termmus and the ⁇ -amino group of the N-terminal am o acid. This approach is extendable to ⁇ -ammo acids (e.g., ⁇ -alanine). Alternatively, glutamme residues at the N-termmus or C- term us can be tethered with an alkenedyl chain between the side chain nitrogen atoms (J.C. Phelan et al., J. of the American Chemical Society 119, 455 - 460 (1997)).
  • Peptides of the invention which are modified by substitution.
  • one or more, preferably one or two, ammo acids are replaced with another natural or unnatural ammo acid, e.g. with the respective D-analog, or a mimetic.
  • Phe or Tyr may be replaced with another building block, e.g. another proteinogenic ammo acid, or a structurally related analogue.
  • Preferred modifications are such that an ⁇ -helix conformation in the peptide is induced, increased or maintained.
  • R 2 , X 3 and/or X 4 may, independently from one another, be replaced by a ⁇ , ⁇ -d ⁇ subst ⁇ tuted ammo acid residue, ⁇ - aminoisobutync acid, 1-am ⁇ no-cyclopropane-1-carboxyl ⁇ c acid, 1-am ⁇ no-cyclopentane-1- carboxylic acid, 1-am ⁇ no-cyclohexane-1-carboxyl ⁇ c acid, 4-am ⁇ no p ⁇ per ⁇ d ⁇ ne-4-carboxyl ⁇ c acid and 1 -am ⁇ no-cycloheptane-1-carboxyl ⁇ c acid.
  • Peptides of the invention labeled with an enzyme, a fluorescent marker, a chemiluminescent marker, a metal chelate, paramagnetic particles, biotm, or the like.
  • the peptide of the invention is bound to the conjugation partner directly or by way of a spacer or linker group, e.g. a (peptidic) hydrophilic spacer.
  • the peptide is attached at the N- or C-terminal ammo acid
  • biotm may be attached to the N-termmus of a peptide of the invention via a serine residue or the tetramer SerGlySerGly
  • Peptides of the invention carrying one or more protecting groups at a (potentially) reactive (side group), such as ammo-protecting group, e.g. acetyl, or a carboxy-protect g group.
  • a (potentially) reactive (side group) such as ammo-protecting group, e.g. acetyl, or a carboxy-protect g group.
  • the C-termmal carboxy group of a compound of the invention may be present in form of a carboxamide function.
  • Suitable protecting groups are commonly known in the art and further exemplified herembelow. Such groups may be introduced e.g. to enhance the stability of the compound against proteolytic degradation. If desired, such protecting groups are removed.
  • Peptides of the invention fused or attached to another protein or peptide e.g. a protein or peptide serving as internalization vector, such as another peptide facilitating cellular uptake, e.g. a "penetratin".
  • An exemplary penetratin comprising derivative according to the invention is e.g a peptide comprising the sixteen ammo acid sequence from the homeodomain of the Antennapedia protein (D. Derossi et al., J. Biol. Chem.
  • Salts especially acid addition salts, salts with bases or, where several salt-forming groups are present, mixed salts or internal salts.
  • Exemplary salts are e.g. the salts described in the Examples.
  • Preferred are pharmaceutically acceptable salts.
  • Derivatives of a peptide of the invention also comprise fragments of such peptide which, as compared to a peptide of formula (I), consist of or comprise at least eight i.e. eight or nine, consecutive amino acids of said motif. Such fragments may be further derivatized as described in detail above.
  • a preferred fragment according to the invention is an 8mer peptide, i.e. a peptide containing eight amino acid residues, of formula
  • R 2 , R 3 and R 4 independently from one another, each have the meanings and preferences given for formula (I) above,
  • X 2 is methionine, isoleucine, threonine, arginine, alanine or serine, preferably methionine;
  • X 3 is glutamic acid, threonine, alanine, phenylalanine or serine, preferably glutamic acid;
  • X 4 is glycine, glutamine, threonine, alanine or aspartic acid, preferably glycine, or a derivative as defined above of such fragment.
  • R ⁇ , R 2 , R 3 and R 4 independently from one another, each have the meanings and preferences given for formula (I) above,
  • X t is arginine, asparagine, alanine, threonine or valine; particularly arginine X 2 is methionine, isoleucine, threonine, arginine, alanine or serine; preferably methionine; X 3 is glutamic acid, threonine, alanine, phenylalanine or serine; preferably glutamic acid; X 4 is glycine, glutamine, threonine, alanine or aspartic acid, preferably glycine, or a derivative as defined above of such fragment. Particularly preferred derivatives of peptide fragments of the invention contain the 8mer motif of formula (lb) or the 9mer motif of formula (lc) and also
  • a suitable label means e.g. an enzyme, a fluorescent marker, a chemiluminescent marker, a metal chelate, paramagnetic particles, biotin, or the like, and/or
  • one or more protecting groups e.g. as defined above, such as acetyl, and/or
  • R 3 is Phe or particularly Tyr
  • Phe or Tyr may be replaced with another building block, e.g. another proteinogenic amino acid, or a structurally related analogue, e.g. orth ⁇ -tyrosine, homophenylalanine or 2-naphtyl-alanine.
  • Preferred modifications are such that an ⁇ -helix conformation in the fragment is induced, increased or maintained.
  • each of R 2 , X 3 and/or X 4 may, independently from one another, be replaced by a ⁇ , ⁇ -disubstituted amino acid residue, such as ⁇ -aminoisobutyric acid (Aib), 1-amino- cyclopropane-1-carboxylic acid, 1-amino-cyclopentane-1-carboxylic acid, 1 -amino- cyclohexane-1 -carboxylic acid, 4-aminopiperidine-4-carboxylic acid, or 1-amino- cycloheptane-1 -carboxylic acid.
  • a ⁇ , ⁇ -disubstituted amino acid residue such as ⁇ -aminoisobutyric acid (Aib), 1-amino- cyclopropane-1-carboxylic acid, 1-amino-cyclopentane-1-carboxylic acid, 1 -amino- cyclohexane-1 -carboxylic acid,
  • X- may be replaced with NH 2 -(CH 2 ) n -CO-, wherein n is from 4 to 6, preferably a 6- amino-hexanoic acid residue.
  • n is from 4 to 6, preferably a 6- amino-hexanoic acid residue.
  • the N-terminal amino group of such fragment derivative will form a lactam with the side chain of aspartic acid.
  • Exemplary fragments include the following: P-A-F-T-H-Y-W-P, and, particularly, P-T-F- S-D-Y-W-P and P-R-F-M-D-Y-W-P, or derivatives thereof. Particularly preferred are fragments having the following amino acid sequences: R-F-M-D-Y-W-E-G-L and F-M-D-Y- W-E-G-L, or derivatives thereof.
  • a derivative according to the invention may involve one or multiple modifications as compared to a peptide of the invention, e.g. carry one or more of the above defined moieties.
  • a derivative of the invention is intended to include compounds derivable from or based on a peptide of the invention or another derivative of the invention.
  • the preferred derivatives of the invention are capable of binding to MDM2 and of selectively inhibiting or blocking the binding of MDM2 to the p53 protein.
  • the compounds of the invention have useful, in particular pharmacologically useful properties. For example, they are useful in the treatment of diseases that respond to the inhibition of the p53-MDM2 interaction.
  • the term "compound of the invention” includes peptides and derivatives of the peptides of the invention as well as DNA encoding for the described peptides and derivatives, triple-strand forming or antisense nucleotides, small molecules or peptides capable of inhibiting expression of MDM2, and antibodies and any further molecules capable of inhibiting p53- MDM2 interaction.
  • test compound to inhibit interaction between MDM2 and p53 can be shown by assays commonly known in the art, or modifications of known assays readily apparent to a person of ordinary skill in the art.
  • Suitable assays include e.g. a binding assay determining binding of a test compound, e.g. a compound of the invention, to MDM2, an in vitro transcription assay or an assay as described in European Patent Application 95810576.9, corresponding to International Application No. PCT/EP 96/03957. Assays may be performed qualitatively or quantitatively and require comparison to one or more suitable controls.
  • a preferred binding assay is a competitive binding assay.
  • the principle underlying a competitive binding assay is generally known in the art. Briefly, such binding assay is performed by allowing a compound to be tested for its capability to compete with a known, suitably labeled ligand, e.g. MDM2 or p53 for the binding site at a target molecule, e.g. p53 or MDM2 (depending on which molecule is used as known ligand).
  • a suitably labeled ligand is e.g. a radioactively labeled ligand or a ligand which can be detected by its optical properties, such as absorbance or fluorescence. After removing unbound ligand and test compound the amount of labeled ligand bound to the-target protein is measured. If the amount of bound ligand is reduced in the presence of the test compound, said compound is found to bind to the target molecule.
  • ELISA-type assays may be used wherein p53 or an appropriately labeled p53 peptide comprising the MDM2 binding site on p53 is immobilized and binding of MDM2 is competed for by a candidate inhibitor.
  • MDM2 may be immobilized and binding of p53 is competed for by such candidate.
  • an assay involving phage display of a candidate peptide e.g. a phage ELISA assay, may be used.
  • Particularly preferred compounds of the invention are superior to the peptide having the amino acid sequence QETFSDLWKLLP corresponding to the correct p53 wild-type sequence in their ability to selectively inhibit the binding of p53 and MDM2.
  • the peptides and derivatives of the present invention can be readily prepared according to well-established, standard liquid or, preferably, solid-phase peptide synthesis methods, general descriptions of which are broadly available (see, for example, in J.M. Stewart and J.D. Young, Solid Phase Peptide Synthesis, 2nd edition, Pierce Chemical Company, Rockford, Illinois (1984), in M. Bodanzsky and A. Bodanzsky, The Practice of Peptide Synthesis, Springer Verlag, New York (1984); and Applied Biosystems 430A Users Manual, ABI inc., Foster City, California), or they may be prepared in solution, by the liquid phase method or by any combination of solid-phase, liquid phase and solution chemistry, e.g. by first completing the respective peptide portion and then, if desired and appropriate, after removal of any protecting groups being present, by introduction of the residue X by reaction of the respective carbonic or sulfonic acid or a reactive derivative thereof.
  • Reactive derivatives of carbonic or sulfonic acids are preferably reactive esters, reactive anhydrides or reactive cyclic amides. Reactive carbonic acid or reactive sulfonic acid derivatives can also be formed in situ.
  • the reaction steps required e.g. for the synthesis of amide or sulfonamide bonds usually depend on the type of activation of the carboxylic or sulfo group participating in the reaction.
  • the reactions normally run in the presence of a condensing agent or, when activating the carboxylic or sulfonic acids in the form of anhydrides, of an agent that binds the carboxylic or sulfonic acid formed.
  • the reactions are especially carried out in a temperature range from -30 to +150 °C, preferably from +10 to +70 °C, and, most preferably, from +20 to +50 °C, if appropriate, in an inert gas atmosphere, e.g. under nitrogen or argon.
  • Synthesis proceeds in a stepwise, cyclical fashion by successively removing the NH 2 protecting group of the amino group to be reacted next and then coupling an activated fragment (e.g. an amino acid, di-, tri- or oligopeptide or a carboxylic acid or sulfonic acid, or a reactive derivative thereof, to the deprotected NH 2 (e.g. ⁇ - or ⁇ -NH 2 ).
  • an activated fragment e.g. an amino acid, di-, tri- or oligopeptide or a carboxylic acid or sulfonic acid, or a reactive derivative thereof.
  • activation of the COOH group of the amino acid to be reacted or the carboxyl or sulfo group of the acid to be attached by the condensation reaction is effected
  • symmetric anhydride obtainable, for example, by condensation of the corresponding acid in the presence of a carbodiimide or 1-diethyl- aminopropyne; symmetric anhydrides method
  • asymmetric anhydride such as the respective carbonic or sulfonic acid bromide, chloride or fluoride, or
  • an "active ester” e.g. an amino- or amido ester, such as a 1- hydroxy-benzotriazole (HOBT) or N-hydroxysuccinimide ester, or an aryl ester, such as a penta-fluorophenyl, 4-nitrophenyl or 2,4,5-tetrachlorophenyl ester; or by an appropriate combination of any of the reagents and reactions mentioned under (i) to (iii).
  • an active ester e.g. an amino- or amido ester, such as a 1- hydroxy-benzotriazole (HOBT) or N-hydroxysuccinimide ester, or an aryl ester, such as a penta-fluorophenyl, 4-nitrophenyl or 2,4,5-tetrachlorophenyl ester; or by an appropriate combination of any of the reagents and reactions mentioned under (i) to (iii).
  • HOBT 1- hydroxy-benzotriazole
  • Useful acid binding agents that can be employed in the condensation reactions are, for example, alkaline metals, carbonates or bicarbonates, such as sodium or potassium carbonate or bicarbonate (if appropriate, together with a sulfate), or organic bases such as sterically hindered organic nitrogen bases, for example tri-lower alkylamines, such as N,N- diisopropyl-N-ethylamine, which can be used alone or in any appropriate combination.
  • Reactive groups in the monomers of ligands or in the resin-bound or free intermediates resulting from one or more coupling steps can be protected by third groups as protecting groups that are customarily used in peptide synthesis.
  • third groups protecting groups that are customarily used in peptide synthesis. Examples of protecting groups, their introduction and their removal are, for example, described in standard works such as "Protective groups in Organic Chemistry", Plenum Press, London, New York 1973; “Methoden der organischen Chemie”, Houben-Weyl, 4. edition, Vol. 15/1 , Georg-Thieme Verlag, Stuttgart 1974; Th. W.
  • protecting groups comprises also resins used for solid phase synthesis, preferably those specifically mentioned above and below.
  • hydroxy protecting groups are acyl radicals, such as tert-lower alkoxycarbonyl radicals, for example tert-butoxycarbonyl, etherifying groups, such as tert- lower alkyl groups, for example t-butyl, or silyl- or tin radicals, such as tert-butyl-dimethylsilyl or the tri-n-butyltin radical.
  • acyl radicals such as tert-lower alkoxycarbonyl radicals, for example tert-butoxycarbonyl
  • etherifying groups such as tert- lower alkyl groups, for example t-butyl
  • silyl- or tin radicals such as tert-butyl-dimethylsilyl or the tri-n-butyltin radical.
  • Carboxy groups can be protected by groups as defined above for the C-terminal protecting groups Y, preferably by esterifying groups selected from those of the tert-butyl type, from benzyl, from trimethylsilylethyl and from 2-triphenylsilyl groups, or they can be protected as lower alkenyl esters, such as allylic esters. .
  • Amino or guanidino (e.g. in H-Arg-OH) groups can be protected by removable acyl groups or by arylmethyl, etherified mercapto, 2-acyl-lower alk-1-enyl, a silyl group or an organic sulfonyl group or tin amino protecting groups; tert-butoxycarbonyl, allyloxycarbonyl, benzyl-oxycarbonyl, 4-nitrobenzyloxycarbonyl, 2-chlorobenzyloxycarbonyl, 2- bromobenzyloxy-carbonyl, diphenylmethoxycarbonyl, nitrophenylsulfenyl, 2,2,2-trichloro- ethoxycarbonyl, 2,2,5,7,8-pentamethylchroman-6-sulfonyl (PMC - very preferred), 2,2,4,6,7- pentamethyldihydrobenzofuran-5-sulfonyl (Pbf) or 4-methoxy-2,
  • Carbamide groups (for example, in the side chains of asparagine and glutamine) can be protected at the nitrogen atom by arylmethyl groups, preferably triphenylmethyl (trityl) or analogues thereof with one or more lower alkoxy, such as methoxy, and/or lower alkyl, such as methyl, substituents in one or more phenyl rings.
  • arylmethyl groups preferably triphenylmethyl (trityl) or analogues thereof with one or more lower alkoxy, such as methoxy, and/or lower alkyl, such as methyl, substituents in one or more phenyl rings.
  • Imino groups (e.g. in imidazole) can be protected by 2,4-dinitrophenyl, trityl, tert- butoxy-carbonyl or p-toluene sulfonyl, or (e.g. in indole) by formyl or tert-butoxycarbonyl.
  • Mercapto groups can be protected, e.g., by acetamidomethyl, by trityl or by p- methylbenzyl.
  • a large number of methods of removing protective groups in the final products or any inter-mediates are known in the art and comprise, inter alia, ⁇ -elimination, solvolysis, hydrolysis, aicoholysis, acidolysis, photolysis, enzymatical removal, treatment with a base or reduction.
  • the protective groups are usually removed after the complete synthesis of the resin- bound molecule by conventional methods of peptide chemistry, conveniently by treatment with 95 % trifluoroacetic acid (Fmoc-chemistry).
  • strong nucleophiles such as dimethyl sulfide and/or 2-ethanedithiol, may be additionally added to capture the generated compounds resulting from the protecting groups, e.g. in a combination such as trimethyl-silyltrifluoro-methansulfonate/dimethylsulfide/trifluoroacetic acid ethanedithiol/m- cresol.
  • the two preferred methods of solid phase peptide synthesis are the Boc and the Fmoc methods, which are named with reference to their use of the tert-butoxycarbonyl (Boc) or 9-fluorenylmethyloxycarbonyl (Fmoc) group, respectively, to protect the ⁇ -NH 2 or ⁇ - NHR 3 of the amino acid residue to be coupled (see J. M. Stewart, J. D. Young, Solid-Phase Peptide Synthesis, 2n edn., Pierce, Rockford, Illinois (1984) or G. Barany, R.B. Merrifield, Solid-phase Peptide Synthesis, in: The Peptides, Vol. 2 (E. Gross, J.
  • Derivatives of the invention are prepared according to conventional methods involving de novo synthesis or starting from a peptide or another derivative of the invention.
  • the present invention provides a method for treating or preventing hyperproliferative disease by interfering with the interaction or binding between p53 and MDM2 in tumor cells.
  • the method may comprise administering an effective amount of a compound of the invention to a warm blood animal, including a human, or tumor cells containing wild type p53.
  • the administration of the compounds of the present invention may induce cell growth arrest or apoptosis.
  • the present invention may be used to treat disease and or tumor cells comprising non-elevated MDM2 levels.
  • Non elevated levels of MDM2 as used herein refers to MDM2 levels lower than those found in cells containing more than the normal copy number (2) of mdm2 or below about 10,000 molecules of MDM2 per cell as measured by ELISA and similar assays known in the art (Picksley et al., Oncogene 9, 2523-2529 (1994)).
  • the method of the present invention encompasses adm inistering DNA to tumor cells and or a warm blooded animal, including a human.
  • DNA of the present invention encodes a product that interferes with the interaction of p53 and MDM2.
  • DNA typically is in an expression vector, such as a retrovirus, DNA virus or plasmid into which DNA sequences necessary for expression in eukaryotic cells are properly position to result in expression of the DNA.
  • the DNA sequences are designed to express high levels of the desired product in tumor cells in a form that is stable and active as exemplified by the binding element TIP 12/1 described below.
  • the DNA may be administered to cells in vivos, ex vivos or in vitro as appropriate.
  • the DNA may be administered encapsulated in liposomes, via microinjection or any other form known in the art to achieve efficient cellular uptake.
  • Administering compounds that interfere with the interaction of p53 and MDM2 by affecting the expression of MDM2 are also encompassed by the method of the present invention.
  • Triple strand-forming or antisense oligonucleotides which bind the mdm2 gene or its mRNA and prevent transcription or translation may also administered to tumor cells and/or a warm blooded animal, including a human, in vivos, ex vivos or in vitro.
  • the oligonucleotides may interact with unprocessed mRNA or processed mRNA. Small molecules and peptides which specifically inhibit MDM2 expression may also be administered to cells.
  • antibodies that interfere with the interaction between p53 and MDM2 may be administered to tumor cells and/or to a warm blooded animal, including a human, facilitating cell growth arrest or apoptosis.
  • Antibodies of the present invention interrupt p53 and MDM2 interaction, and may comprise polyclonal, monoclonal, and recombinant antibodies.
  • Antibodies of the invention may be associated with liposomes or other means known in the art to facilitate cellular uptake.
  • DNA encoding for the antibodies of the invention may also be administered to the cell, as described above, the antibody being delivered to the upon expression of the administered DNA.
  • the present invention relates to uses of a compound of the invention including its use in the purification of a binding partner, particularly MDM2; its use as a "lead compound” for drug development or design; its use in a method of identifying compounds which interfere with the binding of MDM2 to p53; its use in diagnosis, e.g. to measure the levels of MDM2 in blood samples in the case of leukemia or solid carcinomas, such as sarcomas or glioblastomas.
  • the invention relates also to pharmaceutical compositions comprising compounds of the invention, to their use in the therapeutic (including prophylactic) treatment of the hyperproliferative diseases and viral infections, to the compounds for said use and to the preparation of pharmaceutical preparations.
  • the pharmacologically acceptable compounds of the present invention may be used, for example, for the preparation of pharmaceutical compositions that comprise an effective amount of the active ingredient together or in admixture with a significant amount of inorganic or organic, solid or liquid, pharmaceutically acceptable carriers.
  • the invention provides a pharmaceutical composition that is suitable for admin istration to a warm-blooded animal, especially a human (or to cells or cell lines derived from a warmblooded animal, especially a human, e.g.
  • compositions according to the invention are those for enteral, such as nasal, rectal or oral, or parenteral, such as intramuscular or intravenous, administration to warm-blooded animals (humans and animals), that comprise an effective dose of the pharmacologically active ingredient, alone or together with a significant amount of a pharmaceutically acceptable carrier.
  • the dose of the active ingredient depends on the species of warm-blooded animal, the body weight, the age and the individual condition, individual pharmacok etic data, the disease to be treated and the mode of administration.
  • the invention relates also to a method of treating diseases that respond to inhibition of the interaction of MDM2 and p53, which comprises administering a prophylactically or especially therapeutically effective amount of a compound according to the invention, especially to a warm-blooded animal, for example a human, that, on account of one of the mentioned diseases, requires such treatment.
  • a prophylactically or especially therapeutically effective amount of a compound according to the invention especially to a warm-blooded animal, for example a human, that, on account of one of the mentioned diseases, requires such treatment.
  • the administered compound is a peptide or derivative of the invention.
  • compositions comprise from approximately 1 % to approximately 95%, preferably from approximately 20 % to approximately 90%, active ingredient.
  • Pharmaceutical compositions according to the invention may be, for example, in unit dose form, such as in the form of ampoules, vials, suppositories, dragees, tablets or capsules.
  • compositions of the present invention are prepared in a manner known per se, for example by means of conventional dissolving, lyophilising, mixing, granulating or confectioning processes.
  • Solutions of the active ingredient, and also suspensions, and especially isotonic aqueous solutions or suspensions are preferably used, it bei ng possible, for example in the case of lyophi zed compositions that comprise the active ingredient alone or together with a carrier, for example mannitol, for such solutions or suspensions to be produced prior to use.
  • the pharmaceutical compositions may be sterilized and/or may comprise excipients, for example preservatives, stabilisers, wetting and/or emulsifying agents, solubilisers, salts for regulating the osmotic pressure and/or buffers, and are prepared in a manner known per se, for example by means of conven tional dissolving or lyophilising processes.
  • the said solutions or suspensions may comprise viscosity-increasing substances, such as sodium carboxymethylcellulose, carboxymethylcellulose, dextran, poly vinylpyrrolidone or gelatin.
  • Suspensions in oil comprise as the oil component the vegetable, synthetic or semi- synthetic oils customary for injection purposes.
  • liquid fatty acid esters that contain as the acid component a long-chained fatty acid having from 8 to 22, especially from 12 to 22, carbon atoms, for example lauric acid, tridecyiic acid, myristic acid, pentadecylic acid, palmitic acid, margaric acid, stearic acid, arachidic acid, behenic acid or corresponding unsaturated acids, for example oleic acid, elaidic acid, erucic acid, brasidic acid or linoleic acid, if desired with the addition of anti oxidants, for example vitamin E, ⁇ -carotene or 3,5-di-tert-butyl-4-hydroxytoluene.
  • anti oxidants for example vitamin E, ⁇ -carotene or 3,5-di-tert-butyl-4-hydroxytoluene.
  • the alcohol component of those fatty acid esters has a maximum of 6 carbon atoms and is a mono- or poly-hydroxy, for example a mono-, di- or tri-hydroxy, alcohol, for example methanol, ethanol, propanol, butanol or pentanol or the isomers thereof, but especially glycol and glycerol.
  • fatty acid esters are there fore to be mentioned: ethyl oleate, isopropyl myristate, isopropyl palmitate, "Labrafil M 2375” (polyoxyethylene glycerol trioleate, Gattefosse, Paris), "Miglyol 812” (triglyceride of saturated fatty acids with a chain length of C 8 to Ci 2 , H ⁇ ls AG, Germany), but especially vegetable oils, such as cottonseed oil, almond oil, olive oil, castor oil, sesame oil, soybean oil and more especially groundnut oil.
  • vegetable oils such as cottonseed oil, almond oil, olive oil, castor oil, sesame oil, soybean oil and more especially groundnut oil.
  • the injection compositions are prepared in customary manner under sterile conditions; the same applies also to introducing the compositions into ampoules or vials and sealing the containers.
  • compositions for oral administration can be obtained by combining the active ingredient with solid carriers, if desired granulating a resulting mixture, and processing the mixture, if desired or necessary, after the addition of appropriate excipients, into tablets, dragee cores or capsules. It is also possible for them to be incorporated into plastics carriers that allow the active ingredients to diffuse or be released in measured amounts.
  • Suitable carriers are especially fillers, such as sugars, for example lactose, saccharose, mannitol or sorbitol, cellulose preparations and/or calcium phosphates, for example tricalcium phosphate or calcium hydrogen phosphate, and binders, such as starch pastes using for example corn, wheat, rice or potato starch, gelatin, tragacanth, methyl- cellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose and/or poly vinylpyrrolidone, and/or, if desired, disintegrates, such as the above- mentioned starches, also carboxymethyl starch, crosslinked polyvinylpyrrolidone, agar, alginic acid or a salt thereof, such as sodium alginate.
  • fillers such as sugars, for example lactose, saccharose, mannitol or sorbitol, cellulose preparations and/or calcium phosphates, for example tricalcium phosphate or calcium hydrogen phosphate
  • binders such as
  • Excipients are especially flow conditioners and lubricants, for example silicic acid, talc, stearic acid or salts thereof, such as magnesium or calcium stearate, and/or polyethylene glycol.
  • Dragee cores are provided with suitable, optionally enteric, coatings, there being used, inter alia, concentrated sugar solutions which may comprise gum arabic, talc, polyvinylpyrrolidone, polyethylene glycol and/or titanium dioxide, or coating solutions in suitable organic solvents, or, for the preparation of enteric coatings, solutions of suitable cellulose preparations, such as ethylcellulose phthalate or hydroxypropyimethylcellulose phthalate.
  • Capsules are dry-filled capsules made of gelatin and soft sealed capsules made of gelatin and a plasticiser, such as glycerol or sorbitol.
  • the dry-filled capsules may comprise the active ingredient in the form of granules, for example with fillers, such as lactose, binders, such as starches, and/or glidants, such as talc or magnesium stearate, and if desired with stabil isers.
  • the active ingredient is preferably dissolved or suspended in suitable oily excipients, such as fatty oils, paraffin oil or liquid polyethylene glycols, it being possible also for stabilisers and/or antibacterial agents to be added.
  • Dyes or pigments may be added to the tablets or dragee coatings or the capsule casings, for example for identification purposes or to indicate different doses of active ingredient.
  • the following Examples serve to illustrate the present invention, but should not be construed as a limitation thereof.
  • the invention particularly relates to the specific embodiments (e.g. peptides, methods for their preparation, and assays as described in these Examples.
  • the below-identified peptides are synthesised on a Milligen 9050 automated peptide synthesizer (continuous flow; Millipore, Bedford, MA, USA), starting with an Fmoc-PAL- PEG-PS resin (see Albericio, F. et al, J. Org. Chem., 55 (1990) 3730-3743) for establishing the C-terminal carboxamide, and using chemical protocols based on the fluorenylmethoxycarbonyl chemistry (see E. Atherton and R.C. Sheppard, in Solid-Phase Peptide Synthesis-A Practical Approach, eds: R. Rickwood and B.D. Hames, IRL Press at Oxford University Press, Oxford, 1989).
  • Fmoc-amino acids (3 equivalents) are incorporated using their 2,4,5-trichlorophenyl esters (single coupling) with minimum reaction times of 30 min (see 9050 Plus PepSynthesizer User's Guide, Millipore Corporation, Bedford, MA, 1992).
  • Side chains are protected with the following groups: fert-butyl for aspartic acid, glutamic acid, tyrosine, serine and threonine; t ⁇ rt-butyloxycarbonyl for lysine and tryptophan; 2,2,5,7,8-pentamethyl-chroman-6-sulfonyl for arginine; trityl for histidine, cysteine, asparagine, and glutamine.
  • the complete peptide resins obtained after the final coupling reaction are simultaneously deprotected and cleaved by treatment with trifluoroacetic acid/water/ethanedithiol (76:4:20, v/v/v) for 3 h at room temperature.
  • the complete peptide resins obtained after the final coupling reaction are simultaneously deprotected and cleaved by treatment with trifluoroacetic acid/water/ethanedithiol (76:4:20, v/v/v) for 3 h at room temperature.
  • the filtrate from each cleavage reaction is precipitated in diisopropyl ether-petroleum ether (1 :1 , v/v) at 0° C, and the precipitates are collected by filtration.
  • the crude compounds are dissolved in 2N AcOH/acetonitrile (1 :1 , v/v) to remove the N' n -carboxy group from the side chain of tryptophan.
  • the course of the reactions is monitored by analytical reversed-phase HPLC.
  • Mass spectrometric analyses reveal molecular masses within 0.1% of the expected values (positive or negative ion mode).
  • Quantitative amino acid analyses of the final products reveal amino acid compositions within 5% of the expected values.
  • the purity of the peptides is verified by reversed-phase analytical HPLC on a Nucleosil column (250 x 4.0 mm; 5 mm, 100): linear gradient over 10 min of MeCN/0.09% TFA and H2 ⁇ /0.1% TFA from 1 :49 to 3:2; flow rate 2.0 ml/min, detection at 215 nm (HPLC System A); HPLC System B: linear gradient over 10 min of MeCN/0.09% TFA and H2 ⁇ /0.1% TFA from 1 :49 to 1 :0; flow rate 2.0 ml/min, detection at 215 nm.
  • the peptides are as follows:
  • the peptide denvatives contain a free N-termmal am o group.
  • Peptides with a free N-terminal am o group include:
  • (+)-Biotin (3 equivalents; Fluka, Buchs, Switzerland) is coupled with N-[(dimethylamino)1H- 1 ,2,3-triazolo[4,5-b]pyridin-1 -ylmethylene]-N-methylmethan-aminium hexafluorophosphate N-oxide (3 equiv.; double coupling; PerSeptive Biosystems, Hamburg, Germany) in the presence of diisopropylethylamine (6 equiv.)
  • the peptide contains the intemalization vector: Ala-Ala-Val-Ala-Leu-Leu-Pro-Ala-Val-Leu- Leu-Ala-Leu-Leu-Ala-Pro (Lin et al., J. Biol. Chem. 270, 14255-14258 (1995)).
  • the peptide is synthesised as described in Example 1 using N a -Fmoc-Lys(Aloc)-OH.
  • the side chain of lysine is selectively deprotected with tetrak ⁇ s(triphenylphosphine) palladium (0) in the presence of trimethylsilylacetate and 4- (trimethylsilyl)morpholine dissolved in dichloromethane.
  • the deprotection is carried out in an argon atmosphere for 2 h at room temperature, followed by washing with dichloromethane (4 x 1 min), /V-methylpyrrolidin-2-one (4 x 1 min), 0.05 M sodium diethyldithiocarbamate in DMF containing 0.5% of diisopropylethylamine (4 x 1 min), and ⁇ /-methylpyrrolidin-2-one (4 x 1 min).
  • (+)-biotin to the side chain of lysine is mediated by ⁇ /- [d ⁇ methylam ⁇ no)1 /--1 ,2,3-tr ⁇ azolo[4,5-b)pyridin-1-ylmethylene]- ⁇ /-methylmethan-am ⁇ n ⁇ um hexafluorophosphate ⁇ -ox ⁇ de in the presence of diisopropyl ethylamine.
  • Title compound: Mass spectral analysis (negative-ion mode): 3593.7 (calc. 3593.4, C169H265N40O40S3), tR 9.15 (HPLC System B).
  • Cyclic peptides containing a disulphide bond are synthesized from the respective cysteinyl peptides as follows: the cysteinyl peptide (20 mg; in the following referred to as starting compound) is dissolved in a 0.1 M solution of ammonium bicarbonate (20 ml). The mixture is left to stand open to atmosphere. Aliquots of the solution are removed at different times and analysed by analytical HPLC. After 24 h, the reaction mixture is concentrated to dryness. The crude compound is dissolved in water and injected directly in a medium- pressure liquid chromatography system as described above, and the title compound is obtained.
  • cysteine peniciltamine ( ⁇ , ⁇ -d ⁇ methyl-cyste ⁇ ne) can be used.
  • L- cysteme may be changed for D-cysteme either at the N- or C- terminus, or in both sides
  • Peptides containing thioether bridges are formed from starting compounds having a free cysteine residue at the C-termmus and a bromo-containing building block at the N-termmus (e g , bromo-acetic acid) Cyclisation can be carried out on solid phase by a selective deprotection of the side chain of cysteine (Mayer, J P et al., Tetrahedron Lett. 361411 , 7387-7390 (1995))
  • the peptide is synthesised manually on a 4-(2',4'-d ⁇ methoxyphenyl-am ⁇ nomethyl)-phenoxy- resm (Novabiochem, Laufelfmgen, Switzerland), employing the fluorenylmethoxycarbonyl strategy Fmoc-removal is with pipe ⁇ dine/dimethylacetamide (1 4, v/v; 6 x 2 mm), followed by washing with methanol (3 x 1 m ), ⁇ /-methylpyrrol ⁇ d ⁇ n-2-one (2 x 1 mm), methanol (3 x 1 mm), and ⁇ /-methylpyrrol ⁇ d ⁇ n-2-one (3 x 2 mm).
  • Ammo acid side chains are protected with the following groups: ferf-butyl for threonine, serine, aspartic acid and tyrosine; 2,2,5,7,8- pentamethyl-chroman-6-sulfonyl for arginine; tert-butyloxycarbonyl for tryptophan; allyl for glutamic acid; and allyloxycarbonyl for lysine
  • the required Fmoc-denvatives of tryptophan, tyrosine, threonine, serine, aspartic acid, arginine, methionine, phenylalanine and alanine are incorporated using their 2,4,5-tr ⁇ chlorophenyl esters (2 equiv.) in the presence of 1- hydroxybenzot ⁇ azole (2 equiv.) and diisopropylethylamine (0.75 equiv.).
  • N ⁇ -Fmoc-Lys(Aloc)-OH (2 equiv.; PerSeptive Biosystems, Hamburg, Germany) and N ⁇ - Fmoc-Glu(OAII)-OH (2 equiv.; Millipore, Bedford, MA, U.S.A ) is accomplished with benzotr ⁇ azole-1 -yl-oxy-tr ⁇ s-(d ⁇ methylam ⁇ no)-phosphon ⁇ um hexaf luorophosphate/1 - hydroxybenzot ⁇ azole (1 :1; 2 equiv.) in the presence of diisopropylethylamine (4 equiv.) Coupling is achieved by first dissolving the Fmoc-amino acid, diisopropylethylamine, and the coupling reagent in V-methylpyrrolidin-2-one, then waiting 3 min for preactivation, adding the mixture to the resin, and finally shaking for at least 45 min.
  • the deprotection is carried out in an argon atmosphere for 2h at room temperature, followed by washing with dichloromethane (4 x 1 min), /-methylpyrrolidin-2- one (4 x 1 min), 0.05 M sodium diethyldithiocarbamate in DMF containing 0.5% of diisopropylethylamine (4 x 1 min), and ⁇ /-methylpyrrolidin-2-one (4 x 1 min).
  • Intramolecular cyclisation on the solid support is accomplished with benzotriazole-1 -yl-oxy-tris- (dimethylamino)-phosphoniumhexafluorophosphate/1 -hydroxybenzotriazole (1 :1 ; 6 equiv.; double coupling) in the presence of diisopropylethylamine (12 equiv.).
  • the complete peptide resin obtained after the cyclisation step is simultaneously deprotected and cleaved by treatment with trifluoroacetic acid/water/ethanedithiol (76:4:20, v/v/v) for 3 h at room temperature.
  • the filtrate is precipitated in diisopropyl ether-petroleum ether (1 :1 , v/v) at 0 ° C, and the precipitate is collected by filtration.
  • the crude compound is dissolved in 2N AcOH/acetonitrile (1:1 , v/v) to remove the N in -carboxy group from the side chain of tryptophan.
  • the courses of the reactions are monitored by analytical reversed-phase HPLC. After 2 h at 40 °C, the solution is concentrated to dryness and the crude peptide is purified by medium-pressure liquid chromatography as described above.
  • glutamic acid it is possible to use aspartic acid.
  • lysine ornithine or diaminobutyric acid may be used.
  • side-side cyclisation it is possible to make a lactam between the side chain of aspartic acid or glutamic acid at the C-terminus and the ⁇ -amino group of the N-terminal amino acid.
  • This approach can also be expanded to ⁇ -amino acids (e.g., ⁇ -alanine).
  • ⁇ -amino acids e.g., ⁇ -alanine
  • the peptide is synthesised as described in Example 5.
  • the incorporation of N a -Fmoc-1- amino-cyclopropane-1 -carboxylic acid (2 equiv.) is carried out with benzotriazole-1-yl-oxy- tris-(dimethylamino)-phosphonium hexafluorophosphate/N-hydroxybenzotriazole (1 :1 ; 2 equiv.) in the presence of diisopropylethylamine (5 equiv.).
  • N a -Fmoc-aminoisobutyric acid (2 equiv.) is coupled with benzotriazole-1-yl-oxy-tris-(dimethylamino)-phosphonium hexa- fluorophosphate/N-hydroxybenzotriazole (1 :1 ; 2 equiv.; first coupling) and N-[(dimethyl- amino)-1 H-1 ,2,3-triazolo-[4,5-b]pyridin-1-ylmethylene]-N-methylmethanaminium hexa fluoro- phosphate N-oxide (2 equiv.; second coupling) in the presence of diisopropyl ethylamine (5 equiv.).
  • a second coupling for glutamic acid and methionine (2 equiv.) is performed with N- [(dimethylamino)-l H-1 ,2,3-triazolo-[4,5-b]pyridin-1 -ylmethylene]-N-methylmethanaminium hexafluorophosphate N-oxide (2 equiv.; second coupling) in the presence of diisopropylethylamine (5 equiv.).
  • the complete peptide resin obtained after the final coupling reaction is simultaneously deprotected and cleaved by treatment with trifluoro acetic acid/ ⁇ O (95:5, v/v) for 3 h at room temperature.
  • the filtrate from the cleavage reaction is precipitated in diisopropyl ether/petroleum ether (1:1 , v/v, 0 °C), and the precipitate collected by filtration.
  • the crude peptide is purified as described in Example 1.
  • the DNA region of the mdm2 gene encoding the first 188 amino acids of the protein is obtained by Poiymerase Chain Reaction (PCR) amplification of the mdm2 gene.
  • the oligonucleotides used for PCR are designed such that a BamHI restriction site is introduced at the 5' extremity of the gene and an EcoRI restriction site at its 3' end .
  • the PCR fragments digested by BamHI and EcoRI are ligated with a BamHI / EcoRI cleaved pGEX-2T vector.
  • the resulting vector comprises a fusion gene consisting of the full length sequence of glutathione-S-transferase of S.
  • Glutathione-S-transferase protein (for control experiments) is obtained from E. coli strain BL21 (Novagen) transformed with pGEX-2T plasmid.
  • test compound e.g. a fluorogenic peptide described in Example 4
  • GST-hdm2 protein e.g. a fluorogenic peptide described in Example 4
  • the instrument setting during the titration is identical so that the fluorescence intensities in the presence or absence of the GST-hdm2 protein can be compared
  • the addition of the GST-hdm2 protein to the solution containing the fluorogenic peptide results in an increase in the emission fluorescence of the fluorogenic peptide at 530 nm.
  • This assay is applicable to the detection of specific interactions of peptides or low molecular weight compounds with the MDM2 protein. In addition, it allows accurate kinetic measurements in solution.
  • Example 8 Identification of MDM2 binding peptides by phage display
  • hdm2 refers to the human double minute gene2 and the corresponding protein.
  • the phage libraries used in this study display random peptide sequences of six, twelve or fifteen ammo acid residues at the N-termmus of the minor coat protein 111. These libraries are provided by George Smith (University of Missouri, 6 and 15mer) and William Dower (Affy ax Research Institute, 12mer). In a biopann g procedure library samples are screened on solid phase GST-hdm2 (hdm2 comprising ammo acids 1 -188). Polystyrene pet ⁇ dishes (Falcon 3001 ) are coated with 5 ⁇ g/ml GST-hdm2 or DO- 1 (monoclonal anti- p53 antibody) overnight at 4°C in a humidity chamber.
  • Unbound material is washed off with 2.5ml PBS and the dishes are blocked with 2ml TBST-M (150mM NaCI, 50mM Tns-HCI, pH 7.5, 0.1 % (v/v)Tween20, 5% (w/v) low fat milk powder) for 1h at 4 °C.
  • the petn dishes are washed three times with 2.5 ml PBS and 500 ⁇ l phage suspension containing 1x10 1 1 (6 and 12mer libraries) or 7.5x10 12 TU (transforming units) is added and allowed to bind for 3h at 4°C.
  • bound phages are eluted with 400 ⁇ l elution buffer (0.1 N HCI-glycine pH2.2, 1mg/ml BSA) for 20 min.
  • the eluates are neutralized with 24 ⁇ l 2M Tns base and used to infect 2.5ml log-phase E.coli K91 cells (50 mm, 37°C).
  • the whole suspension is transfered into 50ml Falcon tubes with 10 ml 2xYT medium containing 20 ⁇ g/ml tetracycl e (2xYT, Tet) and incubated for 24 hours at 37°C with shaking.
  • the cultures are spun to remove the bacteria and the phage particles are purified from the supernatant by PEG precipitation.
  • the phage pellets are resuspended in 1 ml TBS and aliquots are used for a second round of biopannmg which is carried out as for the first with the following modifications:
  • Single colonies are transfered to wells of a 96-well tissue culture plate containing 200 ⁇ l 2xYT medium with 20 ⁇ g/ml tetracyclme per well. Phage supernatant is collected for ELISA screening after a 24 hour incubation at 37°C with shaking. ELISA positive clones are grown up as 2 ml bacterial cultures in 2xYT medium with 20 ⁇ g/ml tetracyclme for 24 hours Phage are PEG precipitated and redissolved in 200 ⁇ l TBS buffer. Phage DNA is extracted with phenol/chloroform and ethanol precipitated. The DNA pellet is redissolved in 10 ⁇ l water and used as template for sequencing (Sequenase).
  • PVC assay plates are coated with 100 ⁇ l antigen (GST-hdm2, MBP-hdm2, GST, MBP, or DO-1) at 5 ⁇ g ml in PBS overnight at 4°C and blocked with 200 ⁇ l PBST-M (PBS, containing 5% (w/v) fat-free dried milk and 0.1%.(v/v) Tween 20) for one hour at room temperature.
  • 100 ⁇ l phage suspension (supernatant or PEG concentrated phage) is diluted in PBST-M and added for three hours at 4 °C.
  • Bound phages are reacted with 100 ⁇ l HRP- labelled sheep ant ⁇ -M13 antibody (Pharmacia) for one hour at room temperature followed by substrate development with 100 ⁇ l TMB/H202 (0.1 mg/ml TMB, 0.3% H 2 0 2 in 0.1 M Na- acetate, pH 6.0) for 15 min. The reaction is stopped by adding 100 ⁇ l 1 M sulphuric acid to the substrate and the absorbance is measured at 450 nm. All washings between the incubation steps are done with tap water.
  • purified SMP14 (8 ⁇ g/ i in PBS) is used to coat the plate directly.
  • the pre-incubated phage-hdm2 samples are transfered to the coated and blocked plate and incubated for two hours at room temperature. Bound phages are detected as described.
  • Phage pools which have been recovered from two rounds of biopanning on solid phase GST- and MBP-hdm2 or DO-1 using samples of 6, 12, or 15mer phage display libraries are screened in ELISAs for antigen binding. Phage from 12 and 15mer libraries selected twice with GST-hdm2 or once with GST-hdm2 followed by MBP-hdm2 clearly bind to GST-hdm2, whereas the 6mer pool is completely negative. On the other hand, monoclonal anti-p53 antibody DO-1 is able to select phages from all three libraries proving the integrity of the 6mer library.
  • the phage pools are tested against MBP-hdm2, GST and MBP. Both, 12 and 15mer pools contain hdm2 binding phages (positive for MBP-hdm2, but negative for MBP alone). In addition, 15mer phages twice biopanned with GST-hdm2 (GST/GST-hdm2) are strongly selected for GST-binders. In the 15mer pool which is panned on MBP-hdm2 in the second round (GST/MBP-hdm2) the anti-GST signal is reduced, probably because GST is no longer present as a selecting antigen. GST does not pull out any phage from the 12mer library.
  • Single phage clones are grown from 12 and 15mer pools and tested for GST, GST-hdm2 and MBP-hdm2 binding. Many clones are clearly positive with GST-hdm2 and MBP-hdm2. Phage clones from the 12 and 15mer pools which are shown to be positive with GST- and MBP-hdm2 are selected for further analysis. Phage DNA is extracted from each clone and the nucleotide inserts are sequenced. From 28 clones 6 unique insert sequences are obtained (ammo acid sequences given in single letter code):
  • GST-phages are able to bind only to GST-hdm2. All three anti- mdm2 antibodies used (SMP14, 4B2, 3G5) are able to bind to hdm2 complexed with GST- phage.
  • Antibody SMP 1 4 is commercially available and described in Picksley et al., Oncogene 9, 2523-2529 (1994) inco ⁇ orated by reference above.
  • Antibodies 3G5 and 4B2 are descnbed in Chen, J et al., Mol.Cell Bio., vol.13, 4107-4114 (1993) also incorporated herein by reference in its entirety.
  • the hdm2-phage recognizes all three hdm2 fusion proteins including TRX-hdm2 never used for the phage selection (biopanning).
  • the hdm2-phage complexes are efficiently pulled down by SMP14 and 4B2, but 3G5 is hardly able to bind to these complexes. It has been shown that mdm2-p53 complexes cannot be bound by 3G5, probably because the epitope of this antibody lies within the p53 binding domain of mdm2.
  • Another experiment shows that hdm2-phages but not GST- phages are able to inhibit the interaction between hdm2 and TIP.
  • TIP is thioredoxin with the mdm2 binding sequence of p53 inserted into its active site.
  • a dilution series of GST-hdm2 is offered in solution to a fixed amount of phages. Phage-hdm2 complexes are pulled down by solid phase SMP14 and bound phages are detected. All phage clones tested show a very similar strong binding to GST-hdm2 with a half-maximal binding concentration of 0.5 to 10 nM GST-hdm2, dependent on the hdm2 preparation used.
  • baculovirus produced mdm2 (Sf9 cell extract) prove that the phage clones selected with hdm2 are able to bind to its mouse homologue as well.
  • the phage sequences and a consensus sequence are produced as free peptides and tested for their relative capacity to block the interaction of MDM2 with p53 in three different ELISA formats.
  • the new consensus sequence and some of the phage derived peptides show a remarkable increase in specific activity over the wild type p53 peptide sequence.
  • the clones are produced using the Invitrogen-Expression system. Using Bluescript containing the hdm2 gene as a template, PCR is carried out with the following primers (5'-3'): START2 primer: gcg gat ccg atg gtg agg age agg caa atg STOP1 (to N221): gcc tgc age eta att cga tgg cgt ccc tgt aga STOP2 (full length): gc ctg cag eta ggg gaa ata agt tag cac aat STOP3 (to D294): gc ctg cag eta ate ttc ttc aaa tga ate tgt START3 primer (from D294): ggg gat cct gaa att tec tta get gac.
  • START2 primer g
  • the resulting PCR products are cloned into pCR II (TA cloning kit, Invitrogen).
  • the resulting plasmids are cleaved with BamHI and Pstl.
  • the products are ligated into the BamH1/Pstl cleaved pTrxFus.
  • the plasmid is introduced into E.coli G1724 .
  • the following clones are obtained: 1. clone 1/8 Thio-MVRSRQ-MI...N221
  • MBP Maltose binding protein
  • the PCR product is obtained using the STOP1 primer described above with START1 : gc gga tec atg gtg agg age agg caa atg .
  • a plasmid containing wild type hdm2 is used as a template in PCR.
  • the primers are designed such that a BamHI site is introduced into the 5' end and a EcoRI site into the 3' end of the gene.
  • the PCR products are digested and ligated into pGEX-2T (Pharmacia).
  • the plasmid is then introduced into E.coli BL21 cells .
  • Cells are grown in RM medium (1 xM9 salts, 2% Casamino acids, 1 % glycerol, 1mM MgCI 2 , 100 g/ml ampicillin) overnight at 30°C. They are then inoculated into fresh Induction medium (1x M9 salts, 0.2 % Casamino acids, 0.5 % glucose, I mM MgCI 2 , 100 g/ml ampicillin to a dilution of 1/20. Cells are then grown to an OD of 0.25 to 0.5 at 30°C. The culture is transfered to 37°C and induced with L-Tryptophan at a final concentration of 100 g ml. After 3 h cells are harvested by centrifugation.
  • the pellets are resuspended in ice cold 20 mM Tris/HCI, pH 8, 2.5 mM EDTA with protease inhibitors (1 mM PMSF, 1 mM benzamidine, leupeptin, approtinin and pepstatin at 10 g/ml each.
  • the cells are lysed by sonication, shock freezing, quick thawing. The cycle is repeated two more times. The lysate is then centrifuged at 4000 ⁇ for 15 min at 4°C. The supernatant is used .
  • Cells are grown in rich Medium with glucose and ampicillin (10 g tryptone, 5 g yeast extract,
  • the supernatant is diluted 1/5 with column buffer and loaded on an amylose resin (New England Biolabs, 15 ml, prepared in column buffer). Elution is carried out with column buffer + 10 mM Maltose. Active fractions are pooled, concentrated and desalted on a 10 DG column (BioRad). They are stored in 50 mM Tris /Hcl pH 7.4, 50 mM NaCI, 20 % glycerol, 1 mM DTT.
  • Bacteria cultures are grown to OD 0.8. They are cooled to RT and induced with 1 mM IPTG, then grown for 4h at 27°C. Cells are harvested and pellets flash frozen in liquid nitrogen. Pellets are resuspended in ice cold buffer A (0.5 M NaCI, 2.7 mM KCI, 10 mM Na 2 HPO , 1.8 mM KH 2 PO 4 , 1 mM PMSF, 1 mM EDTA, 10 mM 2-mercaptoethanol, pH 7.3). They are lysed by a French press or alternatively by sonication. After centrifugation the soluble fraction is loaded onto a glutathione sepharose 4B column (Pharmacia) equilibrated with buffer A.
  • buffer A 0.5 M NaCI, 2.7 mM KCI, 10 mM Na 2 HPO , 1.8 mM KH 2 PO 4 , 1 mM PMSF, 1 mM EDTA, 10 mM 2-mercapto
  • the protein is then eluted with buffer B (50 mM Tris/HCI, 10 mM reduced glutathione, 0.5 M NaCI, 1 mM EDTA. 1 mM PMSF or benzamidine, 10 mM 2- mercaptoethanol or 1 mM DTT, pH 8.0.) Active fractions are desalted on Sephadex G25 or 10 DG (BioRad) preequilibrated with buffer C (50 mM Tris/HCI, 50 mM NaCI, 20 % glycerol, 10 mM 2-mercaptoethanol or 1 mM DTT, 0.1 % Triton x-100, pH 7.6).
  • buffer B 50 mM Tris/HCI, 10 mM reduced glutathione, 0.5 M NaCI, 1 mM EDTA. 1 mM PMSF or benzamidine, 10 mM 2- mercaptoethanol or 1 mM DTT, pH 8.0.
  • Active fractions are desalted on
  • the protein is used for Elisas or further purified on a Mono Q column (Pharmacia) preequilibrated with buffer C.
  • the protein is eluted with a linear gradient of buffer C containing 1 M NaCI.
  • the fractions containing fusionprotein are pooled, concentrated (Centricon 30), flash frozen in liquid nitrogen and stored at - 70°C.
  • Elisa plates They are named according to the reagent which is used to coat the Elisa plates. All Elisas are carried out at 4°C.
  • Elisa P2 P2 is a biotinylated peptide consisting of 18 amino acids of the Terminal part of p53, namely: Biotin-S-G-S-G-E-P-P-L-S-Q-E-T-F-S-D-L-W-K-L-L-P-E
  • Plates are incubated overnight with 10 ⁇ g/ml streptavidin at 37 C C. They are blocked with 2% BSA in PBS for 1 h. Peptide is applied at 5 ⁇ g/ml in blocking solution for 1 h. A second blocking step is carried out with 5 % milk, 0.1 % Tween20 in PBS (blocking solution2) for a minimum of 10 min. Hdm2fusionproteins are diluted in blocking solution2 and applied for 1h. Bound hdm2 is detected with SMP 14 hybridoma cell supernatant diluted 1/2 in block solution2. HRP-anti-mouse IgG (DAKO) is used as second antibody. Washing between incubations is carried out 6 times with tap water.
  • DAKO HRP-anti-mouse IgG
  • TIP is thioredoxin which has additional amino acids inserted into its active site. These are derived from the N-terminus of p53 and are the following:
  • each P1 and P2 are phosphorylated using PNK and annealed for 1 h at 37°C.
  • the vector pTRX (InVitrogen) is cleaved with Rsrll and dephosphorylated. After ligation the plasmids are introduced into E.coli 1724 cells.
  • Plasmid containing bacteria are grown in RM medium at 30°C and induced with L-Trp as described earlier.
  • a soluble lysate is made by freeze -thaw-sonication cycles. This lysate is then heat shocked at 80°C for 10 min.
  • the soluble fraction is used to coat Elisa-plates at a concentration of 40 ⁇ g/ml in PBS o/n. Plates are blocked in blocking solution2 for 1 h.
  • Plates are coated with 2.6 ⁇ g/ml GST-hdm2(1-188) in PBS at 4°C o/n. They are blocked in blocking solution 2 for 1 h.
  • Full length p53, lysozyme lysate from E. coli, purified on heparin- sepharose is applied in blocking solution2 with 10 % glycerol and 10 mM DTT for 1h.
  • Binding is established with mAb 421 and HRP coupled anti mouse IgG. HRP activity is measured using TMB.
  • Elisas inhibitors are preincubated with either hdm2-fusionproteins or p53 for 15 min before the mixture is transfered to the plate.
  • Peptide inhibitors are dissolved in DMSO.
  • the human wild type p53 gene is used as a template for PCR to obtain the gene fragment encoding for residues 1 to 362 of the 393 amino acids of natural (human) p53 (p53D30).
  • the oligonucleotides used for PCR are designed such that a Ndel restriction site is introduced at the 5' end and a BamHI site at the 3' end .
  • the PCR fragments digested by Ndel and BamHI are ligated with a Ndel/ BamHI cleaved pET- 3a plasmid.
  • the complete gene is sequenced and the expression plasmid is introduced into E. coli strain BL21 (DE3)pLysS (Novagen).
  • ice cold buffer D 50 mM 4-(2-hydroxyethyl)-piperaz ⁇ ne-ethane-sulfonic acid (Hepes.NaOH), 10 % (v/v) glycerol, 0.1 mM EDTA, 0.1 % (v/v) Triton X-100, 5 mM 1 ,4-di
  • the soluble fraction is loaded onto a HiTrap Heparin column (Pharmacia Biotech) preequilibrated at 4 °C with buffer D.
  • the purity of the protein preparation is evaluated by gel scanning (Schimadzu CS- 930) on a SDS-PAGE (Laemmli, U.K. (1970) Nature, 227, 680-385) stained with Coomassie blue. Protein concentration is determined according to Bradford, M.B. (1976) Anal. Biochem., 72, 248-254).
  • peptide binding elements may be constructed in which the peptides of the present invention are presented on the active site of Escherichia coli thoredoxin.
  • the pTrx vector (Invitrogen) is cleaved with restriction enzyme Rsrll. Ogligomers, corresponding to the peptide identified on clone 12/1 , described in example 8 above, and wild type p53 sequences are phosphorylated, annealed and then ligated into the cleaved pTrx vector.
  • TIP wt binding element
  • TIP 12/1 a binding element comprising the peptide insert of clone 12/1 described in example 8.
  • E.Coli 1724 cells are transformed with the resulting plasmids as well as pTrx which may act as a negative control binding element (Trx) comprising thioredoxin without a peptide insert.
  • the cultures may be grown in RM medium (1xM9 salts, 2% Casamino acids, 1 % glycerol, 1mM MgCI 2 , 100 g/ml ampicillin) overnight at 30°C.
  • the cultures are inoculated into fresh induction medium (1x M9 salts, 0.2 % Casamino acids, 0.5 % glucose, I M MgCI 2 , 100 g/ml ampicillin to a dilution of 1/20) and grown to an Optical Density (OD) of 0.25 to 0.5 at 30°C.
  • the culture is transferred to 37°C and induced with L-Tryptophan at a final concentration of 100 g/ml. After 3 hours to 4 hours cells are harvested by centrifugation.
  • the pellets are resuspended in ice cold 20 mM Tris/HCI, pH 8, 2.5 mM EDTA with protease inhibitors 1 mM PMSF, 1 mM benzamidine, leupeptin, approtinin and pepstatin at 10 g/ml each.
  • the cells are lysed by shock freezing, thawing and sonicating. The cycle is repeated two more times. The soluble lysate is then cent ⁇ fuged at 10000g for 20 m at 4°C. Heat shock lysates are obtained by resuspend g petllets to an OD of 100 and then treating at 80°C for 10 minutes followed by centrifugation at 10,000g for 20 m .
  • Purification of soluble extracts is carried out by loading clear soluble lysates onto an Ion exchange Q50 column (BioRad) and elutmg with a linear gradient of 0.05M-1 MKCL in 50mMT ⁇ s/HCL pH7.8, 0.1%Tr ⁇ ton X-100, 10% glycerol and 50mMKCL
  • Active fractions may be identified on dot blots with an anti-thioredoxm antibody available from Invitrogen.
  • the active fractions may then be concentrated using Cent ⁇ prep 3 filters (Amicon) and loaded unto a G100 column (Pharmacia) which has been preequilibrated with 30 mM HEPES, pH 8.0, 500 mM KCL, 0.1% Triton X100, and 10% glycerol. Following elution, active fractions may be pooled, concentrated and dialyzed against PBS.
  • the complete thioredoxin coding region with peptide insertions (TIP wt, and TIP 12/1) or without peptide inserts (Trx) may be PCR amplified using standard PCR reagents and conditions known in the art and the following primers: 5'-3': CGGGATCCACCATGGGCGATAAAATTATTCACCTG and 5'-3': CTCGACGCTAACCTGGCCTAGGGAATTCC.
  • PCR products may be cleaved with BamHI and Eco Rl and ligated into BamHI and EcoRI cleaved pcDNA3.
  • pcDNA3 (Promega) is a vector having a CMV promoter for driving expression of TIP wt, TIP 12/1 and Trx in mammalian cells.
  • the plasmids may be amplified in E. coli as known in the art. Plasmid DNA encoding for TIP 12/1 , TIP wt and Trx may be purified using a Quiagent purification system or phenol/chloroform precipitation.
  • Antibodies or DNA encoding the described binding elements may be microi ⁇ jected into Vrn.6 cells, a transformed rat thyroid epithelial cell line and T22 cells, a mouse prostrate derived cell line both cell lines being stably transfected with pRGC ⁇ Fos- Lacz, a p53 responsive ⁇ -galactosidase reporter.
  • Production of the Vrn.6 cell line and the pRGC ⁇ Fos-Lacz reporter are known in the art. Blaydes, J.P. et al., (1997), Oncogene, vol 14, in press; and Hupp, T.R et al. (1995) Cell, vol. 83, 237-245 hereby incorporated by reference in its entirety.
  • Vrn.6 tolerate hight levels of wild type p53 and overexpress MDM2 at a protein level.
  • T22 cells typically contain low levels of p53 and mdm2.
  • microinjection cells may be seeded into tissue culture dishes and grown to 60- 70% confluence.
  • Microinjection may be performed using an Eppendorfer micorinjection system (Microinjector 5242, Micromanipulator 5170) mounted to an Axiovert light microscope (Zeiss) having a heated stage.
  • Eppendorfer micorinjection system Microinjector 5242, Micromanipulator 5170
  • Zeiss Axiovert light microscope
  • Purified mouse monoclonal antibodies 3G5 and 4B2 may be injected intranuclearly and cytoplasmiely in PBS at a concentration of 1.3 mg/ml. Plasmid DNA encoding for TIP 12/1 , TIP wt and Trx may be injected intronuclearly in water at a concentration of 0.25 mg7ml. Following microinjection, fresh medium may be added to the cell cultures and the cultures further incubated for 24 hours.
  • cells may be washed with PBS and fixed with 2% formaldehyde,/0.2% glutaraldehyde in PBS for 5 minutes on ice. The cells may be washed again and overlaid with X-gal (0.25 mg/ml) in a reaction mix (5mM potassium ferricyanide, 2mM magnesium chloride in PBS). Cells may then be incubated at 37 °C for 16 hours after which they may be observed for blue stained cells indicating a positive response. Results:
  • 3G5 antibody or TIP 12/1 were injected intranuciearly. There was not a positive response weht Trx was injected intranuciearly. 3G5 binds mdm2 withing the p53 binding pocket thereby blocking p53-MDM2 association (B ⁇ ttinger et al., 1997)
  • 4B2 antibody or Trx were injected.
  • 4B2 is an anti MDM2 antibody that targets an epitope outside the p53 binding pocket on MDM2.
  • DNA encoding the described binding elements TIP 12/1 , TIP wt and Trx and the pRGC ⁇ FosLacZ reporter may be transiently transfeeted into the following three different cell types, OSA cells, a human osteosarcome cell line , U2-Os cells, another osteosareoma cell line, and MCF-7 cells, a breast conacer cell line containing wild type p53 .
  • the OSA cell line contains a highly elevated mdm2 level due to gene amplification (Florence et al. 1994).
  • the U2-OS cell line has no gene amplification for mdm2 but has elevated levels of mdm2-mRNA (Florence et al. 1994).
  • the MCF-7 cell line contains heterogenously expressed low levels of wild type p53 and no reported mdm2 elevation.
  • cells are seeded into 6 well plates at 1.5 x 10 6 cell per well. They are grown to a density of 80% confluence and transfeeted using different Lipophilic reagents such Lipofectin and Lipofectamin from Promega or Dosper and Dotap from Boehringer.
  • Lipophilic reagents such Lipofectin and Lipofectamin from Promega or Dosper and Dotap from Boehringer.
  • 2.5 ⁇ g of TIP encoding plasmid DNA, 1 ⁇ g RGC ⁇ FosLacZ DNA and 5-1 O ⁇ g of lipophili reagent according to manufacturer instructions are mixed in serum free medium and applied to the cells. Two to four hours after transfection, complete medium is added. Forty-eight hours after transfection ⁇ -galactosidase activity is measured using DPRG (Boehringer) as a substrate.
  • T22 cells U2-Os cells, OSA cells and SAOS 2 cells may be grown in in Dulbeccor's modified Eagle medium (DMEM) supplemented with 10% Fetal Calf Serum. Additionally, for T22 cells 1 mg/ml of the antibiotic G418 may be added. Vrn. 6 cells are grown as is known in the art, previously described by Blaydes et al., 1997.
  • DMEM Dulbeccor's modified Eagle medium

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Genetics & Genomics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Amplifiers (AREA)
  • Crystals, And After-Treatments Of Crystals (AREA)
PCT/EP1997/003549 1996-07-05 1997-07-04 Inhibitors of the interaction between p53 and mdm2 Ceased WO1998001467A2 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
AU38479/97A AU3847997A (en) 1996-07-05 1997-07-04 Inhibitors of the interaction between P53 and MDM2
NZ333609A NZ333609A (en) 1996-07-05 1997-07-04 Peptide inhibitors of the interaction between P35 and MDM2 and the treatment of tumor cells
JP10504775A JP2001500365A (ja) 1996-07-05 1997-07-04 P53とmdm2の間の相互作用の阻害剤
EP97935511A EP0958305B1 (en) 1996-07-05 1997-07-04 Inhibitions of the interaction between p53 and mdm2
DE69738754T DE69738754D1 (de) 1996-07-05 1997-07-04 Hemmer der interaktion zwischen p53 und mdm2
US09/214,371 US7083983B2 (en) 1996-07-05 1997-07-04 Inhibitors of the interaction between P53 and MDM2
US10/927,262 US20050137137A1 (en) 1996-07-05 2004-08-25 Inhibitors of the Interaction between p53 and MDM2

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GBGB9614197.3A GB9614197D0 (https=) 1996-07-05 1996-07-05
GB9614197.3 1996-07-05
GBGB9707041.1A GB9707041D0 (en) 1997-04-07 1997-04-07 Inhibitors of the interaction between p53 and mdm2
GB9707041.1 1997-04-07

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US10/927,262 Continuation US20050137137A1 (en) 1996-07-05 2004-08-25 Inhibitors of the Interaction between p53 and MDM2

Publications (1)

Publication Number Publication Date
WO1998001467A2 true WO1998001467A2 (en) 1998-01-15

Family

ID=26309649

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1997/003549 Ceased WO1998001467A2 (en) 1996-07-05 1997-07-04 Inhibitors of the interaction between p53 and mdm2

Country Status (8)

Country Link
EP (1) EP0958305B1 (https=)
JP (1) JP2001500365A (https=)
AT (1) ATE397621T1 (https=)
AU (1) AU3847997A (https=)
CA (1) CA2259149A1 (https=)
DE (1) DE69738754D1 (https=)
NZ (1) NZ333609A (https=)
WO (1) WO1998001467A2 (https=)

Cited By (49)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998047525A1 (en) * 1997-04-22 1998-10-29 University Of Dundee MATERIALS AND METHODS RELATING TO INHIBITING THE INTERACTION OF p53 AND mdm2
EP0947494A1 (en) * 1998-03-30 1999-10-06 F. Hoffmann-La Roche Ag Derivatives of phenoxy acetic acid and phenoxymethyltetrazole having antitumor activity
WO2000015657A1 (en) * 1998-09-12 2000-03-23 Astrazeneca Ab Piperizine-4-phenyl derivatives as inhibitors of the interaction between mdm2 and 53
AU742993B2 (en) * 1998-03-26 2002-01-17 Isis Pharmaceuticals, Inc. Antisense modulation of human mdm2 expression
EP0989136A4 (en) * 1997-05-15 2002-10-09 Kyowa Hakko Kogyo Kk PEPTIDES WITH CYCLIC STRUCTURES THAT CAN RECOVER THE ACTIVITY OF MUTED P53 PROTEINS.
US6864054B1 (en) * 1998-05-26 2005-03-08 Institute Of Molecular And Cell Biology Polypeptides from CREB binding protein and related protein p300 for use in transcriptional regulation
WO2005097820A1 (en) * 2004-04-06 2005-10-20 Korea Research Institute Of Bioscience And Biotechnology Peptides for inhibiting mdm2 function
US7083983B2 (en) 1996-07-05 2006-08-01 Cancer Research Campaign Technology Limited Inhibitors of the interaction between P53 and MDM2
US7498336B2 (en) 2003-02-13 2009-03-03 The United States Of America As Represented By The Secretary, Department Of Health And Human Services Deazaflavin compounds and methods of use thereof
US7531515B2 (en) 2000-04-05 2009-05-12 The Research Foundation Of State University Of New York Peptides selectively lethal to malignant and transformed mammalian cells
WO2011005219A1 (en) * 2009-07-07 2011-01-13 Agency For Science, Technology And Research Novel mdm2 binding peptides and uses thereof
WO2011023677A1 (en) 2009-08-26 2011-03-03 Novartis Ag Tetra-substituted heteroaryl compounds and their use as mdm2 and/or mdm4 modulators
WO2011076786A1 (en) 2009-12-22 2011-06-30 Novartis Ag Substituted isoquinolinones and quinazolinones
WO2012066095A1 (en) 2010-11-19 2012-05-24 Novartis Ag Crystalline form of an inhibitor of mdm2/4 and p53 interaction
WO2012175520A1 (en) 2011-06-20 2012-12-27 Novartis Ag Hydroxy substituted isoquinolinone derivatives
WO2012175487A1 (en) 2011-06-20 2012-12-27 Novartis Ag Cyclohexyl isoquinolinone compounds
US20130330421A1 (en) * 2011-12-01 2013-12-12 Katholieke Universiteit Leuven, K.U. Leuven R&D Combinations of therapeutic agents for treating melanoma
US20140162339A1 (en) * 1999-05-18 2014-06-12 President And Fellows Of Harvard College Stabilized Compounds Having Secondary Structure Motifs
CN103974973A (zh) * 2011-11-09 2014-08-06 莫茨制药有限及两合公司 显示出缩短的生物学活性的神经毒素
US9096684B2 (en) 2011-10-18 2015-08-04 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
WO2016049359A1 (en) * 2014-09-24 2016-03-31 Aileron Therapeutics, Inc. Peptidomimetic macrocycles and uses thereof
US9365576B2 (en) 2012-05-24 2016-06-14 Novartis Ag Pyrrolopyrrolidinone compounds
US9403827B2 (en) 2013-01-22 2016-08-02 Novartis Ag Substituted purinone compounds
US9464115B2 (en) 2003-11-05 2016-10-11 Dana-Farber Cancer Institute, Inc. Stabilized alpha helical peptides and uses thereof
US9505804B2 (en) 2012-02-15 2016-11-29 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
US9527896B2 (en) 2007-01-31 2016-12-27 Dana-Farber Cancer Institute, Inc. Stabilized p53 peptides and uses thereof
US9550796B2 (en) 2013-11-21 2017-01-24 Novartis Ag Pyrrolopyrrolone derivatives and their use as BET inhibitors
US9556180B2 (en) 2013-01-22 2017-01-31 Novartis Ag Pyrazolo[3,4-d]pyrimidinone compounds as inhibitors of the P53/MDM2 interaction
US9604919B2 (en) 2012-11-01 2017-03-28 Aileron Therapeutics, Inc. Disubstituted amino acids and methods of preparation and use thereof
US9624247B2 (en) 2013-05-28 2017-04-18 Novartis Ag Pyrazolo-pyrrolidin-4-one derivatives as bet inhibitors and their use in the treatment of disease
US9714249B2 (en) 2013-05-28 2017-07-25 Novartis Ag Pyrazolo-pyrrolidin-4-one derivatives and their use in the treatment of disease
WO2017201449A1 (en) 2016-05-20 2017-11-23 Genentech, Inc. Protac antibody conjugates and methods of use
US9890166B2 (en) 2013-05-27 2018-02-13 Novartis Ag Imidazopyrrolidine derivatives and their use in the treatment of disease
US9957299B2 (en) 2010-08-13 2018-05-01 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
US10023613B2 (en) 2015-09-10 2018-07-17 Aileron Therapeutics, Inc. Peptidomimetic macrocycles as modulators of MCL-1
US10022422B2 (en) 2009-01-14 2018-07-17 Alleron Therapeutics, Inc. Peptidomimetic macrocycles
US10059741B2 (en) 2015-07-01 2018-08-28 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
CN109206474A (zh) * 2018-11-27 2019-01-15 青岛海洋生物医药研究院 一种线性肽合成方法
US10227380B2 (en) 2012-02-15 2019-03-12 Aileron Therapeutics, Inc. Triazole-crosslinked and thioether-crosslinked peptidomimetic macrocycles
US10253067B2 (en) 2015-03-20 2019-04-09 Aileron Therapeutics, Inc. Peptidomimetic macrocycles and uses thereof
US10300109B2 (en) 2009-09-22 2019-05-28 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
US10301351B2 (en) 2007-03-28 2019-05-28 President And Fellows Of Harvard College Stitched polypeptides
WO2019118893A1 (en) 2017-12-15 2019-06-20 Dana-Farber Cancer Institute, Inc. Stabilized peptide-mediated targeted protein degradation
WO2020172115A1 (en) * 2019-02-20 2020-08-27 Oncolyze, Inc. Hdm2 antibody for use in treating cancer
CN112266407A (zh) * 2020-09-28 2021-01-26 宁夏大学 特异结合p53蛋白的七肽、编码基因、制备方法及用途
US10905739B2 (en) 2014-09-24 2021-02-02 Aileron Therapeutics, Inc. Peptidomimetic macrocycles and formulations thereof
US11091522B2 (en) 2018-07-23 2021-08-17 Aileron Therapeutics, Inc. Peptidomimetic macrocycles and uses thereof
WO2023056069A1 (en) 2021-09-30 2023-04-06 Angiex, Inc. Degrader-antibody conjugates and methods of using same
WO2024240858A1 (en) 2023-05-23 2024-11-28 Valerio Therapeutics Protac molecules directed against dna damage repair system and uses thereof

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE602004024831D1 (de) * 2004-04-22 2010-02-04 Ortho Mcneil Pharm Inc Hdm2-inhibitorkomplexe und verwendungen davon
CA2765657A1 (en) * 2009-06-16 2010-12-23 Tokai University Anti-gram-negative bacteria agent
EP4312749A4 (en) * 2021-03-31 2025-07-09 Zeteo Tech Inc DIAGNOSIS OF RESPIRATORY DISEASES BY CAPTURE OF AEROSOLIZED BIOMATERIAL PARTICLES USING FIXED BED SYSTEMS AND METHODS

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of EP0958305A2 *

Cited By (65)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7083983B2 (en) 1996-07-05 2006-08-01 Cancer Research Campaign Technology Limited Inhibitors of the interaction between P53 and MDM2
WO1998047525A1 (en) * 1997-04-22 1998-10-29 University Of Dundee MATERIALS AND METHODS RELATING TO INHIBITING THE INTERACTION OF p53 AND mdm2
EP0989136A4 (en) * 1997-05-15 2002-10-09 Kyowa Hakko Kogyo Kk PEPTIDES WITH CYCLIC STRUCTURES THAT CAN RECOVER THE ACTIVITY OF MUTED P53 PROTEINS.
AU742993B2 (en) * 1998-03-26 2002-01-17 Isis Pharmaceuticals, Inc. Antisense modulation of human mdm2 expression
EP0947494A1 (en) * 1998-03-30 1999-10-06 F. Hoffmann-La Roche Ag Derivatives of phenoxy acetic acid and phenoxymethyltetrazole having antitumor activity
US6864054B1 (en) * 1998-05-26 2005-03-08 Institute Of Molecular And Cell Biology Polypeptides from CREB binding protein and related protein p300 for use in transcriptional regulation
US6770627B1 (en) 1998-09-12 2004-08-03 Astrazeneca Ab Piperizine-4-phenyl derivatives as inhibitors of the interaction between mdm2 and p 53
WO2000015657A1 (en) * 1998-09-12 2000-03-23 Astrazeneca Ab Piperizine-4-phenyl derivatives as inhibitors of the interaction between mdm2 and 53
US10487110B2 (en) 1999-05-18 2019-11-26 President And Fellows Of Harvard College Stabilized compounds having secondary structure motifs
US20140162339A1 (en) * 1999-05-18 2014-06-12 President And Fellows Of Harvard College Stabilized Compounds Having Secondary Structure Motifs
US9505801B2 (en) * 1999-05-18 2016-11-29 President And Fellows Of Harvard College Stabilized compounds having secondary structure motifs
US7745405B2 (en) 2000-04-05 2010-06-29 The Research Foundation Of State University Of New York Peptides selectively lethal to malignant and transformed mammalian cells
US7531515B2 (en) 2000-04-05 2009-05-12 The Research Foundation Of State University Of New York Peptides selectively lethal to malignant and transformed mammalian cells
US7498336B2 (en) 2003-02-13 2009-03-03 The United States Of America As Represented By The Secretary, Department Of Health And Human Services Deazaflavin compounds and methods of use thereof
AU2004220114B2 (en) * 2003-03-12 2010-03-04 The Research Foundation Of State University Of New York Peptides selectively lethal to malignant and transformed mammalian cells
US9464115B2 (en) 2003-11-05 2016-10-11 Dana-Farber Cancer Institute, Inc. Stabilized alpha helical peptides and uses thereof
WO2005097820A1 (en) * 2004-04-06 2005-10-20 Korea Research Institute Of Bioscience And Biotechnology Peptides for inhibiting mdm2 function
US9527896B2 (en) 2007-01-31 2016-12-27 Dana-Farber Cancer Institute, Inc. Stabilized p53 peptides and uses thereof
US10301351B2 (en) 2007-03-28 2019-05-28 President And Fellows Of Harvard College Stitched polypeptides
US10022422B2 (en) 2009-01-14 2018-07-17 Alleron Therapeutics, Inc. Peptidomimetic macrocycles
WO2011005219A1 (en) * 2009-07-07 2011-01-13 Agency For Science, Technology And Research Novel mdm2 binding peptides and uses thereof
WO2011023677A1 (en) 2009-08-26 2011-03-03 Novartis Ag Tetra-substituted heteroaryl compounds and their use as mdm2 and/or mdm4 modulators
US10300109B2 (en) 2009-09-22 2019-05-28 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
US9051279B2 (en) 2009-12-22 2015-06-09 Novartis Ag Substituted isoquinolinones and quinazolinones
WO2011076786A1 (en) 2009-12-22 2011-06-30 Novartis Ag Substituted isoquinolinones and quinazolinones
US9957299B2 (en) 2010-08-13 2018-05-01 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
WO2012066095A1 (en) 2010-11-19 2012-05-24 Novartis Ag Crystalline form of an inhibitor of mdm2/4 and p53 interaction
US8969351B2 (en) 2010-11-19 2015-03-03 Novartis Ag Crystalline form of an inhibitor of MDM2/4 and p53 interaction
US9073898B2 (en) 2010-11-19 2015-07-07 Novartis Ag Crystalline form of an inhibitor of MDM2/4 and p53 interaction
WO2012175487A1 (en) 2011-06-20 2012-12-27 Novartis Ag Cyclohexyl isoquinolinone compounds
WO2012175520A1 (en) 2011-06-20 2012-12-27 Novartis Ag Hydroxy substituted isoquinolinone derivatives
US9522947B2 (en) 2011-10-18 2016-12-20 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
US9096684B2 (en) 2011-10-18 2015-08-04 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
US10308699B2 (en) 2011-10-18 2019-06-04 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
CN103974973A (zh) * 2011-11-09 2014-08-06 莫茨制药有限及两合公司 显示出缩短的生物学活性的神经毒素
US9408885B2 (en) * 2011-12-01 2016-08-09 Vib Vzw Combinations of therapeutic agents for treating melanoma
US20130330421A1 (en) * 2011-12-01 2013-12-12 Katholieke Universiteit Leuven, K.U. Leuven R&D Combinations of therapeutic agents for treating melanoma
US10213477B2 (en) 2012-02-15 2019-02-26 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
US10227380B2 (en) 2012-02-15 2019-03-12 Aileron Therapeutics, Inc. Triazole-crosslinked and thioether-crosslinked peptidomimetic macrocycles
US9505804B2 (en) 2012-02-15 2016-11-29 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
US9365576B2 (en) 2012-05-24 2016-06-14 Novartis Ag Pyrrolopyrrolidinone compounds
US10669230B2 (en) 2012-11-01 2020-06-02 Aileron Therapeutics, Inc. Disubstituted amino acids and methods of preparation and use thereof
US9845287B2 (en) 2012-11-01 2017-12-19 Aileron Therapeutics, Inc. Disubstituted amino acids and methods of preparation and use thereof
US9604919B2 (en) 2012-11-01 2017-03-28 Aileron Therapeutics, Inc. Disubstituted amino acids and methods of preparation and use thereof
US9403827B2 (en) 2013-01-22 2016-08-02 Novartis Ag Substituted purinone compounds
US9556180B2 (en) 2013-01-22 2017-01-31 Novartis Ag Pyrazolo[3,4-d]pyrimidinone compounds as inhibitors of the P53/MDM2 interaction
US9890166B2 (en) 2013-05-27 2018-02-13 Novartis Ag Imidazopyrrolidine derivatives and their use in the treatment of disease
US9714249B2 (en) 2013-05-28 2017-07-25 Novartis Ag Pyrazolo-pyrrolidin-4-one derivatives and their use in the treatment of disease
US9624247B2 (en) 2013-05-28 2017-04-18 Novartis Ag Pyrazolo-pyrrolidin-4-one derivatives as bet inhibitors and their use in the treatment of disease
US9550796B2 (en) 2013-11-21 2017-01-24 Novartis Ag Pyrrolopyrrolone derivatives and their use as BET inhibitors
WO2016049359A1 (en) * 2014-09-24 2016-03-31 Aileron Therapeutics, Inc. Peptidomimetic macrocycles and uses thereof
US10471120B2 (en) 2014-09-24 2019-11-12 Aileron Therapeutics, Inc. Peptidomimetic macrocycles and uses thereof
US10905739B2 (en) 2014-09-24 2021-02-02 Aileron Therapeutics, Inc. Peptidomimetic macrocycles and formulations thereof
US10253067B2 (en) 2015-03-20 2019-04-09 Aileron Therapeutics, Inc. Peptidomimetic macrocycles and uses thereof
US10059741B2 (en) 2015-07-01 2018-08-28 Aileron Therapeutics, Inc. Peptidomimetic macrocycles
US10023613B2 (en) 2015-09-10 2018-07-17 Aileron Therapeutics, Inc. Peptidomimetic macrocycles as modulators of MCL-1
WO2017201449A1 (en) 2016-05-20 2017-11-23 Genentech, Inc. Protac antibody conjugates and methods of use
WO2019118893A1 (en) 2017-12-15 2019-06-20 Dana-Farber Cancer Institute, Inc. Stabilized peptide-mediated targeted protein degradation
US11091522B2 (en) 2018-07-23 2021-08-17 Aileron Therapeutics, Inc. Peptidomimetic macrocycles and uses thereof
CN109206474A (zh) * 2018-11-27 2019-01-15 青岛海洋生物医药研究院 一种线性肽合成方法
WO2020172115A1 (en) * 2019-02-20 2020-08-27 Oncolyze, Inc. Hdm2 antibody for use in treating cancer
CN112266407A (zh) * 2020-09-28 2021-01-26 宁夏大学 特异结合p53蛋白的七肽、编码基因、制备方法及用途
CN112266407B (zh) * 2020-09-28 2023-05-12 宁夏医科大学总医院 特异结合p53蛋白的七肽、编码基因、制备方法及用途
WO2023056069A1 (en) 2021-09-30 2023-04-06 Angiex, Inc. Degrader-antibody conjugates and methods of using same
WO2024240858A1 (en) 2023-05-23 2024-11-28 Valerio Therapeutics Protac molecules directed against dna damage repair system and uses thereof

Also Published As

Publication number Publication date
CA2259149A1 (en) 1998-01-15
EP0958305B1 (en) 2008-06-04
JP2001500365A (ja) 2001-01-16
AU3847997A (en) 1998-02-02
DE69738754D1 (de) 2008-07-17
ATE397621T1 (de) 2008-06-15
NZ333609A (en) 2000-08-25
EP0958305A2 (en) 1999-11-24

Similar Documents

Publication Publication Date Title
EP0958305B1 (en) Inhibitions of the interaction between p53 and mdm2
US7083983B2 (en) Inhibitors of the interaction between P53 and MDM2
AU2024200512B2 (en) Stabilized peptide-mediated targeted protein degradation
Ahangarpour et al. Photo-induced radical thiol–ene chemistry: a versatile toolbox for peptide-based drug design
US12329799B2 (en) Peptidyl inhibitors of calcineurin-NFAT interaction
AU2005256155A1 (en) Conjugates and therapeutic uses thereof
SK286581B6 (sk) Deriváty dolastatinu 15, farmaceutický prípravok s ich obsahom a ich použitie
US10632187B2 (en) Hemagglutinin-binding peptide
WO2015022283A1 (en) Yap-tead inhibitors
CA3231587A1 (en) Antiviral structurally-stapled sars-cov-2 peptide- cholesterol conjugates and uses thereof
JPWO2017217545A1 (ja) プレキシンの結合調節剤
AU777766B2 (en) Inhibitors of the interaction between p53 and MDM2
WO1998012219A1 (en) Methionine, penicillamine and cysteine-analogue containing peptides having immunomodulating activity
JP2024170574A (ja) ヘマグルチニン結合ペプチド
US8937155B2 (en) Antimicrobial peptides and peptide derivatives derived from Oncopeltus fasciatus
US20260041753A1 (en) Respiratory syncytial virus surface glycoprotein peptides, conjugates, and uses thereof
EP4611787A1 (en) Ccr2 inhibitors and methods of use
WO1998012214A1 (en) Cysteine analogue containing peptides having immunomodulatory effect

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH KE LS MW SD SZ UG ZW AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL

CFP Corrected version of a pamphlet front page
CR1 Correction of entry in section i

Free format text: PAT. BUL. 02/98 UNDER INID (54) "TITLE", REPLACE THE EXISTING TEXT BY "INHIBITORS OF THE INTERACTION BETWEEN P53 AND MDM2"

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 333609

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 1997935511

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2259149

Country of ref document: CA

Ref country code: CA

Ref document number: 2259149

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 09214371

Country of ref document: US

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1997935511

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 1997935511

Country of ref document: EP