WO1997038003A1 - Proteine humaine specifique a l'hematopoïese - Google Patents

Proteine humaine specifique a l'hematopoïese Download PDF

Info

Publication number
WO1997038003A1
WO1997038003A1 PCT/US1996/004930 US9604930W WO9738003A1 WO 1997038003 A1 WO1997038003 A1 WO 1997038003A1 US 9604930 W US9604930 W US 9604930W WO 9738003 A1 WO9738003 A1 WO 9738003A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
hhsp
amino acid
seq
Prior art date
Application number
PCT/US1996/004930
Other languages
English (en)
Inventor
Ying-Fei Wei
Haodong Li
Original Assignee
Human Genome Sciences, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences, Inc. filed Critical Human Genome Sciences, Inc.
Priority to AU53890/96A priority Critical patent/AU5389096A/en
Priority to PCT/US1996/004930 priority patent/WO1997038003A1/fr
Priority to US08/837,029 priority patent/US5945303A/en
Publication of WO1997038003A1 publication Critical patent/WO1997038003A1/fr
Priority to US09/987,967 priority patent/US20020055144A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • This invention relates, in part, to newly identified polynucleotides and polypeptides,- variants and derivatives of the polynucleotides and polypeptides; processes for making the polynucleotides and the polypeptides, and their variants and derivatives; agonists and antagonists of the polypeptides,- and uses of the polynucleotides, polypeptides, variants, derivatives, agonists and antagonists.
  • the invention relates to polynucleotides and polypeptides of human hematopoietic-specific protein, sometimes hereinafter referred to as "hHSP" .
  • the thymus is an unpaired organ located in the mediastinal cavity anterior to and above the heart. It consists of two flattened symmetrical lobes each enclosed in a capsule, from which trabecula extend into the gland dividing each lobe into many lobules, each consisting of a cortex and medulla.
  • the cortex is composed of dense lymphoid tissue containing many immature T cells (thymocytes) closely packed together.
  • the medulla also contains thymocytes, but they are less numerous and more differentiated.
  • thymic stromal cells including epithelial cells, macrophages, fibroblasts and dendritic cells. It also contains characteristic thymic Hassall's corpuscles comprised of terminally differentiated medullary epithelial cells.
  • the thymus is necessary for the development of T cells and T cells are necessary for immunocompetence. For example, children with DiGeorge Syndrome or mice of the nu/nu strain are lacking a thymus and are immunocompromised.
  • Thymocytes develop in the thymus as the precursor of the thymus-derived lymphocyte (T-lymphocyte) that constitutes the cellular arm of the immune response.
  • T-lymphocyte thymus-derived lymphocyte
  • the pro-thymocyte migrates from the bone marrow to the thymus where it proliferates and differentiates into thymic lymphoid cells (T cells) .
  • T cells thymic lymphoid cells
  • TCR antigen specific T cell receptors
  • TCR antigen specific T cell receptors
  • Antigens such as proteins from bacteria, viruses, fungi and protozoa can induce a cellular immune response directly.
  • Antigen presenting cells such as macrophages and dendritic cells are considered to be necessary for processing and presenting all antigens to T cells.
  • the T cell On initial contact with the antigen, the T cell undergoes clonal proliferation and differentiates into committed T cells with various functions. Abnormalities in the process of T cell differentiation may result in immunodeficiencies, characterized by diminished T cell responses, or autoimmune diseases, characterized by enhanced and unregulated T cell responses.
  • the activated T-lymphocyte mediates cellular immunity by a direct toxic effect, reacting directly with cell-membrane- associated antigens, or by releasing various soluble factors called lymphokines.
  • Lymphokines are referred to as the chemical mediators of cellular immunity and several factors have now been defined, for example, interferon-7 (IFN-7) which activates macrophage antigen presenting activity and regulates further T cell differentiation and lymphotoxin (LT) which prevents clonal proliferation of lymphocytes and damages lymphocytes and other cell types.
  • IFN-7 interferon-7
  • LT lymphotoxin
  • T cells may require macrophage participation and some B cells require T-helper cell participation. Both first and later contacts with antigen result in activated T cells or B cells (plasma cells) , the mediators respectively, of cellular and of humoral (antibody-mediated) immunity.
  • T cells control both the cellular and humoral arms of the immune system through the release of factors such as B cell growth factor (interleukin-4, IL-4) .
  • B cell growth factor interleukin-4, IL-4
  • AIDS acquired immunodeficiency disease
  • proteins which regulate T cell maturation, growth and effector function. Proteins, such as hHSP which are expressed in the thymus, the site where T cells differentiate, have a distinct therapeutic potential in T cell regulation and in the treatment of immunodeficiency, autoimmune disease or other forms of hematopoietic dysfunction.
  • polypeptides inter alia, that have been identified as novel hHSP by analysis of specific expression of hHSP in the thymus and hematopoietic tissues.
  • the polynucleotide comprises the region encoding human hHSP in the sequence set out in Figure 1 (SEQ ID NO:2) .
  • an isolated nucleic acid molecule encoding a mature polypeptide expressed by the human cDNA contained in the deposited clone.
  • isolated nucleic acid molecules encoding human hHSP including mRNAs, cDNAs, genomic DNAs and, in further embodiments of this aspect of the invention, biologically, diagnostically, clinically or therapeutically useful variants, analogs or derivatives thereof, or fragments thereof, including fragments of the variants, analogs and derivatives.
  • hHSP polypeptides particularly human hHSP polypeptides, that plays a role in the immune response by regulating the differentiation and maturation of cells of the immune system, specifically progenitor cells which originate in the thymus, for example T cells, and cells of hematopoietic origin, and which therefore may be employed to treat and/or prevent auto-immune disorders, graft rejection, provide defense against malignant cells, viral infection, fungal infection and bacteria.
  • hHSP novel polypeptides of human origin referred to herein as hHSP as well as biologically, diagnostically or therapeutically useful fragments, variants and derivatives thereof, variants and derivatives of the fragments, and analogs of the foregoing.
  • methods for producing the aforementioned hHSP polypeptides comprising culturing host cells having expressibly incorporated therein an exogenously-derived human hHSP-encoding polynucleotide under conditions for expression of human hHSP in the host and then recovering the expressed polypeptide.
  • products, compositions and methods for, among other things: assessing hHSP expression in cells by determining hHSP polypeptides or hHSP- encoding mRNA,- assaying genetic variation and aberrations, such as defects, in hHSP genes; and administering a hHSP polypeptide or polynucleotide to an organism to augment hHSP function or remediate hHSP dysfunction.
  • probes that hybridize to human hHSP sequences.
  • antibodies against hHSP polypeptides there are provided antibodies against hHSP polypeptides.
  • the antibodies are highly selective for human hHSP.
  • hHSP agonists are molecules that mimic hHSP, that bind to hHSP-binding molecules or receptor molecules, and that elicit or augment hHSP-induced responses. Also among preferred agonists are molecules that interact with hHSP or hHSP polypeptides, or with other modulators of hHSP activities, and thereby potentiate or augment an effect of hHSP or more than one effect of hHSP.
  • hHSP antagonists include those which mimic hHSP so as to bind to hHSP receptor or binding molecules but not elicit a hHSP-induced response or more than one hHSP-induced response. Also among preferred antagonists are molecules that bind to or interact with hHSP so as to inhibit an effect of hHSP or more than one effect of hHSP or which prevent expression of hHSP.
  • the antagonists may be used to inhibit the action of hHSP polypeptides. They may be used, for instance, to treat and/or prevent delayed hypersensitivity, a T cell-mediated reaction.
  • compositions comprising a hHSP polynucleotide or a hHSP polypeptide for administration to cells in vi tro, to cells ex vivo and to cells in vivo, or to a multicellular organism.
  • the compositions comprise a hHSP polynucleotide for expression of a hHSP polypeptide in a host organism for treatment of disease.
  • a host organism for treatment of disease.
  • Figure l shows the nucleotide and deduced amino acid sequence of human hHSP.
  • Figure 2 shows structural and functional features of hHSP deduced by the indicated techniques, as a function of amino acid sequence.
  • DIGESTION of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA.
  • the various restriction enzymes referred to herein are commercially available and their reaction conditions, cofactors and other requirements for use are known and routine to the skilled artisan.
  • plasmid or DNA fragment is digested with about 2 units of enzyme in about 20 ⁇ l of reaction buffer.
  • isolating DNA fragments for plasmid construction typically 5 to 50 ⁇ g of DNA are digested with 20 to 250 units of enzyme in proportionately larger volumes.
  • GENETIC ELEMENT generally means a polynucleotide comprising a region that encodes a polypeptide or a region that regulates transcription or translation or other processes important to expression of the polypeptide in a host cell, or a polynucleotide comprising both a region that encodes a polypeptide and a region operably linked thereto that regulates expression.
  • Genetic elements may be comprised within a vector that replicates as an episomal element; that is, as a molecule physically independent of the host cell genome. They may be comprised within mini-chromosomes, such as those that arise during amplification of transfected DNA by methotrexate selection in eukaryotic cells. Genetic elements also may be comprised within a host cell genome,- not in their natural state but, rather, following manipulation such as isolation, cloning and introduction into a host cell in the form of purified DNA or in a vector, among others.
  • ISOLATED means altered "by the hand of man” from its natural state; i.e., that, if it occurs in nature, it has been changed or removed from its original environment, or both.
  • a naturally occurring polynucleotide or a polypeptide naturally present in a living animal in its natural state is not “isolated, " but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated", as the term is employed herein.
  • the term isolated means that it is separated from the chromosome and cell in which it naturally occurs.
  • such polynucleotides can be joined to other polynucleotides, such as DNAs, for mutagenesis, to form fusion proteins, and for propagation or expression in a host, for instance.
  • the isolated polynucleotides alone or joined to other polynucleotides such as vectors, can be introduced into host cells, in culture or in whole organisms. Introduced into host cells in culture or in whole organisms, such DNAs still would be isolated, as the term is used herein, because they would not be in their naturally occurring form or environment.
  • polynucleotides and polypeptides may occur in a composition, such as a media formulations, solutions for introduction of polynucleotides or polypeptides, for example, into cells, compositions or solutions for chemical or enzymatic reactions, for instance, which are not naturally occurring compositions, and, therein remain isolated polynucleotides or polypeptides within the meaning of that term as it is employed herein.
  • a composition such as a media formulations, solutions for introduction of polynucleotides or polypeptides, for example, into cells, compositions or solutions for chemical or enzymatic reactions, for instance, which are not naturally occurring compositions, and, therein remain isolated polynucleotides or polypeptides within the meaning of that term as it is employed herein.
  • LIGATION refers to the process of forming phosphodiester bonds between two or more polynucleotides, which most often are double stranded DNAs.
  • Techniques for ligation are well known to the art and protocols for ligation are described in standard laboratory manuals and references, such as, for instance, Sambrook et al., MOLECULAR CLONING, A LABORATORY MANUAL, 2nd Ed. ; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989) and Maniatis et al., pg. 146, as cited below.
  • OLIGONUCLEOTIDE(S) refers to relatively short polynucleotides. Often the term refers to single-stranded deoxyribonucleotides, but it can refer as well to single-or double-stranded ribonucleotides, RNA:DNA hybrids and double-stranded DNAs, among others.
  • Oligonucleotides such as single-stranded DNA probe oligonucleotides, often are synthesized by chemical methods, such as those implemented on automated oligonucleotide synthesizers. However, oligonucleotides can be made by a variety of other methods, including in vitro recombinant DNA-mediated techniques and by expression of DNAs in cells and organisms.
  • oligonucleotides typically are obtained without a 5' phosphate.
  • the 5' ends of such oligonucleotides are not substrates for phosphodiester bond formation by ligation reactions that employ DNA ligases typically used to form recombinant DNA molecules.
  • a phosphate can be added by standard techniques, such as those that employ a kinase and ATP.
  • the 3' end of a chemically synthesized oligonucleotide generally has a free hydroxyl group and, in the presence of a ligase, such as T4 DNA ligase, readily will form a phosphodiester bond with a 5' phosphate of another polynucleotide, such as another oligonucleotide. As is well known, this reaction can be prevented selectively, where desired, by removing the 5' phosphates of the other polynucleotide(s) prior to ligation.
  • a ligase such as T4 DNA ligase
  • PLASMIDS generally are designated herein by a lower case p preceded and/or followed by capital letters and/or numbers, in accordance with standard naming conventions that are familiar to those of skill in the art.
  • plasmids disclosed herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids by routine application of well known, published procedures.
  • Many plasmids and other cloning and expression vectors that can be used in accordance with the present invention are well known and readily available to those of skill in the art.
  • those of skill readily may construct any number of other plasmids suitable for use in the invention. The properties, construction and use of such plasmids, as well as other vectors, in the present invention will be readily apparent to those of skill from the present disclosure.
  • POLYNUCLEOTIDE(S) generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA.
  • polynucleotides as used herein refers to, among others, single-and double-stranded DNA, DNA that is a mixture of single-and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions.
  • polynucleotide as used herein refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA.
  • the strands in such regions may be from the same molecule or from different molecules.
  • the regions may include all of one or more of the molecules, but more typically involve only a region of some of the molecules.
  • One of the molecules of a triple-helical region often is an oligonucleotide.
  • polynucleotide includes DNAs or RNAs as described above that contain one or more modified bases.
  • DNAs or RNAs with backbones modified for stability or for other reasons are “polynucleotides” as that term is intended herein.
  • DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritylated bases, to name just two examples are polynucleotides as the term is used herein.
  • polynucleotide as it is employed herein embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including simple and complex cells, inter alia .
  • POLYPEPTIDES includes all polypeptides as described below.
  • the basic structure of polypeptides is well known and has been described in innumerable textbooks and other publications in the art.
  • the term is used herein to refer to any peptide or protein comprising two or more amino acids joined to each other in a linear chain by peptide bonds.
  • the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types.
  • polypeptides often contain amino acids other than the 20 amino acids commonly referred to as the 20 naturally occurring amino acids, and that many amino acids, including the terminal amino acids, may be modified in a given polypeptide, either by natural processes, such as processing and other post-translational modifications, but also by chemical modification techniques which are well known to the art. Even the common modifications that occur naturally in polypeptides are too numerous to list exhaustively here, but they are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature, and they are well known to those of skill in the art.
  • polypeptides of the present are, to name an illustrative few, acetylation, acylation, ADP-ribo ⁇ ylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cystine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolyticprocessing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as
  • polypeptides are not always entirely linear.
  • polypeptides may be branched as a result of ubiquitination, and they may be circular, with or without branching, generally as a result of posttranslation events, including natural processing event and events brought about by human manipulation which do not occur naturally.
  • Circular, branched and branched circular polypeptides may be synthesized by non-translation natural process and by entirely synthetic methods, as well. Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini.
  • blockage of the amino or carboxyl group in a polypeptide, or both, by a covalent modification is common in naturally occurring and synthetic polypeptides and such modifications may be present in polypeptides of the present invention, as well.
  • the amino terminal residue of polypeptides made in E. coli, prior to proteolytic processing almost invariably will be N-formylmethionine.
  • polypeptides made by expressing a cloned gene in a host for instance, the nature and extent of the modifications in large part will be determined by the host cell posttranslational modification capacity and the modification signals present in the polypeptide amino acid sequence.
  • glycosylation often does not occur in bacterial hosts such as E. coli. Accordingly, when glycosylation is desired, a polypeptide should be expressed in a glycosylating host, generally a eukaryotic cell.
  • Insect cell often carry out the same posttranslational glycosylations as mammalian cells and, for this reason, insect cell expression systems have been developed to express efficiently mammalian proteins having native patterns of glycosylation, inter alia . Similar considerations apply to other modifications.
  • polypeptide encompasses all such modifications, particularly those that are present in polypeptides synthesized by expressing a polynucleotide in a host cell.
  • VARIANT(S) of polynucleotides or polypeptides are polynucleotides or polypeptides that differ from a reference polynucleotide or polypeptide, respectively. Variants in this sense are described below and elsewhere in the present disclosure in greater detail.
  • a polynucleotide that differs in nucleotide sequence from another, reference polynucleotide Generally, differences are limited ⁇ o that the nucleotide sequences of the reference and the variant are closely similar overall and, in many regions, identical.
  • changes in the nucleotide sequence of the variant may be silent. That is, they may not alter the amino acids encoded by the polynucleotide. Where alterations are limited to silent changes of this type a variant will encode a polypeptide with the same amino acid sequence as the reference. Also as noted below, changes in the nucleotide sequence of the variant may alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide. Such nucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below.
  • a variant and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions, fusions and truncations, which may be present in any combination.
  • RECEPTOR MOLECULE refers to molecules which bind or interact specifically with hHSP polypeptides of the present invention, including not only classic receptors, which are preferred, but also other molecules that specifically bind to or interact with polypeptides of the invention (which also may be referred to as “binding molecules” and “interaction molecules,” respectively and as “hHSP binding molecules” and “hHSP interaction molecules.
  • Binding between polypeptides of the invention and such molecules, including receptor or binding or interaction molecules may be exclusive to polypeptides of the invention, which is very highly preferred, or it may be highly specific for polypeptides of the invention, which is highly preferred, or it may be highly specific to a group of proteins that includes polypeptides of the invention, which is preferred, or it may be specific to several groups of proteins at least one of which includes polypeptides of the invention.
  • Receptors also may be non-naturally occurring, such as antibodies and antibody-derived reagents that bind specifically to polypeptides of the invention.
  • the present invention relates to novel hHSP polypeptides and polynucleotides, among other things, as described in greater detail below.
  • the invention relates to polypeptides and polynucleotides of a novel human hHSP.
  • the invention relates especially to hHSP having the nucleotide and amino acid sequences set out in Figure 1 (SEQ ID NO:l and 2) , and to the hHSP nucleotide and amino acid sequences of the human cDNA in the deposited clone, which is hereinafter described.
  • nucleotide and amino acid sequences set out in Figure l were obtained by sequencing the human cDNA of the deposited clone.
  • sequence of the deposited clone is controlling as to any discrepancies between the two and any reference to the sequence of Figure 1 (SEQ ID N0:1) includes reference to the sequence of the human cDNA of the deposited clone.
  • isolated polynucleotides that encode the hHSP polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) .
  • a polynucleotide of the present invention encoding a human hHSP polypeptide may be obtained using standard cloning and screening procedures, such as those for cloning cDNAs using mRNA from cells of human tissue as starting material.
  • standard cloning and screening procedures such as those for cloning cDNAs using mRNA from cells of human tissue as starting material.
  • the polynucleotide set out in Figure 1 (SEQ ID N0:1) was discovered in a cDNA library derived from cells of a human B cell lymphoma.
  • the hHSP sequence was determined by sequencing the human cDNA encoding human hHSP in the deposited clone.
  • the human cDNA sequence thus obtained is set out in Figure 1 (SEQ ID N0:1) . It contains an open reading frame encoding a protein of about 189 amino acid residues, with a putative leader of 22 amino acids such that the mature protein comprises 167 amino acids.
  • hHSP has a deduced molecular weight of about 21 kDa. The protein is specifically expressed in the thymus and hematopoietic tissues.
  • Polynucleotides of the present invention may be in the form of RNA, such as mRNA, or in the form of DNA, including, for instance, cDNA and genomic DNA obtained by cloning or produced by chemical synthetic techniques or by a combination thereof.
  • the DNA may be double-stranded or single-stranded.
  • Single-stranded DNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the anti-sense strand.
  • the coding sequence which encodes the polypeptide may be identical to the coding sequence of the polynucleotide shown in Figure 1 (SEQ ID NO:l) . It also may be a polynucleotide with a different sequence, which, as a result of the redundancy (degeneracy) of the genetic code, encodes the polypeptide of the DNA of Figure 1 (SEQ ID NO:l) .
  • Polynucleotides of the present invention which encode the polypeptide of Figure 1 may include, but are not limited to the coding sequence for the mature polypeptide, by itself; the coding sequence for the mature polypeptide and additional coding sequences, such as those encoding a leader or secretory sequence, such as a pre-, or pro- or prepro- protein sequence; the coding sequence of the mature polypeptide, with or without the aforementioned additional coding sequences, together with additional, non-coding sequences, including for example, but not limited to introns and non-coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription, mRNA processing - including splicing and polyadenylation signals, for example - ribosome binding and stability of mRNA; additional coding sequence which codes for additional amino acids, such as those which provide additional functionalities.
  • the polypeptide may be fused to a marker sequence, such as a peptide, which facilitates purification of the fused polypeptide.
  • the marker sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (Qiagen, Inc.) , among others, many of which are commercially available.
  • hexa-histidine provides for convenient purification of the fusion protein.
  • the HA tag corresponds to an epitope derived of influenza hemagglutinin protein, which has been described by Wilson et al., Cell 37: 767 (1984) , for instance.
  • polynucleotide encoding a polypeptide encompasses polynucleotides which include a sequence encoding a polypeptide of the present invention, particularly the human hHSP having the amino acid sequence set out in Figure l (SEQ ID NO:2) .
  • the term encompasses polynucleotides that include a single continuous region or discontinuous regions encoding the polypeptide (for example, interrupted by introns) together with additional region ⁇ .
  • the present invention further relates to variants of the herein above described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) .
  • a variant of the polynucleotide may be a naturally occurring variant such as a naturally occurring allelic variant, or it may be a variant that is not known to occur naturally.
  • Such non-naturally occurring variants of the polynucleotide may be made by mutagenesis techniques, including those applied to polynucleotides, cells or organisms.
  • variants in this regard are variants that differ from the aforementioned polynucleotides by nucleotide substitutions, deletions or additions.
  • the substitutions, deletions or additions may involve one or more nucleotides.
  • the variants may be altered in coding or non-coding regions or both. Alterations in the coding region ⁇ may produce con ⁇ ervative or non-con ⁇ ervative amino acid substitutions, deletions or additions.
  • polypeptides having the amino acid sequence of hHSP set out in Figure 1 SEQ ID NO:2
  • variants, analogs, derivatives and fragments thereof SEQ ID NO:2
  • fragments of the variants, analogs and derivatives SEQ ID NO:2
  • polynucleotides having nucleotides in excess of the polynucleotide of SEQ ID NO:l which encode polypeptides which are larger than the polypeptides shown in Figure 1 (SEQ ID NO:2) ; variants, analogues, derivatives and fragments thereof, and fragments of the variants, analogues and derivatives.
  • polynucleotides encoding hHSP variants, analogs, derivatives and fragments, and variants, analogs and derivatives of the fragments which have the amino acid sequence of the hHSP polypeptide of Figure 1 (SEQ ID NO:2) in which several, a few, 5 to 10, 1 to 5, l to 3, 2, l or no amino acid residues are substituted, deleted or added, in any combination.
  • silent substitutions, additions and deletions which do not alter the properties and activities of the hHSP.
  • conservative substitutions are also especially preferred in this regard.
  • polynucleotides that are at least 70% identical to a polynucleotide encoding the hHSP polypeptide having the amino acid sequence set out in Figure 1 (SEQ ID NO:2) , and polynucleotides which are complementary to such polynucleotides.
  • polynucleotides that comprise a region that is at least 80% identical to a polynucleotide encoding the hHSP polypeptide and polynucleotides complementary thereto.
  • polynucleotides at least 90% identical to the same are particularly preferred, and among these particularly preferred polynucleotides, those with at least 95% are especially preferred.
  • those with at least 97% are highly preferred among those with at least 95%, and among these those with at least 98% and at least 99% are particularly highly preferred, with at least 99% being the more preferred.
  • Particularly preferred embodiments in this respect are polynucleotides which encode polypeptides which retain substantially the same biological function or activity as the mature polypeptide encoded by the human cDNA of Figure l (SEQ ID NO:l) .
  • the present invention further relates to polynucleotides that hybridize to the herein above-described sequences.
  • the present invention especially relates to polynucleotides which hybridize under stringent conditions to the herein above-described polynucleotides.
  • stringent conditions means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.
  • polynucleotides of the invention may be used as a hybridization probe for cDNA and genomic DNA to isolate full-length cDNAs and genomic clones encoding hHSP and to isolate cDNA and genomic clones of other genes that have a high sequence similarity to the human hHSP gene.
  • Such probes generally will comprise at least 15 bases.
  • such probes will have at least 30 bases and may have at least 50 bases.
  • Particularly preferred probes will have at least 30 bases and will have 50 bases or less.
  • the coding region of the hHSP gene may be isolated by screening using the known DNA sequence to synthesize an oligonucleotide probe.
  • a labeled oligonucleotide having a sequence complementary to that of a gene of the present invention is then used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
  • polynucleotides and polypeptides of the present invention may be employed as research reagents and materials for discovery of treatments and diagnostics to human disease, as further discussed herein relating to polynucleotide assays, inter alia.
  • the polynucleotides may encode a polypeptide which is the mature protein plus additional amino or carboxyl-terminal amino acids, or amino acids interior to the mature polypeptide (when the mature form has more than one polypeptide chain, for instance) .
  • Such sequences may play a role in processing of a protein from precursor to a mature form, may facilitate protein trafficking, may prolong or shorten protein half-life or may facilitate manipulation of a protein for assay or production, among other things.
  • the additional amino acids may be processed away from the mature protein by cellular enzymes.
  • a precursor protein, having the mature form of the polypeptide fused to one or more prosequences may be an inactive form of the polypeptide.
  • inactive precursors When prosequences are removed such inactive precursors generally are activated. Some or all of the prosequences may be removed before activation. Generally, such precursors are called proproteins.
  • a polynucleotide of the present invention may encode a mature protein, a mature protein plus a leader sequence (which may be referred to as a preprotein) , a precursor of a mature protein having one or more prosequences which are not the leader sequences of a preprotein, or a preproprotein, which is a precursor to a proprotein, having a leader sequence and one or more prosequences, which generally are removed during processing steps that produce active and mature forms of the polypeptide.
  • a leader sequence which may be referred to as a preprotein
  • a preproprotein which is a precursor to a proprotein, having a leader sequence and one or more prosequences, which generally are removed during processing steps that produce active and mature forms of the polypeptide.
  • a deposit containing a human hHSP cDNA has been deposited with the American Type Culture Collection, as noted above. Also as noted above, the cDNA deposit is referred to herein as "the deposited clone" or as "the cDNA of the deposited clone.”
  • the deposited clone was deposited with the American Type Culture Collection, 12301 Park Lawn Drive, Rockville, Maryland 20852, USA, on March 1, 1996 and assigned ATCC Deposit No. 97455.
  • the deposited material is a pBluescript SK (-) plasmid (Stratagene, La Jolla, CA) that contains the human cDNA of Figure 1 (SEQ ID N0:1) .
  • sequence of the polynucleotides contained in the deposited material, as well as the amino acid sequence of the polypeptide encoded thereby, are controlling in the event of any conflict with any description of sequences herein.
  • a license may be required to make, use or sell the deposited materials, and no such license is hereby granted.
  • Polypeptides The present invention further relates to a human hHSP polypeptide which has the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) .
  • the invention also relates to fragments, analogs and derivatives of these polypeptides.
  • fragment when referring to the polypeptide of Figure 1 (SEQ ID NO:2) means a polypeptide which retains essentially the same or similar activity as such polypeptide.
  • an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide. In certain preferred embodiments it is a recombinant polypeptide.
  • the fragment, derivative or analog of the polypeptide of Figure 1 may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non- conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol) , (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence or (v) one in which the mature polypeptide comprises additional amino acids.
  • Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein
  • particularly preferred embodiments of the invention in this regard are polypeptides having the amino acid sequence of hHSP set out in Figure 1 (SEQ ID NO:2) , variants, analogs, derivatives and fragments thereof, and variants, analogs and derivatives of the fragments.
  • particularly preferred embodiments of the invention in this regard are polypeptides having the amino acid sequence of the hHSP of the cDNA in the deposited clone, variants, analogs, derivatives and fragments thereof, and variants, analogs and derivatives of the fragments.
  • substitutions are those that vary from a reference by conservative amino acid substitutions. Such substitutions are those that substitute a given amino acid in a polypeptide by another amino acid of like characteristics. Typically seen as conservative substitutions are the replacements, one for another, among the aliphatic amino acids Ala, Val, Leu and lie; interchange of the hydroxyl residues Ser and Thr, exchange of the acidic residues Asp and Glu, substitution between the amide residues Asn and Gin, exchange of the basic residues Lys and Arg and replacements among the aromatic residues Phe, Tyr.
  • variants, analogs, derivatives and fragments, and variants, analogs and derivatives of the fragments having the amino acid sequence of the hHSP polypeptide of Figure 1 (SEQ ID NO:2) in which several, a few, 5 to 10, 1 to 5, 1 to 3, 2, 1 or no amino acid residues are substituted, deleted or added, in any combination.
  • silent substitutions, additions and deletions which do not alter the properties and activities of the hHSP.
  • conservative substitutions are also especially preferred in this regard.
  • polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
  • polypeptides of the present invention also include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) as well as polypeptides which have at least 70% similarity (preferably at least 70% identity) to the polypeptide of SEQ ID NO:2 and more preferably at least 90% similarity (more preferably at least 90% identity) to the polypeptide of SEQ ID NO:2 and still more preferably at least 95% similarity (still more preferably at least 95% identity) to the polypeptide of SEQ ID NO:2 and also include portions of such polypeptides with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.
  • similarity between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide.
  • Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full- length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. Fragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides of the present invention.
  • polypeptides comprising fragments of hHSP, most particularly fragments of the hHSP having the amino acid set out in Figure 1 (SEQ ID NO:2) , and fragments of variants and derivatives of the hHSP of Figure l (SEQ ID NO:2) .
  • a fragment is a polypeptide having an amino acid sequence that entirely is the same as part but not all of the amino acid sequence of the aforementioned hHSP polypeptides and variants or derivatives thereof.
  • fragments may be "free-standing,” i.e., not part of or fused to other amino acids or polypeptides, or they may be comprised within a larger polypeptide of which they form a part or region.
  • the presently discussed fragments most preferably form a single continuous region.
  • several fragments may be comprised within a single larger polypeptide.
  • certain preferred embodiments relate to a fragment of a hHSP polypeptide of the present comprised within a precursor polypeptide designed for expression in a host and having heterologous pre and pro- polypeptide regions fused to the amino terminus of the hHSP fragment and an additional region fused to the carboxyl terminus of the fragment.
  • fragments in one aspect of the meaning intended herein refers to the portion or portions of a fusion polypeptide or fusion protein derived from hHSP.
  • polypeptide fragments of the invention there may be mentioned those which have from about 22 to about 189 amino acids.
  • about 22 amino acids in this context means a polypeptide fragment of 22 plus or minus several, a few, 5, 4, 3, 2 or 1 amino acids to 189 plus or minus several a few, 5, 4, 3, 2 or 1 amino acid residues, i.e., ranges as broad as 22 minus several amino acids to 189 plus several amino acids to as narrow as 20 plus several amino acids to 50 minus several amino acids.
  • Truncation mutants include hHSP polypeptides having the amino acid sequence of Figure 1 (SEQ ID NO:2) , or of variants or derivatives thereof, except for deletion of a continuous series of residues (that is, a continuous region, part or portion) that includes the amino terminus, or a continuous series of residues that includes the carboxyl terminus or, as in double truncation mutants, deletion of two continuous series of residues, one including the amino terminus and one including the carboxyl terminus.
  • Fragments having the size range ⁇ ⁇ et out about also are preferred embodiments of truncation fragments, which are especially preferred among fragments generally.
  • fragments characterized by structural or functional attributes of hHSP are fragments characterized by structural or functional attributes of hHSP.
  • Preferred embodiments of the invention in this regard include fragments that comprise alpha-helix and alpha-helix forming regions ("alpha-regions”) , beta-sheet and beta-sheet-forming regions (“beta-regions”) , turn and turn-forming regions (“tur -regions”) , coil and coil-forming regions (“coil-regions”) , hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions and high antigenic index region ⁇ of hHSP.
  • Certain preferred regions in these regards are set out in Figure 2, and include, but are not limited to, region ⁇ of the aforementioned types identified by analysis of the amino acid sequence set out in Figure 1 (SEQ ID NO:2) .
  • such preferred regions include Gamier-Robson alpha-regions, beta-region ⁇ , turn-regions and coil-regions, Chou-Fasman alpha- region ⁇ , beta-regions and turn-regions, Kyte-Doolittle hydrophilic regions and hydrophilic region ⁇ , Eisenberg alpha and beta amphipathic regions, Karplus-Schulz flexible regions, Emini surface-forming regions and Jameson-Wolf high antigenic index regions.
  • fragments in this regard are those that comprise regions of hHSP that combine several structural features, such as several of the features set out above.
  • the regions defined by the residues about 20 to 25, 30 to 40, 80 to 100, 120 to 140, 150 to 180, and 180 to 189 amino acids of Figure 1 (SEQ ID NO:2) which all are characterized by amino acid compositions highly characteristic of turn-regions, hydrophilic regions, flexible-regions, surface-forming regions, and high antigenic index-regions, are especially highly preferred regions.
  • Such regions may be comprised within a larger polypeptide or may be by themselves a preferred fragment of the present invention, as discussed above. It will be appreciated that the term "about” as used in this paragraph has the meaning set out above regarding fragments in general.
  • fragments that mediate activities of hHSP are those that mediate activities of hHSP.
  • fragments that have a chemical, biological or other activity of hHSP including those with a similar activity or an improved activity, or with a decreased undesirable activity.
  • truncation mutants as discussed above.
  • the invention also relates to, among others, polynucleotides encoding the aforementioned fragments, polynucleotides that hybridize to polynucleotides encoding the fragments, particularly those that hybridize under stringent conditions, and polynucleotides, such as PCR primers, for amplifying polynucleotides that encode the fragments.
  • preferred polynucleotides are those that correspondent to the preferred fragments, as discussed above.
  • the present invention also relates to vectors which include polynucleotides of the present invention, host cells •which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
  • Host cells can be genetically engineered to incorporate polynucleotides and express polypeptides of the present invention.
  • polynucleotides may be introduced into host cells using well known techniques of infection, transduction, transfection, transvection and transformation.
  • the polynucleotides may be introduced alone or with other polynucleotides.
  • Such other polynucleotides may be introduced independently, co-introduced or introduced joined to the polynucleotides of the invention.
  • polynucleotides of the invention may be transfected into host cells with another, separate, polynucleotide encoding a selectable marker, using standard techniques for co ⁇ transfection and selection in, for instance, mammalian cells.
  • the polynucleotides generally will be stably incorporated into the host cell genome.
  • the polynucleotides may be joined to a vector containing a selectable marker for propagation in a host.
  • the vector construct may be introduced into host cells by the aforementioned techniques.
  • a plasmid vector is introduced as DNA in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid.
  • Electroporation also may be used to introduce polynucleotides into a host. If the vector is a virus, it may be packaged in vitro or introduced into a packaging cell and the packaged virus may be transduced into cells.
  • the vector may be, for example, a plasmid vector, a single or double-stranded phage vector, a single or double-stranded RNA or DNA viral vector.
  • Such vectors may be introduced into cells as polynucleotides, preferably DNA, by well known techniques for introducing DNA and RNA into cells.
  • the vectors in the case of phage and viral vectors also may be and preferably are introduced into cells as packaged or encapsidated virus by well known techniques for infection and transduction.
  • Viral vectors may be replication competent or replication defective. In the latter case viral propagation generally will occur only in complementing host cells.
  • vectors in certain respect ⁇ , are tho ⁇ e for expression of polynucleotides and polypeptides of the present invention.
  • such vectors comprise cis-acting control regions effective for expression in a host operatively linked to the polynucleotide to be expressed.
  • Appropriate trans-acting factors either are supplied by the host, supplied by a complementing vector or supplied by the vector itself upon introduction into the host.
  • the vectors provide for specific expression.
  • Such specific expression may be inducible expression or expression only in certain types of cells or both inducible and cell-specific.
  • Particularly preferred among inducible vectors are vectors that can be induced for expression by environmental factors that are easy to manipulate, such as temperature and nutrient additives.
  • a variety of vectors suitable to this aspect of the invention, including constitutive and inducible expression vectors for use in prokaryotic and eukaryotic hosts, are well known and employed routinely by those of skill in the art.
  • the engineered host cells can be cultured in conventional nutrient media, which may be modified as appropriate for, inter alia, activating promoters, selecting transformants or amplifying genes. Culture conditions, such as temperature, pH and the like, previously used with the host cell selected for expression generally will be suitable for expression of polypeptides of the present invention as will be apparent to tho ⁇ e of skill in the art. A great variety of expres ⁇ ion vectors can be used to express a polypeptide of the invention.
  • Such vectors include chromosomal, episomal and virus-derived vectors e.g., vectors derived from bacterial plasmids, from bacteriophage, from yeast episome ⁇ , from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabie ⁇ viruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids, all may be used for expression in accordance with this aspect of the present invention.
  • any vector suitable to maintain, propagate or express polynucleotides to express a polypeptide in a host may be used for expres ⁇ ion in this regard.
  • the appropriate DNA sequence may be inserted into the vector by any of a variety of well-known and routine techniques.
  • a DNA sequence for expression is joined to an expression vector by cleaving the DNA sequence and the expression vector with one or more restriction endonucleases and then joining the restriction fragments together using T4 DNA ligase.
  • Procedures for restriction and ligation that can be used to this end are well known and routine to those of skill. Suitable procedures in this regard, and for constructing expression vectors using alternative techniques, which also are well known and routine to those skill, are set forth in great detail in Sambrook et al. cited elsewhere herein.
  • the DNA sequence in the expression vector is operatively linked to appropriate expression control sequence(s), including, for instance, a promoter to direct mRNA transcription.
  • appropriate expression control sequence(s) including, for instance, a promoter to direct mRNA transcription.
  • promoters include the phage lambda PL promoter, the E. coli lac, trp and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name just a few of the well-known promoters. It will be understood that numerous promoters not mentioned are suitable for use in this aspect of the invention are well known and readily may be employed by those of skill in the manner illustrated by the discussion and the examples herein.
  • expression constructs will contain sites for transcription initiation and termination, and, in the transcribed region, a ribosome binding site for translation.
  • the coding portion of the mature transcripts expres ⁇ ed by the constructs will include a translation initiating AUG at the beginning and a termination codon appropriately positioned at the end of the polypeptide to be translated.
  • constructs may contain control regions that regulate as well as engender expression.
  • control regions that regulate as well as engender expression.
  • such regions will operate by controlling transcription, such as repressor binding sites and enhancers, among others.
  • Vectors for propagation and expression generally will include selectable markers. Such markers also may be suitable for amplification or the vectors may contain additional markers for this purpose.
  • the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells.
  • Preferred markers include dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, and tetracycline, theomycin, kanamycin or ampicillin resistance genes for culturing E. coli and other bacteria.
  • the vector containing the appropriate DNA sequence as described elsewhere herein, as well as an appropriate promoter, and other appropriate control sequences, may be introduced into an appropriate host using a variety of well known techniques suitable to expression therein of a desired polypeptide.
  • appropriate hosts include bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells,- insect cells such as Drosophila S2 and Spodoptera Sf9 cells,- animal cells such as CHO, COS and Bowes melanoma cells,- and plant cells.
  • Hosts for of a great variety of expression constructs are well known, and those of skill will be enabled by the present disclosure readily to select a host for expressing a polypeptides in accordance with this aspect of the present invention.
  • Various mammalian cell culture systems can be employed for expres ⁇ ion, as well. Examples of mammalian expression sy ⁇ tems include the COS-7 lines of monkey kidney fibroblast, described in Gluzman et al., Cell 23: 175 (1981).
  • Other cell lines capable of expressing a compatible vector include for example, the C127, 3T3, CHO, HeLa, human kidney 293 and BHK cell lines.
  • the present invention also includes recombinant constructs, such as expres ⁇ ion con ⁇ tructs, comprising one or more of the sequences described above.
  • the constructs comprise a vector, such a ⁇ a pla ⁇ mid or viral vector, into which such a sequence of the invention has been inserted.
  • the sequence may be inserted in a forward or reverse orientation.
  • the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and there are many commercially available vectors suitable for use in the present invention.
  • vectors which are commercially available, are provided by way of example.
  • vectors preferred for use in bacteria are pQE70, pQE60 and pQE-9, available from Qiagen,- pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNH16a, pNH18A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia.
  • eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. These vectors are listed solely by way of illustration of the many commercially available and well known vectors that are available to those of skill in the art for use in accordance with this aspect of the present invention. It will be appreciated that any other plasmid or vector suitable for, for example, introduction, maintenance, propagation or expression of a polynucleotide or polypeptide of the invention in a host may be used in this aspect of the invention.
  • Promoter regions can be selected from any desired gene using vectors that contain a reporter transcription unit lacking a promoter region, such as a chloramphenicol acetyl transferase
  • promoters for expression of polynucleotides of the present invention include not only well known and readily available promoters, but also promoters that readily may be obtained by the foregoing technique, using a reporter gene.
  • bacterial promoters suitable for expression of polynucleotides and polypeptides in accordance with the present invention are the E. coli lad and lacZ promoters, the T3 and T7 promoters, the T5 tac promoter, the lambda PR, PL promoters and the trp promoter.
  • known eukaryotic promoters suitable in this regard are the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, the promoters of retroviral LTRs, such as those of the Rous sarcoma virus ("RSV”) , and metallothionein promoters, such as the mouse metallothionein-I promoter.
  • recombinant expression vectors will include origins of replication, a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence, and a selectable marker to permit isolation of vector containing cells after exposure to the vector.
  • the present invention also relates to host cells containing the above-described constructs discussed above.
  • the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
  • Constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.
  • the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
  • Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.
  • Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) .
  • Enhancers are cis- acting elements of DNA, usually about from 10 to 300 bp that act to increase transcriptional activity of a promoter in a given host cell-type.
  • enhancers include the SV40 enhancer, which is located on the late side of the replication origin at bp 100 to 270, the cytomegaloviru ⁇ early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • Polynucleotides of the invention encoding the heterologou ⁇ structural sequence of a polypeptide of the invention generally will be inserted into the vector using standard techniques so that it is operably linked to the promoter for expres ⁇ ion.
  • the polynucleotide will be positioned so that the transcription start site is located appropriately 5' to a ribo ⁇ ome binding ⁇ ite.
  • the ribo ⁇ ome binding site will be 5' to the AUG that initiates tran ⁇ lation of the polypeptide to be expressed.
  • secretion signals may be incorporated into the expressed polypeptide.
  • the signals may be endogenous to the polypeptide or they may be heterologous signals.
  • the polypeptide may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals but also additional heterologous functional regions.
  • a region of additional amino acids, particularly charged amino acids may be added to the N-terminus of the polypeptide to improve stability and persistence in the host cell, during purification or during subsequent handling and storage.
  • region also may be added to the polypeptide to facilitate purification. Such region ⁇ may be removed prior to final preparation of the polypeptide.
  • the addition of peptide moieties to polypeptides to engender secretion or excretion, to improve stability and to facilitate purification, among others, are familiar and routine techniques in the art.
  • Cells typically then are harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.
  • Microbial cell ⁇ employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well known to those skilled in the art.
  • the hHSP polypeptide can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography ("HPLC") is employed for purification. Well known technique ⁇ for refolding protein may be employed to regenerate active conformation when the polypeptide is denatured during isolation and or purification.
  • HPLC high performance liquid chromatography
  • Polypeptides of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher p l ant, insect and mammalian cells. Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non- glycosylated. In addition, polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes.
  • hHSP polynucleotides and polypeptides may be used in accordance with the present invention for a variety of applications, particularly those that make use of the chemical and biological properties of hHSP. Among these are applications in immune regulation. Additional applications related to diagnosi ⁇ and to treatment of disorders of cells, tissues and organisms. These aspects of the invention are illustrated further by the following discus ⁇ ion.
  • This invention is also related to the use of the hHSP polynucleotides to detect complementary polynucleotides such as, for example, as a diagnostic reagent. Detection of a mutated form of hHSP associated with " a dysfunction will provide a diagnostic tool that can add or define a diagnosis of a disease or su ⁇ ceptibility to a di ⁇ ea ⁇ e which results from under-expression over-expression or altered expression of hHSP, such as, for example, immune disorders.
  • Nucleic acids for diagnosi ⁇ may be obtained from a patient' ⁇ cells, such as from blood, urine, saliva, tissue biopsy and autopsy material.
  • the genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR prior to analysis. PCR (Saiki et al., Nature, 324: 163-166 (1986)) .
  • RNA or cDNA may also be used in the same ways.
  • PCR primers complementary to the nucleic acid encoding hHSP can be used to identify and analyze hHSP expres ⁇ ion and mutations.
  • deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype.
  • Point mutations can be identified by hybridizing amplified DNA to radiolabeled hHSP RNA or alternatively, radiolabeled hHSP antisense DNA sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures.
  • Sequence difference ⁇ between a reference gene and genes having mutations also may be revealed by direct DNA sequencing.
  • cloned DNA segment ⁇ may be employed a ⁇ probes to detect specific DNA segments.
  • the sensitivity of such methods can be greatly enhanced by appropriate use of PCR or another amplification method.
  • a sequencing primer is used with double- stranded PCR product or a single-stranded template molecule generated by a modified PCR.
  • the sequence determination is performed by conventional procedures with radiolabeled nucleotide or by automatic sequencing procedures with fluorescent-tag ⁇ .
  • DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels, with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al., Science, 230: 1242 (1985)).
  • Sequence changes at specific locations also may be revealed by nuclease protection assays, such as RNase and SI protection or the chemical cleavage method (e.g., Cotton et al., Proc. Natl. Acad. Sci., USA, 85: 4397-4401 (1985)).
  • nuclease protection assays such as RNase and SI protection or the chemical cleavage method (e.g., Cotton et al., Proc. Natl. Acad. Sci., USA, 85: 4397-4401 (1985)).
  • the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e.g., restriction fragment length polymorphisms ("RFLP”) and Southern blotting of genomic DNA.
  • restriction enzymes e.g., restriction fragment length polymorphisms ("RFLP") and Southern blotting of genomic DNA.
  • mutations also can be detected by in situ analysis.
  • sequences of the present invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
  • Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location.
  • the mapping of DNAs to chromosome ⁇ according to the present invention is an important first step in correlating those sequences with genes associated with disease.
  • the cDNA herein disclosed is used to clone genomic DNA of a hHSP gene. This can be accomplished using a variety of well known techniques and libraries, which generally are available commercially.
  • the genomic DNA the is used for in situ chromosome mapping using well known techniques for this purpose.
  • some trial and error may be neces ⁇ ary to identify a genomic probe that give ⁇ a good in ⁇ itu hybridization signal.
  • ⁇ equence ⁇ can be mapped to chromo ⁇ ome ⁇ by preparing PCR primer ⁇ (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.
  • mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
  • sublocalization can be achieved with panels of fragments from specific chromosome ⁇ or pools of large genomic clones in an analogous manner.
  • Other mapping strategie ⁇ that can ⁇ imilarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosome ⁇ and preselection by hybridization to construct chromosome specific-cDNA libraries.
  • Fluorescence in ⁇ itu hybridization of a cDNA clone to a metapha ⁇ e chromosomal spread can be used to provide a precise chromosomal location in one step.
  • This technique can be used with cDNA as short as 50 or 60 bases.
  • Verma et al. HUMAN CHROMOSOMES: A MANUAL OF BASIC TECHNIQUES, Pergamon Press, New York (1988) .
  • the phy ⁇ ical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V.
  • McKusick, MENDELIAN INHERITANCE IN MAN available on line through Johns Hopkins University, Welch Medical Library.
  • the relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes) .
  • a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This as ⁇ umes l megabase mapping resolution and one gene per 20 kb) .
  • the present invention also relates to a diagnostic assays such as quantitative and diagnostic assays for detecting levels of hHSP protein in cells and ti ⁇ ues, including determination of normal and abnormal levels.
  • a diagnostic assay in accordance with the invention for detecting over-expression of hHSP protein compared to normal control tissue samples may be used to detect the presence of immune disorders, for example.
  • Assay techniques that can be used to determine levels of a protein, such as an hHSP protein of the present invention, in a sample derived from a host are well-known to those of skill in the art.
  • Such assay methods include radioimmunoassays, competitive-binding assays, Western Blot analysis and ELISA assay ⁇ .
  • An ELISA assay initially comprises preparing an antibody specific to hHSP, preferably a monoclonal antibody.
  • a reporter antibody generally is prepared which binds to the monoclonal antibody.
  • the reporter antibody is attached a detectable reagent such as radioactive, fluorescent or enzymatic reagent, in this example horseradish peroxidase enzyme.
  • a sample is removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin.
  • the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any hHSP proteins attached to the polystyrene dish. Unbound monoclonal antibody i ⁇ washed out with buffer.
  • the reporter antibody linked to horseradish peroxidase is placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to hHSP. Unattached reporter antibody is then washed out.
  • Reagents for peroxidase activity, including a colorimetric substrate are then added to the dish. Immobilized peroxidase, linked to hHSP through the primary and secondary antibodies, produces a colored reaction product. The amount of color developed in a given time period indicates the amount of hHSP protein present in the sample. Quantitative results typically are obtained by reference to a standard curve.
  • a competition assay may be employed wherein antibodies specific to hHSP attached to a solid support and labeled hHSP and a sample derived from the host are passed over the solid support and the amount of label detected attached to the solid support can be correlated to a quantity of hHSP in the sample.
  • polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto.
  • These antibodies can be, for example, polyclonal or monoclonal antibodies.
  • the present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
  • Antibodies generated again ⁇ t the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptide ⁇ to an animal, preferably a nonhuman.
  • the antibody ⁇ o obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptide ⁇ .
  • Such antibodies can then be used to isolate the polypeptide from tis ⁇ ue expre ⁇ ing that polypeptide.
  • any technique which provide ⁇ antibodie ⁇ produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler, G. and Milstein, C. , Nature 256: 495-497 (1975), the trioma technique, the human B cell hybridoma technique (Kozbor et al., Immunology Today 4: 72 (1983) and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., pg. 77-96 in MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R. Lis ⁇ , Inc. (1985).
  • the above-described antibodies may be employed to isolate or to identify clones expressing the polypeptide or purify the polypeptide of the present invention by attachment of the antibody to a solid support for isolation and/or purification by affinity chromatography.
  • hHSP plays a role in the immune response by regulating the differentiation and maturation of cells of the immune system, specifically progenitor cells which originate in the thymus, for example T cells, and cell ⁇ of hematopoietic origin and which therefore may be employed to treat and/or prevent auto-immune disorders, graft rejection, provide defense against malignant cells, viral infection, fungal infection and bacteria.
  • This invention also provides a method for identification of molecules, such as receptor molecules, that bind hHSP.
  • Genes encoding proteins that bind hHSP, such as receptor proteins can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting. Such methods are described in many laboratory manuals such as, for instance, Coligan et al., Current Protocols in Immunology 1(2): Chapter 5 (1991) . For instance, expression cloning may be employed for this purpose.
  • polyadenylated RNA is prepared from a cell responsive to hHSP, a cDNA library is created from this RNA, the library is divided into pools and the pools are transfected individually into cells that are not responsive to hHSP.
  • hHSP can be labeled by a variety of well-known techniques including standard method ⁇ of radio-iodination or inclu ⁇ ion of a recognition ⁇ ite for a site- ⁇ pecific protein kinase.
  • the cells are fixed and binding of hHSP is determined. These procedures conveniently are carried out on glass slide ⁇ .
  • Pools are identified of cDNA that produced hHSP-binding cells. Sub-pools are prepared from these positives, transfected into host cells and screened as described above. Using an iterative sub- pooling and re-screening process, plasmids containing one or more single clones that encode the putative binding molecule, such as a receptor molecule, can be isolated and the clones are sequenced.
  • a labeled ligand can be photoaffinity linked to a cell extract, such as a membrane or a membrane extract, prepared from cells that express a molecule that it binds, such as a receptor molecule.
  • Cross-linked material is resolved by polyacrylamide gel electrophoresis ("PAGE") and exposed to X-ray film.
  • PAGE polyacrylamide gel electrophoresis
  • the labeled complex containing the ligand-receptor can be excised, resolved into peptide fragments, and subjected to protein microsequencing.
  • the amino acid sequence obtained from microsequencing can be used to design unique or degenerate oligonucleotide probes to screen cDNA libraries to identify genes encoding the putative receptor molecule.
  • Polypeptides of the invention also can be used to assess hHSP binding capacity of hHSP binding molecules, such a ⁇ receptor molecule ⁇ , in cells or in cell-free preparations.
  • Agonists and antagonists - assays and molecules The invention also provides a method of screening compounds to identify those which enhance or block the action of hHSP on cells, such as its interaction with hHSP-binding molecules such as receptor molecules.
  • An agonist is a compound which increases the natural biological functions of hHSP or which functions in a manner similar to hHSP, while antagonists decrease or eliminate such functions.
  • An example of such a method includes the yeast 2-hybrid assay.
  • a cellular compartment such as a membrane or a preparation thereof, such as a membrane-preparation, may be prepared from a cell that expresses a molecule that binds hHSP, such as a molecule of a signaling or regulatory pathway modulated by hHSP.
  • the preparation is incubated with labeled hHSP in the absence or the presence of a candidate molecule which may be a hHSP agonist or antagonist.
  • the ability of the candidate molecule to bind the binding molecule is reflected in decreased binding of the labeled ligand.
  • Molecules which bind gratuitously, i.e., without inducing the effects of hHSP on binding the hHSP binding molecule are most likely to be good antagonists. Molecules that bind well and elicit effects that are the same as or closely related to hHSP, are good agonists. hHSP-like effects of potential agonists and antagonists may by measured, for instance, by determining activity of a second messenger sy ⁇ tem following interaction of the candidate molecule with a cell or appropriate cell preparation, and comparing the effect with that of hHSP or molecules that elicit the same effects as hHSP. Second messenger systems that may be useful in this regard include but are not limited to AMP guanylate cyclase, ion channel or phosphoinositide hydrolysis second messenger systems.
  • hHSP antagonists are a competitive assay that combines hHSP and a potential antagonist with membrane-bound hHSP receptor molecules or recombinant hHSP receptor molecule ⁇ under appropriate conditions for a competitive inhibition assay.
  • hHSP can be labeled, such as by radioactivity, such that the number of hHSP molecules bound to a receptor molecule can be determined accurately to assess the effectiveness of the potential antagonist.
  • Potential antagonists include small organic molecules, peptides, polypeptides and antibodies that bind to a polypeptide of the invention and thereby inhibit or extinguish its activity. Potential antagonists also may be small organic molecules, a peptide, a polypeptide such as a closely related protein or antibody that binds the same ⁇ ites on a binding molecule, such as a receptor molecule, without inducing hHSP-induced activities, thereby preventing the action of hHSP by excluding hHSP from binding.
  • Antisense technology can be used to control gene expression through antisense DNA or RNA or through triple-helix formation.
  • Anti ⁇ en ⁇ e techniques are discussed, for example, in - Okano, J. Neurochem. 56: 560 (1991); OLIGODEOXYNUCLEOTIDES AS ANTISENSE INHIBITORS OF GENE EXPRESSION, CRC Press, Boca Raton, FL (1988) .
  • Triple helix formation is discussed in, for instance Lee et al., Nucleic Acids Research 6: 3073 (1979); Cooney et al., Science 241: 456 (1988); and Dervan et al. , Science 251: 1360 (1991) .
  • the methods are based on binding of a polynucleotide to a complementary DNA or RNA.
  • the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene (or proraotor) involved in transcription thereby preventing transcription and the production of hHSP.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into hHSP polypeptide.
  • the oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of hHSP.
  • the antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.
  • the antagonists may be employed for instance to treat and/or prevent delayed hypersen ⁇ itivity.
  • compositions compri ⁇ ing the polynucleotide or the polypeptides discussed above or the agonists or antagonists.
  • the polypeptides of the present invention may be employed in combination with a non-sterile or sterile carrier or carriers for use with cells, tissues or organisms, such as a pharmaceutical carrier suitable for administration to a subject.
  • a pharmaceutical carrier suitable for administration to a subject such as a pharmaceutical carrier suitable for administration to a subject.
  • Such compositions comprise, for instance, a media additive or a therapeutically effective amount of a polypeptide of the invention and a pharmaceutically acceptable carrier or excipient.
  • Such carriers may include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol and combinations thereof. The formulation should suit the mode of administration.
  • the invention further relate ⁇ to pharmaceutical packs and kits comprising one or more containers filled with one or more of the ingredients of the aforementioned compositions of the invention.
  • Associated with such container(s) can be a notice in the form pre ⁇ cribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, reflecting approval by the agency of the manufacture, use or sale of the product for human administration.
  • Polypeptides and other compounds of the present invention may be employed alone or in conjunction with other compounds, such as therapeutic compounds.
  • compositions may be administered in any effective, convenient manner including, for in ⁇ tance, administration by topical, oral, anal, vaginal, intravenous, intraperitoneal, intramuscular, subcutaneou ⁇ , intranasal or intradermal route ⁇ among others.
  • the pharmaceutical compo ⁇ itions generally are administered in an amount effective for treatment or prophylaxis of a specific indication or indications.
  • the compositions are administered in an amount of at least about 10 ⁇ g/kg body weight. In most cases they will be administered in an amount not in excess of about 8 mg/kg body weight per day. Preferably, in most cases, dose is from about 10 ⁇ g/kg to about 1 mg/kg body weight, daily. It will be appreciated that optimum dosage will be determined by standard methods for each treatment modality and indication, taking into account the indication, its severity, route of administration, complicating conditions and the like.
  • hHSP polynucleotides, polypeptides, agonists and antagonists that are polypeptides may be employed in accordance with the present invention by expres ⁇ ion of ⁇ uch polypeptide ⁇ in vivo, in treatment modalities often referred to as "gene therapy.”
  • cells from a patient may be engineered with a polynucleotide, such as a DNA or RNA, encoding a polypeptide ex vivo, and the engineered cells then can be provided to a patient to be treated with the polypeptide.
  • a polynucleotide such as a DNA or RNA
  • cells may be engineered ex vivo by the use of a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention.
  • cells may be engineered in vivo for expres ⁇ ion of a polypeptide in vivo by procedures known in the art.
  • a polynucleotide of the invention may be engineered for expression in a replication defective retroviral vector, a ⁇ discussed above.
  • the retroviral expression construct then may be isolated and introduced into a packaging cell is tran ⁇ duced with a retroviral pla ⁇ mid vector containing RNA encoding a polypeptide of the present invention such that the packaging cell now produces infectious viral particles containing the gene of interest.
  • These producer cells may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo .
  • Retroviruses from which the retroviral plasmid vectors herein above mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruse ⁇ such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and mammary tumor virus.
  • the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.
  • Such vectors well include one or more promoters for expressing the polypeptide.
  • Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller et al., Biotechniques 7: 980-990 (1989), or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, RNA polymerase III, and ⁇ -actin promoters) .
  • CMV cytomegalovirus
  • viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.
  • the promoters of the present invention include promoters which may be employed to control expression of the protein of the present invention in desired tissues, for example, the promoters may be employed to regulate expression of the protein in a tissue of choice.
  • Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or heterologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter,- heat shock promoters,- the albumin promoter; the ApoAI promoter,- human globin promoters; viral thymidine kinase promoters, such as the Herpe ⁇ Simplex thymidine kinase promoter,- retroviral LTR ⁇ (including the modified retroviral LTRs herein above described) ; the ⁇ -actin promoter,- and human growth hormone promoter ⁇ .
  • the promoter also may be the native promoter which controls the gene
  • the retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines.
  • packaging cells which may be tran ⁇ fected include, but are not limited to, the PE501, PA317, Y-2, Y-AM, PA12, T19-14X, VT-19-17- H2, YCRE, YCRIP, GP+E-86, GP+envAml2, and DAN cell lines as described in Miller, A., Human Gene Therapy 1: 5-14 (1990).
  • the vector may be transduced into the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposome ⁇ , and CaP04 precipitation.
  • the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.
  • the producer cell line will generate infectious retroviral vector particles, which include the nucleic acid sequence(s) encoding the polypeptides. Such retroviral vector particles then may be employed to transduce eukaryotic cells, either in vitro or in vivo.
  • the transduced eukaryotic cells will express the nucleic acid sequence (s) encoding the polypeptide.
  • Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cell ⁇ , hepatocyte ⁇ , fibrobla ⁇ ts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.
  • ligations were accomplished using standard buffers, incubation temperatures and times, approximately equimolar amounts of the DNA fragments to be ligated and approximately 10 units of T4 DNA ligase ("ligase”) per 0.5 ⁇ g of DNA.
  • ligase T4 DNA ligase
  • the DNA sequence encoding human hHSP in the deposited polynucleotide is amplified using PCR oligonucleotide primer ⁇ specific to the amino acid carboxyl terminal sequence of the human hHSP protein and to vector sequences 3' to the gene. Additional nucleotides containing restriction sites to facilitate cloning are added to the 5' and 3' sequences respectively.
  • the 5' oligonucleotide primer had the sequence 5' CGCGGATCCGACAGGGCGCCACTCACAG 3' (SEQ ID NO:3) containing the underlined Bam HI restriction site, which encodes a start AUG, followed by 19 nucleotides of the human hHSP coding sequence set out in Figure l (SEQ ID N0:1) beginning with the tenth base of the 23rd codon.
  • the 3' primer had the sequence 5' GCGTCTAGAGAGGTC1ACTGGGTTTTA TTTG 3' (SEQ ID NO:4) containing the underlined Xba I restriction site followed by 21 nucleotides complementary to the last 21 nucleotides of the hHSP cDNA sequence set out in Figure l (SEQ ID NO:l) , including the stop codon.
  • restriction ⁇ sites are convenient to restriction enzyme sites in the bacterial expression vectors pQE-9, which are u ⁇ ed for bacterial expre ⁇ sion in these examples. (Qiagen, Inc. Chatsworth, CA) .
  • pQE-9 11 encodes ampicillin antibiotic resistance ("Ampr") and contains a bacterial origin of replication ("ori"), an IPTG inducible promoter, a ribosome binding site (“RBS”), a 6-His tag and restriction enzyme sites.
  • the amplified human hHSP DNA and the vector pQE-9 both are digested with Bam HI and Xba I and the digested DNAs then are ligated together. Insertion of the hHSP DNA into the pQE-9 restricted vector placed the hHSP coding region downstream of and operably linked to the vector's IPTG-inducible promoter and in- frame with an initiating AUG appropriately positioned for translation of hHSP.
  • the ligation mixture is transformed into competent E. coli cells using standard procedures. Such procedures are described in
  • E. coli strain M15/rep4 containing multiple copies of the plasmid pREP4, which expres ⁇ es lac repre ⁇ sor and confers kanamycin resistance (“Kanr”) , is used in carrying out the illustrative example described here.
  • Kanr kanamycin resistance
  • Transformant ⁇ are identified by their ability to grow on LB plate ⁇ in the presence of ampicillin. Plasmid DNA is isolated from resi ⁇ tant colonies and the identity of the cloned DNA is confirmed by restriction analysis.
  • Clones containing the desired constructs are grown overnight ("O/N") in liquid culture in LB media supplemented with both ampicillin (100 ug/ml) and kanamycin (25 ug/ml) .
  • the O/N culture is used to inoculate a large culture, at a dilution of approximately 1:100 to 1:250.
  • the cells are grown to an optical density at 600nm ("OD600") of between 0.4 and 0.6.
  • I ⁇ opropyl-B-D-thiogalactopyrano ⁇ ide (“IPTG”) is then added to a final concentration of l mM to induce transcription from lac repressor sensitive promoters, by inactivating the lad repressor.
  • IPTG I ⁇ opropyl-B-D-thiogalactopyrano ⁇ ide
  • Cells subsequently are incubated further for 3 to 4 hours.
  • Cells then are harvested by centrifugation and disrupted, by standard methods.
  • Inclusion bodies were purified from the disrupted cells using routine collection techniques, and protein is solubilized from the inclusion bodies into 8M urea.
  • the 8M urea solution containing the solubilized protein is passed over a PD-10 column in 2X phosphate buffered saline ("PBS") , thereby removing the urea, exchanging the buffer and refolding the protein.
  • PBS 2X phosphate buffered saline
  • the protein is purified by a further step of chromatography to remove endotoxin. Then, it is sterile filtered.
  • the ⁇ terile filtered protein preparation is stored in 2X PBS at a concentration of 95 micrograms per mL.
  • Example 2 Cloning and expression of human hHSP in a baculovirus expression system
  • the cDNA sequence encoding the full length human hHSP protein, in the deposited clone is amplified using PCR oligonucleotide primers corresponding to the 5' and 3 ' sequences of the gene:
  • the 5' primer has the sequence 5' CGCGGAT£CGCCATCATGAGG CTGTCACTGCCAC 3' (SEQ ID NO:5) containing the underlined Bam HI restriction enzyme site followed by 19 base ⁇ of the ⁇ equence of hHSP of Figure 1 (SEQ ID NO:l) .
  • An efficient signal for initiation of translation in eukaryotic cells a ⁇ de ⁇ cribed by Kozak, M., J. Mol. Biol. 196: 947-950 (1987) i ⁇ appropriately located in the vector portion of the construct.
  • T-E 3' primer has the sequence 5' GCGTCTAGAGAGGTCACTGGG TTTTATTTG 3' (SEQ ID NO:6) containing the underlined Xba I restriction followed by nucleotides complementary to the last 21 nucleotides of the hHSP cDNA sequence set prior to poly A tail set out in Figure 1 (SEQ ID NO:l) , including the stop codon.
  • the amplified fragment is isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca. ) .
  • the fragment then is digested with BamHl and Xba I and again is purified on a 1% agarose gel. This fragment is designated herein F2.
  • the vector pA2 is used to express the hHSP protein in the baculovirus expression system, using standard methods, such as those described in Summers et al, A MANUAL OF METHODS FOR BACULOVIRUS VECTORS AND INSECT CELL CULTURE PROCEDURES, Texas Agricultural Experimental Station Bulletin No. 1555 (1987) .
  • This expres ⁇ ion vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis viru ⁇ (AcMNPV) followed by convenient re ⁇ triction sites .
  • the polyadenylation site of the simian virus 40 (“SV40") is used for efficient polyadenylation.
  • the beta-galactosidase gene from E.coli is inserted in the same orientation as the polyhedrin promoter and is followed by the polyadenylation signal of the polyhedrin gene.
  • the polyhedrin sequences are flanked at both sides by viral sequences for cell-mediated homologous recombination with wild-type viral DNA to generate viable viru ⁇ that express the cloned polynucleotide.
  • baculovirus vectors could be used in place of pA2, such as pAc373, pVL941 and pAcIMl provided, as those of skill readily will appreciate, that construction provides appropriately located signal ⁇ for tran ⁇ cription, translation, trafficking and the like, such as an in-frame AUG and a signal peptide, as required.
  • signal ⁇ for tran ⁇ cription, translation, trafficking and the like, such as an in-frame AUG and a signal peptide, as required.
  • Such vector ⁇ are de ⁇ cribed in Luckow et al., Virology 170: 31-39, among other ⁇ .
  • the plasmid is digested with the restriction enzymes Bam HI and Xba I.
  • the DNA is then isolated from a 1% agarose gel using a commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.) . This vector DNA is designated herein "V2".
  • Fragment F2 and the dephosphorylated plasmid V2 are ligated together with T4 DNA ligase.
  • E.coli HB101 cells are transformed with ligation mix and spread on culture plates.
  • Bacteria are identified that contain the plasmid with the human hHSP gene by digesting DNA from individual colonies using Bam HI and Xba I and then analyzing the digestion product by gel electrophoresi ⁇ . The sequence of the cloned fragment is confirmed by DNA sequencing. This plasmid is designated herein pBachHSP.
  • 5 ⁇ g of the plasmid pBachHSP is co-transfected with 1.0 ⁇ g of a commercially available linearized baculovirus DNA ("BaculoGoldTM baculovirus DNA", Pharmingen, San Diego, CA.), using the lipofection method described by Feigner et al. , Proc. Natl. Acad. Sci. USA 84: 7413-7417 (1987).
  • BaculoGoldTM virus DNA and 5 ⁇ g of the plasmid pBachHSP are mixed in a sterile well of a microtiter plate containing 50 ⁇ l of serum free Grace's medium (Life Technologies Inc., Gaithersburg, MD) .
  • plaque assay After four days the supernatant is collected and a plaque assay is performed, as described by Summers and Smith, cited above.
  • An agarose gel with "Blue Gal” (Life Technologies Inc., Gaithersburg) is used to allow easy identification and isolation of gal-expressing clones, which produce blue-stained plaques. (A detailed description of a "plaque assay” of this type can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc. , Gaithersburg, page 9-10) .
  • V-hHSP A clone containing properly inserted hHSP is identified by DNA analysis including restriction mapping and sequencing. This is designated herein as V-hHSP.
  • Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS.
  • the cells are infected with the recombinant baculovirus V-hHSP at a multiplicity of infection ("MOI") of about 2 (about 1 to about 3) .
  • MOI multiplicity of infection
  • the medium is removed and is replaced with SF900 II medium minus methionine and cysteine (available from Life Technologies Inc., Gaithersburg). 42 hours later, 5 ⁇ Ci of 35S-methionine and 5 ⁇ Ci 35S cysteine (available from Amersham) are added.
  • the cells are further incubated for 16 hours and then they are harvested by centrifugation, lysed and the labeled proteins are visualized by SDS-PAGE and autoradiography.
  • the expre ⁇ sion plasmid, hHSP HA is made by cloning a cDNA encoding hHSP into the expression vector pcDNAI/Amp (which can be obtained from Invitrogen, Inc.).
  • the expression vector pcDNAI/amp contains: (1) an E.coli origin of replication effective for propagation in E. coli and other prokaryotic cell; (2) an ampicillin resistance gene for selection of plasmid-containing prokaryotic cells; (3) an SV40 origin of replication for propagation in eukaryotic cells; (4) a CMV promoter, a polylinker, an SV40 intron, and a polyadenylation signal arranged so that a cDNA conveniently can be placed under expression control of the CMV promoter and operably linked to the SV40 intron and the polyadenylation signal by means of restriction site ⁇ in the polylinker.
  • a DNA fragment encoding the entire hHSP precursor and a HA tag fused in frame to its 3' end is cloned into the polylinker region of the vector so that recombinant protein expression is directed by the CMV promoter.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein de ⁇ cribed by Wil ⁇ on et al., Cell 37: 767 (1984) .
  • the fusion of the HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
  • the plasmid construction strategy is as follows.
  • the hHSP cDNA of the deposit clone is amplified using primers that contained convenient restriction sites, much as described above regarding the construction of expression vectors for expression of hHSP in E. coli and S. furgiperda.
  • one of the primers contains a hemagglutinin tag ("HA tag") as described above.
  • Suitable primers include that following, which are u ⁇ ed in thi ⁇ example.
  • the 5' primer containing the underlined Bam HI site, an AUG start codon and 16 nucleotides thereafter, has the following sequence, 5' CGCCCATCCGCCATCATGAGGCTGTCACTGCCAC 3' (SEQ ID NO:7).
  • the 3' primer containing the underlined Xba I site, a stopped codon, 9 codons forming hemaglutinin tag and 18 bp of 3' coding sequence (at the 3' end) has the following sequence, 5' ⁇ CTCTAGATC-AAGCGTAGTCTGGGACGTCGTATGGGTAGAGCT 3' (SEQ ID NO: 1)
  • the PCR amplified DNA fragment and the vector, pcDNAI/Amp, are digested with and then ligated.
  • the ligation mixture is transformed into E. coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037) the transformed culture is plated on ampicillin media plates which then are incubated to allow growth of ampicillin resistant colonies. Plasmid DNA is isolated from resistant colonies and examined by restriction analysis and gel sizing for the presence of the hHSP-encoding fragment.
  • COS cells are transfected with an expression vector, as described above, using DEAE-DEXTRAN, as described, for instance, in Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, Cold Spring Laboratory Press, Cold Spring Harbor, New York (1989) .
  • Cells are incubated under conditions for expres ⁇ ion of hHSP by the vector.
  • hHSP HA fusion protein is detected by radiolabelling and immunoprecipitation, using methods described in, for example Harlow et al., ANTIBODIES: A LABORATORY MANUAL, 2nd Ed.,- Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1988) . To this end, two days after transfection, the cells are labeled by incubation in media containing 35S-cysteine for 8 hours.
  • the cells and the media are collected, and the cells are washed and the lysed with detergent-containing RIPA buffer: 150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5, as described by Wilson et al. cited above.
  • Proteins are precipitated from the cell lysate and from the culture media using an HA-specific monoclonal antibody. The precipitated proteins then are analyzed by SDS-PAGE gels and autoradiography. An expression product of the expected size is seen in the cell lysate, which is not seen in negative controls.
  • RNAzolTM B system Biotecx Laboratories, Inc. 6023 South Loop East, Hou ⁇ ton, TX 77033
  • RNA i ⁇ isolated from tissue sample ⁇ About 10 ⁇ g of poly A RNA i ⁇ isolated from tissue sample ⁇ . The RNA is size resolved by electrophoresis through a 1% agarose gel under strongly denaturing conditions. RNA is blotted from the gel onto a nylon filter, and the filter then is prepared for hybridization to a detectably labeled polynucleotide probe.
  • the antisense strand of the coding region of the cDNA insert in the deposited clone is labeled to a high specific activity.
  • the cDNA is labeled by primer extension, using the Prime-It kit, available from Stratagene. The reaction is carried out using 50 ng of the cDNA, following the standard reaction protocol as recommended by the supplier.
  • the labeled polynucleotide is purified away from other labeled reaction components by column chromatography using a Select-G-50 column, obtained from 5-Prime - 3-Prime, Inc. of 5603 Arapahoe Road, Boulder, CO 80303.
  • the labeled probe is hybridized to the filter, at a concentration of 1,000,000 cpm/ml, in a small volume of 7% SDS, 0.5 M NaP04, pH 7.4 at 65°C, overnight.
  • mRNA for hHSP is abundant in thymus, spleen, appendix, bone marrow, prostate, testis, ovary, small intestine, colon, peripheral blood leukocyte and lymph node.
  • Fibroblasts are obtained from a subject by skin biopsy.
  • the resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask.
  • the flask is turned upside down, closed tight and left at room temperature overnight. After 24 hours at room temperature, the flask is inverted - the chunks of tissue remain fixed to the bottom of the flask - and fresh media is added (e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin) .
  • the tissue is then incubated at 37 * C for approximately one week. At this time, fresh media is added and subsequently changed every several days. After an additional two weeks in culture, a monolayer of fibroblasts emerges. The monolayer is trypsinized and scaled into larger flasks.
  • a vector for gene therapy is digested with restriction enzymes for cloning a fragment to be expressed.
  • the digested vector is treated with calf intestinal phosphatase to prevent self-ligation.
  • the dephosphorylated, linear vector is fractionated on an agarose gel and purified.
  • hHSP cDNA capable of expressing active hHSP is isolated.
  • the ends of the fragment are modified, if necessary, for cloning into the vector. For instance, 5" overhanging may be treated with DNA polymerase to create blunt ends. 3 ' overhanging ends may be removed using SI nuclease. Linkers may be ligated to blunt ends with T4 DNA ligase.
  • Equal quantities of the Moloney murine leukemia virus linear backbone and the hHSP fragment are mixed together and joined using T4 DNA ligase.
  • the ligation mixture is used to transform E. Coli and the bacteria are then plated onto agar-containing kanamycin. Kanamycin phenotype and restriction analysis confirm that the vector has the properly inserted gene.
  • Packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf serum (CS) , penicillin and streptomycin.
  • DMEM Dulbecco's Modified Eagles Medium
  • CS calf serum
  • penicillin and streptomycin The vector containing the hHSP gene is introduced into the packaging cells by standard techniques. Infectious viral particles containing the hHSP gene are collected from the packaging cells, which now are called producer cells.
  • Fre ⁇ h media i ⁇ added to the producer cell ⁇ and after an appropriate incubation period media is harvested from the plates of confluent producer cells.
  • the media, containing the infectious viral particles, is filtered through a Millipore filter to remove detached producer cells.
  • the filtered media then is used to infect fibroblast cells.
  • Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the filtered media.
  • Polybrene (Aldrich) may be included in the media to facilitate transduction. After appropriate incubation, the media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibroblast ⁇ will be infected and no selection is required. If the titer is low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his, to select out transduced cells for expansion.
  • Engineered fibroblasts then may be injected into rats, either alone or after having been grown to confluence on microcarrier beads, such as cytodex 3 beads.
  • the injected fibroblasts produce hHSP product, and the biological actions of the protein are conveyed to the host.
  • Infected sf9 cell supernatant from Example 2 was harvested by low speed centrifugation 4 days post transfection.
  • the supernatant was diluted with 2 volume of lOmM Tri ⁇ -HCl, pH 7.5, 2mM EDTA, then passed through a strong anion exchange column (poros 50 HQ, PerSeptive Biosystem) for initial capturing.
  • HQ column was washed with 50mM NaCl in 25mM Tris-HCl, 2mM EDTA and eluted with step gradient of 250, 500, 750, 1500mM NaCl.
  • hHSP was eluted at the step of 250mM NaCl.
  • the HQ fractions were diluted 2-fold as described above, applied onto a weak anion exchange column (poros 50 PI, PerSeptive Biosystem) and eluted at 150 to 400mM NaCl with a linear gradient.
  • the resultant hHSP fraction was mixed with 3 volume of 25mM NaOAc pH 4.5, then applied onto a weak cation exchanged column (poros 20 CM, PerSeptive Biosystem) and eluted with a 300 to 750mM NaCl gradient.
  • the CM purified hHSP is of 80% purity and finally polished by a Superdex S200 (Pharmacia) size exclusion column.
  • the final purified hHSP appears as a close doublet on SDS-PAGE at greater than 95% purity.
  • the purified hHSP was analyzed by N-terminus sequence. Two cleavage site ⁇ were ⁇ hown at the N-terminus:
  • ADDRESSEE CARELLA, BYRNE, BAIN, GILFILLAN, CECCHI,
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention porte sur des polypeptides hHSP, des polynucléotides codant ces polypeptides ainsi que des procédés pour produire ces polypeptides, particulièrement en exprimant les polynucléotides et les agonistes et les antagonistes des polypeptides. L'invention concerne aussi des procédés pour l'utilisation des ces polynucléotides, polypeptides, agonistes et antagonistes dans des applications qui se rapportent en partie à la recherche, aux diagnostics et à la pratique clinique.
PCT/US1996/004930 1996-04-11 1996-04-11 Proteine humaine specifique a l'hematopoïese WO1997038003A1 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
AU53890/96A AU5389096A (en) 1996-04-11 1996-04-11 Human hematopoietic-specific protein
PCT/US1996/004930 WO1997038003A1 (fr) 1996-04-11 1996-04-11 Proteine humaine specifique a l'hematopoïese
US08/837,029 US5945303A (en) 1996-04-11 1997-04-11 Human hematopoietic-specific protein
US09/987,967 US20020055144A1 (en) 1996-04-11 2001-11-16 Human hematopoietic-specific protein

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US1996/004930 WO1997038003A1 (fr) 1996-04-11 1996-04-11 Proteine humaine specifique a l'hematopoïese

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US08/837,029 Continuation US5945303A (en) 1996-04-11 1997-04-11 Human hematopoietic-specific protein

Publications (1)

Publication Number Publication Date
WO1997038003A1 true WO1997038003A1 (fr) 1997-10-16

Family

ID=22254944

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1996/004930 WO1997038003A1 (fr) 1996-04-11 1996-04-11 Proteine humaine specifique a l'hematopoïese

Country Status (3)

Country Link
US (2) US5945303A (fr)
AU (1) AU5389096A (fr)
WO (1) WO1997038003A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999053051A2 (fr) * 1998-04-09 1999-10-21 Genset Etiquettes de sequences exprimees (est) des 5' et proteines humaines codees
US7223727B2 (en) 1998-04-09 2007-05-29 Serono Genetics Institute S.A. GSSP4 polynucleotides and polypeptides and uses thereof
WO2010054789A1 (fr) 2008-11-12 2010-05-20 Roche Diagnostics Gmbh Pacap en tant que marqueur pour le cancer

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE10315775A1 (de) * 2003-04-04 2004-10-14 Eckart Gmbh & Co. Kg Dünne deckende Aluminiumpigmente, Verfahren zur Herstellung derselben und Verwendung der Aluminiumpigmente
CA2826386C (fr) 2011-02-08 2020-04-28 Cellular Dynamics International, Inc. Production de precurseurs hematopoietiques obtenus par programmation
JP6976939B2 (ja) 2015-10-20 2021-12-08 フジフィルム セルラー ダイナミクス，インコーポレイテッド 遺伝的プログラミングによる多系統造血前駆細胞の作製
AU2017340644B2 (en) 2016-10-05 2024-05-09 FUJIFILM Cellular Dynamics, Inc. Methods for directed differentiation of pluripotent stem cells to HLA homozygous immune cells
WO2018067826A1 (fr) 2016-10-05 2018-04-12 Cellular Dynamics International, Inc. Génération de lignées matures à partir de cellules souches pluripotentes induites avec une interruption mecp2
US20200123501A1 (en) 2017-04-18 2020-04-23 FUJIFILM Cellular Dynamics, Inc. Antigen-specific immune effector cells
AU2021280343A1 (en) 2020-05-29 2022-12-08 FUJIFILM Cellular Dynamics, Inc. Retinal pigmented epithelium and photoreceptor dual cell aggregates and methods of use thereof
MX2022015002A (es) 2020-05-29 2023-03-03 Fujifilm Cellular Dynamics Inc Bicapa del epitelio pigmentario de la retina y fotorreceptores y uso de los mismos.
WO2022251443A1 (fr) 2021-05-26 2022-12-01 FUJIFILM Cellular Dynamics, Inc. Procédés pour empêcher le silençage rapide de gènes dans des cellules souches pluripotentes
US20240003871A1 (en) 2022-06-29 2024-01-04 FUJIFILM Cellular Dynamics, Inc. Ipsc-derived astrocytes and methods of use thereof

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5212074A (en) * 1990-08-28 1993-05-18 Chiron Corporation Genetic material encoding new insulin-like growth factor binding protein igfbp-6
GB9214857D0 (en) * 1992-07-13 1992-08-26 Medical Res Council Human nucleic acid fragments and their use
WO1995014772A1 (fr) * 1993-11-12 1995-06-01 Kenichi Matsubara Signature genique

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
EMBO JOURNAL, Vol. 14, No. 14, issued 1995, TAKEMOTO et al., "LckBPI, a Proline-Rich Protein Expressed in Haematopoietic Lineage Cells, Directly Associates with the SH3 Domain of a Protein Tyrosine Kinase p56lck", pages 3403-3414. *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999053051A2 (fr) * 1998-04-09 1999-10-21 Genset Etiquettes de sequences exprimees (est) des 5' et proteines humaines codees
WO1999053051A3 (fr) * 1998-04-09 2000-04-06 Genset Sa Etiquettes de sequences exprimees (est) des 5' et proteines humaines codees
US6822072B1 (en) 1998-04-09 2004-11-23 Genset S.A. Expressed sequence tags and encoded human proteins
US7223727B2 (en) 1998-04-09 2007-05-29 Serono Genetics Institute S.A. GSSP4 polynucleotides and polypeptides and uses thereof
US7235381B2 (en) 1998-04-09 2007-06-26 Serono Genetics Institute S.A. Expressed sequence tags and encoded human proteins
WO2010054789A1 (fr) 2008-11-12 2010-05-20 Roche Diagnostics Gmbh Pacap en tant que marqueur pour le cancer

Also Published As

Publication number Publication date
US5945303A (en) 1999-08-31
AU5389096A (en) 1997-10-29
US20020055144A1 (en) 2002-05-09

Similar Documents

Publication Publication Date Title
US5874240A (en) Human 4-1BB receptor splicing variant
WO1997033899A1 (fr) Molecule i induisant l'apoptose
WO1997034997A1 (fr) Facteur i, ii et iii de liaison de steroides specifique a l'endometre humain
AU733603B2 (en) Chemokine alpha 2
US6174992B1 (en) Human endometrial specific steroid-binding factor I, II and III
US6008022A (en) Human cytokine polypeptide
WO1999038882A1 (fr) Cystatine f humaine
US5945303A (en) Human hematopoietic-specific protein
WO1997034013A1 (fr) Cytokine ii chimiotactique
US7309780B2 (en) Antibodies to natural killer cell activating factor II
US20060171918A1 (en) Apoptosis inducing molecule I
US6908986B2 (en) Chemokine alpha 3
WO1997036915A1 (fr) Cystatine f humain
WO1997033898A1 (fr) Variante d'epissage de recepteur de 4-1bb chez l'homme
US5952197A (en) DNA encoding the chemotactic cytokine III
EP0937147A1 (fr) Facteur ii d'activation de cellules tueuses naturelles chez l'homme
WO1997037021A1 (fr) Cystatine f humaine
WO1997035027A1 (fr) Chemokine alpha 3
AU767338B2 (en) Chemokine alpha 2
WO1997035028A1 (fr) Cytostatine iii
US20040197874A1 (en) Human cytokine polypeptide
WO1997032993A1 (fr) Cytokine iii chimiotactique
EP0896614A1 (fr) Facteur i, ii et iii de liaison de steroides specifique a l'endometre humain

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AM AU BG BR BY CA CN CZ EE FI GE HU JP KG KP KR KZ LT LV MD MN MX NO NZ PL RO RU SG SI SK TJ TM UA US UZ VN

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 97507940

Format of ref document f/p: F

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA