EP0896614A1 - Facteur i, ii et iii de liaison de steroides specifique a l'endometre humain - Google Patents

Facteur i, ii et iii de liaison de steroides specifique a l'endometre humain

Info

Publication number
EP0896614A1
EP0896614A1 EP96910504A EP96910504A EP0896614A1 EP 0896614 A1 EP0896614 A1 EP 0896614A1 EP 96910504 A EP96910504 A EP 96910504A EP 96910504 A EP96910504 A EP 96910504A EP 0896614 A1 EP0896614 A1 EP 0896614A1
Authority
EP
European Patent Office
Prior art keywords
polypeptide
polynucleotide
hesf
seq
iii
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP96910504A
Other languages
German (de)
English (en)
Other versions
EP0896614A4 (fr
Inventor
Jian Ni
Guo-Liang Yu
Reiner L. Gentz
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Human Genome Sciences Inc
Original Assignee
Human Genome Sciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences Inc filed Critical Human Genome Sciences Inc
Priority claimed from CA002248136A external-priority patent/CA2248136A1/fr
Publication of EP0896614A1 publication Critical patent/EP0896614A1/fr
Publication of EP0896614A4 publication Critical patent/EP0896614A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • This invention relates, in part, to newly identified polynucleotides and polypeptides; variants and derivatives of the polynucleotides and polypeptides; processes for making the polynucleotides and the polypeptides, and their variants and derivatives; agonists and antagonists of the polypeptides; and uses of the polynucleotides, polypeptides, variants, derivatives, agonists and antagonists.
  • the invention relates to polynucleotides and polypeptides of human endometrial specific steroid-binding factor I, II and III, sometimes hereinafter referred to as "hESF I, II and III".
  • the regulation of cells and tissues is controlled by autocrine and paracrine factors, such as systemic hormones and factors that modulate or mediate the action of hormones.
  • peptides expressed locally, can influence certain biological activity in the mammalian system and are very important in the regulation of cells of the epithelium. These factors largely have not been identified or characterized, particularly not in humans.
  • CC10 mammalian CC10
  • rat and rabbit CC10 Humida Cell 10 kDa secretory protein
  • Clara Cell 17 kDa protein Clara Cell 17 kDa protein
  • CC10 specifically binds methylsulfonyl-polychlorated biphenyls (PCBs) (Nordlund, Moler, L. et al . , J. Biol. Chem.. 265:12690-12693 (1990)) and inhibits phospholipase A 2 (Singh, G. et al .
  • PCBs methylsulfonyl-polychlorated biphenyls
  • rat uteroglobin is a covalently bound homodimer whose three dimensional structure is well known (Morize, I. et al., J. Mol. Biol.. 194:725-739 (1987) . Uteroglobin expression in rabbits hac been originally reported in the uterus during the preimplantation phase (Beier, H.M., Biochem. Biophvs. Acta. 160:289-290 (1968)) . More recently, the protein was also detected m oviduct (Kirchner, C. , Cell Tissue Res. , 170:490-492 (1976)), male genital organs (Beier, H.M. et al . , Cell Tissue Res.
  • rat CC10 mRNA is expressed like rat uteroglobin not only in lung but also in the esophagus as well in uteri of estrogen and progesterone treated female rats (Hagen, G. 1990 supra) suggesting that rat CC10 is the rat counterpart of rat uteroglobin (see in general Wolf, M. et al . , Human Molecular Genetics, 1(6) :371-378 (1992) ) .
  • CC10 expression is abundant in non-neoplastic human lung, and it is detectable in tumors in corresponding cell lines at markedly lower levels (Broers, J.L.V. et al . , Lab. Invest. , 66:337-346 (1992) ; Linnoila, R.I. et al . , Amer. J. Clin. Pathol.. 90:1-12 (1988)) .
  • CC10 levels were also significantly lower in serum and bronchoalveolar lavage specimens obtained from smokers and lung cancer patients compared with specimens from healthy non- smokers (Bernard, A. et al., Europ. Resp. J. , 5:1231-1238 (1992)) .
  • CC10 RNA becomes altered in distinct lung compartments and may implicate a role for CC10 in the development of pulmonary carcinomas (Jensen, S.M. et al . , Int. J. Cancer. 58:629-637 (1994) .
  • UG Some of the biological properties of UG, such as masking the antigenicity of blastomers (Mukherjee, A.B., et al . , Med.
  • a nonapeptide derived from the amino acid sequence of ⁇ -helix-3 of UG monomer (residues 39-47) possesses all the biological properties of the intact protein and has been identified as an active site of UG responsible for its PLA 2 - inhibitory and antiinflammatory activities (Miele, L. , et al . , Nature (Lond.) . 335:726-730 (1988)) .
  • cclOkD-specific transcripts are present in several nonrespiratory human organs and tissues.
  • an antibody to rabbit UG a UG-like immunoreactivity in human endometrium (Kikukawa, T. , et al. , J. Clin. Endocrinol. Metab. , 67:315-321 (1988)), prostate (Manyak, M.J., et al . , J. Urol.. 140:176-182 (1988)), and respiratory tract (Dhanireddy, R. , e al., Biochem. Biophys. Res. Commun. , 152:1447-1454 (1988)), has been described.
  • UG in the rabbit uterine fluid is first detectable on day 3 of pregnancy, and peak level is reached on day 5 (for a review see Miele, L., et al . , Endocr. Rev.. 8:474- 490 (1987)) .
  • UG by inhibiting PLA, activity, may down-regulate the production of proinflammatory lipid mediators, which promote contraction and motility of the uterine smooth muscle. Therefore, it is suggested that UG facilitates the maintenance of myometrial quiescence during gestation.
  • polypeptides inter alia, that have been identified as novel hESF I, II and III by homology between the amino acid sequence set out in Figures 1, 2 and 3 (SEQ ID NO:2, 4 and 6) and known amino acid sequences of other proteins such as rat prostatic steroid-binding protein.
  • polynucleotides comprise the regions encoding human hESF I, II and III in the sequence set out in Figures 1, 2 and 3 (SEQ ID NO:2, 4 and 6) .
  • nucleic acid molecules encoding mature polypeptides expressed by the human cDNA contained in ATCC Deposit No. 97401 (ESF I), 97402 (ESF II) and 97403 (ESF III) .
  • isolated nucleic acid molecules encoding human hESF I, II and III, including mRNA ⁇ , cDNAs, genomic DNAs and, in further embodiments of this aspect of the invention, biologically, diagnostically, clinically or therapeutically useful variants, analogs or derivatives thereof, or fragments thereof, including fragments of the variants, analogs and derivatives.
  • hESF I, II and III polypeptides particularly human hESF I, II and III polypeptides, that treat and/or prevent inflammation, asthma, rhinitis, cystic fibrosis, airway disease, neopla ⁇ ia, atopy, inhibit phospholipase A : activity, bind polychlorinated biphenyls, reduce foreign protein antigenicity, inhibit monocyte and neutrophil chemotaxis and phagocytosis, inhibit platelet aggregation, regulate eicosanoid levels in the human uterus and control the growth of endometrial cells.
  • novel polypeptides of human origin referred to herein as hESF I, II and III as well as biologically, diagnostically or therapeutically useful fragments, variants and derivatives thereof, variants and derivatives of the fragments, and analogs of the foregoing.
  • methods for producing the aforementioned hESF I, II and III polypeptides comprising culturing host cells having expressibly incorporated therein an exogenously-derived human hESF I, II or III encoding polynucleotide under conditions for expression of human hESF I, II and III in the host and then recovering the expressed polypeptides.
  • products, compositions and methods for, among other things: assessing hESF I, II and III expression in cells by determining hESF I, II and III polypeptides or hESF I, II and Ill-encoding mRNA; expressing hESF I, II and III in vitro, ex vivo or in vivo by exposing cells to hESF I, II and III polypeptides or polynucleotides as disclosed herein; assaying genetic variation and aberrations, such as defects, in hESF I, II and III genes; and administering a hESF I, II and III polypeptide or polynucleotide to an organism to augment hESF I, II and III function or remediate hESF I, II and III dysfunction.
  • probes that hybridize to human hESF I, II and III sequences.
  • antibodies against hESF I, II and III polypeptides there are provided antibodies against hESF I, II and III polypeptides.
  • the antibodies are highly selective for human hESF I, II and III.
  • hESF I, II and III agonists are provided.
  • preferred agonists are molecules that mimic hESF I, II and III, that bind to hESF I, II and III-binding molecules or receptor molecules, and that elicit or augment hESF I, II and Ill-induced responses.
  • molecules that interact with hESF I are also provided.
  • hESF I, II and III antagonists are provided.
  • preferred antagonists are those which mimic hESF I, II and III so as to bind to hESF I, II and III receptors or binding molecules but not elicit a hESF I, II and III-induced response or more than one hESF I, II and III-induced response or which prevent expression of hESF I, II and III.
  • molecules that bind to or interact with hESF I, II and III so as to inhibit an effeet (s) of hESF I, II and III.
  • the agonists and antagonists may be used to mimic, augment or inhibit the action of hESF I, II and III polypeptides. They may be used, for instance, to treat and/or prevent an inherited susceptibility to asthma.
  • compositions comprising a hESF I, II or III polynucleotide or a hESF I, II or III polypeptide for administration to cells in vitro, to cells ex vivo and to cells in vivo, or to a multicellular organism.
  • the compositions comprise a hESF I, II or III polynucleotide for expression of a hESF I, II or III polypeptide in a host organism for treatment of disease.
  • Particularly preferred in this regard is expression in a human patient for treatment of a dysfunction associated with aberrant endogenous activity.
  • Figure 1 shows the nucleotide and deduced amino acid sequence of human hESF I.
  • Figure 2 shows the nucleotide and deduced amino acid sequence of human hESF II.
  • Figure 3 shows the nucleotide and deduced amino acid sequence of human hESF III.
  • Figure 4 shows the regions of similarity between amino acid sequences of hESF I and rat prostatic steroid-binding protein polypeptides (SEQ ID NO:25) .
  • Figure 5 shows the regions of similarity between amino acid sequences of hESF II and rat prostatic steroid-binding protein polypeptides (SEQ ID NO:26) .
  • Figure 6 shows the regions of similarity between amino acid sequences of hESF III and rat prostatic steroid-binding protein polypeptides (SEQ ID NO:27) .
  • Figure 7 shows structural and functional features of hESF I deduced by the indicated techniques, as a function of amino acid sequence.
  • Figure 8 shows structural and functional features of hESF II deduced by the indicated techniques, as a function of amino acid sequence.
  • Figure 9 shows structural and functional features of hESF III deduced by the indicated techniques, as a function of amino acid sequence.
  • DIGESTION of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA.
  • the various restriction enzymes referred to herein are commercially available and their reaction conditions, cofactors and other requirements for use are known and routine to the skilled artisan.
  • plasmid or DNA fragment is digested with about 2 units of enzyme in about 20 ⁇ l of reaction buffer.
  • isolating DNA fragments for plasmid construction typically 5 to 50 ⁇ g of DNA are digested with 20 to 250 units of enzyme in proportionately larger volumes.
  • Incubation times of about 1 hour at 37"C are ordinarily used, but conditions may vary in accordance with standard procedures, the supplier's instructions and the particulars of the reaction.
  • reactions may be analyzed, and fragments may be purified by electrophoresis through an agarose or polyacrylamide gel, using well known methods that are routine for those skilled in the art.
  • GENETIC ELEMENT generally means a polynucleotide comprising a region that encodes a polypeptide or a region that regulates transcription or translation or other processes important to expression of the polypeptide in a host cell, or a polynucleotide comprising both a region that encodes a polypeptide and a region operably linked thereto that regulates expression.
  • Genetic elements may be comprised within a vector that replicates as an episomal element; that is, as a molecule physically independent of the host cell genome. They may be comprised within mini-chromosomes, such as those that arise during amplification of transfected DNA by methotrexate selection in eukaryotic cells. Genetic elements also may be comprised within a host cell genome; not in their natural state but, rather, following manipulation such as isolation, cloning and introduction into a host cell in the form of purified DNA or in a vector, among others.
  • ISOLATED means altered "by the hand of man” from its natural state; i.e., that, if it occurs in nature, it has been changed or removed from its original environment, or both.
  • a naturally occurring polynucleotide or a polypeptide naturally present in a living animal in its natural state is not “isolated,” but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is “isolated”, as the term is employed herein.
  • isolated means that it is separated from the chromosome and cell in which it naturally occurs.
  • polynucleotides can be joined to other polynucleotides, such as DNAs, for mutagene ⁇ is, to form fusion proteins, and for propagation or expression in a host, for instance.
  • the isolated polynucleotides, alone or joined to other polynucleotides such as vectors, can be introduced into host cells, in culture or in whole organisms. Introduced into host cells in culture or in whole organisms, such DNAs still would be isolated, as the term is used herein, because they would not be in their naturally occurring form or environment.
  • polynucleotides and polypeptides may occur in a composition, such as a media formulations, solutions for introduction of polynucleotides or polypeptides, for example, into cells, compositions or solutions for chemical or enzymatic reactions, for instance, which are not naturally occurring compositions, and, therein remain isolated polynucleotides or polypeptides within the meaning of that term as it is employed herein.
  • LIGATION refers to the process of forming phosphodiester bonds between two or more polynucleotides, which most often are double stranded DNAs. Techniques for ligation are well known to the art and protocols for ligation are described in standard laboratory manuals and references, such as, for instance, Sambrook et al.
  • OLIGONUCLEOTIDE(S) refers to relatively short polynucleotides. Often the term refers to single-stranded deoxyribonucleotides, but it can refer as well to single-or double-stranded ribonucleotides, RNA:DNA hybrids and double-stranded DNAs, among others.
  • Oligonucleotides such as single-stranded DNA probe oligonucleotides, often are synthesized by chemical methods, such as those implemented on automated oligonucleotide synthesizers. However, oligonucleotides can be made by a variety of other methods, including in vitro recombinant DNA-mediated techniques and by expression of DNAs in cells and organisms.
  • oligonucleotides typically are obtained without a 5' phosphate.
  • the 5' ends of such oligonucleotides are not substrates for phosphodiester bond formation by ligation reactions that employ DNA ligases typically used to form recombinant DNA molecules.
  • a phosphate can be added by standard techniques, such as those that employ a kinase and ATP.
  • the 3' end of a chemically synthesized oligonucleotide generally has a free hydroxy1 group and, in the presence of a ligase, such as T4 DNA ligase, readily will form a phosphodiester bond with a 5' phosphate of another polynucleotide, such as another oligonucleotide. As is well known, this reaction can be prevented selectively, where desired, by removing the 5' phosphates of the other polynucleotide(s) prior to ligation.
  • a ligase such as T4 DNA ligase
  • PLASMIDS generally are designated herein by a lower case p preceded and/or followed by capital letters and/or numbers, in accordance with standard naming conventions that are familiar to those of skill in the art.
  • plasmids disclosed herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids by routine application of well known, published procedures.
  • Many plasmids and other cloning and expression vectors that can be used in accordance with the present invention are well known and readily available to those of skill in the art.
  • those of skill readily may construct any number of other plasmids suitable for use in the invention. The properties, construction and use of such plasmids, as well as other vectors, in the present invention will be readily apparent to those of skill from the present disclosure.
  • POLYNUCLEOTIDE(S) generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA.
  • polynucleotides as used herein refers to, among others, single-and double-stranded DNA, DNA that is a mixture of single-and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions.
  • polynucleotide as used herein refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA.
  • the strands in such regions may be from the same molecule or from different molecules.
  • the regions may include all of one or more of the molecules, but more typically involve only a region of some of the molecules.
  • One of the molecules of a triple-helical region often is an oligonucleotide.
  • polynucleotide includes DNAs or RNAs as described above that contain one or more modified bases.
  • DNAs or RNAs with backbones modified for stability or for other reasons are “polynucleotides” as that term is intended herein.
  • DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritylated bases, to name just two examples are polynucleotides as the term is used herein.
  • polynucleotide as it is employed herein embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including simple and complex cells, inter alia .
  • POLYPEPTIDES as used herein, includes all polypeptides as described below. The basic structure of polypeptides is well known and has been described in innumerable textbooks and other publications in the art.
  • the term is used herein to refer to any peptide or protein comprising two or more amino acids joined to each other in a linear chain by peptide bonds.
  • the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types.
  • polypeptides often contain amino acids other than the 20 amino acids commonly referred to as the 20 naturally occurring amino acids, and that many amino acids, including the terminal ammo acids, may be modified in a given polypeptide, either by natural processes, such as processing and other post-translational modifications, but also by chemical modification techniques which are well known to the art. Even the common modifications that occur naturally in polypeptides are too numerous to list exhaustively here, but they are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature, and they are well known to those of skill m the art.
  • polypeptides of the present are, to name an illustrative few, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of pho ⁇ photidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cystine, formation of pyroglutamate, for ylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, my ⁇ stoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids
  • polypeptides are not always entirely linear.
  • polypeptides may be branched as a result of ubiquitination, and they may be circular, with or without branching, generally as a result of po ⁇ ttran ⁇ lation events, including natural processing event and events brought about by human manipulation which do not occur naturally.
  • Circular, branched and branched circular polypeptides may be synthesized by non-translation natural process and by entirely synthetic methods, as well.
  • Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini.
  • blockage of the amino or carboxyl group in a polypeptide, or both, by a covalent modification is common in naturally occurring and synthetic polypeptides and such modifications may be present in polypeptides of the present invention, as well.
  • the amino terminal residue of polypeptides made in E. coli, prior to proteolytic processing almost invariably will be N-formylmethionine.
  • polypeptides made by expressing a cloned gene in a host for instance, the nature and extent of the modifications in large part will be determined by the host cell posttranslational modification capacity and the modification signals present in the polypeptide amino acid sequence.
  • glycosylation often does not occur in bacterial hosts such as E. coli. Accordingly, when glycosylation is desired, a polypeptide should be expressed in a glycosylating host, generally a eukaryotic cell.
  • Insect cell often carry out the same posttranslational glycosylations as mammalian cells and, for this reason, insect cell expression systems have been developed to express efficiently mammalian proteins having native patterns of glycosylation, inter alia . Similar considerations apply to other modifications.
  • polypeptide encompasses all such modifications, particularly those that are present in polypeptides synthesized by expressing a polynucleotide in a host cell.
  • VARIANT(S) of polynucleotides or polypeptides are polynucleotides or polypeptides that differ from a reference polynucleotide or polypeptide, respectively. Variants in this sense are described below and elsewhere in the present disclosure in greater detail.
  • changes in the nucleotide sequence of the variant may be silent. That is, they may not alter the amino acids encoded by the polynucleotide. Where alterations are limited to silent changes of this type a variant will encode a polypeptide with the same amino acid sequence as the reference. Also as noted below, changes in the nucleotide sequence of the variant may alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide. Such nucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below.
  • a variant and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions, fusions and truncations, which may be present in any combination.
  • RECEPTOR MOLECULE refers to molecules which bind or interact specifically with hESF I, II and III polypeptides of the present invention, including not only classic receptors, which are preferred, but also other molecules that specifically bind to or interact with polypeptides of the invention (which also may be referred to as "binding molecules” and “interaction molecules,” respectively and as “hESF I, II and III binding molecules” and “hESF I, II and III interaction molecules.” Binding between polypeptides of the invention and such molecules, including receptor or binding or interaction molecules may be exclusive to polypeptides of the invention, which is very highly preferred, or it may be highly specific for polypeptides of the invention, which is highly preferred, or it may be highly specific to a group of proteins that includes polypeptides of the invention, which is preferred, or it may be specific to several groups of proteins at least one of which includes polypeptides of the invention.
  • Receptors also may be non-naturally occurring, such as antibodies and antibody-derived reagents that bind to polypeptides of the invention.
  • the present invention relates to novel hESF I, II and III polypeptides and polynucleotides, among other things, as described in greater detail below.
  • the invention relates to polypeptides and polynucleotides of novel human hESF I, II and III, which are related by ammo acid sequence homology to the rat prostatic steroid-binding pro-ein.
  • the invention relates especially to hESF I, II and III having the nucleotide and amino acid sequences set out in Figures 1, 2 and 3 (SEQ ID NO:1-6) and to the hESF I, II and III nucleotides and amino acid sequences of the human cDNAs in ATCC Deposit No.
  • the deposited clone or as the "cDNA of the deposited clone."
  • the nucleotide and ammo acid sequences set out in Figures 1, 2 and 3 (SEQ ID NO:2, 4 and 6) were obtained by sequencing the cDNA of the deposited clone.
  • the sequence of the deposited clone is controlling as to any discrepancies between the two and any reference to the sequences of Figures 1, 2 and 3 (SEQ ID N0:1, 3 and 5) include reference to the sequence of the human cDNA of the deposited claim.
  • isolated polynucleotides which encode hESF I, II and III polypeptides having the deduced amino acid sequences of Figures 1, 2 and 3 (SEQ ID NO:2, 4 and 6) .
  • a polynucleotide of the present invention encoding human hESF I, II and III polypeptided may be obtained using standard cloning and screening procedures, such as those for cloning cDNAs using mRNA from cells of a human endometrial tumor as starting material.
  • standard cloning and screening procedures such as those for cloning cDNAs using mRNA from cells of a human endometrial tumor as starting material.
  • the polynucleotide set out in Figure 1 (SEQ ID N0:1) was discovered in a cDNA library derived from cells of a human endometrial tumor.
  • the polynucleotide of Figure 2 (SEQ ID NO:3) was discovered in a cDNA library derived from cyclohexamide treated CEM cells.
  • the polynucleotide of Figure 3 (SEQ ID NO:5) was discovered in a cDNA library derived from human endometrial tumor.
  • Human hESF I of the invention is structurally related to other proteins of the Clara cell secretory protein family, as shown by the results of sequencing the cDNA encoding human hESF I in the deposited clone.
  • the cDNA sequence thus obtained is set out in Figure l (SEQ ID N0:1) . It contains an open reading frame encoding a protein of about 90 amino acid residues, wherein the initial 21 am o acid residues represent a putative leader sequence, with a deduced molecular weight of the full-length protein of about 9.8 kDa.
  • the protein exhibits greatest homology to the rat prostatic steroid-binding protein, among known proteins.
  • the protein hESF I has about 46.067% identity and about 66.3% similarity with the amino acid sequence of the rat prostatic steroid-binding protein.
  • Human hESF II contains an open reading frame encoding a protein of about 90 amino acid residues, wherein the initial 21 amino acid residues represent a putative leader sequence, with a deduced molecular weight of the full-length protein of about 9.9 kDa.
  • the protein exhibits greatest homology to the rat prostatic steroid-binding protein, among known proteins.
  • Human hESF III contains an open reading frame encoding a protein of about 95 amino acid residues, wherein the initial 21 amino acid residues represent a putative leader sequence, with a deduced molecular weight of the full-length protein of about 8.10 kDa.
  • the protein exhibits greatest homology to rat prostatic steroid-binding protein C3, among known proteins.
  • III has about 36.2% identity and about 64.9% similarity with the amino acid sequence of the rat prostatic steroid-binding protein C3.
  • Polynucleotides of the present invention may be in the form of RNA, such as mRNA, or in the form of DNA, including, for instance, cDNA and genomic DNA obtained by cloning or produced by chemical synthetic techniques or by a combination thereof.
  • the DNA may be double-stranded or single-stranded.
  • Single-stranded DNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the anti-sense strand.
  • the coding sequence which encodes the polypeptides may be identical to the coding sequence of the polynucleotides shown in Figures 1, 2 and 3 (SEQ ID N0:1, 3 and 5) . It also may be a polynucleotide with a different sequence, which, as a result of the redundancy (degeneracy) of the genetic code, encodes the polypeptides of the human cDNA of Figures 1, 2 and 3 (SEQ ID NO:l, 3 and 5) .
  • Polynucleotides of the present invention which encode the polypeptides of Figures 1, 2 and 3 may include, but are not limited to the coding sequence for the mature polypeptide, by itself; the coding sequence for the mature polypeptide and additional coding sequences, such as those encoding a leader or secretory sequence, such as a pre-, or pro- or prepro- protein sequence; the coding sequence of the mature polypeptide, with or without the aforementioned additional coding sequences, together with additional, non-coding sequences, including for example, but not limited to introns and non-coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription, mRNA processing - including splicing and polyadenylation signals, for example - ribosome binding and stability of mRNA; additional coding sequence which codes for additional amino acids, such as those which provide additional functionalities.
  • the polypeptide may be fused to a marker sequence, such as a peptide, which facilitates purification of the fused polypeptide.
  • the marker sequence is a hexa-histidine peptide, such as the tag provided in the pQE vector (Qiagen, Inc., among others, many of which are commercially available.
  • hexa-histidine provides for convenient purification of the fusion protein.
  • the HA tag corresponds to an epitope derived of influenza hemagglutinin protein, which has been described by Wilson et al., Cell 37: 767 (1984) , for instance.
  • polynucleotide encoding a polypeptide encompasses polynucleotides which include a sequence encoding a polypeptide of the present invention, particularly human hESF I, II and III having the amino acid sequences set out in Figures 1, 2 and 3 (SEQ ID NO:2, 4 and 6) .
  • the term encompasses polynucleotides that include a single continuous region or discontinuous regions encoding the polypeptide (for example, interrupted by introns) together with additional regions, that also may contain coding and/or non-coding sequences.
  • the present invention further relates to variants of the herein above described polynucleotides which encode for fragments, analogs and derivatives of the polypeptides having the deduced amino acid sequences of Figures 1, 2 and 3 (SEQ ID NO:2, 4 and 6) .
  • a variant of the polynucleotide may be a naturally occurring variant such as a naturally occurring allelic variant, or it may be a variant that is not known to occur naturally.
  • Such non- naturally occurring variants of the polynucleotide may be made by mutagenesis techniques, including those applied to polynucleotides, cells or organisms.
  • variants in this regard are variants that differ from the aforementioned polynucleotides by nucleotide substitutions, deletions or additions.
  • the substitutions, deletions or additions may involve one or more nucleotides.
  • the variants may be altered in coding or non-coding regions or both. Alterations in the coding regions may produce conservative or non-conservative amino acid substitutions, deletions or additions.
  • polynucleotides encoding hESF I, II and III variants, analogs, derivatives and fragments, and variants, analogs and derivatives of the fragments which have the amino acid sequence of the hESF I, II or III polypeptides of Figures 1, 2 and 3 (SEQ ID NO:2, 4 and 6) in which several, a few, 5 to 10, 1 to 5, 1 to 3, 2, 1 or no amino acid residues are substituted, deleted or added, in any combination.
  • silent substitutions, additions and deletions which do not alter the properties and activities of the hESF I, II and III.
  • conservative substitutions are especially preferred.
  • polynucleotides that are at least 70% identical to a polynucleotides encoding the hESF I, II and III polypeptides having the amino acid sequences set out in Figures 1, 2 and 3 (SEQ ID NO:2, 4 and 6) , and polynucleotides which are complementary to such polynucleotides.
  • polynucleotides that comprise a region that is at least 80% identical to a polynucleotide encoding the hESF I, II or III polypeptides of the cDNA of the deposited clone and polynucleotides complementary thereto.
  • polynucleotides at least 90% identical to the same are particularly preferred, and among these particularly preferred polynucleotides, those with at least 95% are especially preferred. Furthermore, those with at least 97% are highly preferred among those with at least 95%, and among these those with at least 98% and at least 99% are particularly highly preferred, with at least 99% being the more preferred.
  • polynucleotides which encode polypeptides which retain substantially the same biological function or activity as the mature polypeptide encoded by the human cDNA of Figures 1, 2 and 3 (SEQ ID N0:1, 3 and 5) .
  • the present invention further relates to polynucleotides that hybridize to the herein above-described sequences.
  • the present invention especially relates to polynucleotides which hybridize under stringent conditions to the herein above-described polynucleotides.
  • stringent conditions means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.
  • polynucleotides of the invention may be used as a hybridization probe for cDNA and genomic DNA to isolate full-length cDNAs and genomic clones encoding hESF I, II or III and to isolate cDNA and genomic clones of other genes that have a high sequence similarity to the human hESF I, II or III genes.
  • Such probes generally will comprise at least 15 bases.
  • such probes will have at least 30 bases and may have at least 50 bases.
  • the coding region of the hESF I, II and III genes may be isolated by screening using the known DNA sequence to synthesize an oligonucleotide probe.
  • a labeled oligonucleotide having a sequence complementary to that of a gene of the present invention is then used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
  • polynucleotides and polypeptides of the present invention may be employed as research reagents and materials for discovery of treatments and diagnostics to human disease, as further discussed herein relating to polynucleotide assays, inter alia .
  • the polynucleotides may encode a polypeptide which is the mature protein plus additional ammo or carboxyl-terminal amino acids, or ammo acids interior to the mature polypeptlde (when the mature form has more than one polypeptide chain, for instance) .
  • Such sequences may play a role in processing of a protein from precursor to a mature form, may facilitate protein trafficking, may prolong or shorten protein hal -life or may facilitate manipulation of a protein for assay or production, among other things.
  • the additional amino acids may be processed away from the mature protein by cellular enzymes.
  • a precursor protein, having the mature form of the polypeptide fused to one or more prosequences may be an inactive form of the polypeptide.
  • inactive precursors When prosequences are removed such inactive precursors generally are activated. Some or all of the prosequences may be removed before activation. Generally, such precursors are called proproteins.
  • a polynucleotide of the present invention may encode a mature protein, a mature protein plus a leader sequence (which may be referred to as a preprotein) , a precursor of a mature protein having one or more prosequence ⁇ which are not the leader sequences of a preprotein, or a preproprotein, which is a precursor to a proprotein, having a leader sequence and one or more prosequences, which generally are removed during processing steps that produce active and mature forms of the polypeptide.
  • a leader sequence which may be referred to as a preprotein
  • a precursor of a mature protein having one or more prosequence ⁇ which are not the leader sequences of a preprotein
  • a preproprotein which is a precursor to a proprotein, having a leader sequence and one or more prosequences, which generally are removed during processing steps that produce active and mature forms of the polypeptide.
  • a deposit containing a human hESF I, II and III cDNA has been deposited with the American Type Culture Collection, as noted above. Also as noted above, the cDNA deposit is referred to herein as "the deposited clone" or a ⁇ "the cDNA of the depo ⁇ ited clone.”
  • the depo ⁇ ited clone was deposited with the American Type Culture Collection, 12301 Park Lawn Drive, Rockville, Maryland 20852, USA, on January 2, 1996 and assigned ATCC Deposit No. 97401, 97402 and 97403.
  • the deposited materials are pBluescript SK (-) plasmids (Stratagene, La Jolla, CA) containing the full length hESF I, II and III cDNA.
  • sequence of the polynucleotides contained in the deposited material, as well as the amino acid sequence of the polypeptide encoded thereby, are controlling in the event of any conflict with any description of sequences herein.
  • a license may be required to make, use or sell the deposited materials, and no such license is hereby granted.
  • the present invention further relates to a human hESF I, II and III polypeptide which has the deduced amino acid sequence of Figures 1, 2 and 3 (SEQ ID NO:2, 4 and 6) .
  • the invention also relates to fragments, analogs and derivatives of these polypeptides.
  • fragment when referring to the polypeptide of Figures 1, 2 and 3 (SEQ ID NO:2, 4 and 6) means a polypeptide which retains essentially the same biological function or activity as such polypeptide.
  • an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide. In certain preferred embodiments it is a recombinant polypeptide.
  • the fragment, derivative or analog of the polypeptide of Figures 1, 2 and 3 may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol) , or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence.
  • Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.
  • substitutions are those that vary from a reference by conservative amino acid substitutions. Such substitutions are those that substitute a given amino acid in a polypeptide by another amino acid of like characteristics. Typically seen as conservative substitutions are the replacements, one for another, among the aliphatic amino acids Ala, Val, Leu and lie; interchange of the hydroxy1 residues Ser and Thr, exchange of the acidic residues Asp and Glu, substitution between the amide residues Asn and Gin, exchange of the basic residues Lys and Arg and replacements among the aromatic residues Phe, Tyr.
  • polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
  • polypeptides of the present invention include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) as well as polypeptides which have at least 75% similarity (preferably at least 75% identity) to the polypeptide of SEQ ID NO:2 and more preferably at least 90% similarity (more preferably at least 90% identity) to the polypeptide of SEQ ID NO:2 and still more preferably at least 95% similarity (still more preferably at least 95% identity) to the polypeptide of SEQ ID NO:2 and also include portion ⁇ of such polypeptides with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.
  • a ⁇ known in the art "similarity" between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide.
  • Fragments or portion ⁇ of the polypeptides of the present invention may be employed for producing the corresponding full- length polypeptide by peptide synthesis; therefore, the fragments may be employed a ⁇ intermediates for producing the full-length polypeptides. Fragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides of the present invention.
  • polypeptides comprising fragments of hESF I, II and III, most particularly fragments of the hESF I, II and III having the amino acid sequence set out in Figures 1, 2 and 3 (SEQ ID NO:2, 4 and 6) , and fragments of variants and derivatives of the hESF I, II and III of Figures 1, 2 and 3 (SEQ ID NO:2, 4 and 6) .
  • a fragment is a polypeptide having an amino acid sequence that entirely is the same as part but not all of the amino acid sequence of the aforementioned hESF I, II and III polypeptides and variants or derivatives thereof.
  • fragments may be "free-standing,” i.e., not part of or fused to other amino acids or polypeptides, or they may be comprised within a larger polypeptide of which they form a part or region.
  • the presently discussed fragments most preferably form a single continuous region. However, several fragments may be comprised within a single larger polypeptide.
  • fragments in one aspect of the meaning intended herein refers to the portion or portions of a fusion polypeptide or fusion protein derived from hESF I, II and III.
  • polypeptide fragments of the invention there may be mentioned those which have from about 15 to about 139 amino acids.
  • H i g h l y preferred in this regard are the recited ranges plus or minus a ⁇ many as 5 amino acids at either or at both extremes.
  • Particularly highly preferred are the recited ranges plus or minus as many as 3 amino acids at either or at both the recited extremes.
  • Especially preferred are ranges plus or minus 1 amino acid at either or at both extremes or the recited ranges with no additions or deletions.
  • Most highly preferred of all in this regard are fragments from about 15 to about 45 amino acids.
  • Truncation mutants include hESF I, II and III polypeptides having the amino acid sequence of Figures 1, 2 and 3 (SEQ ID NO:2, 4 and 6), or variants or derivatives thereof, except for deletion of a continuous series of residues (that is, a continuous region, part or portion) that includes the amino terminus, or a continuous series of residues that includes the carboxyl terminus or, as in double truncation mutants, deletion of two continuous series of residues, one including the amino terminus and one including the carboxyl terminu ⁇ .
  • Fragments having the size ranges set out about are preferred embodiments of truncation fragments, which are especially preferred among fragments generally.
  • fragments characterized by structural or functional attributes of hESF I, II and III are fragments characterized by structural or functional attributes of hESF I, II and III.
  • Preferred embodiments of the invention in this regard include fragments that comprise alpha-helix and alpha-helix forming regions ("alpha-regions") , beta-sheet and beta-sheet-forming regions (“beta-regions”) , turn and turn-forming regions ("turn- regions”), coil and coil-forming regions ("coil-regions”), hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface- forming regions and high antigenic index regions of hESF I, II and III.
  • Certain preferred regions in these regards are set out in Figures 4, 5 and 6 and include, but are not limited to, regions of the aforementioned types identified by analysis of the amino acid sequence set out in Figures l, 2 and 3 (SEQ ID N0:2, 4 and 6) .
  • such preferred regions include Gamier-Robson alpha-regions, beta-regions, turn-regions and coil- reg ons, Chou-Fasman alpha-region ⁇ , beta-regions and turn-regions, Kyte-Doolittle hydrophilic regions and hydrophilic regions, Eisenberg alpha and beta amphipathic region ⁇ , Karplus-Schulz flexible regions, Emini surface-forming regions and Jameson-Wolf high antigenic index regions.
  • fragments in this regard are those that comprise regions of hESF I, II and III that combine several structural features, such as several of the features set out above.
  • the regions defined by the residues of Figures 1, 2 and 3 (SEQ ID NO:2, 4 and 6), which all are characterized by amino acid compositions highly characteristic of turn-regions, hydrophilic regions, flexible-regions, surface-forming regions, and high antigenic index-regions are especially highly preferred regions.
  • Such regions may be comprised within a larger polypeptide or may be by themselves a preferred fragment of the present invention, as discussed above. It will be appreciated that the term "about” as used in this paragraph has the meaning set out above regarding fragments in general.
  • fragments that mediate activities of hESF I, II and III are those that mediate activities of hESF I, II and III.
  • fragments that have a chemical, biological or other activity of hESF I, II and III including those with a similar activity or an improved activity, or with a decreased undesirable activity.
  • fragment ⁇ in the ⁇ e regards are truncation mutants, as discus ⁇ ed above.
  • the invention also relates to, among others, polynucleotides encoding the aforementioned fragments, polynucleotides that hybridize to polynucleotides encoding the fragments, particularly those that hybridize under stringent conditions, and polynucleotides, such as PCR primers, for amplifying polynucleotides that encode the fragments.
  • preferred polynucleotides are those that correspondent to the preferred fragment ⁇ , as discussed above.
  • the present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
  • Host cells can be genetically engineered to incorporate polynucleotides and express polypeptides of the present invention.
  • polynucleotides may be introduced into ho ⁇ t cells using well known techniques of infection, transduction, transfection, tran ⁇ vection and transformation.
  • the polynucleotides may be introduced alone or with other polynucleotides.
  • Such other polynucleotides may be introduced independently, co-introduced or introduced joined to the polynucleotides of the invention.
  • polynucleotides of the invention may be transfected into host cells with another, separate, polynucleotide encoding a selectable marker, using standard techniques for co- transfection and selection in, for instance, mammalian cells.
  • the polynucleotides generally will be stably incorporated into the host cell genome.
  • the polynucleotides may be joined to a vector containing a selectable marker, for propagation in a host.
  • the vector construct may be introduced into host cells by the aforementioned techniques.
  • a plasmid vector is introduced as DNA in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid.
  • Electroporation also may be used to introduce polynucleotides into a host. If the vector is a virus, it may be packaged in vitro or introduced into a packaging cell and the packaged virus may be transduced into cells.
  • the vector may be, for example, a plasmid vector, a single or double-stranded phage vector, a single or double-stranded RNA or DNA viral vector.
  • Such vectors may be introduced into cells a ⁇ polynucleotides, preferably DNA, by well known techniques for introducing DNA and RNA into cells.
  • the vectors in the case of phage and viral vectors also may be and preferably are introduced into cells as packaged or encapsidated virus by well known techniques for infection and transduction.
  • Viral vectors may be replication competent or replication defective. In the latter case viral propagation generally will occur only in complementing host cells.
  • vectors are those for expression of polynucleotides and polypeptides of the present invention.
  • such vectors comprise cis-acting control regions effective for expression in a host operatively linked to the polynucleotide to be expressed.
  • Appropriate trans-acting factors either are supplied by the host, supplied by a complementing vector or supplied by the vector itself upon introduction into the host.
  • the vectors provide for specific expression.
  • Such specific expression may be inducible expression or expression only in certain types of cells or both inducible and cell-specific.
  • Particularly preferred among inducible vectors are vectors that can be induced for expression by environmental factors that are easy to manipulate, such as temperature and nutrient additives.
  • a variety of vectors suitable to this aspect of the invention, including constitutive and inducible expression vectors for use in prokaryotic and eukaryotic hosts, are well known and employed routinely by those of skill in the art.
  • the engineered host cells can be cultured in conventional nutrient media, which may be modified as appropriate for, inter alia, activating promoters, selecting transformant ⁇ or amplifying genes.
  • Culture conditions such as temperature, pH and the like, previously used with the host cell selected for expression generally will be suitable for expression of polypeptides of the present invention as will be apparent to those of skill in the art.
  • vectors can be used to express a polypeptide of the invention.
  • Such vectors include chromosomal, episomal and virus-derived vectors e.g., vectors derived from bacterial plasmids, from bacteriophage, from yeast episomes, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids, all may be used for expression in accordance with this aspect of the present invention.
  • any vector suitable to maintain, propagate or expres ⁇ polynucleotides to express a polypeptide in a host may be used for expression in this regard.
  • the appropriate DNA sequence may be inserted into the vector by any of a variety of well-known and routine techniques.
  • a DNA sequence for expression is joined to an expression vector by cleaving the DNA sequence and the expression vector with one or more restriction endonucleases and then joining the restriction fragments together using T4 DNA ligase.
  • Procedures for restriction and ligation that can be used to this end are well known and routine to those of skill. Suitable procedures in this regard, and for constructing expression vectors using alternative techniques, which also are well known and routine to those skill, are set forth in great detail in Sambrook et al. cited elsewhere herein.
  • the DNA sequence in the expression vector is operatively linked to appropriate expression control sequence( ⁇ ), including, for instance, a promoter to direct mRNA transcription.
  • appropriate expression control sequence( ⁇ ) including, for instance, a promoter to direct mRNA transcription.
  • promoters include the phage lambda PL promoter, the E. coli lac, trp and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name just a few of the well-known promoters. It will be understood that numerous promoters not mentioned are suitable for use in this aspect of the invention are well known and readily may be employed by those of skill in the manner illustrated by the discussion and the examples herein.
  • expression constructs will contain sites for transcription initiation and termination, and, in the transcribed region, a ribosome binding site for translation.
  • the coding portion of the mature transcripts expressed by the constructs will include a translation initiating AUG at the beginning and a termination codon appropriately posit med at the end of the polypeptide to be translated.
  • constructs may contain control regions that regulate as well as engender expression. Generally, in accordance with many commonly practiced procedures, such regions will operate by controlling transcription, such as represser binding sites and enhancers, among others.
  • Vectors for propagation and expression generally will include selectable markers. Such markers also may be suitable for amplification or the vectors may contain additional markers for this purpose.
  • the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells. Preferred markers include dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, and tetracycline or ampicillin resistance genes for culturing E. coli and other bacteria.
  • the vector containing the appropriate DNA sequence as described elsewhere herein, as well as an appropriate promoter, and other appropriate control sequences, may be introduced into an appropriate host using a variety of well known techniques suitable to expression therein of a desired polypeptide.
  • appropriate hosts include bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS and Bowes melanoma cells; and plant cells. Hosts for of a great variety of expression constructs are well known, and those of skill will be enabled by the present disclosure readily to select a host for expressing a polypeptides in accordance with this aspect of the present invention.
  • the present invention also includes recombinant constructs, such as expression constructs, comprising one or more of the sequences described above.
  • the constructs comprise a vector, such as a plasmid or viral vector, into which such a sequence of the invention has been inserted.
  • the sequence may be inserted in a forward or reverse orientation.
  • the construct further comprises regulatory sequence ⁇ , including, for example, a promoter, operably linked to the sequence.
  • regulatory sequence ⁇ including, for example, a promoter, operably linked to the sequence.
  • vectors which are commercially available, are provided by way of example.
  • vectors preferred for use in bacteria are pQE70, pQE60 and pQE-9, available from Qiagen; pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNH16a, pNHl ⁇ A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3, PKK233-3, pDR540, pRIT5 available from Pharmacia.
  • eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. These vectors are listed solely by way of illustration of the many commercially available and well known vectors that are available to those of skill in the art for use in accordance with this a ⁇ pect of the present invention. It will be appreciated that any other plasmid or vector suitable for, for example, introduction, maintenance, propagation or expression of a polynucleotide or polypeptide of the invention in a host may be used in this aspect of the invention.
  • Promoter regions can be selected from any desired gene using vectors that contain a reporter transcription unit lacking a promoter region, such as a chlora phenicol acetyl transferase ("cat") transcription unit, downstream of restriction site or sites for introducing a candidate promoter fragment; i.e., a fragment that may contain a promoter.
  • a reporter transcription unit lacking a promoter region such as a chlora phenicol acetyl transferase ("cat") transcription unit, downstream of restriction site or sites for introducing a candidate promoter fragment; i.e., a fragment that may contain a promoter.
  • introduction into the vector of a promoter-containing fragment at the restriction site upstream of the cat gene engenders production of CAT activity, which can be detected by standard CAT assays.
  • Vectors suitable to this end are well known and readily available. Two such vectors are pKK232-8 and pCM7.
  • promoters for expression of polynucleotides of the present invention include not
  • bacterial promoters suitable for expression of polynucleotides and polypeptides in accordance with the present invention are the B. coli lad and lacZ and promoters, the T3 and T7 promoters, the gpt promoter, the lambda PR, PL promoters and the trp promoter.
  • eukaryotic promoters suitable in this regard are the CMV imnediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, the promoters of retroviral LTRs, such as those of the Rous sarcoma viru ⁇ ("RSV”) , and metallothionein promoters, such as the mouse metallothionein-I promoter.
  • retroviral LTRs such as those of the Rous sarcoma viru ⁇ (“RSV")
  • metallothionein promoters such as the mouse metallothionein-I promoter.
  • the present invention also relates to host cells containing the above-described constructs discussed above.
  • the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection or other methods. Such methods are described in many standard laboratory manuals, such as Davis et al. BASIC METHODS IN MOLECULAR BIOLOGY, (1986) .
  • Constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.
  • the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
  • Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) .
  • recombinant expression vectors will include origins of replication, a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence, and a selectable marker to permit isolation of vector containing cells after exposure to the vector.
  • suitable promoters are those derived from the genes that encode glycolytic enzymes such as 3- phosphoglycerate kinase ("PGK”), a-factor, acid phosphatase, and heat shock proteins, among others.
  • PGK 3- phosphoglycerate kinase
  • Selectable markers include the ampicillin resistance gene of E. coli and the trpl gene of S. cerevisiae.
  • Enhancers are cis- acting elements of DNA, usually about from 10 to 300 bp that act to increase transcriptional activity of a promoter in a given host cell-type.
  • enhancers include the SV40 enhancer, which is located on the late side of the replication origin at bp 100 to 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • Polynucleotides of the invention encoding the heterologous structural sequence of a polypeptide of the invention generally will be inserted into the vector using standard techniques so that it is operably linked to the promoter for expression.
  • the polynucleotide will be positioned so that the transcription start site is located appropriately 5 ' to a ribosome binding site.
  • the ribosome binding site will be 5 ' to the AUG that initiates translation of the polypeptide to be expressed.
  • secretion signals may be incorporated into the expres ⁇ ed polypeptide.
  • the ⁇ ignals may be endogenous to the polypeptide or they may be heterologous signals.
  • the polypeptide may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals but also additional heterologous functional regions.
  • a region of additional amino acids, particularly charged amino acids may be added to the N-terminus of the polypeptide to improve stability and persistence in the host cell, during purification or during subsequent handling and storage.
  • region also may be added to the polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the polypeptide.
  • the addition of peptide moieties to polypeptides to engender secretion or excretion, to improve stability and to facilitate purification, among others, are familiar and routine techniques in the art.
  • Suitable prokaryotic hosts for propagation, maintenance or expression of polynucleotides and polypeptides in accordance with the invention include Escherischia coli, Bacillus subtilis and Salmonella typhimurium. Various species of Pseudomona ⁇ , Streptomyces, and Staphylococcus are suitable hosts in this regard. Moreover, many other hosts also known to those of skill may be employed in this regard.
  • useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017) .
  • cloning vector pBR322 ATCC 37017
  • Such commercial vector ⁇ include, for example, pKK223-3 (Pharmacia Fine Chemical ⁇ , Uppsala, Sweden) and GEMl (Promega Biotec, Madison, Wl, USA) .
  • pBR322 "backbone" section ⁇ are combined with an appropriate promoter and the ⁇ tructural sequence to be expressed.
  • Cells typically then are harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.
  • Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.
  • mammalian cell culture systems can be employed for expression, as well.
  • mammalian expression systems include the COS-7 lines of monkey kidney fibrobla ⁇ t, described in Gluzman et al. , Cell 23: 175 (1981) .
  • Other cell lines capable of expressing a compatible vector include for example, the C127, 3T3, CHO, HeLa, human kidney 293 and BHK cell lines.
  • Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, transcriptional termination sequence ⁇ , and 5' flanking non-transcribed sequences that are neces ⁇ ary for expression.
  • DNA sequences derived from the SV40 splice sites, and the SV40 polyadenylation sites are used for required non-transcribed genetic elements of these types.
  • the hESF I, II and III polypeptide can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulo ⁇ e chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography ("HPLC”) is employed for purification.
  • HPLC high performance liquid chromatography
  • Well known techniques for refolding protein may be employed to regenerate active conformation when the polypeptide is denatured during isolation and or purification.
  • Polypeptides of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells. Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non- glyco ⁇ ylated. In addition, polypeptide ⁇ of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated proces ⁇ e ⁇ .
  • hESF I, II and III polynucleotides and polypeptides may be used in accordance with the present invention for a variety of applications, particularly those that make use of the chemical and biological properties hESF I, II and III. Additional applications relate to diagnosis and to treatment of disorders of cells, tissues and organisms. These aspects of the invention are illustrated further by the following discussion.
  • This invention is also related to the use of the hESF I, II and III polynucleotides to detect complementary polynucleotides such as, for example, as a diagnostic reagent. Detection of a mutated form of hESF I, II and III associated with a dysfunction will provide a diagnostic tool that can add or define a diagnosis of a disease or susceptibility to a disease which results from under-expression, over-expre ⁇ sion or altered expression of hESF I, II and III, such as, for example, a susceptibility to inherited asthma and endometrial cancer.
  • Nucleic acids for diagnosi ⁇ may be obtained from a patient's cells, such a ⁇ from blood, urine, ⁇ aliva, tissue biopsy and autopsy material.
  • the genomic DNA may be used directly for detection or may be amplified enzy atically by using PCR prior to analysis. PCR (Saiki et al., Nature, 324: 163-166 (1986)).
  • RNA or cDNA may also be used in the same ways.
  • PCR primers complementary to the nucleic acid encoding hESF I, II and III can be used to identify and analyze hESF I, II and III expression and mutations.
  • deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype.
  • Point mutations can be identified by hybridizing amplified DNA to radiolabeled hESF I, II and III RNA or alternatively, radiolabeled hESF I, II and III antisense DNA sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures.
  • Sequence differences between a reference gene and genes having mutations also may be revealed by direct DNA sequencing.
  • cloned DNA segment ⁇ may be employed a ⁇ probes to detect specific DNA segments.
  • the sensitivity of such methods can be greatly enhanced by appropriate use of PCR or another amplification method.
  • a sequencing primer is used with double- stranded PCR product or a ⁇ ingle- ⁇ tranded template molecule generated by a modified PCR.
  • the sequence determination is performed by conventional procedures with radiolabeled nucleotide or by automatic sequencing procedures with fluorescent-tags.
  • DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels, with or without denaturing agents. Small sequence deletions and insertion ⁇ can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al., Science, 230: 1242 (1985)).
  • Sequence changes at specific locations also may be revealed by nuclease protection as ⁇ ay ⁇ , such as RNase and SI protection or the chemical cleavage method (e.g., Cotton et al., Proc. Na l. Acad. Sci., USA, 85: 4397-4401 (1985)).
  • the detection of a specific DNA sequence may be achieved by methods such a ⁇ hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes,
  • RFLP restriction fragment length polymorphisms
  • mutations also can be detected by in situ analysi ⁇ .
  • the ⁇ equences of the present invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
  • Few chromosome marking reagents based on actual sequence data (repeat polymorphism ⁇ ) are presently available for marking chromosomal location.
  • the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with di ⁇ ease.
  • the cDNA herein disclosed is used to clone genomic DNA of a hESF I, II and III gene. This can be accomplished using a variety of well known techniques and libraries, which generally are available commercially.
  • the genomic DNA the is used for in situ chromosome mapping using well known techniques for this purpose. Typically, in accordance with routine procedures for chromosome mapping, some trial and error may be necessary to identify a genomic probe that gives a good in situ hybridization signal.
  • sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.
  • mapping of somatic cell hybrids is a rapid procedure for as ⁇ igning a particular DNA to a particular chromosome.
  • sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogou ⁇ manner.
  • Other mapping strategie ⁇ that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
  • Fluorescence in situ hybridization of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step.
  • This technique can be used with cDNA as short as 50 or 60.
  • Verma et al. HUMAN CHROMOSOMES: A MANUAL OF BASIC TECHNIQUES, Pergamon Press, New York (1988) .
  • a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb) .
  • the present invention also relates to a diagnostic a ⁇ says such as quantitative and diagnostic as ⁇ ays for detecting levels of hESF I, II and III protein in cells and tissues, and biological fluids such, for example, as blood and urine, including determination of normal and abnormal levels.
  • a diagnostic assay in accordance with the invention for detecting over-expression or under-expression of hESF I, II and III protein compared to normal control tissue samples may be used to detect the presence of neoplasia, for example.
  • a ⁇ ay techniques that can be used to determine levels of a protein, such as an hESF I, II and III protein of the present invention, in a sample derived from a host are well-known to those of skill in the art.
  • An ELISA a ⁇ say initially comprises preparing an antibody specific to hESF I, II or III, preferably a monoclonal antibody.
  • a reporter antibody generally is prepared which binds to the monoclonal antibody.
  • the reporter antibody is attached a detectable reagent such as radioactive, fluorescent or enzymatic reagent, for example horseradish peroxidase enzyme.
  • a sample is removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such a ⁇ bovine ⁇ erum albumin.
  • a non-specific protein such as a ⁇ bovine ⁇ erum albumin.
  • the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any hESF I, II or III proteins attached to the polystyrene dish. Unbound monoclonal antibody is washed out with buffer.
  • the reporter antibody linked to horseradish peroxidase is placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to hESF I, II or III. Unattached reporter antibody is then washed out. Reagents for peroxidase activity, including a colorimetric substrate are then added to the dish. Immobilized peroxidase, linked to hESF I, II or III through the primary and secondary antibodies, produces a colored reaction product. The amount of color developed in a given time period indicates the amount of hESF I, II or III protein present in the sample. Quantitative results typically are obtained by reference to a standard curve.
  • a competition assay may be employed wherein antibodies specific to hESF I, II or III attached to a solid support and labeled hESF I, II or III and a sample derived from the host are passed over the solid support and the amount of label detected attached to the solid support can be correlated to a quantity of hESF I, II or III in the sample.
  • polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto.
  • These antibodies can be, for example, polyclonal or monoclonal antibodies.
  • the present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
  • Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection cf the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
  • any technique which provide ⁇ antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler, G. and Milstein, C. , Nature 256: 495-497 (1975), the triotna technique, the human B-cell hybridoma technique (Kozbor et al. , Immunology Today 4: 72 (1983) and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., pg. 77-96 in MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc. (1985).
  • the above-described antibodies may be employed to isolate or to identify clones expressing the polypeptide or purify the polypeptide of the present invention by attachment of the antibody to a solid support for isolation and/or purification by affinity chromotography.
  • the polynucleotides and polypeptides of the present invention may be employed to prevent and/or treat inflammation, asthma, rhinitis, cystic fibrosi ⁇ , airway disease, prevent and/or treat neoplasia, atopy, inhibit phospholipase A 2 , bind polychlorated biphenyls, reduce foreign protein antigenicity, inhibit monocyte and neutrophil chemotaxis and phagocytosis, inhibit platelet aggregation, regulate eicosanoid levels in the human uterus, control the growth of endometrial cells.
  • hESF I, II and III binding molecules and assays This invention also provides a method for identification of molecule ⁇ , such a ⁇ receptor molecules, that bind hESF I, II and III.
  • Genes encoding proteins that bind hESF I, II and III, such as receptor proteins can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting. Such methods are described in many laboratory manuals such as, for instance, Coligan et al. , Current Protocols in Immunology 1(2): Chapter 5 (1991).
  • expre ⁇ ion cloning may be employed for thi ⁇ purpose.
  • thi ⁇ end polyadenylated RNA is prepared from a cell responsive to hESF I, II and III, a cDNA library is created from thi ⁇ RNA, the library is divided into pools and the pools are transfected individually into cells that are not responsive to hESF I, II and III. The transfected cells then are exposed to labeled hESF I, II and III.
  • hESF I, II and III can be labeled by a variety of well-known techniques including standard methods of radio-iodination or inclusion of a recognition site for a site- specific protein kinase.
  • the cells are fixed and binding of cytostatin is determined.
  • a labeled ligand can be photoaffinity linked to a cell extract, such as a membrane or a membrane extract, prepared from cells that express a molecule that it binds, such as a receptor molecule.
  • Cross-linked material is resolved by polyacrylamide gel electrophoresis ("PAGE") and exposed to X-ray film.
  • PAGE polyacrylamide gel electrophoresis
  • the labeled complex containing the ligand-receptor can be excised, resolved into peptide fragments, and subjected to protein microsequencing.
  • the amino acid sequence obtained from microsequencing can be used to design unique or degenerate oligonucleotide probes to screen cDNA libraries to identify genes encoding the putative receptor molecule.
  • Polypeptides of the invention also can be used to assess hESF I, II and III binding capacity of hESF I, II and III binding molecules, such as receptor molecules, in cells or in cell-free preparations.
  • Agonists and antagonists - assays and molecules The invention also provides a method of screening compounds to identify those which enhance or block the action of hESF I, II and III on cells, such a ⁇ its interaction with hESF I, II and Ill- binding molecule ⁇ such as receptor molecules.
  • An agonist is a compound which increases the natural biological functions of hESF I, II and III or which functions in a manner similar to hESF I, II and III, while antagonists decrease or eliminate such functions.
  • a cellular compartment such as a membrane or a preparation thereof, such a ⁇ a membrane-preparation, may be prepared from a cell that expre ⁇ e ⁇ a molecule that binds hESF I, II and III, such as a molecule of a signaling or regulatory pathway modulated by hESF I, II and III.
  • the preparation is incubated with labeled hESF I, II and III in the absence or the presence of a candidate molecule which may be a hESF I, II and III agonist or antagonist .
  • the ability of the candidate molecule to bind the binding molecule is reflected in decreased binding of the labeled ligand.
  • Molecules which bind gratuitously, i.e., without inducing the effects of hESF I, II and III on binding the hESF I, II and III binding molecule are most likely to be good antagonists.
  • Molecules that bind well and elicit effects that are the same as or closely related to hESF I, II and III are agonists.
  • hESF I, II and III-like effects of potential agonists and antagonists may by measured, for in ⁇ tance, by determining activity of a second messenger system following interaction of the candidate molecule with a cell or appropriate cell preparation, and comparing the effect with that of hESF I, II and III or molecules that elicit the same effects as hESF I, II and III.
  • Second messenger systems that may be useful in this regard include but are not limited to AMP guanylate cyclase, ion channel or phosphoinositide hydrolysis second messenger systems.
  • hESF I, II and III antagonists are competitive assays that combines hESF I, II and III and a potential antagonist with membrane-bound hESF I, II and III receptor molecules or recombinant hESF I, II and III receptor molecules under appropriate conditions for a competitive inhibition assay.
  • hESF I, II and III can be labeled, such as by radioactivity, such that the number of hESF I, II and III molecules bound to a receptor molecule can be determined accurately to assess the effectivenes ⁇ of the potential antagonist.
  • Potential antagonists include small organic molecules, peptides, polypeptides and antibodies that bind to a polypeptide of the invention and thereby inhibit or extinguish its activity. Potential antagonists also may be small organic molecules, a peptide, a polypeptide such a ⁇ a closely related protein or antibody that binds the same sites on a binding molecule, such as a receptor molecule, without inducing hESF I, II and III-induced activities, thereby preventing the action of hESF I, II and III by excluding hESF I, II and III from binding.
  • Potential antagonists include a ⁇ mall molecule which binds to and occupies the binding site of the polypeptide thereby preventing binding to cellular binding molecule ⁇ , ⁇ uch as receptor molecules, such that normal biological activity is prevented.
  • small molecules include but are not limited to small organic molecules, peptides or peptide-like molecules.
  • Other potential antagonists include antisense molecules.
  • Antisense technology can be u ⁇ ed to control gene expression through antisense DNA or RNA or through triple-helix formation. Antisense techniques are discu ⁇ sed, for example, in - Okano, J. Neurochem.
  • the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and the production of hESF I, II and III.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into hESF I, II and III polypeptide.
  • the oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of hESF I, II and III.
  • the antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.
  • the antagoni ⁇ ts may be employed for instance to treat an inherited susceptibility to asthma.
  • compositions comprising the polynucleotide or the polypeptides discu ⁇ sed above or the agonists or antagonists.
  • the polypeptides of the present invention may be employed in combination with a non-sterile or sterile carrier or carriers for use with cells, tissues or organisms, such as a pharmaceutical carrier suitable for administration to a subject.
  • a pharmaceutical carrier suitable for administration to a subject such as a pharmaceutical carrier suitable for administration to a subject.
  • Such compositions comprise, for instance, a media additive or a therapeutically effective amount of a polypeptide of the invention and a pharmaceutically acceptable carrier or excipient.
  • Such carriers may include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol and combinations thereof. The formulation should suit the mode of administration.
  • the invention further relates to pharmaceutical packs and kits comprising one or more containers filled with one or more of the ingredients of the aforementioned compositions of the invention.
  • Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, reflecting approval by the agency of the manufacture, use or sale of the product for human administration.
  • Polypeptides and other compounds of the present invention may be employed alone or in conjunction with other compounds, such as therapeutic compounds.
  • the pharmaceutical composition ⁇ may be administered in any effective, convenient manner including, for instance, administration by topical, oral, anal, vaginal, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes among others.
  • the pharmaceutical composition ⁇ generally are administered in an amount effective for treatment or prophylaxis of a specific indication or indications.
  • the compositions are administered in an amount of at least about 10 ⁇ g/kg body weight. In most cases they will be administered in an amount not in excess of about 8 mg/kg body weight per day. Preferably, in most cases, dose is from about 10 ⁇ g/kg to about 1 mg/kg body weight, daily. It will be appreciated that optimum dosage will be determined by standard methods for each treatment modality and indication, taking into account the indication, its ⁇ everity, route of administration, complicating conditions and the like.
  • the hESF I, II and III polynucleotides, polypeptides, agonists and antagonists that are polypeptides may be employed in accordance with the present invention by expression of such polypeptides in vivo, in treatment modalities often referred to a ⁇ "gene therapy.”
  • cells from a patient may be engineered with a polynucleotide, such as a DNA or RNA, encoding a polypeptide ex vivo, and the engineered cells then can be provided to a patient to be treated with the polypeptide.
  • cells may be engineered ex vivo by the u ⁇ e of a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention.
  • a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention.
  • cells may be engineered in vivo for expression of a polypeptide in vivo by procedures known in the art.
  • a polynucleotide of the invention may be engineered for expression in a replication defective retroviral vector, as discussed above.
  • the retroviral expression construct then may be isolated and introduced into a packaging cell is transduced with a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention such that the packaging cell now produces infectious viral particles containing the gene of interest.
  • These producer cells may be administered to a patient for engineering cells in vivo and expres ⁇ ion of the polypeptide in vivo.
  • Retroviruses from which the retroviral plasmid vectors herein above mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruse ⁇ ⁇ uch a ⁇ Rou ⁇ Sarcoma Viru ⁇ , Harvey Sarcoma Viru ⁇ , avian leuko ⁇ i ⁇ virus, gibbon ape leukemia viru ⁇ , human immunodeficiency viru ⁇ , adenoviru ⁇ , Myeloproliferative Sarcoma Virus, and mammary tumor virus.
  • the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.
  • Such vectors well include one or more promoters for expressing the polypeptide.
  • Suitable promoters which may be employed include, but are not limited to, the retroviral LTR,- the SV40 promoter,- and the human cytomegalovirus (CMV) promoter described in Miller et al., Biotechniques 7: 980-990 (1989), or any other promoter (e.g., cellular promoters such a ⁇ eukaryotic cellular promoters including, but not limited to, the histone, RNA polymerase III, and ⁇ -actin promoters) .
  • CMV cytomegalovirus
  • viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.
  • Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or heterologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter,- heat shock promoters,- the albumin promoter; the ApoAI promoter,- human globin promoters,- viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter,- retroviral LTRs (including the modified retroviral LTRs herein above described) ,- the ⁇ -actin promoter,- and human growth hormone promoters.
  • the promoter also may be the native promoter which controls
  • the retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines.
  • packaging cells which may be transfected include, but are not limited to, the PE501, PA317, Y-2, Y-AM, PA12, T19-14X, VT-19-17- H2, YCRE, YCRIP, GP+E-86, GP+envAml2, and DAN cell lines as described in Miller, A., Human Gene Therapy 1: 5-14 (1990).
  • the vector may be transduced into the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaP04 precipitation.
  • the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then admini ⁇ tered to a host.
  • the producer cell line will generate infectious retroviral vector particles, which include the nucleic acid sequence(s) encoding the polypeptides. Such retroviral vector particles then may be employed to transduce eukaryotic cells, either in vitro in vivo.
  • the transduced eukaryotic cells will expres ⁇ the nucleic acid sequence(s) encoding the polypeptide.
  • Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocyte ⁇ , fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.
  • ligations were accomplished using standard buffers, incubation temperatures and times, approximately equimolar amounts of the DNA fragments to be ligated and approximately 10 units of T4 DNA ligase ("ligase”) per 0.5 ⁇ g of DNA.
  • ligase T4 DNA ligase
  • the DNA sequence encoding human hESF I, II or III in the deposited polynucleotide was amplified u ⁇ ing PCR oligonucleotide primers ⁇ pecific to the amino acid carboxyl terminal sequence of the human hESF I, II or III protein and to vector sequences 3' to the gene. Additional nucleotides containing restriction sites to facilitate cloning were added to the 5' and 3' sequence ⁇ respectively.
  • the 5' oligonucleotide primer had the sequence for hESF I: 5' CGCGCATGCTTGTCTGCCCAGCTG 3' (SEQ ID NO:7) containing the underlined Sph I restriction site, which encodes a start AUG, followed by 15 nucleotides of the human hESF I coding sequence set out in Figure 1 (SEQ ID NO:l) , beginning with the first base of the codon for amino acid 22 (leucine) .
  • hESF II 5' CGCCCATGGAGTTCTGCCCAGCTC 3' (SEQ ID NO:8) containing the underlined Ncol restriction site, which encodes a start ATG, followed by 16 nucleotides of the human hESF II coding sequence set out in Figure 2 (SEQ ID NO:3) , beginning with the first base of the codon for amino acid 22.
  • hESF III 5' CGC GCA TGC ACT GCT ATG CAG ATT 3' (SEQ ID NO:9) containing the underlined SphI restriction site, which encodes a start ATG, followed by 16 nucleotide ⁇ of the human hESF III coding sequence set out in Figure 3 (SEQ ID NO:5) .
  • the 3' primer has the sequence for hESF I 5' 5C_ Se_OATTTTTACATGTCA 3' (SEQ ID NO:10) containing the underlined Hind III restriction site followed by 15 nucleotides complementary to 15 nucleotides of the hESF I non- coding sequence set out in Figure 1 (SEQ ID NO:l), including the stop codon.
  • hESF II 5' ⁇ _ ⁇ AG ⁇ TTAGTTTTTACATGTCA 3' (SEQ ID NO:11) containing the underlined Hind III restriction site followed by 15 nucleotides complementary to the last 15 nucleotides of the hESF II non-coding sequence set out in Figure 2 (SEQ ID NO:3) , including the stop codon.
  • pQE-60 hESF I and II
  • pQE-60 encodes ampicillin antibiotic resistance ("A pr") and contains a bacterial origin of replication ("ori") , an IPTG inducible promoter, a ribosome binding site (“RBS”) , a 6-His tag and restriction enzyme sites.
  • E. coli strain M15/rep4 containing multiple copies of the plasmid pREP4, which expresses lac repressor and confers kanamycin resistance (“Kanr"), was used in carrying out the illustrative example described here.
  • This strain which is only one of many that are suitable for expressing hESF I, II and III is available commercially from Qiagen.
  • Transformants were identified by their ability to grow on LB plates in the presence of a picillin. Plasmid DNA was isolated from resistant colonies and the identity of the cloned DNA was confirmed by restriction analysis.
  • Clones containing the desired constructs were grown overnight ("O/N") in liquid culture in LB media supplemented with both ampicillin (100 ug/ml) and kanamycin (25 ug/ml) .
  • the O/N culture was used to inoculate a large culture, at a dilution of approximately 1:100 to 1:250.
  • the cells were grown to an optical density at 600nm ("OD600") of between 0.4 and 0.6.
  • i ⁇ opropyl-B-D-thiogalactopyrano ⁇ ide (“IPTG”) was then added to a final concentration of 1 mM to induce transcription from lac repressor sensitive promoters, by inactivating the lad repressor.
  • IPTG i ⁇ opropyl-B-D-thiogalactopyrano ⁇ ide
  • IPTG i ⁇ opropyl-B-D-thiogalactopyrano ⁇ ide
  • the 8M urea solution containing the solubilized protein was passed over a PD-10 column in 2X phosphate buffered saline ("PBS") , thereby removing the urea, exchanging the buffer and refolding the protein.
  • PBS 2X phosphate buffered saline
  • the protein was purified by a further step of chromatography to remove endotoxin. Then, it wa ⁇ sterile filtered.
  • the sterile filtered protein preparation was stored in 2X PBS at a concentration of 95 micrograms per L.
  • the cDNA sequence encoding the full length human hESF I, II and III protein, in the deposited clone is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene: for hESF I the 5' primer has the sequence 5' CCCGGATCC GCCATCATGAGGCTGTCAGTGTCT 3' (SEQ ID NO:13) containing the BamHI restriction enzyme site (bold) followed by a kozak sequence (GCC ATC) and 20 base ⁇ of the ⁇ equence of hESF I of Figure 1 (SEQ ID NO-.l) ; for hESF II the 5' primer ha ⁇ the sequence 5' CGC GGA TCC GCC ATC ATG AAG CTG TCG GTG 3' (SEQ ID NO:14) containing the BamHI restriction enzyme site (bold) followed by 15 bases of the sequence of hESF II of Figure 2 (SBQ ID NO:3) ; for hESF
  • the 3' primer has the sequence 5' CCCGGTACC 'ri l'lTl l l l'l I r 3' (SEQ ID NO:16) containing the underlined Asp7l8 restriction site followed by 18 nucleotides complementary to the poly A tail; for hESF II the 3' primer has the sequence 5' CGC GGTACCACGCCTTGGGTAAAGTTA 3' (SEQ ID NO:17) containing the underlined Asp7i8 restriction followed by nucleotides complementary to 15 nucleotides of the hESF II non-coding sequence set out in Figure 2 (SEQ ID NO:3) , including the stop codon; for hESF III the 3' primer has the sequence 5' CGC GGT ACC ACG CCT TGG GTA AAG TTA 3' (SEQ ID NO:18) containing the underlined Asp7l8 restriction followed by nucleotides complementary to 18 nucleotides of the hESF III non-
  • the amplified fragments are isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.) .
  • the fragments then are digested with the respective restriction enzymes and again are purified on a 1% agarose gel. This fragments are designated herein F2.
  • the vector pRGl is used to express the hESF I, II or III protein in the baculovirus expression system, using standard methods, such as those described in Summers et al, A MANUAL OF METHODS FOR BACULOVIRUS VECTORS AND INSECT CELL CULTURE PROCEDURES, Texas Agricultural Experimental Station Bulletin No. 1555 (1987) .
  • This expression vector contains the ⁇ trong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by convenient restriction sites.
  • the polyadenylation site of the simian virus 40 (“SV40") is used for efficient polyadenylation.
  • the beta-galactosidase gene from E.coli is inserted in the same orientation as the polyhedrin promoter and is followed by the polyadenylation signal of the polyhedrin gene.
  • the polyhedrin sequences are flanked at both sides by viral sequences for cell- mediated homologous recombination with wild-type viral DNA to generate viable virus that express the cloned polynucleotide.
  • baculovirus vector ⁇ could be used in place of pA2, such as pAc373, pVL941 and pAcIMl provided, as those of skill readily will appreciate, that construction provides appropriately located signals for transcription, translation, trafficking and the like.
  • pA2 pAc373, pVL941 and pAcIMl provided, as those of skill readily will appreciate, that construction provides appropriately located signals for transcription, translation, trafficking and the like.
  • Such vectors are described in Luckow et al. , Virology 170: 31-39, among others.
  • the plasmid is digested with the respective restriction enzymes and then is dephosphorylated using calf intestinal phosphata ⁇ e, using routine procedures known in the art.
  • the DNA is then isolated from a 1% agarose gel using a commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). This vector DNA is designated herein U V2".
  • Fragments F2 and the dephosphorylated plasmid V2 are ligated together with T4 DNA ligase.
  • E.coli HB101 cells are transformed with ligation mix and spread on culture plates.
  • Bacteria are identified that contain the plasmid with the human hESF I, II or III gene by digesting DNA from individual colonies using the respective restriction enzymes and then analyzing the digestion product by gel electrophoresis. The sequence of the cloned fragment is confirmed by DNA sequencing.
  • Thi ⁇ plasmid is designated herein pBachESF I, II or III.
  • 5 ⁇ g of the plasmid pBachESF I, II or III is co-transfected with 1.0 ⁇ g of a commercially available linearized baculovirus DNA ("BaculoGoldTM baculovirus DNA", Pharmingen, San Diego, CA.), using the lipofection method described by Feigner et al., Proc. Natl. Acad. Sci. USA 84: 7413-7417 (1987).
  • l ⁇ g of BaculoGoldTM virus DNA and 5 ⁇ g of the plasmid pBachESF I, II or III are mixed in a sterile well of a microtiter plate containing 50 ⁇ l of serum free Grace's medium (Life Technologies Inc., Gaithersburg, MD) .
  • plaque assay After four day ⁇ the supernatant is collected and a plaque assay is performed, as described by Summers and Smith, cited above. An agarose gel with "Blue Gal” (Life Technologies Inc., Gaithersburg) is used to allow easy identification and isolation of gal-expressing clones, which produce blue-stained plaques. (A detailed de ⁇ cription of a "plaque assay" of this type can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc. , Gaithersburg, page 9-10) .
  • V-hESF I, II or III A clone containing properly inserted hESF I, II or III i ⁇ identified by DNA analysis including restriction mapping and sequencing. This is designated herein as V-hESF I, II or III.
  • Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS.
  • the cells are infected with the recombinant baculovirus V-hESF I, II or III at a multiplicity of infection ("MOI") of about 2.
  • MOI multiplicity of infection
  • the medium is removed and is replaced with SF900 II medium minus methionine and cysteine (available from Life Technologies Inc., Gaithersburg). 42 hours later, 5 ⁇ Ci of 35S-methionine and 5 ⁇ Ci 35S cysteine (available from Amersham) are added.
  • the cell ⁇ are further incubated for 16 hour ⁇ and then they are harvested by centrifugation, lysed and the labeled proteins are visualized by SDS-PAGE and autoradiography.
  • the expre ⁇ ion pla ⁇ mid, hESF I, II and III HA, i ⁇ made by cloning a cDNA encoding hESF I, II and III into the expression vector pcDNAI/Amp (which can be obtained from Invitrogen, Inc.).
  • the expression vector pcDNAI/amp contains: (1) an E.coli origin of replication effective for propagation in E. coli and other prokaryotic cell; (2) an ampicillin resistance gene for selection of plasmid-containing prokaryotic cell ⁇ ,- (3) an SV40 origin of replication for propagation in eukaryotic cells; (4) a CMV promoter, a polylinker, an SV40 intron, and a polyadenylation signal arranged so that a cDNA conveniently can be placed under expression control of the CMV promoter and operably linked to the SV40 intron and the polyadenylation signal by means of restriction sites in the polylinker.
  • a DNA fragment encoding the entire hESF I, II and III precursor and a HA tag fused in frame to its 3' end is cloned into the polylinker region of the vector so that recombinant protein expression is directed by the CMV promoter.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein described by Wilson et al., Cell 37: 767 (1984) .
  • the fusion of the HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
  • the plasmid construction strategy is as follows:
  • the hESF I, II and III cDNA of the deposit clone is amplified using primers that contained convenient restriction sites, much as described above regarding the construction of expression vectors for expression of hESF I, II and III in E. coli and S. fugiperda.
  • one of the primers contains a heamaglutinin tag ("HA tag") as described above.
  • Suitable primers include that following, which are used in this example:
  • the 5' primer containing the underlined BamHI site, an AUG start codon and has the following sequence.
  • 5' CGC GGA TCC ACC ATG GTC TCG CTG GCC CTT 3' (SEQ ID NO:19) (ESFI);
  • 5' CGC GGA TCC ACC ATG AAG CTG TCG GTG TGT 3' (SEQ ID NO:20) (ESFII) ;
  • the 3' primer containing the underlined Xbal site, stop codon, HA tag and 15 bp of 3' coding sequence (at the 3' end) has the following sequence:
  • the PCR amplified DNA fragment and the vector, pcDNAI/Amp, are digested with and then ligated.
  • the ligation mixture is transformed into E. coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037) the transformed culture is plated on ampicillin media plates which then are incubated to allow growth of ampicillin resistant colonies. Plasmid DNA is isolated from resistant colonies and examined by restriction analysis and gel sizing for the presence of the hESF I, II and Ill-encoding fragment.
  • COS cells are transfected with an expression vector, as described above, using DEAE-DEXTRAN, as described, for instance, in Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, Cold Spring Laboratory Press, Cold Spring Harbor, New York (1989). Cells are incubated under condition ⁇ for expression of hESF I, II and III by the vector.
  • hESF I, II and III HA fusion protein is detected by radiolabelling and immunoprecipitation, using methods described in, for example Harlow et al., ANTIBODIES: A LABORATORY MANUAL, 2nd Ed.,- Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1988) . To this end, two days after transfection, the cells are labeled by incubation in media containing 35S- cysteine for 8 hours.
  • the cells and the media are collected, and the cells are washed and the lysed with detergent-containing RIPA buffer: 150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5, as described by Wilson et al. cited above.
  • Proteins are precipitated from the cell lysate and from the culture media using an HA-specii ' ic monoclonal antibody. The precipitated proteins then are analyzed by SDS-PAGE gels and autoradiography. An expression product of the expected size is seen in the cell lysate, which is not seen in negative controls.
  • RNAzolTM B system Biotecx Laboratories, Inc. 6023 South Loop East, Houston, TX 77033.
  • RNA is isolated from tissue samples. The RNA is size resolved by electrophoresis through a 1% agarose gel under strongly denaturing conditions. RNA is blotted from the gel onto a nylon filter, and the filter then is prepared for hybridization to a detectably labeled polynucleotide probe.
  • the antisense strand of the coding region of the cDNA insert in the deposited clone is labeled to a high specific activity.
  • the cDNA is labeled by primer extension, using the Prime-It kit, available from Stratagene. The reaction is carried out using 50 ng of the cDNA, following the standard reaction protocol as recommended by the supplier.
  • the labeled polynucleotide is purified away from other labeled reaction components by column chromatography using a Select-G-50 column, obtained from 5-Prime - 3-Prime, Inc. of 5603 Arapahoe Road, Boulder, CO 80303.
  • the labeled probe is hybridized to the filter, at a concentration of 1,000,000 cpm/ml, in a small volume of 7% SDS, 0.5 M NaP04, pH 7.4 at 65'C, overnight.
  • the probe solution is drained and the filter is washed twice at room temperature and twice at 60'C with 0.5 x SSC, 0.1% SDS.
  • the filter then is dried and exposed to film at -70 * C overnight with an intensifying screen.
  • Fibroblasts are obtained from a subject by skin biopsy.
  • the resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tis ⁇ ue culture flask, approximately ten pieces are placed in each flask.
  • the flask is turned upside down, closed tight and left at room temperature overnight. After 24 hours at room temperature, the flask is inverted - the chunks of tissue remain fixed to the bottom of the flask - and fresh media is added (e.g. , Ham's F12 media, with 10% FBS, penicillin and streptomycin) .
  • the tissue is then incubated at 37'C for approximately one week. At this time, fresh media is added and subsequently changed every several day ⁇ . After an additional two week ⁇ in culture, a monolayer of fibroblasts emerges. The monolayer is trypsinized and scaled into larger flask ⁇ .
  • a vector for gene therapy is digested with restriction enzymes for cloning a fragment to be expressed.
  • the digested vector is treated with calf intestinal phosphata ⁇ e to prevent self-ligation.
  • the dephosphorylated, linear vector is fractionated on an agarose gel and purified.
  • hESF I, II and III cDNA capable of expressing active hESF I, II and III, is isolated.
  • the ends of the fragment are modified, if necessary, for cloning into the vector. For instance, 5" overhanging may be treated with DNA polymerase to create blunt ends. 3' overhanging ends may be removed using SI nuclease. Linkers may be ligated to blunt ends with T4 DNA ligase.
  • Equal quantities of the Moloney murine leukemia virus linear backbone and the hESF I, II or III fragment are mixed together and joined using T4 DNA ligase.
  • the ligation mixture is used to transform E. Coli and the bacteria are then plated onto agar- containing kanamycin. Kanamycin phenotype and restriction analysi ⁇ confirm that the vector ha ⁇ the properly inserted gene.
  • Packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf serum (CS) , penicillin and streptomycin.
  • DMEM Dulbecco's Modified Eagles Medium
  • CS calf serum
  • penicillin and streptomycin The vector containing the hESF I, II or III gene is introduced into the packaging cells by standard techniques. Infectious viral particles containing the hESF I, II or III gene are collected from the packaging cells, which now are called producer cells.
  • Fresh media is added to the producer cells, and after an appropriate incubation period media is harvested from the plates of confluent producer cells.
  • the media containing the infectious viral particles, is filtered through a Millipore filter to remove detached producer cell ⁇ .
  • the filtered media then i ⁇ used to infect fibrobla ⁇ t cell ⁇ .
  • Media i ⁇ removed from a sub-confluent plate of fibroblasts and quickly replaced with the filtered media.
  • Polybrene (Aldrich) may be included in the media to facilitate transduction. After appropriate incubation, the media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibrobla ⁇ t ⁇ will be infected and no selection is required. If the titer i ⁇ low, then it i ⁇ necessary to use a retroviral vector that ha ⁇ a ⁇ electable marker, ⁇ uch as neo or his, to select out transduced cells for expansion.
  • Engineered fibroblasts then may be injected into rats, either alone or after having been grown to confluence on microcarrier beads, such as cytodex 3 beads.
  • the injected fibroblasts produce hESF I, II or III product, and the biological actions of the protein are conveyed to the host.
  • ADDRESSEE CARELLA, BYRNE, BAIN, GILFILLAN, CECCHI,
  • MOLECULE TYPE DNA (genomic)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention a trait aux polypeptides hESF I, II et III, aux polynucléotides codant pour des polypeptides et à des procédés de production de tels polypeptides par expression notamment des polynucléotides, ainsi qu'à des agonistes et antagonistes desdits polypeptides. L'invention concerne également des procédés d'utilisation de tels polynucléotides, polypeptides, agonistes et antagonistes pour certaines applications se rapportant, entre autres, aux domaines de la recherche diagnostique et clinique.
EP96910504A 1996-03-21 1996-03-21 Facteur i, ii et iii de liaison de steroides specifique a l'endometre humain Withdrawn EP0896614A4 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US1472496P 1996-03-21 1996-03-21
CA002248136A CA2248136A1 (fr) 1996-03-21 1996-03-21 Facteur i, ii et iii de liaison de steroides specifique a l'endometre humain
PCT/US1996/003857 WO1997034997A1 (fr) 1996-03-21 1996-03-21 Facteur i, ii et iii de liaison de steroides specifique a l'endometre humain
US08/821,451 US6066724A (en) 1996-03-21 1997-03-21 Human endometrial specific steroid-binding factor I, II and III

Publications (2)

Publication Number Publication Date
EP0896614A1 true EP0896614A1 (fr) 1999-02-17
EP0896614A4 EP0896614A4 (fr) 1999-05-12

Family

ID=46202877

Family Applications (1)

Application Number Title Priority Date Filing Date
EP96910504A Withdrawn EP0896614A4 (fr) 1996-03-21 1996-03-21 Facteur i, ii et iii de liaison de steroides specifique a l'endometre humain

Country Status (2)

Country Link
EP (1) EP0896614A4 (fr)
AU (1) AU5367996A (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996038463A1 (fr) * 1995-05-31 1996-12-05 Washington University Sequence d'adn et proteine codee du cancer du sein specifique de la glande mammaire

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996038463A1 (fr) * 1995-05-31 1996-12-05 Washington University Sequence d'adn et proteine codee du cancer du sein specifique de la glande mammaire

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
See also references of WO9734997A1 *
WATSON M.A. ET AL.: "Mammaglobin, a mammary-specific member of the Uteroglobin gene family, is overexpressed in human breast cancer" CANCER RESEARCH, vol. 56, 15 February 1996, pages 860-865, XP002048615 *

Also Published As

Publication number Publication date
EP0896614A4 (fr) 1999-05-12
AU5367996A (en) 1997-10-10

Similar Documents

Publication Publication Date Title
US6066724A (en) Human endometrial specific steroid-binding factor I, II and III
US6232291B1 (en) Cytostatin III
US20020127651A1 (en) Human 4-1BB receptor splicing variant
US5780286A (en) Arginase II
US20050186616A1 (en) Human cystatin F
US6338948B1 (en) Human endometrial specific steroid-binding factor I, II and III
US6008022A (en) Human cytokine polypeptide
US5945303A (en) Human hematopoietic-specific protein
US7309780B2 (en) Antibodies to natural killer cell activating factor II
WO1997034013A1 (fr) Cytokine ii chimiotactique
US5919658A (en) Human cystatin F
US20060171918A1 (en) Apoptosis inducing molecule I
US5919660A (en) Human requiem
WO1997036915A1 (fr) Cystatine f humain
WO1997033898A1 (fr) Variante d'epissage de recepteur de 4-1bb chez l'homme
EP0896614A1 (fr) Facteur i, ii et iii de liaison de steroides specifique a l'endometre humain
WO1997037021A1 (fr) Cystatine f humaine
EP0937147A1 (fr) Facteur ii d'activation de cellules tueuses naturelles chez l'homme
WO1997035028A1 (fr) Cytostatine iii
US20040197874A1 (en) Human cytokine polypeptide
US20020119528A1 (en) Chemotactic cytokine III
WO1997027747A1 (fr) Cytostatine i
WO1997033986A1 (fr) Arginase ii

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19981021

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

A4 Supplementary search report drawn up and despatched

Effective date: 19990326

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 20020423

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20050705