WO1997035007A1 - Fibroblast growth factor homologous factor-3 (fhf-3) and methods of use - Google Patents
Fibroblast growth factor homologous factor-3 (fhf-3) and methods of use Download PDFInfo
- Publication number
- WO1997035007A1 WO1997035007A1 PCT/US1997/004641 US9704641W WO9735007A1 WO 1997035007 A1 WO1997035007 A1 WO 1997035007A1 US 9704641 W US9704641 W US 9704641W WO 9735007 A1 WO9735007 A1 WO 9735007A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- fhf
- leu
- ser
- gly
- arg
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
- C07K14/50—Fibroblast growth factors [FGF]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/02—Drugs for disorders of the nervous system for peripheral neuropathies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2799/00—Uses of viruses
- C12N2799/02—Uses of viruses as vector
- C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
- C12N2799/027—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a retrovirus
Definitions
- the invention relates generally to growth factors and specifically to a novel member of the fibroblast growth factor family, denoted fibroblast growth factor homologous factor- 3 (FHF-3) and the polynucleotide encoding FHF-3.
- FHF-3 fibroblast growth factor homologous factor- 3
- the fibroblast growth factor family encompasses a group of structurally related proteins with a wide range of growth promoting, survival, and/or differentiation activities in vivo and in vitro (reviewed in Baird, A., and Gospodarowicz, D. Ann N. Y. Acad. Sci. 638: 1, 1991; Eckenstein, F.P., J. Neurobiology 25: 1467, 1994; Mason, IJ. Cell 78: 547, 1994). As of December 1994, nine members of this family had been characterized by molecular cloning.
- aFGF/FGF-1 acidic fibroblast growth factor
- bFGF/FGF-2 basic fibroblast growth factor
- aFGF/FGF-1 acidic fibroblast growth factor
- bFGF/FGF-2 basic fibroblast growth factor
- FGF family Additional members of the FGF family include: int-2/FGF-3, identified as one of the frequent sites of integration of the mouse mammary tumor virus, and therefore a presumptive oncogenic factor (Smith et al, EMBO J.
- FGF-4 Delli-Bovi et al, Cell 50: 729, 1987
- FGF-5 Zhan et al, Mol Cell Biol.S: 3487, 1988
- FGF-6 isolated by molecular cloning based on its homology to FGF-4 (Maries et al, Oncogene 4: 335 (1989)
- keratinocyte growth factor/ FGF-7 identified as a mitogen for keratinocytes (Finch et al, Science 245: 752, 1989); FGF-8 as an androgen-induced mitogen for mammary carcinoma cells (Tanaka et al, Proc. Natl. Acad. Sci.
- FGF-9 as a mitogen for primary astrocytes (Miyamoto et al, Mol. Cell Biol. 13: 4251, 1993).
- FGFs including aFGF and bFGF, lack a classical signal sequence; the mecha ⁇ nism by which they are secreted is not known.
- aFGF, bFGF, and FGF-7/KGF have been shown to exert some or all of their biological activity through high affinity binding to cell surface tyrosine kinase receptors (e.g., Lee, P. L., et al, Science 245: 57, 1989; reviewed in Johnson, D.E. and Williams, L.T., Adv. Cancer Res. 60: 1, 1993).
- Many members of the FGF family also bind tightly to heparin, and a terniary complex of heparin, FGF, and transmembrane receptor may be the biologically relevant signaling species.
- heparin bind tightly to heparin
- a terniary complex of heparin, FGF, and transmembrane receptor may be the biologically relevant signaling species.
- Identification and characterization of new members of the FGF family will provide insights into the mechanisms by which cells and organs control their growth, survival, senescence, differentiation, and recovery from injury.
- the present invention provides a cell growth, survival or differentiation factor, FHF-3 and a polynucleotide sequence which encodes the factor. This factor is involved in the growth, survival, and or differentiation of cells within the central nervous system (CNS) as well as in peripheral tissues.
- CNS central nervous system
- the invention provides a method for detecting alterations in FHF-3 gene expression which are diagnostic of neurodegenerative or neoplastic disorders.
- the invention provides a method for treating a neurodegenerative or neoplastic disorder by modulating the expression or activity of FHF-3.
- Figure 1 shows the nucleotide and predicted amino acid sequence of human FHF-3 (SEQ. ID NO.T and 2).
- Figure 2 shows the alignment of the amino acid sequence of human FHF-3 and each of the other nine members of the FGF family. conserveed residues are highlighted.
- the FGF family members are: aFGF/FGF-1 (Jaye et al, Science 233: 541, 1986), bFGF/FGF-2 (Abraham et al, Science 233: 545, 1986), int-2/FGF-3 (Smith et al , EMBO J. 7: 1013, 1988), FGF-4 (Delli-Bovi et al, Cell 50: 729, 1987), FGF-5 (Zhan et al, Mol Cell Biol.
- FGF-6 Maries et al, Oncogene 4: 335, 1989
- keratinocyte growth factor/ FGF-7 Finch et al, Science 245: 752, 1989
- FGF-8 Tanaka et al, Proc. Natl Acad. Sci. USA 89: 8928, 1992
- FGF-9 FGF-9
- Figure 3 shows a dendrogram in which the length of each path connecting any pair of FGF family members is proportional to the degree of amino acid sequence divergence of that pair.
- Figure 4 shows that the gene encoding FHF-3 is located on human chromosome 17. The human specific hybridization is found on chromosome 17.
- FIG. 5 shows the tissue specificity of FHF-3 expression.
- Ten micrograms of total RNA from the indicated mouse tissues was prepared (Chomczinski & Sacchi. Anal. Biochem. 162: 156, 1987) and used for RNAse protection (Ausabel et al, Current Protocols in Molecular Biology; New York: Wiley Interscience, 1987) with a mouse FHF-3 antisense probe that spanned 200 bases of cloned cDNA including 70 bases of 5' untranslated sequences and 130 bases at the beginning of the coding region.
- RNAse protection at the size expected was observed most strongly with RNA from brain and eye; weak protection was seen with RNA from lung and testis.
- Figure 6 shows an immunoblot of FHF-3 produced in transiently transfected human embryonic kidney cells (line 293).
- Cells transfected with FHF-3 (right lane) synthesize an immunoreactive polypeptide with an apparent molecular mass of 30 kD that is not found in cells transfected with a related FGF family member (FHF- 2; center lane) or in mock transfected cells (left lane).
- the apparent molecular mass in kD of prestained protein size standards are shown to the left.
- Figures 7a and 7b show the nucleotide and deduced amino acid sequence of FHF- 1 and FHF-2, respectively (SEQ ID NO:6-9).
- the present invention provides a growth factor, FHF-3, and a polynucleotide sequence encoding FHF-3.
- FHF-3 is expressed at high levels in brain and eye tissues, and at a lower level in lung and testes.
- the invention provides a method for detection of a cell proliferative or degenerative disorder of central nervous system which is associated with FHF-3 expression or function.
- the invention provides a method for treating a cell prolifera ⁇ tive or immunologic disorder by using an agent which suppresses or enhances FHF- 3 expression or activity.
- FHF-3 protein of this invention The structural homology between the FHF-3 protein of this invention and the members of the FGF family, indicates that FHF-3 is a new member of the family of growth factors. Based on the known activities of many of the other members, it can be expected that FHF-3 will also possess biological activities that will make it useful as a diagnostic and therapeutic reagent.
- TGF TGF-1
- dorsalin-1 Another family member, namely dorsalin-1, is capable of promoting the differentia- tion of neural crest cells (Basler, et al, Cell, 73:687, 1993).
- the inhibins and activins have been shown to be expressed in the brain (Meunier, et al. , Proc. Nat'l Acad.
- TGF family member namely GDF-1
- GDF-1 is nervous system-specific in its expression pattern (Lee, Proc. Nat'l. Acad. Sci, USA, 88:4250, 1991), and certain other family members, such as Vgr-1 (Lyons, et al, Proc. Nat'l. Acad.
- FHF-3 may also possess activities that relate to the function of the nervous system.
- FHF-3 may have neurotrophic activities for various neuronal populations.
- FHF-3 may have in vitro and in vivo applications in the treatment of neurodegenerative diseases, such as amyotrophic lateral sclerosis, or in maintaining cells or tissues in culture prior to transplantation.
- the present invention provides a substantially pure fibroblast growth factor homologous factor-3 (FHF-3) characterized by having a molecular weight of about 26-28kD as determined by reducing SDS-PAGE and having essentially the amino acid sequence of SEQ ID NO:2 (FIGURE 1).
- FHF-3 substantially pure fibroblast growth factor homologous factor-3
- substantially pure refers to FHF-3 which is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated.
- the substantially pure polypeptide will yield a single major band on a non-reducing polyacrylamide gel.
- the purity of the FHF-3 polypeptide can also be determined by amino-terminal amino acid sequence analysis.
- FHF-3 polypeptide includes functional fragments of the polypeptide, as long as the activity of FHF-3 remains. Smaller peptides containing the biological activity of FHF-3 are included in the invention.
- the invention provides polynucleotides encoding the FHF-3 polypeptide. These polynucleotides include DNA, cDNA and RNA sequences which encode FHF-3. It is understood that all polynucleotides encoding all or a portion of FHF-3 are also included herein, as long as they encode a polypeptide with FHF-3 activity. Such polynucleotides include naturally occurring, synthetic, and intentionally manipulated polynucleotides. For example, FHF-3 polynucleotide may be subjected to site- directed mutagenesis. The polynucleotide sequence for FHF-3 also includes antisense sequences.
- the polynucleotides of the invention include sequences that are degenerate as a result of the genetic code. There are 20 natural amino acids, most of which are specified by more than one codon. Therefore, all degenerate nucleotide sequences are included in the invention as long as the amino acid sequence of FHF-3 polypeptide encoded by the nucleotide sequence is functionally unchanged.
- the sequence contains an open reading frame encoding a polypeptide 225 amino acids in length.
- the human FHF-3 inititiator methionine codon shown in FIGURE 1 at position 74 is the first ATG codon in-frame; a good consensus ribosome binding site (GCGCTATGG; Kozak, Nucleic Acids Res., 15: 8125, 1987) is found at this position.
- the next methionine codon within the open reading frame is encountered 124 codons 3' of the putative initiator methionine codon.
- the amino-terminus of the primary translation product of FHF-3 does not conform to the consensus sequence for a signal peptide to direct cotranslational insertion across the endoplasmic reticulum membrane.
- the FHF-3 sequence lacks potential asn-X-ser/thr sites for asparagine-linked glycos ⁇ ylation.
- the human FHF-3 nucleotide sequence is SEQ ID NO:l and the deduced amino acid sequence is preferably SEQ ID NO:2 (see FIGURE 1).
- the polynucleotide encoding FHF-3 includes SEQ ID NO:l as well as nucleic acid sequences complementary to SEQ ID NO:l.
- a complementary sequence may include an antisense nucleotide.
- the sequence is RNA
- the deoxynucleotides A, G, C, and T of SEQ ID NO:l is replaced by ribonucleotides A, G, C, and U, respectively.
- fragments of the above-described nucleic acid sequences that are at least 15 bases in length, which is sufficient to permit the fragment to selectively hybridize to DNA that encodes the protein of SEQ ID NO:2 under physiological conditions. Specifically, the fragments should hybridize to DNA encoding FHF-3 protein under moderately stringent conditions.
- the FGF family member most homologous to FHF-3 is FGF-9, which shares 30% amino acid identity when aligned with 8 gaps.
- Minor modifications of the FHF-3 primary amino acid sequence may result in proteins which have substantially equivalent activity as compared to the FHF-3 polypeptide described herein.
- Such proteins include those as defined by the term "having essentially the amino acid sequence of SEQ ID NO:2".
- modifications may be deliberate, as by site- directed mutagenesis, or may be spontaneous. All of the polypeptides produced by these modifications are included herein as long as the biological activity of FHF-3 still exists.
- deletion of one or more amino acids can also result in a modification of the structure of the resultant molecule without significantly altering its biological activity. This can lead to the development of a smaller active molecule which would have broader utility. For example, one can remove amino or carboxy terminal amino acids which are not required for FHF-3 biological activity.
- the FHF-3 polypeptide of the invention encoded by the polynucleotide of the invention includes the disclosed sequence (SEQ ID NO:2) and conservative variations thereof.
- the term "conservative variation” as used herein denotes the replacement of an amino acid residue by another, biologically similar residue. Examples of conservative variations include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as the substitution of arginine for lysine, glutamic for aspartic acid, or glutamine for asparagine, and the like.
- the term “conservative variation” also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid provided that antibodies raised to the substituted polypeptide also immunoreact with the unsubstituted polypeptide.
- DNA sequences of the invention can be obtained by several methods. For exam ⁇ ple, the DNA can be isolated using hybridization techniques which are well known in the art. These include, but are not limited to: 1) hybridization of genomic or cDNA libraries with probes to detect homologous nucleotide sequences, 2) poly ⁇ merase chain reaction (PCR) on genomic DNA or cDNA using primers capable of annealing to the DNA sequence of interest, and 3) antibody screening of expression libraries to detect cloned DNA fragments with shared structural features.
- hybridization techniques which are well known in the art. These include, but are not limited to: 1) hybridization of genomic or cDNA libraries with probes to detect homologous nucleotide sequences, 2) poly ⁇ merase chain reaction (PCR) on genomic DNA or cDNA using primers capable of annealing to the DNA sequence of interest, and 3) antibody screening of expression libraries to detect cloned DNA fragments with shared structural features.
- the FHF-3 polynucleotide of the invention is derived from a mammalian organism, and most preferably from human. Screening procedures which rely on nucleic acid hybridization make it possible to isolate any gene sequence from any organism, provided the appropriate probe is available. Oligonucleotide probes, which correspond to a part of the sequence encoding the protein in question, can be synthesized chemically. This requires that short, oligopeptide stretches of amino acid sequence must be known. The DNA sequence encoding the protein can be deduced from the genetic code, however, the degeneracy of the code must be taken into account. It is possible to perform a mixed addition reaction when the se ⁇ quence is degenerate.
- hybridization is preferably performed on either single-stranded DNA or denatured double-stranded DNA.
- Hybridization is particu ⁇ larly useful in the detection of cDNA clones derived from sources where an extremely low amount of mRNA sequences relating to the polypeptide of interest are present.
- stringent hybridization conditions directed to avoid non-specific binding, it is possible, for example, to allow the auto- radiographic visualization of a specific cDNA clone by the hybridization of the target DNA to that single probe in the mixture which is its complete complement (Wallace, et al, Nucl. Acid Res., 9:879, 1981; Maniatis, et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y 1989).
- DNA sequences encoding FHF-3 can also be obtained by: 1) isolation of double-stranded DNA sequences from the genomic DNA; 2) chemical manufacture of a DNA sequence to provide the necessary codons for the polypeptide of interest; and 3) in vitro synthesis of a double-stranded DNA sequence by reverse transcription of mRNA isolated from a eukaryotic donor cell. In the latter case, a double-stranded DNA complement of mRNA is eventually formed which is generally referred to as cDNA.
- genomic DNA isolates are the least common. This is especially true when it is desirable to obtain the microbial expression of mammalian polypeptides due to the presence of introns.
- DNA sequences are frequently the method of choice when the entire sequence of amino acid residues of the desired polypeptide product is known.
- the direct synthesis of DNA sequences is not possible and the method of choice is the synthesis of cDNA sequences.
- the standard procedures for isolating cDNA sequences of interest is the formation of plasmid- or phage-carrying cDNA libraries which are derived from reverse transcription of mRNA which is abundant in donor cells that have a high level of genetic expression. When used in combination with polymerase chain reaction technology, even rare expression products can be cloned.
- the production of labeled single or double- stranded DNA or RNA probe sequences duplicating a sequence putatively present in the target cDNA may be employed in DNA/DNA hybridization procedures which are carried out on cloned copies of the cDNA which have been denatured into a single-stranded form (Jay, et al, Nucl. Acid Res., 11:2325, 1983).
- a cDNA expression library such as lambda gtl l, can be screened indirectly for FHF-3 peptides having at least one epitope, using antibodies specific for FHF-3.
- Such antibodies can be either polyclonally or monoclonally derived and used to detect expression product indicative of the presence of FHF-3 cDNA.
- DNA sequences encoding FHF-3 can be expressed in vitro by DNA transfer into a suitable host cell.
- "Host cells” are cells in which a vector can be propagated and its DNA expressed.
- the term also includes any progeny of the subject host cell. It is understood that all progeny may not be identical to the parental cell since there may be mutations that occur during replication. However, such progeny are included when the term "host cell” is used. Methods of stable transfer, meaning that the foreign DNA is continuously maintained in the host, are known in the art.
- the FHF-3 polynucleotide sequences may be inserted into a recombinant expression vector.
- recombinant expression vector refers to a plasmid, virus or other vehicle known in the art that has been manipulated by insertion or incorporation of the FHF-3 genetic sequences.
- Such expression vectors contain a promoter sequence which facilitates the efficient transcription of the inserted genetic sequence of the host.
- the expression vector typically contains an origin of replication, a promoter, as well as specific genes which allow phenotypic selection of the transformed cells.
- Vectors suitable for use in the present invention include, but are not limited to the T7-based expression vector for expression in bacteria (Rosenberg, et al., Gene, 56:125, 1987), the pMSXND expression vector for expression in mammalian cells (Lee and Nathans, J. Biol. Chem., 263:3521 , 1988) and baculovirus-derived vectors for expression in insect cells.
- the DNA segment can be present in the vector operably linked to regulatory elements, for example, a promoter (e.g., T7, metal lothionein I, or polyhedrin promoters).
- Polynucleotide sequences encoding FHF-3 can be expressed in either prokaryotes or eukaryotes.
- Hosts can include microbial, yeast, insect and mammalian organisms. Methods of expressing DNA sequences having eukaryotic or viral sequences in prokaryotes are well known in the art.
- Biologically functional viral and plasmid DNA vectors capable of expression and replication in a host are known in the art. Such vectors are used to incorporate DNA sequences of the invention.
- Transformation of a host cell with recombinant DNA may be carried out by conventional techniques as are well known to those skilled in the art.
- the host is prokaryotic, such as E. coli
- competent cells which are capable of DNA uptake can be prepared from cells harvested after exponential growth phase and subsequently treated by the CaCl 2 method using procedures well known in the art.
- MgCl 2 or RbCl can be used. Transformation can also be performed after forming a protoplast of the host cell if desired.
- Eukaryotic cells can also be cotransformed with DNA sequences encoding the FHF-3 of the invention, and a second foreign DNA molecule encoding a selectable phenotype, such as the herpes simplex thymidine kinase gene.
- Another method is to use a eukaryotic viral vector, such as simian virus 40 (SV40) or bovine papilloma virus, to transiently infect or transform eukaryotic cells and express the protein, (see for example, Eukaryotic Viral Cold Spring Harbor Laboratory, Gluzman ed., 1982).
- Isolation and purification of microbial expressed polypeptide, or fragments thereof, provided by the invention may be carried out by conventional means including preparative chromatography and immunological separations involving monoclonal or polyclonal antibodies.
- the FHF-3 polypeptides of the invention can also be used to produce antibodies which are immunoreactive or bind to epitopes of the FHF-3 polypeptides.
- Anti ⁇ body which consists essentially of pooled monoclonal antibodies with different epitopic specificities, as well as distinct monoclonal antibody preparations are provided.
- Monoclonal antibodies are made from antigen containing fragments of the protein by methods well known in the art (Kohler, et al, Nature, 256:495, 1975; Current Protocols in Molecular Biology, Ausubel, et al, ed., 1989).
- antibody as used in this invention includes intact molecules as well as fragments thereof, such as Fab, F(ab') 2 , and Fv which are capable of binding the epitopic determinant. These antibody fragments retain some ability to selectively bind with its antigen or receptor and are defined as follows:
- Fab the fragment which contains a monovalent antigen-binding fragment of an antibody molecule can be produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain;
- Fab' the fragment of an antibody molecule can be obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain; two Fab' fragments are obtained per antibody mole ⁇ cule;
- (Fab') 2 the fragment of the antibody that can be obtained by treating whole antibody with the enzyme pepsin without subsequent reduction
- F(ab') 2 is a dimer of two Fab' fragments held together by two disulfide bonds
- Fv defined as a genetically engineered fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains
- Single chain antibody defined as a genetically engineered molecule containing the variable region of the light chain, the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule.
- epitopic determinants means any antigenic determinant on an antigen to which the paratope of an antibody binds.
- Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics.
- Antibodies which bind to the FHF-3 polypeptide of the invention can be prepared using an intact polypeptide or fragments containing small peptides of interest as the immunizing antigen.
- the polypeptide or a peptide used to immunize an animal can be derived from translated cDNA (see for example, EXAMPLES 4 and 6) or chemical synthesis which can be conjugated to a carrier protein, if desired.
- carrier protein if desired.
- Such commonly used carriers which are chemically coupled to the peptide include keyhole limpet hemocyanin (KLH), thyroglobulin, bovine serum albumin (BSA), and tetanus toxoid.
- the coupled peptide is then used to immunize the animal (e.g., a mouse, a rat, or a rabbit).
- polyclonal or monoclonal antibodies can be further purified, for exam ⁇ ple, by binding to and elution from a matrix to which the polypeptide or a peptide to which the antibodies were raised is bound.
- Those of skill in the art will know of various techniques common in the immunology arts for purification and/or concentration of polyclonal antibodies, as well as monoclonal antibodies (See for example, Coligan, et al. , Unit 9, Current Protocols in Immunology, Wiley I- nterscience, 1994, incorporated by reference).
- an anti-idiotypic monoclonal antibody made to a first monoclonal antibody will have a binding domain in the hypervariable region which is the "image" of the epitope bound by the first mono ⁇ clonal antibody.
- cell-proliferative disorder denotes malignant as well as non-malignant cell populations which often appear to differ from the surrounding tissue both morphologically and genotypically.
- Malignant cells i.e. cancer
- the FHF-3 polynucleotide that is an antisense molecule is useful in treating malignancies of the various organ systems, particularly, for example, cells in the central nervous system, including neural tissue, testes, and cells of the eye.
- any disorder which is etiologically linked to altered expression of FHF-3 could be considered susceptible to treatment with a FHF-3 suppressing reagent.
- One such disorder is a malignant cell proliferative disorder, for example.
- an antibody or nucleic acid probe specific for FHF-3 may be used to detect FHF-3 polypeptide (using antibody) or polynucleotide (using nucleic acid probe) in biological fluids or tissues.
- the invention provides a method for detecting a cell proliferative disorder of neural tissue or testes, for example, which comprises contacting an anti-FHF-3 antibody or nucleic acid probe with a cell suspected of having a FHF-3 associated disorder and detecting binding to the antibody or nucleic acid probe.
- the antibody reactive with FHF-3 or the nucleic acid probe is preferably labeled with a compound which allows detection of binding to FHF-3. Any specimen containing a detectable amount of antigen or polynucleotide can be used.
- a preferred sample of this invention is CNS, e.g. , neural tissue or cerebrospinal fluid or eye tissue.
- the level of FHF-3 in the suspect cell can be compared with the level in a normal cell to determine whether the subject has a FHF-3-associated cell proliferative disorder.
- the subject is human.
- PCR polymerase chain reaction
- LAT ligated activated transcription
- NASBA nucleic acid sequence-based amplification
- the antibodies of the invention can be used in any subject in which it is desirable to administer in vitro or in vivo immunodiagnosis or immunotherapy.
- the antibod ⁇ ies of the invention are suited for use, for example, in immunoassays in which they can be utilized in liquid phase or bound to a solid phase carrier.
- the antibodies in these immunoassays can be detectably labeled in various ways. Examples of types of immunoassays which can utilize antibodies of the invention are competitive and non-competitive immunoassays in either a direct or indirect format. Examples of such immunoassays are the radioimmunoassay (RIA) and the sandwich (immunometric) assay.
- RIA radioimmunoassay
- sandwich immunometric
- Detection of the antigens using the antibodies of the invention can be done utilizing immunoassays which are run in either the forward, reverse, or simultaneous modes, including immunohistochemical assays on physiological samples. Those of skill in the art will know, or can readily discern, other immunoassay formats without undue experimentation.
- the antibodies of the invention can be bound to many different carriers and used to detect the presence of an antigen comprising the polypeptide of the invention. Examples of well-known carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, agaroses and magnetite. The nature of the carrier can be either soluble or insoluble for purposes of the invention. Those skilled in the art will know of other suitable carriers for binding antibodies, or will be able to ascertain such, using routine experimentation.
- labels and methods of labeling known to those of ordinary skill in the art.
- Examples of the types of labels which can be used in the present invention include enzymes, radioisotopes, fluorescent compounds, colloidal metals, chemiluminescent compounds, phosphorescent compounds, and biolumines- cent compounds.
- Those of ordinary skill in the art will know of other suitable labels for binding to the antibody, or will be able to ascertain such, using routine experimentation.
- Another technique which may also result in greater sensitivity consists of coupling the antibodies to low molecular weight haptens. These haptens can then be specifically detected by means of a second reaction. For example, it is common to use such haptens as biotin, which reacts with avidin, or dinitrophenyl, puridoxal, and fluorescein, which can react with specific antihapten antibodies.
- the detectably labeled antibody is given a dose which is diagnostically effective.
- diagnostically effective means that the amount of detectably labeled monoclonal antibody is administered in sufficient quantity to enable detection of the site having the antigen comprising a polypeptide of the invention for which the monoclonal antibodies are specific.
- concentration of detectably labeled monoclonal antibody which is administered should be sufficient such that the binding to those cells having the polypeptide is detectable compared to the background. Further, it is desirable that the detectably labeled monoclonal antibody be rapidly cleared from the circulatory system in order to give the best target-to-background signal ratio.
- the dosage of detectably labeled monoclonal antibody for in vivo diagnosis will vary depending on such factors as age, sex, and extent of disease of the individual. Such dosages may vary, for example, depending on whether multiple injections are given, antigenic burden, and other factors known to those of skill in the art.
- a radioisotope used for in vivo imaging will lack a particle emission, but produce a large number of photons in the 140-250 keV range, which may readily be detected by conventional gamma cameras.
- radioisotopes may be bound to immunoglobulin either directly or indirectly by using an intermediate functional group.
- Intermediate functional groups which often are used to bind radioisotopes which exist as metallic ions to i- mmunoglobulins are the bifunctional chelating agents such as d- iethylenetriaminepentacetic acid (DTPA) and ethylenediaminetetraacetic acid (EDTA) and similar molecules.
- DTPA d- iethylenetriaminepentacetic acid
- EDTA ethylenediaminetetraacetic acid
- Typical examples of metallic ions which can be bound to the monoclonal antibodies of the invention are lu In, 97 Ru, 67 Ga, 68 Ga, 72 As, 89 Zr, and 201 Tl.
- the monoclonal antibodies of the invention can also be labeled with a paramag ⁇ netic isotope for purposes of in vivo diagnosis, as in magnetic resonance imaging (MRI) or electron spin resonance (ESR).
- MRI magnetic resonance imaging
- ESR electron spin resonance
- any conventional method for visualizing diagnostic imaging can be utilized.
- gamma and positron emitting radioisotopes are used for camera imaging and paramagnetic isotopes for MRI.
- Elements which are particularly useful in such techniques include 157 Gd, 55 Mn, 162 Dy, 52 Cr, and 56 Fe.
- the monoclonal antibodies or polynucleotides of the invention can be used in vitro and in vivo to monitor the course of amelioration of a FHF-3 -associated disease in a subject.
- a particular therapeutic regimen aimed at ameliorat ⁇ ing the FHF-3-associated disease is effective.
- the term "ameliorate” denotes a lessening of the detrimental effect of the FHF-3 -associated disease in the subject receiving therapy.
- the present invention identifies a nucleotide sequence that can be expressed in an altered manner as compared to expression in a normal cell, therefore it is possible to design appropriate therapeutic or diagnostic techniques directed to this sequence.
- Detection of elevated levels of FHF-3 expression is accomplished by hybridization of nucleic acids isolated from a cell suspected of having an FHF-3 associated proliferative disorder with an FHF-3 polynucleotide of the invention. Analysis, such as Northern Blot analysis, are utilized to quantitate expression of FHF-3. Other standard nucleic acid detection techniques will be known to those of skill in the art.
- Treatment of an FHF-3 associated cell proliferative disorder include modulation of FHF-3 gene expression and FHF-3 activity.
- modulate envisions the suppression of expression of FHF-3 when it is over-expressed, or augmentation of FHF-3 expression when it is under-expressed.
- nucleic acid sequences that interfere with FHF-3 expression at the translational level can be used. This approach utilizes, for example, antisense nucleic acid, ribozymes, or triplex agents to block transcription or translation of a specific FHF-3 mRNA, either by masking that mRNA with an antisense nucleic acid or triplex agent, or by cleaving it with a ribozyme.
- disorders include neurodegenerative diseases, for example.
- Antisense nucleic acids are DNA or RNA molecules that are complementary to at least a portion of a specific mRNA molecule (Weintraub, Scientific American, 262:40, 1990). In the cell, the antisense nucleic acids hybridize to the correspond ⁇ ing mRNA, forming a double-stranded molecule. The antisense nucleic acids interfere with the translation of the mRNA, since the cell will not translate a mRNA that is double-stranded. Antisense oligomers of about 15 nucleotides are preferred, since they are easily synthesized and are less likely to cause problems than larger molecules when introduced into the target FHF- 3 -producing cell. The use of antisense methods to inhibit the in vitro translation of genes is well known in the art (Marcus- Sakura, AnalBiochem. , 172:289, 1988).
- triplex strategy Use of an oligonucleotide to stall transcription is known as the triplex strategy since the oligomer winds around double-helical DNA, forming a three-strand helix. Therefore, these triplex compounds can be designed to recognize a unique site on a chosen gene (Maher, et al, Antisense Res. and Dev., 1£3):227, 1991; Helene, C, Anticancer Drug Design, 6(6):569, 1991).
- Ribozymes are RNA molecules possessing the ability to specifically cleave other single-stranded RNA in a manner analogous to DNA restriction endonucleases. Through the modification of nucleotide sequences which encode these RNAs, it is possible to engineer molecules that recognize specific nucleotide sequences in an RNA molecule and cleave it (Cech, J.Amer.Med. Assn., 260:3030, 1988). A major advantage of this approach is that, because they are sequence-specific, only mRNAs with particular sequences are inactivated.
- Tetrahymena-type ribozymes 5 recognize sequences which are four bases in length, while “hammerhead”-type ribozymes recognize base sequences 11-18 bases in length.
- the longer the recogni ⁇ tion sequence the greater the likelihood that the sequence will occur exclusively in the target mRNA species. Consequently, hammerhead-type ribozymes are prefera ⁇ ble to tetrahymena-type ribozymes for inactivating a specific mRNA species and 10 18-based recognition sequences are preferable to shorter recognition sequences.
- the present invention also provides gene therapy for the treatment of cell prolifera ⁇ tive or immunologic disorders which are mediated by FHF-3 protein. Such therapy would achieve its therapeutic effect by introduction of the FHF-3 antisense polynu ⁇ cleotide into cells having the proliferative disorder. Delivery of antisense FHF-3 15 polynucleotide can be achieved using a recombinant expression vector such as a chimeric virus or a colloidal dispersion system. Especially preferred for therapeutic delivery of antisense sequences is the use of targeted liposomes.
- RNA virus such as a 0 retrovirus
- retroviral vector is a derivative of a murine or avian retrovirus.
- retroviral vectors in which a single foreign gene can be inserted include, but are not limited to: Moloney murine leukemia virus (- MoMuLV), Harvey murine sarcoma virus (HaMuSV), murine mammary tumor virus (MuMTV), and Rous Sarcoma Virus (RSV).
- a vector such as the gibbon ape leukemia virus (GaLV) is utilized.
- GaLV gibbon ape leukemia virus
- retroviral vectors can inco ⁇ orate multiple genes. All of these vectors can transfer or inco ⁇ orate a gene for a selectable marker so that transduced cells can be identified and generated.
- the vector is now target specific.
- Retroviral vectors can be made target specific by attaching, for example, a sugar, a glycolipid, or a protein. Preferred targeting is accomplished by using an antibody to target the retroviral vector.
- helper cell lines that contain piasmids encoding all of the structural genes of the retrovirus under the control of regulatory sequences within the LTR. These piasmids are missing a nucleotide sequence which enables the packaging mecha ⁇ nism to recognize an RNA transcript for encapsidation.
- Helper cell lines which have deletions of the packaging signal include, but are not limited to ⁇ 2, PA317 and PA 12, for example. These cell lines produce empty virions, since no genome is packaged. If a retroviral vector is introduced into such cells in which the packaging signal is intact, but the structural genes are replaced by other genes of interest, the vector can be packaged and vector virion produced.
- NIH 3T3 or other tissue culture cells can be directly transfected with piasmids encoding the retroviral structural genes gag, pol and env, by conventional calcium phosphate transfection. These cells are then transfected with the vector plasmid containing the genes of interest. The resulting cells release the retroviral vector into the culture medium.
- Another targeted delivery system for FHF-3 antisense polynucleotides is a colloidal dispersion system. Colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. The preferred colloidal system of this invention is a liposome.
- Liposomes are artificial membrane vesicles which are useful as delivery vehicles in vitro and in vivo. It has been shown that large unilamellar vesicles (LUV), which range in size from 0.2-4.0 ⁇ m can encapsulate a substantial percentage of an aqueous buffer containing large macromolecules. RNA, DNA and intact virions can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form (Fraley, et al, Trends Biochem. Sci., 6:77, 1981). In addition to mammalian cells, liposomes have been used for delivery of polynucleotides in plant, yeast and bacterial cells.
- LUV large unilamellar vesicles
- a liposome In order for a liposome to be an efficient gene transfer vehicle, the following characteristics should be present: (1) encapsulation of the genes of interest at high efficiency while not compromising their biological activity; (2) preferential and substantial binding to a target cell in comparison to non-target cells; (3) delivery of the aqueous contents of the vesicle to the target cell cytoplasm at high efficiency; and (4) accurate and effective expression of genetic information (Mannino, et al. , B- iotechniques, 6:682, 1988).
- composition of tbe liposome is usually a combination of phospholipids, particularly high-phase-transition-temperature phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used.
- the physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations.
- lipids useful in liposome production include phosphatidyl compounds, such as phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides.
- phosphatidyl compounds such as phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides.
- Particu ⁇ larly useful are diacylphosphatidylglycerols, where the lipid moiety contains from 14-18 carbon atoms, particularly from 16-18 carbon atoms, and is saturated.
- Illustrative phospholipids include egg phosphatidylcholine, dipalmitoylphosphatidylcholine and distearoylphosphatidylcholine.
- the targeting of liposomes can be classified based on anatomical and mechanistic factors.
- Anatomical classification is based on the level of selectivity, for example, organ-specific, cell-specific, and organelle-specific.
- Mechanistic targeting can be distinguished based upon whether it is passive or active. Passive targeting utilizes the natural tendency of liposomes to distribute to cells of the reticulo-endothelial system (RES) in organs which contain sinusoidal capillaries.
- RES reticulo-endothelial system
- Active targeting involves alteration of the liposome by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein, or by changing the composition or size of the liposome in order to achieve targeting to organs and cell types other than the naturally occurring sites of localization.
- a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein
- the surface of the targeted delivery system may be modified in a variety of ways.
- lipid groups can be inco ⁇ o ⁇ rated into the lipid bilayer of the liposome in order to maintain the targeting ligand in stable association with the liposomal bilayer.
- Various linking groups can be used for joining the lipid chains to the targeting ligand.
- FHF-3 Due to the expression of FHF-3 in the testes, eye and brain, or neural tissue, there are a variety of applications using the polypeptide, polynucleotide, and antibodies of the invention, related to these tissues. Such applications include treatment of cell proliferative, degenerative, and immunologic disorders involving these and other tissues. In addition, FHF-3 may be useful in various gene therapy proce- dures.
- FHF-3 Due to the high level of expression of FHF-3 in the testes, there are a variety of applications using the polypeptide, polynucleotide, and antibodies of the invention related to this tissue. Such applications include treatment of cell proliferative disorders associated with FHF-3 expression in the testes. Various testicular developmental or acquired disorders can also be subject to FHF-3 applications. These may include, but are not limited to viral infection (e.g., viral orchitis), autoimmunity, sperm production or dysfunction, trauma, and testicular tumors. The presence of high levels of FHF-3 in the testis suggests that FHF-3 or an analogue of FHF-3 could be used to increase or decrease male fertility.
- the identification of a novel member of the FGF family provides a useful tool for diagnosis, prognosis and therapeutic strategies associated with FHF-3 mediated disorders.
- Measurement of FHF-3 levels using anti-FHF-3 antibodies is a useful diagnostic for following the progression or recovery from diseases of the nervous system, including: cancer, stroke, neurodegenerative diseases such as Parkinson's disease or Alzheimer's disease, retinal diseases such as retinitis pigmentosa, or viral encephalitis.
- FHF-3 FHF-3 in the central nervous system
- the observed low level of FHF-3 in a number of peripheral tissues could reflect FHF-3 in peripheral nerve and a presence in sensory neurons in the dorsal root and trigeminal ganglia, and therefore measurement of FHF-3 levels using anti-FHF-3 antibodies could be diagnostic for peripheral neuropathy.
- the presence of high levels of FHF-3 in the testis suggests that measurement of FHF-3 levels using anti-FHF-3 antibodies could be diagnostic for testicular cancer.
- FHF-3 likely has mitogenic and or cell survival activity, therefore FHF-3 or an analogue that mimics FHF-3 action could be used to promote tissue repair or replacement.
- FHF-3 in the CNS suggests such a therapeutic role in diseases of the nervous system, including: stroke, neurodegenerative diseases such as Parkinson's disease or Alzheimer's disease, or in retinal degenerative diseases such as retinitis pigmentosa or macular degeneration, or in peripheral neuropathies.
- blocking FHF-3 action either with anti-FHF-3 antibodies or with an FHF-3 antagonist might slow or ameliorate diseases in which excess cell growth is pathological, most obviously cancer.
- an adult human retina cD A library constructed in lambda gtlO (Nathans, et al, Science 232: 193, 1986) was amplified, and the cDNA inserts were excised en mass by cleavage with EcoR I and purified free of the vector by agarose gel electrophoresis.
- a synthetic oligonucleotide containing an EcoR I site at its 5' end and six random nucleotides at its 3' end (5' GACGAGATATTAGAATTCTACTCGNNNNNN) (SEQ ID NO:3) was used to prime two sequential rounds of DNA synthesis in the presence of the Klenow fragment of E. coli DNA polymerase.
- the resulting duplex molecules were amplified using the polymerase chain reaction (PCR) with a primer corresponding to the unique 5' flanking sequence (5' CCCCCCCCCGACGAGATATTAGAATTCTACTCG) (SEQ ID NO:4).
- PCR polymerase chain reaction
- SEQ ID NO:4 a primer corresponding to the unique 5' flanking sequence
- FHF-1 fibroblast growth factor homologous factor-1
- FHF-1 and FHF-2 amino acid sequences were used to screen the publicly available Genbank database of conceptually translated DNA sequences (DBEST) for amino acid sequences with statistically significant similarity.
- DBEST accession number 76387 A short region of human genomic DNA (DBEST accession number 76387) was found to have a translated sequence with significant homology to approximately 25% of the FHF-1 and FHF-2 amino acid sequences. This genomic segment was one among many genomic segments that were used as landmarks during the search for the breast cancer susceptibility gene on chromosome 17.
- Synthetic DNA primers based on sequence 76387 were used to amplify part of that region from human genomic DNA and from cDNA derived from the human retina. These PCR products were then used as probes to isolate full length cDNA clones from the the human retina cDNA library described above.
- EXAMPLE 2 DEDUCED PRIMARY STRUCTURE OF FHF-3
- Figure 1 shows the sequence of human FHF-3 deduced from the nucleotide sequences of two independent human retina cDNA clones.
- the primary translation product of human FHF-3 is predicted to be 225 amino acids in length.
- the human FHF-3 initiator methionine codon shown in Figure 1 at position 74 is the first in- frame ATG codon; a good consensus ribosome binding site (GCGCTATGG (SEQ ID NO:5); Kozak, Nucleic Acids Res. 15: 8125. 1987) is found at this position.
- the next methionine codon within the open reading frame is encountered 124 codons 3' of the putative initiator methionine codon.
- the amino-terminus of the primary translation product of FHF-3 does not conform to the consensus sequence for a signal peptide to direct cotranslational insertion across the endoplasmic reticulum membrane.
- the FHF-3 sequence lacks asn-X-ser/thr sites for asparagine-linked glycosylation.
- the chromosomal location of FHF-3 was determined by probing a Southern blot containing restriction enzyme digested DNA derived from a panel of 24 hu- man-mouse and human-hamster cell lines, each containing a different human chromosome (Oncor, Gaithersburg, MD). As seen in Figure 4, hybridization of the human FHF-3 probe to human, mouse, and hamster genomic DNA produces distinct hybridizing fragment sizes. Among the hybrid panels, the human-specific hybridization pattern is seen only in the lane corresponding to the hybrid cell line carrying human chromosome 17.
- FHF-3 mRNA To determine the tissue distribution of FHF-3 mRNA, RNase protection analysis was performed on total RNA from mouse brain, eye, heart, kidney, liver, lung, spleen, and testis, as well as a yeast tRNA negative control.
- the probe used was derived from a segment of the mouse FHF-3 gene isolated from a mouse eye cDNA library by hybridization with the full-length human FHF-3 cDNA. As seen in Figure 5, the highest levels of FHF-3 expression are in the brain and eye. Low levels of FHF-3 expression were detected in lung and testis on a longer exposure of the autoradiogram.
- FIG 6 shows an immunoblot of FHF-3 produced in transiently transfected human embryonic kidney cells (line 293).
- Anti-FHF-3 antibodies were raised against a fusion protein containing the gene 10 protein from bacteriophage T7 joined at the carboxy-terminus to the entire FHF-3 protein (Studier and Moffatt, J. Molec. Biol. 189:113. 1986).
- the resulting fusion protein was purified by preparative polyacryl ⁇ amide gel electrophoresis and injected into rabbits.
- the complete open reading frame was inserted into the eukaryotic expression vector pCIS (Gorman, et al, DNA Protein Eng. Tech., 2:3, 1990).
- the region immediately 5' of the initiator methionine coding was converted to an optimal ribosome binding site (CCACCATGG) by PCR amplification with a primer that carried the desired sequence.
- SV40 simian virus 40
- pRSV-TAg large T- antigen
- cells transfected with FHF-3 (right lane) synthesize an immuno ⁇ reactive polypeptide with an apparent molecular mass of 30 kD that is not found in cells transfected with a related FGF family member (FHF-2; center lane) or in mock transfected cells (left lane).
- the apparent molecular mass in kD of prestained protein size standards are shown to the left.
- the apparent molecular mass of recombinant FHF-3 is 5 kD higher that the predicted molecular mass of the primary translation product (25 kD), a discrepancy that most likely reflects the high isoelectric point (10.275) of the protein.
- GAATTCCGGC TCTTGGGGAG CCCAGCGCGC TCCGGGCGCC TGCCGGTTTG GGGGTGTCTC 60
- CAAGACGTGC CTGGGACCGC CCCGCCCCGC CCCCCGGCCG CCAGAGGTTG GGGAAGTTTA 120
- AGC GGC CGC AAG AGG CCG GTG AGG CGG AGA CCA GAA CCC CAG CTC AAA 544 Ser Gly Arg Lys Arg Pro Val Arg Arg Arg Pro Glu Pro Gin Leu Lys 300 305 310
- GATTCTGCAC TCAAAATCTT CCTTTGTGTA GGACAAGAAA ATTGAACCAA AGCTTGCTTG 1251
- CTGAGCCCCC TCCTTGGCTG AAGCCCGAGT GCGGAGAAGC CCGGGCAAAC GCAGGCTAAG 240 GAGACCAAAG CGGCGAAGTC GCGAGACAGC GGACAAGCAG CGGAGGAGAA GGAGGAGGAG300
- GGC AAG ACC AGC TGC GAC AAA AAC AAG TTA AAT GTC TTT TCC CGG GTC 499
- MOLECULE TYPE protein
- MOLECULE TYPE protein
Abstract
Description
Claims
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP97916166A EP0935654A4 (en) | 1996-03-21 | 1997-03-21 | Fibroblast growth factor homologous factor-3 (fhf-3) and methods of use |
AU23415/97A AU719538B2 (en) | 1996-03-21 | 1997-03-21 | Fibroblast growth factor homologous factor-3 (FHF-3) and methods of use |
JP09533753A JP2000509965A (en) | 1996-03-21 | 1997-03-21 | Fibroblast growth factor homologous factor-3 (FHF-3) and method of use |
IL12629897A IL126298A0 (en) | 1996-03-21 | 1997-03-21 | Fibroblast growht factor homologous factor-3 (fhf-3) and method of use |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US62114396A | 1996-03-21 | 1996-03-21 | |
US08/621,143 | 1996-03-21 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1997035007A1 true WO1997035007A1 (en) | 1997-09-25 |
Family
ID=24488909
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1997/004641 WO1997035007A1 (en) | 1996-03-21 | 1997-03-21 | Fibroblast growth factor homologous factor-3 (fhf-3) and methods of use |
Country Status (6)
Country | Link |
---|---|
EP (1) | EP0935654A4 (en) |
JP (1) | JP2000509965A (en) |
AU (1) | AU719538B2 (en) |
CA (1) | CA2249179A1 (en) |
IL (1) | IL126298A0 (en) |
WO (1) | WO1997035007A1 (en) |
Cited By (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0825996A1 (en) * | 1995-05-12 | 1998-03-04 | The Johns Hopkins University School Of Medicine | Fibroblast growth factor homologous factor-1 (fhf-1) and methods of use |
EP0832109A1 (en) * | 1995-05-12 | 1998-04-01 | The Johns Hopkins University School Of Medicine | Fibroblast growth factor homologous factor-2 and methods of use |
EP0960117A1 (en) * | 1996-08-30 | 1999-12-01 | The Johns Hopkins University School Of Medicine | FIBROBLAST GROWTH FACTOR HOMOLOGOUS FACTORS (FHFs) AND METHODS OF USE |
US6110893A (en) * | 1995-06-05 | 2000-08-29 | Human Genome Sciences, Inc. | Fibroblast growth factor 11 |
WO2000073452A2 (en) * | 1999-06-02 | 2000-12-07 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
US6605441B1 (en) | 1995-06-05 | 2003-08-12 | Human Genome Sciences, Inc. | Antibodies against fibroblast growth factor 11 |
US6787640B2 (en) | 1995-06-05 | 2004-09-07 | Human Genome Sciences, Inc. | Fibroblast growth factor 14 |
CN112625140A (en) * | 2020-12-22 | 2021-04-09 | 北京致力生科科技有限公司 | PEP-1-G4S-KGF2 fusion protein and coding gene and application thereof |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1996039509A1 (en) * | 1995-06-05 | 1996-12-12 | Human Genome Sciences, Inc. | Fibroblast growth factor 15 |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1996039506A1 (en) * | 1995-06-05 | 1996-12-12 | Human Genome Sciences, Inc. | Fibroblast growth factor-14 |
US6020189A (en) * | 1996-08-30 | 2000-02-01 | The Johns Hopkins University School Of Medicine | Fibroblast growth factor homologous factors (FHFs) and methods of use |
-
1997
- 1997-03-21 EP EP97916166A patent/EP0935654A4/en not_active Ceased
- 1997-03-21 WO PCT/US1997/004641 patent/WO1997035007A1/en not_active Application Discontinuation
- 1997-03-21 JP JP09533753A patent/JP2000509965A/en not_active Ceased
- 1997-03-21 AU AU23415/97A patent/AU719538B2/en not_active Ceased
- 1997-03-21 IL IL12629897A patent/IL126298A0/en unknown
- 1997-03-21 CA CA002249179A patent/CA2249179A1/en not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1996039509A1 (en) * | 1995-06-05 | 1996-12-12 | Human Genome Sciences, Inc. | Fibroblast growth factor 15 |
Non-Patent Citations (2)
Title |
---|
PROC. NATL. ACAD. SCI. U.S.A., September 1996, Vol. 93, SMALLWOOD et al., "Fibroblast Growth Factor (FGF) Homologous Factors: New Members of the FGF Family Implicated in Nervous System Development", pages 9850-9857. * |
See also references of EP0935654A4 * |
Cited By (14)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0825996A4 (en) * | 1995-05-12 | 2000-06-14 | Univ Johns Hopkins Med | Fibroblast growth factor homologous factor-1 (fhf-1) and methods of use |
EP0832109A1 (en) * | 1995-05-12 | 1998-04-01 | The Johns Hopkins University School Of Medicine | Fibroblast growth factor homologous factor-2 and methods of use |
EP0825996A1 (en) * | 1995-05-12 | 1998-03-04 | The Johns Hopkins University School Of Medicine | Fibroblast growth factor homologous factor-1 (fhf-1) and methods of use |
EP0832109A4 (en) * | 1995-05-12 | 2000-06-14 | Univ Johns Hopkins Med | Fibroblast growth factor homologous factor-2 and methods of use |
US6605441B1 (en) | 1995-06-05 | 2003-08-12 | Human Genome Sciences, Inc. | Antibodies against fibroblast growth factor 11 |
US6110893A (en) * | 1995-06-05 | 2000-08-29 | Human Genome Sciences, Inc. | Fibroblast growth factor 11 |
US6787640B2 (en) | 1995-06-05 | 2004-09-07 | Human Genome Sciences, Inc. | Fibroblast growth factor 14 |
US7338934B2 (en) | 1995-06-05 | 2008-03-04 | Human Genome Sciences, Inc. | Fibroblast growth factor-14 |
EP0960117A4 (en) * | 1996-08-30 | 2000-06-14 | Univ Johns Hopkins Med | FIBROBLAST GROWTH FACTOR HOMOLOGOUS FACTORS (FHFs) AND METHODS OF USE |
EP0960117A1 (en) * | 1996-08-30 | 1999-12-01 | The Johns Hopkins University School Of Medicine | FIBROBLAST GROWTH FACTOR HOMOLOGOUS FACTORS (FHFs) AND METHODS OF USE |
US6635744B1 (en) | 1996-08-30 | 2003-10-21 | The Johns Hopkins University School Of Medicine | Fibroblast growth factor homologous factor-4 |
WO2000073452A2 (en) * | 1999-06-02 | 2000-12-07 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
WO2000073452A3 (en) * | 1999-06-02 | 2001-06-28 | Genentech Inc | Compositions and methods for the treatment of immune related diseases |
CN112625140A (en) * | 2020-12-22 | 2021-04-09 | 北京致力生科科技有限公司 | PEP-1-G4S-KGF2 fusion protein and coding gene and application thereof |
Also Published As
Publication number | Publication date |
---|---|
IL126298A0 (en) | 1999-05-09 |
JP2000509965A (en) | 2000-08-08 |
AU719538B2 (en) | 2000-05-11 |
AU2341597A (en) | 1997-10-10 |
CA2249179A1 (en) | 1997-09-25 |
EP0935654A1 (en) | 1999-08-18 |
EP0935654A4 (en) | 2000-07-05 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU718718B2 (en) | Fibroblast growth factor homologous factor-1 (FHF-1) and methods of use | |
US7074574B2 (en) | Method of detecting growth differentiation factor-7 (GDF-7) using GDF-7 antibodies | |
EP0776337B1 (en) | Growth differentiation factor-11 | |
WO1996035708A9 (en) | Fibroblast growth factor homologous factor-1 (fhf-1) and methods of use | |
US20030023073A1 (en) | Growth differentiation factor-15 | |
EP0770089B1 (en) | Growth differentiation factor-12 | |
WO1997036926A1 (en) | Growth differentiation factor-14 | |
US20070066812A1 (en) | Fibroblast growth factor homologous factor-2 and methods of use | |
US6428966B1 (en) | Growth differentiation factor, lefty-1 | |
AU719538B2 (en) | Fibroblast growth factor homologous factor-3 (FHF-3) and methods of use | |
WO1996035716A9 (en) | Fibroblast growth factor homologous factor-2 and methods of use | |
US20070053880A1 (en) | Growth differentiation factor-16 | |
US5831054A (en) | Polynucleotide encoding growth differentiation factor-12 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG UZ VN |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH KE LS MW SD SZ UG AM AZ BY KG KZ MD RU TJ TM AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
ENP | Entry into the national phase |
Ref document number: 2249179 Country of ref document: CA Ref country code: CA Ref document number: 2249179 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1997916166 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWP | Wipo information: published in national office |
Ref document number: 1997916166 Country of ref document: EP |
|
WWR | Wipo information: refused in national office |
Ref document number: 1997916166 Country of ref document: EP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1997916166 Country of ref document: EP |