CA2249179A1

CA2249179A1 - Fibroblast growth factor homologous factor-3 (fhf-3) and methods of use

Info

Publication number: CA2249179A1
Application number: CA002249179A
Authority: CA
Inventors: Jeremy Nathans; Philip M. Smallwood; Patrick Tong
Original assignee: Individual
Current assignee: School of Medicine of Johns Hopkins University
Priority date: 1996-03-21
Filing date: 1997-03-21
Publication date: 1997-09-25
Also published as: JP2000509965A; AU2341597A; EP0935654A1; IL126298A0; AU719538B2; EP0935654A4; WO1997035007A1

Abstract

A novel protein, fibroblast growth factor homologous factor-3 (FHF-3), the polynucleotide sequence encoding FHF-3, and the deduced amino acid sequence are disclosed. Also disclosed are diagnostic and therapeutic methods of using the FHF-3 polypeptide and polynucleotide sequences and antibodies which specifically bind to FHF-3.

Description

FIBROBLAST GROWTH FACTOR HOMOLOGOUS FACI'OR-3 (~:HF-3) AND METHODS OF USE

BACKGROUND OF THE INVENTION

1. FIELD OF THE INVENTION

5 The invention relates generally to growth factors and specifically to a novel member of the fibroblast growth factor family, denoted f1broblast growth factor _omologous factor-3 (FHF-3) and the polynucleotide encoding FHF-3.

2. DESCRIPTION OF RELATED ART

The fibroblast growth factor family encompasses a group of structurally related 10 proteins with a wide range of growth promoting, survival, and/or differentiation activities in vivo and in vitro (reviewed in Baird, A., and Gospodarowicz, D. Ann N.~ Acad. Sci. 638: 1, 1991; Eckenstein, F.P., J. Neurobiology 25: 1467, 1994;
Mason, I.J. Cell 78: 547, 1994). As of December 1994, nine members of this family had been characterized by molecular cloning. The first two members of the15 farnily to be characterized, acidic fibroblast growth factor (aFGF/FGF-l) and basic fibroblast growth factor (bFGF/FGF-2), have been found in numerous tissues, including for example brain, eye, kidney, placenta, and adrenal (Jaye et al., Science 233: 541, 1986; Abraham et al., Science 233: 545, 1986). These factors have beenshown to be potent mitogens and survival factors for a variety of mesoderm and 20 neurectoderm-derived tissues, including fibroblasts, endothelial cells, hippocampal and cerebral cortical neurons, and astroglia (Burgess, W. H. and Maciag, T., Ann.
Rev. Biochemistry 58: 575, 1989). Additional members of the FGF family include:
int-2/FGF-3, identified as one of the frequent sites of integration of the mousem~mm~ry tumor virus, and therefore a presumptive oncogenic factor (Smith el al.,25 EMBO J. 7: 1013, 1988); ~GF-4 (Delli-Bovi et al., Cell 50: 729, 1987) and FGF-5 (Zhan et al., Mol. Cell Biol.8: 3487, 1988) as transforming genes in the NIH 3T3transfection assay; FGF-6, isolated by molecular cloning based on its homology to FGF-4 (Marics et al., Oncogene 4: 335 (1989); keratinocyte growth factor/ FGF-7,identified as a mitogen for keratinocytes (Finch et al., Science 245: 752, 1989);
S FGF-8 as an androgen-in(lllce~l mitogen for m:~mm~ry carcinoma cells (Tanaka et al., Proc. Natl. Acad. Sci. USA 89: 8928, 1992); and FGF-9 as a mitogen for primary astrocytes (Miyamoto et al., Mol. Cell Biol. 13: 4251, 1993). Several ofthe FGFs, including aFGF and bFGF, lack a classical signal sequence; the mecha-nism by which they are secreted is not known.

10 All members of the FGF family share approximately 25% or more amino acid sequence identity, a degree of homology indicating that they are likely to sharenearly identical three-dimensional structures. Support for this inference comes from a comparison of the three-dimensional structures of bFGF and interleukin 1-beta determined by x-ray diffraction (Eriksson et al., Proc. Natl. Acad. Sci USA
1~ 88: 3441, 1991; Zhang et al., Proc. Natl. Acad. Sci USA 88: 3446, 1991; Ago et al., J. Biochem. 110: 360, 1991). Although these proteins share only 10% amino acid identity, the alpha carbon backbones of the two crystal structures can be superimposed ~,vith a root-mean square deviation of less than 2 angstroms (Zhang et al., Proc. Natl. Acad. Sci USA 88: 3446, 1991). Both proteins consist almost 20 entirely of beta-sheets, which form a barrel composed of three copies of a four-stranded beta-meander motif. The likely heparin- and receptor-binding regions are located on nearby regions on one face of the protein.

aFGF, bFGF, and FGF-7/KGF have been shown to exert some or all of their biological activity through high affinity binding to cell surface tyrosine kinase 25 receptors (e.g., Lee, P. L., et al., Science 245: 57, 1989, reviewed in Johnson, D.E.
and Williams, L.T., Adv. Cancer Res. 60: 1, 1993). Many members of the FGF
family also bind tightly to heparin, and a terniary complex of heparin, FGF, andtransmembrane receptor may be the biologically relevant signaling species. Thus far four different genes have been identified that encode receptors for FGF family members. Recent work has sho~vn that receptor diversity is increased by differen-tial mRNA splicing within the extracellular ligand binding domain, with the result that multiple receptor isoforms with different ligand binding properties can be 5 encoded by the same gene (Johnson, D.E. and ~llliams, L.T., Adv. Cancer Res.
60: 1, 1993). In tissue culture systems, the binding of aFGF or bFGF to its cellsurface receptor activates phospholipase C-gamma (Burgess, W. H. et al., Mol.
Cell Biol. 10: 4770, 1990), a pathway known to integrate a variety of mitogenic signals.

10 Identification and characterization of new members of the FGF family will provide in~ight~ into the mech~ni.cm~ by which cells and organs control their growth, survival, senescence, differentiation, and recovery from injury.

SUMMARY O~ THE INVENTION

The present invention provides a cell growth, survival or differentiation factor, 15 FHF-3 and a polynucleotide sequence which encodes the factor. This factor is involved in the growth, survival, and or differentiation of cells within the central nervous system (CNS) as well as in peripheral tissues.

The invention provides a method for c~eteeting alterations in FHF-3 gene expression which are diagnostic of neurodegenerative or neoplastic disorders. In another 20 embodiment, the invention provides a method for treating a neurodegenerative or neoplastic disorder by mo~ ting the expression or activity of FHF-3.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the nucleotide and predicted amino acid sequence of human FHF-3 (SEQ. ID NO:1 and 2).

W O 97/35007 PCT~US97/04641 Figure 2 shows the alignment of the arnino acid sequence of human FHF-3 and each of the other nine members of the FGF family. Conserved residues are highlighted. The FGF family members are: aFGF/FGF-1 (Jaye et al., Science 233:
541, 1986), bFGF/FGF-2 (Abraham et al., Science 233: 545, 1986), int-2/FGF-3 5 (Smith et al., EMBO J. 7: 1013, 1988), FGF-4 (Delli-Bovi et al., Cell 50: 729,1987), FGF-5 (Zhan et al., Mol. Cell Biol. 8: 3487, 1988), FGF-6 (Marics et al.,Oncogene 4: 335, 1989); keratinocyte growth factor/ FGF-7 (Finch et al.J Science245: 752, 1989), FGF-8 (Tanaka et al., Proc. Natl. Acad. Sci. USA 89: 8928, 1992), and FGF-9 (Miyamoto et al., Mol. Cell Biol. 13: 4251, 1993).

10 Figure 3 shows a dendrogram in which the length of each path connecting any pair of FGF family members is proportional to the degree of arnino acid sequence divergence of that pair.

Figure 4 shows that the gene encoding FHF-3 is located on human chromosome 17.
The human specific hybridization is found on chromosome 17.

15 Figure 5 shows the tissue specificity of FHF-3 expression. Ten micrograms of total RNA from the indicated mouse tissues was prepared (Chomczinski & Sacchi. Anal.
Biochem. 162: 156, 1987) and used for RNAse protection (Ausabel et al., Current Protocols in Molecular Biology; New York: Wiley Interscience, 1987) with a mouse FHF-3 antisense probe that sparmed 200 bases of cloned cDNA including 70 20 bases of 5' untran.~l~te~l sequences and 130 bases at the beginning of the coding region. RNAse protection at the size expected (arrowhead) was observed most strongly with RNA from brain and eye; weak protection was seen with RNA from lung and testis.

Figure 6 shows an immunoblot of FHF-3 produced in transiently transfected human 25 embryonic kidney cells (line 293). Cells transfected with FHF-3 (right lane) synthesi7e an irnmunoreactive polypeptide with an apparent molecular mass of 30 kD that is not found in cells transfected with a related FGF family member (FHF-- 2; center lane) or in mock transfected cells (left lane). The a~)arel~l molecular mass in kD of pre~lailled protein size standards are shown to the left.

Figures 7a and 7b show the nucleotide and ~le~ ce~ amino acid sequence of FHF-1 5 and FHF-2, respectively (SEQ ID NO:6-9).

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides a growth factor, FHF-3, and a polynucleotide sequence encoding FHF-3. FHF;3 is expressed at high levels in brain and eye tissues, and at a lower level in lung and testes.. In one embodiment, the invention 10 provides a method for detection of a cell proliferative or degenerative disorder of central nervous system which is associated with FHF-3 expression or function. Inanother embo~iment, the invention provides a method for treating a cell prolifera-tive or immunologic disorder by using an agent which s~resses or enhances FHF-3 expression or activity.

15 The structural homology between the FHF-3 protein of this invention and the members of the FGF family, indicates that FHF-3 is a new member of the family of growth factors. Based on the known activities of many of the other members, it can be expected that FHF-3 will also possess biological activities that will make it useful as a diagnostic and therapeutic reagent.

20 Many gro~vth factors have expression patterns or possess activities that relate to the function of the nervous system. For example, one growth factor in the TGF
family, namely GDNF, has been shown to be a potent neurotrophic factor that can promote the survival of dopaminergic neurons (Lin, et al., Science, 260:1130).
Another family member, namely dorsalin-1, is capable of promoting the differentia-25 tion of neural crest cells (Basler, et al., Cell, 73:687, 1993). The inhibins and activins have been shown to be expressed in the brain (Meunier, et al., Proc.
Nat'l. Acad. Sci., USA, 85:247, 1988; Sawchenko, et al., Nature, 334:615, 1988),and activin has been shown to be capable of functioning as a nerve cell survivalmolecule (Schubert, et al., Nature, 344:868, 1990). Another TGF family member, 5 namely GDF-l, is nervous system-specific in its expression pattern (Lee, Proc.Nat'l. Acad. Sci., USA, 88:4250, 1991), and certain other family members, such as Vgr-1 (Lyons, et al., Proc. Nat'l. Acad. Sci., USA, 86:4554, 1989; Jones, et al., Development, 111:581, 1991), OP-1 (Ozkaynak, et al., J. Biol. Chem., 267:25220, 1992), and BMP-4 (Jones, et al., Development, 111:531, 1991), are also known to 10 be expressed in the nervous system.

The expression of FHF-3 in brain arld eye suggests that FHF-3 may also possess activities that relate to the function of the nervous system. FHF-3 may have neurotrophic activities for various neuronal populations. Hence, FHF-3 may have in vitro and in vivo applications in the treatment of neurodegenerative diseases, 15 such as amyotrophic lateral sclerosis, or in mah~laining cells or tissues in culture prior to transplantation.

In a first embodiment, the present invention provides a substantially pure fibroblast growth factor homologous factor-3 (FHF-3) characterized by having a molecular weight of about 26-28kD as determined by reducing SDS-PAGE and having 20 essentially the amino acid sequence of SEQ ID NO:2 (FIGURE l). The term "substantially pure" as used herein refers to FHF-3 which is subst~nti~lly free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. One skilled in the art can purify FHF-3 using standard techniques for protein purification. The substantially pure polypeptide will yield a single major 25 band on a non-reclllcing polyacrylamide gel. The purity of the FHF-3 polypeptide can also be determined by amino-terminal amino acid sequence analysis. FHF-3 polypeptide includes functional fragments of the polypeptide, as long as the activity .... . . .

WO 97/35007 PCT/US97/0464~

of FHF-3 remains. Smaller peptides cont~inin~ the biological activity of FHF-3 are included in the invention.

The invention provides polynucleotides encoding the FHF-3 polypeptide. These polynucleotides include DNA, cDNA and RNA sequences which encode FHF-3. It 5 is understood that all polynucleotides encoding all or a portion of FHF-3 are also included herein, as long as they encode a polypeptide with FHF-3 activity. Such polynucleotides include naturally occurring, synthetic, and intentionally manipulated polynucleotides. For example, FHF-3 polynucleotide may be subjected to site-directed mutagenesis. The polynucleotide sequence for FHF-3 also includes 10 ~nti~en~e sequences. The polynucleotides of the invention include sequences that are degenerate as a result of the genetic code. There are 20 natural amino acids, most of which are specified by more than one codon. Therefore, all degenerate nucleotide sequences are included in the invention as long as the amino acid sequence of FHF-3 polypeptide encoded by the nucleotide sequence is functionally1 5 unch~nged.

Specifically disclosed herein is a DNA sequence encoding the human FHF-3 polypeptide. The sequence contains an open reading frame encoding a polypeptide 225 amino acids in length. The human FHF-3 inititiator methionine codon shown in FIGURE 1 at position 74 is the first ATG codon in-frame; a good consensus 20 ribosome binding site (GCGCTATGG, Kozak, Nucleic Acids Res., 15: 8125, 1987) is found at this position. The next methionine codon within the open reading frame is encountered 124 codons 3' of the putative initiator methionine codon. As observed for aFGF and bFGF, the amino-terminus of the primary translation product of FHF-3 does not conform to the consensus sequence for a signal peptide25 to direct cotranslational insertion across the endoplasmic reticulum membrane. The FHF-3 sequence lacks potential asn-X-ser/thr sites for asparagine-linked glycos-ylation. Preferably, the human FHF-3 nucleotide sequence is SEQ ID NO:1 and the ded-lced amino acid sequence is preferably SEQ ID NO:2 (see FIGURE 1).

W O 97/35007 PCTrUS97/04641 The polynucleotide encoding FHF-3 ineludes SEQ ID NO:1 as well as nucleic acid sequences complementary to SEQ ID NO:1. A complementary sequence may inelude an ~nti.cçn.~e nucleotide. When the sequence is RNA, the deoxynucleotides A, G, C, and T of SEQ ID NO:1 is replaced by ribonucleotides A, G, C, and U, 5 respeetively. Also included in the invention are fragments of the above-described nucleic acid sequences that are at least 15 bases in length, which is sufficient to permit the fragment to selectively hybridize to DNA that encodes the protein of SEQ ID NO:2 under physiological eonditions. Specifically, the fragments should hybridize to DNA encoding FHF-3 protein under moderately stringent conditions.

10 The FGF family member most homologous to FHF-3 is FGF-9, which shares 30%
amino acid identity when aligned with 8 gaps. Minor modifications of the FHF-3 primary amino acid sequence may result in proteins which have subst~nti~lly equivalent activity as compared to the FHF-3 polypeptide described herein. Such proteins inelude those as defined by the term "having essentially the amino acid15 sequence of SEQ ID NO:2". Sueh modifieations may be deliberate, as by site-directed mutagenesis, or may be spontaneous. All of the polypeptides produced bythese modifications are included herein as long as the biological activity of FHF-3 still exists. Further, deletion of one or more amino acids ean also result in a modifieation of the strueture of the resultant molecule without significantly altering 20 its biological activity. This ean lead to the development of a smaller activemolecule which would have broader utility. For example, one can remove amino or carboxy terminal amino acids which are not required for FHF-3 biological activity.

The FHF-3 polypeptide of the invention encoded by the polynucleotide of the 25 invention includes the disclosed sequence (SEQ ID NO:2) and conservative variations thereof. The term "conservative variation" as used herein denotes thereplacement of an amino aeid residue by another, biologically similar residue.

Examples of conservative variations include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as the substitution of arginine for Iysine, glutamic for aspartic acid, or glutamine for asparagine, and the like. The 5 term "conservative variation" also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid provided that antibodies raised to the substituted polypeptide also immunoreact with the unsubstituted polypeptide.

DNA sequences of the invention can be obtained by several methods. For exam-ple, the DNA can be isolated using hybridization techniques which are well known10 in the art. These include, but are not limited to: 1) hybridization of genomic or cDNA libraries with probes to detect homologous nucleotide sequences, 2) poly-merase chain reaction (PCR) on genomic DNA or cDNA using primers capable of ~nn~ling to the DNA sequence of interest, and 3) antibody screening of expression libraries to detect cloned DNA fragments with shared structural features.

15 Preferably the FHF-3 polynucleotide of the invention is derived from a m~mm~ n organi~m, and most preferably from human. Screening procedures which rely on nucleic acid hybridization make it possible to isolate any gene sequence from any org;lni~m, provided the appropriate probe is available. Oligonucleotide probes, which correspond to a part of the sequence encoding the protein in question, can be 20 synth~i7ed chemically. This requires that short, oligopeptide stretches of amino acid sequence must be known. The DNA sequence encoding the protein can be dedllce~l from the genetic code, however, the degeneracy of the code must be taken into account. It is possible to perform a mixed addition reaction when the se-quence is degenerate. This includes a heterogeneous mixture of denatured double-- 25 stranded DNA. For such screening, hybridization is preferably performed on either single-stranded DNA or denatured double-stranded DNA. Hybridization is particu-larly useful in the detection of cDNA clones derived from sources where an extremely low amount of mRNA sequences relating to the polypeptide of interest are present. In other words, by using stringent hybridization conditions directed to avoid non-specific binding, it is possible, for example, to allow the auto-radiographic visu~li7~tion of a specific cDNA clone by the hybridization of the target DNA to that single probe in the mixture which is its complete complement 5 (Wallace, et al., Nucl. Acid Res., 9:879, 1981; ~ni~ti~, et al., Molecular Cloning:
A Labora~ory Manual, Cold Spring Harbor, N.~ 1989).

The development of specific DNA sequences encoding FHF-3 can also be obtained by: 1) isolation of double-stranded DNA sequences from the genomic DNA; 2) chemical manufacture of a DNA sequence to provide the necessary codons for the 10 polypeptide of interest; and 3) in vitro synthesis of a double-stranded DNA
sequence by reverse transcription of mRNA isolated from a eukaryotic donor cell.In the latter case, a double-stranded DNA complement of mRNA is eventually formed which is generally referred to as cDNA.

Of the three above-noted methods for developing specific DNA sequences for use 15 in recombinant procedures, the isolation of genomic DNA isolates is the leastcommon. This is especially true when it is desirable to obtain the microbial expression of m~mm~ n polypeptides due to the presence of introns.

The synthesis of DNA sequences is frequently the method of choice when the entire sequence of amino acid residues of the desired polypeptide product is known.
20 When the entire sequence of amino acid residues of the desired polypeptide is not known, the direct synthesis of DNA sequences is not possible and the method of choice is the synthesis of cDNA sequences. Among the standard procedures for isolating cDNA sequences of interest is the formation of plasmid- or phage-carrying cDNA libraries which are derived from reverse transcription of mRNA which is 25 abundant in donor cells that have a high level of genetic ~x~ression. When used in combination with polymerase chain reaction technology, even rare expression products can be cloned. In those cases where significant portions of the amino acid . .

sequence of the polypeptide are known, the production of labeled single or double-stranded DNA or RNA probe sequences duplicating a sequence putatively present in the target cDNA may be employed in DNA/DNA hybridization procedures which are carried out on cloned copies of the cDNA which have been denatured 5 into a single-stranded form (Jay, et al., N~cl. Acid Res., 11:2325, 1983).

A cDNA expression library, such as lambda gtl 1, can be screened indirectly for FHF-3 peptides having at least one epitope~ using antibodies specific for FHF-3.Such antibodies can be either polyclonally or monoclonally derived and used to detect expression product indicative of the presence of FHF-3 cDNA.

10 DNA sequences encoding FHF-3 can be expressed in vitro by DNA transfer into asuitable host cell. "Host cells" are cells in which a vector can be propagated and its DNA expressed. The term also includes any progeny of the subject host cell. It is understood that all progeny may not be identical to the parental cell since there may be mutations that occur during replication. However, such progeny are 15 included when the term "host cell" is used. Methods of stable transfer, m~ning that the foreign DNA is continuously m~int~ined in the host, are known in the art.

In the present invention, the FHF-3 polynucleotide sequences may be inserted into a recombinant expression vector. The term "recombinant expression vector'' refers to a plasmid, virus or other vehicle known in the art that has been manipulated by 20 insertion or incorporation of the FHF-3 genetic sequences. Such expression vectors contain a promoter sequence which facilitates the efficient transcription of theinserted genetic sequence of the host. The expression vector typically contains an origin of replication, a promoter, as well as specific genes which allow phenotypic selection of the transformed cells. Vectors suitable for use in the present invention 25 include, but are not limited to the T7-based expression vector for expression in bacteria (Rosenberg, et al., Gene, 56:125, 1987), the pMSXND expression vector for expression in m~mm~ n cells (Lee and Nathans, J. Biol. Chem., 263:3521, 1988) and baculovirus-derived vectors for expression in insect cells. The DNA
segment can be present in the vector operably linked to regulatory elements, forexample, a promoter (e.g., T7, metallothionein I, or polyhedrin promoters).

Polynucleotide seguences encoding FHF-3 can be expressed in either prokaryotes or 5 eukaryotes. Hosts can include microbial, yeast, insect and m~mm~ n organisms.
Methods of expressing DNA sequences having eukaryotic or viral sequences in prokaryotes are well known in the art. Biologically functional viral and plasmidDNA vectors capable of exl~ession and replication in a host are known in the art.
Such vectors are used to incorporate DNA sequences of the invention.

lO Transformation of a host cell with recombinant DNA may be carried out by conventional techniques as are well known to those skilled in the art. Where thehost is prokaryotic, such as E. coli, competent cells which are capable of DNA
uptake can be prepared from cells harvested after exponential growth phase and subsequently treated by the CaC12 method using procedures well known in the art.15 Alternatively, MgCl2 or RbCl can be used. Transformation can also be performed after forming a protoplast of the host cell if desired.

When the host is a eukaryote, such methods of transfection of DNA as calcium phosphate co-precipitates, conventional mechanical procedures such as micro-injection, electroporation, insertion of a plasmid ~ncace-l in liposomes, or virus 20 vectors may be used. Eukaryotic cells can also be cotransformed with DNA
sequences encoding the FHF-3 of the invention, and a second foreign DNA
molecule encoding a selectable phenotype, such as the herpes simplex thymidine lcinase gene. Another method is to use a eukaryotic viral vector, such as simianvirus 40 (SV40) or bovine papilloma virus, to transiently infect or transform 25 eukaryotic cells and express the protein. (see for example, Eukaryotic Viral ~ctors, Cold Spring Harbor Laboratory, Gluzman ed., 1982).

, ~ . _ Isolation and purification of microbial expressed polypeptide, or fragments thereof, provided by the invention, may be carried out by conventional means including pl~paldlive chromatography and immunological separations involving monoclonal or polyclonal antibodies.

5 The FHF-3 polypeptides of the invention can also be used to produce antibodieswhich are immunoreactive or bind to epitopes of the FHF-3 polypeptides. Anti-body which consists essentially of pooled monoclonal antibodies with different epitopic specificities, as well as distinct monoclonal antibody preparations areprovided. Monoclonal antibodies are made from antigen co.~ g fragments of 10 the protein by methods well known in the art (Kohler, et al., Nature, 256:495, 1975; Current Protocols in Molecular Biolog;y, Ausubel, et al., ed., 1989).

The term "antibody" as used in this invention includes intact molecules as well as fragments thereof, such as Fab, F(ab')2, and Fv which are capable of binding theepitopic det~ lhlallt. These antibody fragments retain some ability to selectively 15 bind with its antigen or receptor and are defined as follows:

(1) Fab, the fragment which contains a monovalent antigen-binding fragment of anantibody molecule can be produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain;

(2) Fab', the fragment of an antibody molecule can be obtained by treating whole20 antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain; two Fab' fr~gm~nt~ are obtained per antibody mole-cule;

(3) (Fab')2, the fragment of the antibody that can be obtained by treating wholeantibody with the enzyme pepsin without subsequent reduction; F(ab')2 is a dimer25 of two Fab' fragments held together by two disulfide bonds;

(4) Fv, defined as a genetical}y engineered fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains; and (S) Single chain antibody ("SCA"), defined as a genetically engineered molecule 5 cont~ining the variable region of the light chain, the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule.

Methods of making these fr~ment~ are known in the art. (See for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New 10 York (198~), incorporated herein by reference).

As used in this invention, the terrn "epitope" means any antigenic determinant on an antigen to which the paratope of an antibody binds. Epitopic determin~nt~
usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural ~5 characteristics, as well as specific charge characteristics.

Antibodies which bind to the FHF-3 polypeptide of the invention can be prepared using an intact polypeptide or fragments cont~ining small peptides of interest as the immunizing antigen. The polypeptide or a peptide used to immunize an animal can be derived from tr~n~l~ted cDNA (see for example, EXAMPLES 4 and 6) or 20 chemical synthesis which can be conjugated to a carrier protein, if desired. Such commonly used carriers which are chemically coupled to the peptide include keyhole limpet hemocyanin (KLH), thyroglobulin, bovine serum albumin (BSA), and tetanus toxoid. The coupled peptide is then used to immunize the animal (e.g., a mouse, a rat, or a rabbit).

If desired, polyclonal or monoclonal antibodies can be further purified, for exam-ple, by binding to and elution from a matrix to which the polypeptide or a peptide to which the antibodies were raised is bound. Those of skill in the art will know of various techniques common in the immunology arts for purification and/or 5 concentration of polyclonal antibodies, as well as monoclonal antibodies (See for example, Coligan, et al, Unit 9, Current Protocols in Immunology, Wiley I-nterscience, 1994, incorporated by reference).

It is also possible to use the anti-idiotype technology to produce monoclonal antibodies which mimic an epitope. For example, an anti-idiotypic monoclonal 10 antibody made to a first monoclonal antibody will have a binding domain in the hypervariable region which is the "image" of the epitope bound by the first mono-clonal antibody.

The term "cell-proliferative disorder" denotes malignant as well as non-malignant cell populations which often appear to differ from the surrounding tissue both 15 morphologically and genotypically. ~lign~nt cells (i.e. cancer) develop as a result of a multistep process. The FHF-3 polynucleotide that is an antisense molecule is useful in treating malignancies of the various organ systems, particularly, for example, cells in the central nervous system, including neural tissue, testes, and cells of the eye. Essentially, any disorder which is etiologically linked to altered 20 expression of FHF-3 could be considered susceptible to treatment with a FHF-3suppressing reagent. One such disorder is a m~lign~nt cell proliferative disorder, for example.

For purposes of the invention, an antibody or nucleic acid probe specific for FHF-3 may be used to detect FHF-3 polypeptide (using antibody) or polynucleotide (using 25 nucleic acid probe) in biological fluids or tissues. The invention provides a method for detecting a cell proliferative disorder of neural tissue or testes, for example, which comprises contacting an anti-FHF-3 antibody or nucleic acid probe with a WO 97/35007 PCTtUS97/04641 cell suspected of having a FHF-3 associated disorder and detecting binding to the antibody or nucleic acid probe. The antibody reactive with FHF-3 or the nucleic acid probe is preferably labeled with a compound which allows detection of binding to FHF-3. Any specimen cont~ining a detectable arnount of antigen or S polynucleotide can be used. A preferred sample of this invention is CNS, e.g.,neural tissue or cerebrospinal fluid or eye tissue. The level of FHF-3 in the suspect cell can be compared with the level in a normal cell to determine whether the subject has a FHF-3-associated cell proliferative disorder. Preferably the subject is human.

10 When the cell component is nucleic acid, it may be necessary to amplify the nucleic acid prior to binding with an FHF-3 specific probe. Preferably, polymerase chain reaction (PCR) is used, however, other nucleic acid amplification procedures such as ligase chain reaction (LCR), ligated activated transcription (LAT) and nucleic acid sequence-based amplification (NASBA) may be used.

15 The antibodies of the invention can be used in any subject in which it is desirable to ~(1mini~ter in vitro or in vivo immunodiagnosis or immunotherapy. The antibod-ies of the invention are suited for use, for example, in immunoassays in which they can be utilized in liquid phase or bound to a solid phase carrier. In addition, the antibodies in these immunoassays can be detectably labeled in various ways.
20 Examples of types of immunoassays which can utilize antibodies of the invention are competitive and non-competitive immunoassays in either a direct or indirect format. Examples of such immunoassays are the radioimmunoassay (RIA) and the sandwich (immunometric) assay. Detection of the antigens using the antibodies ofthe invention can be done utili7ing irnmunoassays which are run in either the 25 forward, reverse, or simultaneous modes, including immunohistochemical assays on physiological samples. Those of skill in the art will know, or can readily discern, other immunoassay formats without undue experimentation.

The antibodies of the invention can be bound to many different carriers and used to detect the presence of an antigen comprising the polypeptide of the invention.
Examples of well-known carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, 5 polyacrylamides, agaroses and magnetite. The nature of the carrier can be either soluble or insoluble for purposes of the invention. Those skilled in the art will know of other suitable carriers for binding antibodies, or will be able to ascertain such, using routine experimentation.

There are many different labels and methods of labeling known to those of 10 ordinary skill in the art. Examples of the types of labels which can be used in the present invention include enzymes, radioisotopes, fluorescent compounds, colloidal metals, chemiluminescent compounds, phosphorescent compounds, and biolumines-cent compounds. Those of ordinary skill in the art will know of other suitable labels for binding to the antibody, or will be able to ascertain such, using routine 1 5 experimentation.

Another technique which may also result in greater sensitivity consists of coupling the antibodies to low molecular weight haptens. T hese haptens can then be specifically detected by means of a second reaction. For example, it is common to use such haptens as biotin, which reacts with avidin, or dinitrophenyl, puridoxal, 20 and fluorescein, which can react with specific antihapten antibodies.

In using the monoclonal antibodies of the invention for the in vivo detection ofantigen, the detectably labeled antibody is given a dose which is diagnosticallyeffective. The term "diagnostically effective" means that the amount of detectably labeled monoclonal antibody is ~rlmini~t~red in sufficlent quantity to enable 25 detection of the site having the antigen comprising a polypeptide of the invention for which the monoclonal antibodies are specific.

W O 97~5007 PCT~US97/04641 The concentration of detectably labeled monoclonal antibody which is ~lmini~tered should be sufficient such that the binding to those cells having the polypeptide is detectable compared to the background. Further, it is desirable that the ~letect~kly labeled monoclonal antibody be rapidly cleared from the circulatory system in 5 order to give the best target-to-background signal ratio.

As a rule, the dosage of detectably labeled monoclonal antibody for in vivo diagnosis will vary depending on such factors as age, sex, and extent of disease of the individual. Such dosages may vary, for example, depending on whether multiple injections are given, antigenic burden, and other factors known to those of 10 skill in the art.

For in vivo diagnostic im~ging, the type of detection instrument available is a major factor in selecting a given radioisotope. The radioisotope chosen must have a type of decay which is detect~ble for a given type of instrument. Still another important factor in selecting a radioisotope for in vivo diagnosis is that deleterious radiation 15 with respect to the host is minimi7efl Ideally, a radioisotope used for in vivo im~ging will lack a particle emission, but produce a large number of photons in the 140-250 keV range, which may readily be detected by conventional gamma cameras.

For in vivo diagnosis radioisotopes may be bound to immunoglobulin either directly 20 or indirectly by using an intermediate functional group. Intermediate functional groups which often are used to bind radioisotopes which exist as metallic ions to i-mmunoglobulins are the bifunctional chelating agents such as d-iethylenetriaminepentacetic acid (DTPA) and ethylenetli~minetetraacetic acid (EDTA) and similar molecules. Typical examples of metallic ions which can be 25 bound to the monoclonal antibodies of the invention are l"In, 97Ru, 67Ga, 68Ga, 72As 89Zr and 20i T1.

.

The monoclonal antibodies of the invention can also be labeled with a paramag-netic isotope for purposes of in vivo diagnosis, as in magnetic resonance im~ging (MRI) or electron spin resonance (ESR). In general, any conventional method for vi~ li7ing diagnostic im~ging can be lltili7~(1 Usually gamma and positron 5 emitting radioisotopes are used for camera im~ging and paramagnetic isotopes for MRI. Elements which are particularly useful in such techniques include '57Gd, ssMn ~62Dy 52Cr, and 56 Fe.

The monoclonal antibodies or polynucleotides of the invention can be used in vitro and in vivo to monitor the course of amelioration of a FHF-3-associated disease in 10 a subject. Thus, for example, by measuring the increase or decrease in the number of cells ex~res~ing antigen comprising a polypeptide of the invention or changes in the concentration of such antigen present in various body fluids, it would be possible to deterrnine whether a particular therapeutic regimen aimed at ameliorat-ing the FHF-3-associated disease is effective. The term "ameliorate" denotes a 15 lessening of the detrimental effect of the FHF-3-associated disease in the subject receiving therapy.

The present invention identifies a nucleotide sequence that can be expressed in an altered manner as compared to ex~Les~ion in a normal cell, therefore it is possible to design a~u~uropliate therapeutic or diagnostic techniques directed to this sequence.
20 Detection of elevated levels of FHF-3 expression is accomplished by hybridization of nucleic acids isolated from a cell suspected of having an FHF-3 associated proliferative disorder with an FHF-3 polynucleotide of the invention. Analysis, such as Northern Blot analysis, are utilized to quantitate expression of FHF-3. Otherstandard nucleic acid detection techniques will be known to those of skill in the art.

25 Treatment of an FHF-3 associated cell proliferative disorder include modulation of FHF-3 gene ~ ession and FHF-3 activity. The term "modulate" envisions the suppression of expression of FHF-3 when it is over-expressed, or ~ m~t~tion of FHF-3 expression when it is under-expressed. Where a cell-proliferative disorder is associated with the expression of FHF-3, nucleic acid sequences that interfere with FHF-3 expression at the translational level can be used. This approach utili7es, for example, ~nti~e~e nucleic acid, ribozymes, or triplex agents to block transcription 5 or translation of a specific FHF-3 mRNA, either by m~.~king that mRNA with an ~nti.~n~e nucleic acid or triplex agent, or by cleaving it with a ribozyme. Suchdisorders include neurodegenerative diseases, for example.

~Anti~en.ce nucleic acids are DNA or RNA molecules that are complementary to at least a portion of a specific mRNA molecule (Weintraub, Scientific American, 10 262:40, 1990). In the cell, the ~nti.~en.ce nucleic acids hybridize to the correspond-ing mRNA, forming a double-stranded molecule. The antisense nucleic acids interfere with the translation of the mRNA, since the cell will not translate a mRNA that is double-stranded. ~nti~.n.ce oligomers of about 15 nucleotides are p~ ed, since they are easily synthesized and are less likely to cause problems 15 than larger molecules when introduced into the target FHF-3-producing cell. The use of ~nti~n~e methods to inhibit the in vitro translation of genes is well known in the art (Marcus-Sakura, Anal.Biochem., 172:289, 1988).

Use of an oligonucleotide to stall transcription is known as the triplex strategy since the oligomer winds around double-helical DNA, forming a three-strand helix.
20 Therefore, these triplex compounds can be desi~necl to recognize a unique site on a chosen gene (Maher, et al., Antisense Res. and Dev., I(3!:227, l991; Helene, C.,Anticancer Drug Design, 6(6!:569, 1991).

Ribozymes are RNA molecules posse~in~ the ability to specifically cleave other single-stranded RNA in a manner analogous to DNA restriction endonucleases.
25 Through the modification of nucleotide sequences which encode these RNAs, it is possible to engineer molecules that recognize specific nucleotide sequences in an RNA molecule and cleave it (Cech, J.Amer.Med. Assn., 260:3030, 1988). A major .

advantage of this approach is that, because they are sequence-specific, only mRNAs with particular sequences are inactivated.

There are two basic types of ribozymes namely, tetra~mena-type (Hasselhoff, Nature, 334:585, 1988) and "hammerhead"-type. Tetra~ymena-type ribozymes 5 recognize sequences which are four bases in length, while "hammerhead"-type ribozymes recognize base sequences 11-18 bases in length. The longer the recogni-tion sequence, the greater the likelihood that the sequence will occur exclusively in the target mRNA species. Consequently, hammerhead-type ribozymes are prefera-ble to tetra~mena-type ribozymes for inactivating a specific mRNA species and 10 18-based recognition sequences are preferable to shorter recognition sequences.

The present invention also provides gene therapy for the treatment of cell prolifera-tive or imml~n~logic disorders which are mediated by FHF-3 protein. Such therapywould achieve its therapeutic effect by introduction of the FHF-3 ~nti~çn~e polynu-cleotide into cells having the proliferative disorder. Delivery of ~nti.~en.~e FHF-3 15 polynucleotide can be achieved using a recombinant expression vector such as a chimeric virus or a colloidal dispersion system. Especially preferred for therapeutic delivery of antisense sequences is the use of targeted liposomes.

Various viral vectors which can be utilized for gene therapy as taught herein include adenovirus, herpes virus, vaccinia, or, preferably, an RNA virus such as a 20 retrovirus. Preferably, the retroviral vector is a derivative of a murine or avian retrovirus. Examples of retroviral vectors in which a single foreign gene can beinserted include, but are not limited to: Moloney murine leukemia virus (-MoMuLV), Harvey murine sarcoma virus (HaMuSV), murine m~mm~ry tumor virus (MuMTV), and Rous Sarcoma Virus (RSV). Preferably, when the subject is 25 a human, a vector such as the gibbon ape le-lkemi~ virus (GaLV) is utili7e~1 A
number of additional retroviral vectors can incorporate multiple genes. All of these vectors can transfer or incorporate a gene for a selectable marker so that transduced cells can be identified and generated. By inserting a FHF-3 sequence of interestinto the viral vector, along with another gene which encodes the ligand for a receptor on a specific target cell, for example, the vector is now target specific.
Retroviral vectors can be made target specific by ~ hing, for example, a sugar, a 5 glycolipid, or a protein. Preferred targeting is accomplished by using an antibody to target the retroviral vector. Those of skill in the art will know of, or can readily ascertain without undue experiment~tion, specific polynucleotide sequences whichcan be inserted into the retroviral genome or attached to a viral envelope to allow target specific deliverv of the retroviral vector cont~inin~ the FHF-3 antisense1 0 polynucleotide.

Since recombinant retroviruses are defective, they require ~ict~nce in order to produce infectious vector particles. This ~.ci~t~nce can be provided, for example, by using helper cell lines that contain plasmids encoding all of the structural genes of the retrovirus under the control of regulatory sequences within the LTR. These 15 plasmids are mi~in~ a nucleotide sequence which enables the packaging mecha-nism to recognize an RNA transcript for encapsidation. Helper cell lines which have deletions of the p~çk~pin~ signal include, but are not limited to ~2, PA317and PA12, for example. These cell lines produce empty virions, since no genome is packaged. If a retroviral vector is introduced into such cells in which the 20 p~çk~ging signal is intact, but the structural genes are replaced by other genes of interest, the vector can be packaged and vector virion produced.

Alternatively, NIH 3T3 or other tissue culture cells can be directly transfected with plasmids encoding the retroviral structural genes gag, pol and env, by conventional calcium phosphate transfection. These cells are then transfected with the vector25 plasmid cont~ining the genes of interest. The reslllting cells release the retroviral vector into the culture medium.

Another targeted delivery system for FHF-3 ~nti~en.~e polynucleotides is a colloidal dispersion system. Colloidal dispersion systems include macromolecule complexes,nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. The preferred colloidal system 5 of this invention is a liposome. Liposomes are artificial membrane vesicles which are useful as delivery vehicles in vitro and in vivo. It has been shown that large unilamellar vesicles (LUV), which range in size from 0.2-4.0 ~lm can enr~psul~te a substantial percentage of an aqueous buffer cont~ining large macromolecules.
RNA, DNA and intact virions can be encapsulated within the aqueous interior and 10 be delivered to cells in a biologically active form (Fraley, el al., Trends Biochem.
Sci., 6:77, 1981). In addition to m~mm~ n cells, liposomes have been used for delivery of polynucleotides in plant, yeast and bacterial cells. In order for a liposome to be an efficient gene transfer vehicle, the following characteristicsshould be present: (1) encapsulation of the genes of interest at high efficiency while 15 not compromising their biological activity; (2) preferential and substantial binding to a target cell in comparison to non-target cells; (3) delivery of the aqueous contents of the vesicle to the target cell cytoplasm at high efficiency; and (4)accurate and effective expression of genetic information (Mannino, et al., B-iotechniques, 6:682, 1~88).

20 The composition of the liposome is usually a combination of phospholipids, particularly high-phase-transition-temperature phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used. The physical characteristics of liposomes depend on pH, ionic strength,and the presence of divalent cations.

25 Examples of lipids useful in liposome production include phosphatidyl compounds, such as phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides. Particu-larly useful are diacylphosphatidylglycerols, where the lipid moiety contains from 14-18 carbon atoms, particularly from 16-18 carbon atoms, and is saturated.
Illustrative phospholipids include egg phosphatidylcholine, dipalmitoylphosphatidylcholine and distearoylphosphatidylcholine.

The targeting of liposomes can be classified based on anatomical and mechanistic5 factors. Anatomical classification is based on the level of selectivity, for exarnple, organ-specific, cell-specific, and organelle-specific. Mechanistic targeting can be distinguished based upon whether it is passive or active. Passive targeting utilizes the natural tendency of liposomes to distribute to cells of the reticulo-endothelial system (RES) in organs which contain sinusoidal capillaries. Active targeting, on 10 the other hand, involves alteration of the liposome by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein, or by ch~nging the composition or size of the liposome in order to achieve L~g~ g to organs and cell types other than the naturally occurring sites of localization.

The surface of the targeted delivery system may be modified in a variety of ways.
15 In the case of a liposomal targeted delivery system, lipid groups can be incorpo-rated into the lipid bilayer of the liposome in order to m~int~in the targeting ligand in stable association with the liposomal bilayer. Various linking groups can be used for joining the lipid chains to the targeting ligand.

Due to the expression of FHF-3 in the testes, eye and brain, or neural tissue, there 20 are a variety of applications using the polypeptide, polynucleotide, and antibodies of the invention, related to these tissues. Such applications include treatment of cell proliferative, degenerative, and immlmologic disorders involving these and other tissues. In addition, FHF-3 may be useful in various gene therapy proce-dures.

25 Due to the high level of expression of FHF-3 in the testes, there are a variety of applications using the polypeptide, polynucleotide, and antibodies of the invention CA 02249l79 l998-09-l7 related to this tissue. Such applications include treatment of cell proliferative disorders associated with FHF-3 expression in the testes. Various testicular developmental or acquired disorders can also be subject to FHF-3 applications.
These may include, but are not limited to viral infection (e.g., viral orchitis), 5 autoimmunity, sperm production or dysfunction, trauma, and testicular tumors. The presence of high levels of FHF-3 in the testis suggests that FHF-3 or an analogue of FHF-3 could be used to increase or decrease male fertility.

The identification of a novel member of the FGF family provides a useful tool for diagnosis, prognosis and therapeutic strategies associated with FHF-3 mediated 10 disorders. Measurement of FHF-3 levels using anti-FHF-3 antibodies is a useful diagnostic for following the progression or recovery from diseases of the nervous system, including: cancer, stroke, neurodegenerative diseases such as Parkinson's disease or Alzheimer's ~ e~e, retinal tii~e~ees such as retinitis pi~ml-ntosa, or viral encephalitis. The presence of high levels of FHF-3 in the central nervous system15 suggests that the observed low level of FHF-3 in a number of peripheral tissues could reflect FHF-3 in peripheral nerve and a presence in sensory neurons in thedorsal root and trigeminal ~ngli~, and therefore measurement of FHF-3 levels using anti-FHF 3 antibodies could be diagnostic i'or peripheral neuropathy. The presence of high levels of FHF-3 in the testis suggests that measurement of FHF-3 20 levels using anti-FHF-3 antibodies could be diagnostic for testicular cancer.
Like other members of the FGF family, FHF-3 likely has mitogenic andlor cell survival activity, therefore FHF-3 or an analogue that mimics FHF-3 action couldbe used to promote tissue repair or replacement. The presence of FHF-3 in the CNS suggests such a therapeutic role in diseases of the nervous system, including:
25 stroke, neurodegenerative diseases such as Parkinson's disease or Alzheimer'se~e, or in retinal degenerative diseases such as retinitis pigmentosa or maculardegeneration, or in peripheral neuropathies. Conversely, blocking FHF-3 action either with anti-FHF-3 antibodies or with an FHF-3 antagonist might slow or ameliorate diseases in which excess cell growth is pathological, most obviously cancer.

The following examples are intenfle~ to illustrate but not limit the invention.
While they are typical of those that might be used, other procedures known to 5 those skilled in the art may alternatively be used.

IDENTIFICATION OF FHF-3, A NOVEL MEMBER OF THE FGF FAM-ILY

To identify novel gene products expressed in the human retina, random segments of 10 human retina cDNA clones were partially sequenced, and the resulting partial sequences compared to the sequences available in the public databases.

In detail, an adult human retina cDNA library constructed in lambda gtlO (Nathans, et al., Science 232: 193, 1986) was amplified, and the cDNA inserts were excised15 en mass by cleavage with EcoR I and purified free of the vector by agarose gel electrophoresis. Following heat denaturation of the purified cDNA inserts, a synthetic oligonucleotide cont~ining an EcoR I site at its 5' end and six randomnucleotides at its 3' end (5' GACGAGATATTAGAATTCTACTCGNNNN~) (SEQ ID NO:3) was used to prime two sequential rounds of DNA synthesis in the 20 presence of the Klenow fragment of E. coli DNA polymerase. The resulting duplex molecules were amplified using the polymerase chain reaction (PCR) with aprimer corresponding to the unique 5' fl~nking sequence (5' CCCCCCCCCGACGAGATATTAGAATTCTACTCG) (SEQ ID NO:4). These PCR products, ~ s~ g a random sampling of the original cDNA inserts, were 25 cleaved with EcoR I, size fractionated by ple~ald~ e agarose gel electrophoresis to include only segments of approximately 500 bp in length, and cloned into lambda gtlO. Three thousand single plaques from this derivative library were arrayed in . .

96-well trays and from these clones the inserts were amplified by PCR using fl~nking vector primers and then sequenced using the dideoxy method and auto-mated fluorescent detection (Applied Biosystems). A single sequencing run from one end of each insert was conceptually tr~n.~l~ted on both strands in all three5 reading frames and the six resulting amino acid sequences were used to search for homology in the GenBank nonre~ll.n-l~nt protein ~l~t~b~e using the BLASTX
searching algorithrn.

One partial cDNA sequence was found that showed statistically significant homol-ogy to previously described members of the FGF family. Using this partial cDNA
10 as a probe, multiple independent cDNA clones were isolated from the human retina cDNA library, including two that encompass the entire open reading frame and from which complete nucleotide sequences were determined. This sequence encodes a novel and highly divergent member of the FGF superfamily and has been named fibroblast growth factor homologous factor-1 (FHF-1). A second closely 15 related sequence (FHF-2) was subsequently characterized on its similarity to the sequence of FHF-1. (SEQ ID NO:6-9; Figures 7a, 7b).

The FHF-1 and FHF-2 amino acid sequences were used to screen the publicly available Genbank ~l~t~h~ce of conceptually translated DNA sequences (DBEST) for amino acid sequences with statistically significant similarity. A short region of 20 human genomic DNA (DBEST accession number 76387) was found to have a tr~n~l~te~l sequence with significant homology to approximately 25% of the FHF-land FHF-2 arnino acid sequences. This genomic segment was one among many genomic segments that were used as lzln(1m~rks during the search for the breast cancer susceptibility gene on chromosome 17. Synthetic DNA primers based on 25 sequence 76387 were used to amplify part of that region from human genomic DNA and from cDNA derived from the human retina. These PCR products were then used as probes to isolate full length cDNA clones from the the human retinacDNA library described above.

Figure 1 shows the sequence of human FHF-3 deduced from the nucleotide sequences of two independent human retina cDNA clones. The primary translation 5 product of human FHF-3 is predicted to be 225 amino acids in length. The humanFHF-3 initiator methionine codon shown in Figure 1 at position 74 is the first in-frame ATG codon; a good consensus ribosome binding site (GCGCTATGG (SEQ
ID NO:5); Kozalc, Nucleic Acids Res. 15: 8125, 1987) is found at this position.
The next methionine codon within the open reading frame is encountered 124 10 codons 3' of the putative initiator methionine codon. As observed for aFGF and bFGF, the amino-terminus of the primary translation product of FHF-3 does not conform to the con~çn~-lc sequence for a signal peptide to direct cotranslational insertion across the endoplasmic reticulum membrane. The FHF-3 sequence lacks asn-X-ser/thr sites for asparagine-linked glycosylation.

15 Alignment of FHF-3 with the other known members of the FGF family is shown inFigure 2 and a dendrogram showing the degree of arnino acid similarity is shown in Figure 3. The most homologous FGF family member is FGF-9 which shows 30% amino acid identity with FHF-3 when aligned with 8 gaps. Note that in the cenkal region of each polypeptide, all FGF family members, including FHF-3, 20 share approximately 50% amino acid identity.

The chromosomal location of FHF-3 was determined by probing a Southern blot cont~ining restriction enzyme digested DNA derived from a panel of 24 hu-25 man-mouse and human-h~m~ter cell lines, each cont~ining a different human chromosome (Oncor, Gaithersburg, MD). As seen in Figure 4, hybridization of the human FHF-3 probe to human, mouse, and hamster genomic DNA produces distinct hybridizing fragment sizes. Among the hybrid panels, the human-specifichybridization pattern is seen only in the lane corresponding to the hybrid cell line 5 carrying human chromosome 17.

TISSUE DISTRIBUTION OF FHF-3 mRNA

To determine the tissue distribution of FHF-3 mRNA, RNase protection analysis was performed on total RNA from mouse brain, eye, heart, kidney, liver, lung, 10 spleen, and testis, as well as a yeast tRNA negative control. The probe used was derived from a segment of the mouse FHF-3 gene isolated from a mouse eye cDNA library by hybridization with the full-length human FHF-3 cDNA. As seen in Figure 5, the highest levels of FHF-3 ~plession are in the brain and eye. Lowlevels of FHF-3 t;;~ression were detected in lung and testis on a longer exposure of 15 the autoradiogram.

Figure 6 shows an immunoblot of FHF-3 produced in transiently transfected human embryonic kidney cells (line 293). Anti-FHF-3 antibodies were raised against a fusion protein cont~ining the gene 10 protein from bacteriophage T7 joined at the 20 carboxy-terminus to the entire FHF-3 protein (Studier and Moffatt, J. Molec. Biol.
189:113, 1986). The resulting fusion protein was purified by preparative polyacryl-amide gel electrophoresis and injected into rabbits. To express FHF-3 in human cells, the complete open reading frame was inserted into the eukaryotic expression vector pCIS (Gorman, et al., DNA Protein Eng. Tech., 2:3, 1990). To increase the25 efficiency of translation, the region immediately 5' of the initiator methionine coding was converted to an optimal ribosome binding site (CCACCATGG) by PCR amplification with a primer that carried the desired sequence. Twenty-four hours after transient transfection of human embryonic kidney cells with the expression construct and a plasmid expressing the simian virus 40 (SV40) large T-antigen (pRSV-TAg; Gorman, et al., DNA Protein Eng. Tech., _:3, 1990), cells were harvested and the proteins subjected to polyacrylamide gel electrophoresis and 5 immunoblotting with rabbit anti FHF-3 antiserum at a dilution of 1:5,000. As shown in Figure 6, cells transfected with FHF-3 (right lane) synth. si7P an immuno-reactive polypeptide with an apparent molecular mass of 30 kD that is not found in cells transfected with a related FGF family member (FHF-2; center lane) or in mock transfected cells (left lane). The a~parelll molecular mass in kD of prestained 10 protein size standards are shown to the left. The al~p~ellt molecular mass ofrecombinant FHF-3 is 5 kD higher that the predicted molecular mass of the primary translation product (25 kD), a discrepancy that most likely reflects the high isoelectric point (10.275) of the protein.

Although the invention has been described with reference to the presently preferred 15 embodiment, it should be understood that various modifications can be made without departing from the spirit of the invention. Accordingly, the invention is limited only by the following claims.

W O 97/3S007 PCT~US97/04641 SEQUENCE LISTING

( I ) GENERAL INFORMATION:

(i) APPLICANT: The lohns Hopkins University School of Medicine (ii) TITLE OF INVENTION: FIBROBROBLAST GROWTH FACTOR HOMOLOGOUS
FACTOR-3 (FHF-3) AND METHODS OF USE

(iii) NUMBER OF SEQUENCES: 19 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Fish & Richardson P.C.
(B) STREET: 4225 Executive Square, Suite 1400 (C) CITY: La Jolla (D) STATE: CA
(E) COUNTRY: USA
(F) ZIP: 92037 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentln Release #1.0, Version #1.30 (vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/621,143 (B) FILING DATE: 21-MAR-1996 (C) CLASSIFICATION:

(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Haile, Lisa A.
(B) REGISTRATION NUMBER: 38,347 (C) REFERENCE/DOCKET NUMBER: 0î265/083001 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 619/678-5070 (B) TELEFAX: 619/678-5099 (2) INFORMATION FOR SEQ ID NO: 1:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 961 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 74..748 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:

Met Ala Ala Leu Ala Ser Ser Leu lle Arg Gln Lys Arg Glu Val Arg Glu Pro Gly Gly Ser Arg Pro Val Ser Ala Gln Arg Arg Val Cys Pro Arg Gly Thr Lys Ser Leu Cys Gln Lys Gln Leu Leu Ile Leu Leu Ser Lys Val Arg Leu Cys Gly Gly Arg Pro Ala Arg Pro Asp Arg Gly Pro Glu Pro Gln Leu Lys Gly lle Val Thr Lys Leu Phe Cys Arg Gln Gly Phe Tyr Leu Gln Ala Asn Pro Asp Gly Ser Ile Gln Gly Thr Pro Glu Asp Thr Ser Ser Phe Thr His Phe Asn Leu Ile Pro Val Gly Leu Arg Val Val Thr Ile Gln Ser Ala Lys Leu Gly His Tyr Met Ala Met Asn Ala Glu Gly Leu Leu Tyr Ser Ser Pro His Phe Thr Ala Glu Cys Arg Phe Lys Glu Cys Val Phe Glu Asn Tyr Tyr Val Leu Tyr Ala Ser Ala Leu Tyr Arg Gln Arg Arg Ser Gly Arg Ala Trp Tyr Leu Gly Leu Asp Lys Glu Gly Gln Val Met Lys Gly Asn Arg Val Lys Lys Thr Lys Ala Ala Ala His Phe Leu Pro Lys Leu Leu Glu Val Ala Met Tyr Gln Glu Pro Ser Leu His Ser Val Pro Glu Ala Ser Pro Ser Ser Pro Pro Ala Pro (2) INFORMATION FOR SEQ ID NO:2:

(i) SEQIJENCE CHARACTERISTICS:
(A) LENGTH: 225 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

Met Ala Ala Leu Ala Ser Ser Leu Ile Arg Gln Lys Arg Glu Val Arg .. . ..... ..

~lu Pro Gly Gly Ser Arg Pro Val Ser Ala Gln Arg Arg Val Cys Pro Arg Gly Thr Lys Ser Leu Cys Gln Lys Gln Leu Leu lle Leu Leu Ser Lys Val Arg Leu Cys Gly Gly Arg Pro Ala Arg Pro Asp Arg Gly Pro Glu Pro Gln Leu Lys Gly Ile Val Thr Lys Leu Phe Cys Arg Gln Gly Phe Tyr Leu Gln Ala Asn Pro Asp Gly Ser Ile Gln Gly Thr Pro Glu ~sp Thr Ser Ser Phe Thr His Phe Asn Leu Ile Pro Val Gly Leu Arg Val Val Thr lle Gln Ser Ala Lys Leu Gly His Tyr Met Ala Met Asn Ala Glu Gly Leu Leu Tyr Ser Ser Pro His Phe Thr Ala Glu Cys Arg 13~ 135 140 Phe Lys Glu Cys Val Phe Glu Asn Tyr Tyr Val Leu Tyr Ala Ser Ala ~eu Tyr Arg Gln Arg Arg Ser Gly Arg Ala Trp Tyr Leu Gly Leu Asp ~ys Glu Gly Gln Val Met Lys Gly Asn Arg Val Lys Lys Thr Lys Ala Ala Ala His Phe Leu Pro Lys Leu Leu Glu Val Ala Met Tyr Gln Glu lgS 200 205 Pro Ser Leu His Ser Val Pro Glu Ala Ser Pro Ser Ser Pro Pro Ala Pro (2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

(2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

(2) INFORMATION FOR SEQ ID NO:5:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:S:

(2) INFORMATION FOR SEQ ID NO:6:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1422 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 332..1061 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

., WO 97t35007 PCTtUS97tO4641 GGCTGGGGCC TGAGGCCCTC GCTGAGCAGC T ATG GCT GCG GCG ATA GCC AGC 352 Met Ala Ala Ala lle Ala Ser Ser Leu lle Arg Gln Lys Arg Gln Ala Arg Glu Ser Asn Ser Asp Arg Val Ser Ala Ser Lys Arg Arg Ser Ser Pro Ser Lys Asp Gly Arg Ser Leu Cys Glu Arg His Val Leu Gly Val Phe Ser Lys Val Arg Phe Cys Ser Gly Arg Lys Arg Pro Val Arg Arg Arg Pro Glu Pro Gln Leu Lys Gly Ile Val Thr Arg Leu Phe Ser Gln Gln Gly Tyr Phe Leu Gln Met His Pro Asp Gly Thr Ile Asp Gly Thr Lys Asp Glu Asn Ser Asp Tyr Thr Leu Phe Asn Leu Ile Pro Val Gly Leu Arg Val Val Ala Ile Gln Gly Val Lys Ala Ser Leu Tyr Val Ala Met Asn Gly Glu Gly Tyr Leu Tyr Ser Ser Asp Val Phe Thr Pro Glu Cys Lys Phe Lys Glu Ser Val Phe Glu Asn Tyr Tyr Val Ile Tyr Ser Ser Thr Leu Tyr Arg Gln Gln Glu Ser Gly Arg Ala Trp Phe Leu Gly Leu Asn Lys Glu Gly Gln lle Met Lys Gly Asn Arg Val Lys Lys Thr Lys Pro Ser Ser His Phe Val Pro Lys Pro Ile Glu Val Cys Met Tyr Arg Glu Pro Ser Leu His Glu Ile Gly Glu Lys Gln Gly Arg Ser Arg Lys Ser Ser Gly Thr Pro Thr Met Asn Gly Gly Lys Val Val Asn Gln Asp Ser Thr (2) rNFORMATlON FOR SEQ ID NO:7:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 243 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

Met Ala Ala Ala lle Ala Ser Ser Leu lle Arg Gln Lys Arg Gln Ala Arg Glu Ser Asn Ser Asp Arg Val Ser Ala Ser Lys Arg Arg Ser Ser Pro Ser Lys Asp Gly Arg Ser Leu Cys Glu Arg His Val Leu Gly Val Phe Ser Lys Val Arg Phe Cys Ser Gly Arg Lys Arg Pro Val Arg Arg Arg Pro Glu Pro Gln Leu Lys Gly lle Val Thr Arg Leu Phe Ser Gln Gln Gly Tyr Phe Leu Gln Met His Pro Asp Gly Thr Ile Asp Gly Thr ~ys Asp Glu Asn Ser Asp Tyr Thr Leu Phe Asn Leu lle Pro Val Gly Leu Arg Val Val Ala Ile Gln Gly Val Lys Ala Ser Leu Tyr Val Ala Met Asn Gly Glu Gly Tyr Leu Tyr Ser Ser Asp Val Phe Thr Pro Glu 130 135 ~40 Cys Lys Phe Lys Glu Ser Val Phe Glu Asn Tyr Tyr Val Ile Tyr Ser ~er Thr Leu Tyr Arg Gln Gln Glu Ser Gly Arg Ala Trp Phe Leu Gly ~eu Asn Lys Glu Gly Gln Ile Met Lys Gly Asn Arg Val Lys Lys Thr Lys Pro Ser Ser His Phe Val Pro Lys Pro lle Glu Val Cys Met Tyr ~rg Glu Pro Ser Leu His Glu Ile Gly Glu Lys Gln Gly Arg Ser Arg Lys Ser Ser Gly Thr Pro Thr Met Asn Gly Gly Lys Val Val Asn Gln Asp Ser Thr (2) INFORMATION FOR SEQ ID NO:8:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1150 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 353..1088 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:

CCAGGCAGCC AGCAGCCCGC GCGGGAGCCG GACCGCCGCC GGAGGAGCTC GGACGGCATG 180' Met W O 97~5007 PCTrUS97/04641 Ala Ala Ala Ile Ala Ser Ser Leu lle Arg Gln Lys Arg Gln Ala Arg Glu Arg Glu Lys Ser Asn Ala Cys Lys Cys Val Ser Ser Pro Ser Lys Gly Lys Thr Ser Cys Asp Lys Asn Lys Leu Asn Val Phe Ser Arg Val Lys Leu Phe Gly Ser Lys Lys Arg Arg Arg Arg Arg Pro Glu Pro Gln Leu Lys Gly Ile Val Thr Lys Leu Tyr Ser Arg Gln Gly Tyr His Leu Gln Leu Gln Ala Asp Gly Thr Ile Asp Gly Thr Lys Asp Glu Asp Ser Thr Tyr Thr Leu Phe Asn Leu Ile Pro Val Gly Leu Arg Val Val Ala lle Gln Gly Val Gln Thr Lys Leu Tyr Leu Ala Met Asn Ser Glu Gly Tyr Leu Tyr Thr Ser Glu Leu Phe Thr Pro Glu Cys Lys Phe Lys Glu Ser Val Phe Glu Asn Tyr Tyr Val Thr Tyr Ser Ser Met lle Tyr Arg Gln Gln Gln Ser Gly Arg Gly Trp Tyr Leu Gly Leu Asn Lys Glu Glv Glu lle Met Lys Gly Asn His Val Lys Lys Asn Lys Pro Ala Ala His Phe Leu Pro Lys Pro Leu Lys Val Ala Met Tyr Lys Glu Pro Ser Leu His Asp Leu Thr Glu Phe Ser Arg Ser Gly Ser Gly Thr Pro Thr Lys Ser Arg Ser Val Ser Gly Val Leu Asn Gly Gly Lys Ser Met Ser His Asn Glu Ser Thr (2) INFORMATION FOR SEQ ID NO:9:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 245 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

Met Ala Ala Ala lle Ala Ser Ser Leu Ile Arg Gln Lys Arg Gln Ala ~rg Glu Arg Glu Lys Ser Asn Ala Cys Lys Cys Val Ser Ser Pro Ser Lys Gly Lys Thr Ser Cys Asp Lys Asn Lys Leu Asn Val Phe Ser Arg Val Lys Leu Phe Gly Ser Lys Lys Arg Arg Arg Arg Arg Pro Glu Pro Gln Leu Lys Gly Ile Val Thr Lys Leu Tyr Ser Arg Gln Gly Tyr His Leu Gln Leu Gln Ala Asp Gly Thr Ile Asp Gly Thr Lys Asp Glu Asp Ser Thr Tyr Thr Leu Phe Asn Leu Ile Pro Val Gly Leu Arg Val Val Ala lle Gln Gly Val Gln Thr Lys Leu Tyr Leu Ala Met Asn Ser Glu Gly Tyr Leu Tyr Thr Ser Glu Leu Phe Thr Pro Glu Cys Lys Phe Lys Glu Ser Val Phe Glu Asn Tyr Tyr Val Thr Tyr Ser Ser Met Ile Tyr Arg Gln Gln Gln Ser Gly Arg Gly Trp Tyr Leu Gly Leu Asn Lys Glu Gly Glu Ile Met Lys Gly Asn His Val Lys Lys Asn Lys Pro Ala Ala His Phe Leu Pro Lys Pro Leu Lys Val Ala Met Tyr Lys Glu Pro Ser Leu His Asp Leu Thr Glu Phe Ser Arg Ser Gly Ser Gly Thr Pro Thr Lys Ser Arg Ser Val Ser Gly Val Leu Asn Gly Gly Lys Ser Met Ser His Asn Glu Ser Thr (2) INFORMATION FOR SEQ ID NO:10:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 216 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:

Met Gly Ser Pro Arg Ser Ala Leu Ser Cys Leu Leu Leu His Leu Leu Val Leu Cys Leu Gln Ala Gln Val Thr Val Gln Ser Ser Pro Asn Phe Thr Gln His Val Arg Glu Gln Ser Leu Val Thr Asp Gln Leu Ser Arg Arg Leu lle Arg Thr Tyr Gln Leu Tyr Ser Arg Thr Ser Gly Lys His Val Gln Val Leu Ala Asn Lys Arg Ile Asn Ala Met Ala Glu Asp Gly Asp Pro Phe Ala Lys Leu Ile Val Glu Thr Asp Thr Phe Gly Ser Arg Val Arg Val Arg Gly Ala Glu Thr Gly Leu Tyr Ile Cys Met Asn Lys Lys Gly Lys Leu Ile Ala Lys Ser Asn Gly Lys Gly Lys Asp Cys Val Phe lle Glu Ile Val Leu Glu Asn Asn Tyr Thr Ala Leu Gln Asn Ala Lys Tyr Glu Gly Trp Tyr Met Ala Phe Thr Arg Lys Gly Arg Pro Arg Lys Gly Ser Lys Thr Arg Gln His Gln Arg Glu Val His Phe Met Lys 165 170 1~5 Arg Leu Pro Arg Gly His His Thr Thr Glu Gln Ser Leu Arg Phe Glu Phe Leu Asn Tyr His Pro Pro Phe Thr Arg Ser Leu Arg Gly Ser Gln Arg Thr Trp Ala Pro Glu Pro Arg (2) INFORMATION FOR SEQ ID NO:I 1:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 225 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:II:

Met Ala Ala Leu Ala Ser Ser Leu Ile Arg Gln Lys Arg Glu Val Arg Glu Pro Gly Gly Ser Arg Pro Val Ser Ala Gln Arg Arg Val Cys Pro Arg Gly Thr Lys Ser Leu Cys Gln Lys Gln Leu Leu Ile Leu Leu Ser Lys Val Arg Leu Cys Gly Gly Arg Pro Ala Arg Pro Asp Arg Gly Pro Glu Pro Gln Leu Lys Gly lle Val Thr Lys Leu Phe Cys Arg Gln Gly ~he Tyr Leu Gln Ala Asn Pro Asp Gly Ser lle Gln Gly Thr Pro Glu Asp Thr Ser Ser Phe Thr His Phe Asn Leu Ile Pro Val Gly Leu Arg Val Val Thr Ile Gln Ser Ala Lys Leu Gly His Tyr Met Ala Met Asn Ala Glu Gly Leu Leu Tyr Ser Ser Pro His Phe Thr Ala Glu Cys Arg Phe Lys Glu Cys Val Phe Glu Asn Tyr Tyr Val Leu Tyr Ala Ser Ala ~eu Tyr Arg Gln Arg Arg Ser Gly Arg Ala Trp Tyr Leu Gly Leu Asp ~ys Glu Gly Gln Val Met Lys Gly Asn Arg Val Lys Lys Thr Lys Ala W O 97/35007 PC~AUS97/04641 Ala Ala His Phe Leu Pro Lys Leu Leu Glu Val Ala Met Tyr Gln Glu Pro Ser Leu His Ser Val Pro Glu Ala Ser Pro Ser Ser Pro Pro Ala Pro (2) INFORMATION FOR SEQ ID NO:12:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 194 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:

Met His Lys Trp Ile Leu Thr Trp Ile Leu Pro Thr Leu Leu Tyr Arg Ser Cys Phe His Ile lle Cys Leu Val Gly Thr lle Ser Leu Ala Cys Asn Asp Met Thr Pro Glu Gln Met Ala Thr Asn Val Asn Cys Ser Ser Pro Glu Arg His Thr Arg Ser Tyr Asp Tyr Met Glu Gly Gly Asp lle Arg Val Arg Arg Leu Phe Cys Arg Thr Gln Trp Tyr Leu Arg Ile Asp Lys Arg Gly Lys Val Lys Gly Thr Gln Glu Met Lys Asn Asn Tyr Asn lle Met Glu Ile Arg Thr Val Ala Val Gly Ile Val Ala lle Lys Gly Val Glu Ser Glu Phe Tyr Leu Ala Met Asn Lys Glu Gly Lys Leu Tyr Ala Lys Lys Glu Cys Asn Glu Asp Cys Asn Phe Lys Glu Leu Ile Leu Glu Asn His Tyr Asn Thr Tyr Ala Ser Ala Lys Trp Thr His Asn Gly Gly Glu Met Phe Val Ala Leu Asn Gln Lys Gly lle Pro Val Arg Gly Lys Lys Thr Lys Lys Glu Gln Lys Thr Ala His Phe Leu Pro Met Ala Ile Thr ~2) INFORMATION FOR SEQ ID N 0:13:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 245 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N 0:13:
-Met Gly Leu lle Trp Leu Leu Leu Leu Ser Leu Leu Glu Pro Ser Trp Pro Thr Thr Gly Pro Gly Thr Arg Leu Arg Arg Asp Ala Gly Gly Arg Gly Gly Val Tyr Glu His Leu Gly Gly Ala Pro Arg Arg Arg Lys Leu Tyr Cys Ala Thr Lys Tyr His Leu Gln Leu His Pro Ser Gly Arg Val Asn Gly Ser Leu Glu Asn Ser Ala Tyr Ser Ile Leu Glu lle Thr Ala Val Glu Val Gly Val Val Ala Ile Lys Gly Leu Phe Ser Gly Arg Tyr Leu Ala Met Asn Lys Arg Gly Arg Leu Tyr Ala Ser Asp His Tyr Asn Ala Glu Cys Glu Phe Val Glu Arg lle His Glu Leu Gly Tyr Asn Thr Tyr Ala Ser Arg Leu Tyr Arg Thr Gly Ser Ser Gly Pro Gly Ala Gln Arg Gln Pro Gly Ala Gln Arg Pro Trp Tyr Val Ser Val Asn Gly Lys Gly Arg Pro Arg Pro Gly Phe Lys Thr Arg Arg Thr Gln Lys Ser Ser 165 1?0 175 Leu Phe Leu Pro Arg Val Leu Gly His Lys Asp His Glu Met Val Arg WO 97/35007 PCr/US97/04641 Leu Leu Gln Ser Ser Gln Pro Arg Ala Pro Gly Glu Gly Ser Gln Pro Arg Gln Arg Arg Gln Lys Lys Gln Ser Pro Gly Asp His Gly Lys Met Glu Thr Leu Ser Thr Arg Ala Thr Pro Ser Thr Gln Leu His Thr Gly Gly Leu Ala Val Ala (2) INFORMATION FOR SEQ ID NO: 14:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 268 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:

Met Ser Leu Ser Phe Leu Leu Leu Leu Phe Phe Ser His Leu Ile Leu Ser Ala Trp Ala His Gly Glu Lys Arg Leu Ala Pro Lys Gly Gln Pro Gly Pro Ala Ala Thr Asp Arg Asn Pro lle Gly Ser Ser Ser Arg Gln WO 97/35007 PCTI~JS97/04641 Ser Ser Ser Ser Ala Met Ser Ser Ser Ser Ala Ser Ser Ser Pro Ala Ala Ser Leu Gly Ser Gln Gly Ser Gly Leu Glu Gln Ser Ser Phe Gln ~rp Ser Pro Ser Gly Arg Arg Thr Gly Ser Leu Tyr Cys Arg Val Gly lle Gly Phe His Leu Gln lle Tyr Pro Asp Gly Lys Val Asn Gly Ser His Glu Ala Asn Met Leu Ser Val Leu Glu lle Phe Ala Val Ser Gln Gly lle Val Gly lle Arg Gly Val Phe Ser Asn Lys Phe Leu Ala Met Ser Lys Lys Gly Lys Leu His Ala Ser Ala Lys Phe Thr Asp Asp Cys Lys Phe Arg Glu Arg Phe Gln Glu Asn Ser Tyr Asn Thr Tyr Ala Ser Ala Ile His Arg Thr Glu Lys Thr Gly Arg Glu Trp Tyr Val Ala Leu Asn Lys Arg Gly Lys Ala Lys Arg Gly Cys Ser Pro Arg Val Lys Pro Gln His Ile Ser Thr His Phe Leu Pro Arg Phe Lys Gln Ser Glu Gln Pro Glu Leu Ser Phe Thr Val Thr Val Pro Glu Lys Lys Asn Pro Pro Ser Pro lle Lys Ser Lys lle Pro Leu Ser Ala Pro Arg Lys Asn Thr Asn Ser Val Lys Tyr Arg Leu Lys Phe Arg Phe Gly (2) lNFORMATION FOR SEQ ID NO: 15:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 206 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:

Met Ser Gly Pro Gly Thr Ala Ala Val Ala Leu Leu Pro Ala Val Leu Leu Ala Leu Leu Ala Pro Trp Ala Gly Arg Gly Gly Ala Ala Ala Pro Thr Ala Pro Asn Gly Thr Leu Glu Ala Glu Leu Glu Arg Arg Trp Glu Ser Leu Val Ala Leu Ser Leu Ala Arg Leu Pro Val Ala Ala Gln Pro Lys Glu Ala Ala Val Gln Ser Gly Ala Gly Asp Tyr Leu Leu Gly lle Lys Arg Leu Arg Arg Leu Tyr Cys Asn Val Gly lle G]y Phe His Leu Gln Ala Leu Pro Asp Gly Arg lle Gly Gly Ala His Ala Asp Thr Arg Asp Ser Leu Leu Glu Leu Ser Pro Val Glu Arg Gly Val Val Ser lle Phe Gly Val Ala Ser Arg Phe Phe Val Ala Met Ser Ser Lys Gly Lys Leu Tyr Gly Ser Pro Phe Phe Thr Asp Glu Cys lle Phe Lys Glu lle Leu Leu Pro Asn Asn Tyr Asn Ala Tyr Glu Ser Tyr Lys Tyr Pro Gly Met Pro lle Ala Leu Ser Lys Asn Gly Lys Thr Lys Lys Gly Asn Arg Val Ser Pro Thr Met Lys Val Thr His Phe Leu Pro Arg Leu (2) INFORMATION FOR SEQ ID NO:16:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 198 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein {xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:

Met Ser Arg Gly Ala Gly Arg Leu Gln Gly Thr Leu Trp Ala Leu Val Phe Leu Gly lle Leu Val Gly Met Val Val Pro Ser Pro Ala Gly Thr Arg Ala Asn Asn Thr Leu Leu Asp Ser Arg Gly Trp Gly Thr Leu Leu Ser Arg Ser Arg Ala Gly Leu Ala Gly Glu Ile Ala Gly Val Asn Trp Glu Ser Gly Tyr Leu Val Gly lle Lys Arg Gln Arg Arg Leu Tyr Cys Asn Val Gly lle Gly Phe His Leu Gln Val Leu Pro Asp Gly Arg lle Ser Gly Thr His Glu Glu Asn Pro Tyr Ser Leu Leu Glu lle Ser Thr Val Glu Arg Gly Val Val Ser Leu Phe Gly Val Arg Ser Ala Leu Phe Val Ala Met Asn Ser Lys Gly Arg Leu Tyr Ala Thr Pro Ser Phe Gln Glu Glu Cys Lys Glu Arg Glu Thr Leu Leu Pro Asn Asn Tyr Asn Ala Tyr Glu Ser Asp Leu Tyr Gln Gly Thr Tyr lle Ala Leu Ser Lys Tyr Gly Arg Val Lys Arg Gly Ser Lys Val Ser Pro Ile Met Thr Val Thr His Phe Leu Pro Arg Ile (2) INFORMATION FOR SEQ ID NO:17:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 208 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:

Met Ala Pro Leu Gly Glu Val Gly Asn Tyr Phe Gly Val Gln Asp Ala Val Pro Phe Gly Asn Val Pro Val Leu Pro Val Asp Ser Pro Val Leu Leu Ser Asp His Leu Gly Gln Ser Glu Ala Gly Gly Leu Pro Arg Gly Pro Ala Val Thr Asp Leu Asp His Leu Lys Gly lle Leu Arg Arg Arg Gln Leu Tyr Cys Arg Thr Gly Phe His Leu Glu Ile Phe Pro Asn Gly W O 97/35007 PCT~US97104641 Thr Ile Gln Gly Thr Arg Lys Asp His Ser Arg Phe Gly lle Leu Glu Phe Ile Ser Ile Ala Val Gly Leu Val Ser Ile Arg Gly Val Asp Ser Gly Leu Tyr Leu Gly Met Asn Glu Lys Gly Glu Leu Tyr Gly Ser Glu Lys Leu Thr Gln Glu Cys Val Phe Arg Glu Gln Phe Glu Glu Asn Trp Tyr Asn Thr Tyr Ser Ser Asn Leu Tyr Lys His Val Asp Thr Gly Arg Arg Tyr Tyr Val Ala Leu Asn Lys Asp Gly Thr Pro Arg Glu Gly Thr Arg Thr Lys Arg His Gln Lys Phe Thr His Phe Leu Pro Arg Pro Val Asp Pro Asp Lys Val Pro Glu Leu Tyr Lys Asp Ile Leu Ser Gln Ser (2) INFORMATION FOR SEQ ID NO:18:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 155 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18:

Met Ala Glu Gly Glu lle Thr Thr Phe Thr Ala Leu Thr Glu Lys Phe Asn Leu Pro Pro Gly Asn Tyr Lys Lys Pro Lys Leu Leu Tyr Cys Ser Asn Gly Gly His Phe Leu Arg Ile Leu Pro Asp Gly Thr Val Asp Gly Thr Arg Asp Arg Ser Asp Gln His lle Gln Leu Gln Leu Ser Ala Glu Ser Val Gly Glu Val Tyr Ile Lys Ser Thr Glu Thr Gly Gln Tyr Leu Ala Met Gln Thr Asp Gly Leu Leu Tyr Gly Ser Gln Thr Pro Asn Glu Glu Cys Leu Phe Leu Glu Arg Leu Glu Glu Asn His Tyr Asn Thr Tyr Ile Ser Lys Lys His Ala Glu Lys Asn Trp Phe Val Gly Leu Lys Lys Asn Gly Ser Cys Lys Arg Gly Pro Arg Thr His Tyr Gly Gln Lys Ala lle Leu Phe Leu Pro Leu Pro Val Ser Ser Asp (2) INFORMATION FOR SEQ ID NO:19:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 155 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:I9:
~et Ala Ala Gly Ser lle Thr Thr Leu Pro Ala Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys Lys Asn Gly Gly Phe Phe Leu Arg lle His Pro Asp Gly Arg Val Asp Gly Val Arg Glu Lys Ser Asp Pro His lle Lys Leu Gln Leu Gln Ala Glu Glu Arg Gly Val Val Ser Ile Lys Gly Val Cys Ala Asn ~rg Tyr Leu Ala Met Lys Glu Asp Gly Arg Leu Leu Ala Ser Lys Cys ~al Thr Asp Glu Cys Phe Phe Phe Glu Arg Leu Glu Ser Asn Asn Tyr Asn Thr Tyr Arg Ser Arg Lys Tyr Thr Ser Trp Tyr Val Ala Leu Lys Arg Thr Gly Gln Tyr Lys Leu Gly Ser Lys Thr Gly Pro Gly Gln Lys Ala lle Leu Phe Leu Pro Met Ser Ala Lys Ser .. . . . , , . ~ .

Claims

1. Substantially pure fibroblast growth factor homologous factor-3 (FHF-3) polypeptide.

2. The polypeptide of claim 1, characterized by:
a. having a molecular weight of about 30kD as determined by reducing SDS-PAGE; and b. encoded by a polynucleotide having a chromosomal location on chromosome 17.

3. The polypeptide of claim 2, having the amino acid sequence as set forth in SEQ ID NO:2 (Figure 1).

4. An isolated polynucleotide sequence encoding the FHF-3 polypeptide of claim 1.

5. The polynucleotide of claim 4, wherein the FHF-3 nucleotide sequence is selected from the group consisting of:
a. SEQ ID NO:1 (Figure 1), wherein T can also be U;
b. nucleic acid sequences complementary to SEQ ID NO:1;
c. fragments of a. or b. that are at least 15 bases in length and that will selectively hybridize to DNA which encodes the FHF-3 protein of SEQ ID NO:2 (Figure 1), under moderately stringent conditions.

6. The polynucleotide sequence of claim 4, wherein the polynucleotide is isolated from a mammalian cell.

7. The polynucleotide of claim 6, wherein the mammalian cell is a human cell.

8. An expression vector including the polynucleotide of claim 4.

9. The vector of claim 8, wherein the vector is a plasmid.

10. The vector of claim 8, wherein the vector is a virus.

11. A host cell stably transformed with the vector of claim 8.

12. The host cell of claim 11, wherein the cell is prokaryotic.

13. The host cell of claim 11, wherein the cell is eukaryotic.

14. An antibody that binds to FHF-3 polypeptide or immunoreactive fragments thereof.

15. The antibody of claim 14, wherein the antibody is polyclonal.

16. The antibody of claim 14, wherein the antibody is monoclonal.

17. A method of detecting a cell proliferative disorder comprising contacting a specimen of a subject suspected of having a FHF-3 associated cell proliferative disorder with a reagent that binds to FHF-3 and detecting binding of the reagent to FHF-3.

18. The method of claim 17, wherein the cell is selected from the group consisting of brain, testes, lung or eye cell.

19. The method of claim 17, wherein the reagent is an antibody which binds to FHF-3.

20. The method of claim 17, wherein the reagent is a polynucleotide which encodes FHF-3 polypeptide or fragments thereof.

21. The method of claim 17, wherein the detecting is in vivo.

22. The method of claim 17, wherein the detection is in vitro.

23. The method of claim 19 or 20, wherein the reagent is detectably labeled.

24. The method of claim 23, wherein the detectable label is selected from the group consisting of a radioisotope, a fluorescent compound, a bioluminescent compound and a chemiluminescent compound.

25. A method of treating a cell proliferative disorder associated with expression of FHF-3, comprising contacting the cell having or suspected of having the disorder with a reagent which suppresses the FHF-3 activity.

26. The method of claim 25, wherein the reagent is an anti-FHF-3 antibody.

27. The method of claim 25, wherein the reagent is a FHF-3 antisense sequence.

28. The method of claim 25, wherein the cell is a testes, brain, lung, or eye cell.

29. The method of claim 25, wherein the reagent which suppresses FHF-3 activity is introduced to the cell using a vector.

30. The method of claim 29, wherein the vector is a colloidal dispersion system.

31. The method of claim 29, wherein the vector is a virus.

32. The method of claim 31, wherein the RNA virus is a retrovirus.