AU719538B2 - Fibroblast growth factor homologous factor-3 (FHF-3) and methods of use - Google Patents

Description

WO 97/35007 PCT/US97/04641 -1- FIBROBLAST GROWTH FACTOR HOMOLOGOUS FACTOR-3 (FHF-3) AND METHODS OF USE BACKGROUND OF THE INVENTION 1. FIELD OF THE INVENTION The invention relates generally to growth factors and specifically to a novel member of the fibroblast growth factor family, denoted fibroblast growth factor homologous factor-3 (FHF-3) and the polynucleotide encoding FHF-3.

2. DESCRIPTION OF RELATED ART The fibroblast growth factor family encompasses a group of structurally related proteins with a wide range of growth promoting, survival, and/or differentiation activities in vivo and in vitro (reviewed in Baird, and Gospodarowicz, D. Ann N. Y Acad. Sci. 638: 1, 1991; Eckenstein, J. Neurobiology 25: 1467, 1994; Mason, I.J. Cell 78: 547, 1994). As of December 1994, nine members of this family had been characterized by molecular cloning. The first two members of the family to be characterized, acidic fibroblast growth factor (aFGF/FGF-1) and basic fibroblast growth factor (bFGF/FGF-2), have been found in numerous tissues, including for example brain, eye, kidney, placenta, and adrenal (Jaye et al., Science 233: 541, 1986; Abraham et al., Science 233: 545, 1986). These factors have been shown to be potent mitogens and survival factors for a variety of mesoderm and neurectoderm-derived tissues, including fibroblasts, endothelial cells, hippocampal and cerebral cortical neurons, and astroglia (Burgess, W. H. and Maciag, Ann.

Rev. Biochemistry 58: 575, 1989). Additional members of the FGF family include: int-2/FGF-3, identified as one of the frequent sites of integration of the mouse mammary tumor virus, and therefore a presumptive oncogenic factor (Smith et al., EMBO J. 7: 1013, 1988); FGF-4 (Delli-Bovi et al., Cell 50: 729, 1987) and WO 97/35007 PCT/US97/04641 -2- (Zhan et al., Mol. Cell Biol.8: 3487, 1988) as transforming genes in the NIH 3T3 transfection assay; FGF-6, isolated by molecular cloning based on its homology to FGF-4 (Marics et al., Oncogene 4: 335 (1989); keratinocyte growth factor/ FGF-7, identified as a mitogen for keratinocytes (Finch et al., Science 245: 752, 1989); FGF-8 as an androgen-induced mitogen for mammary carcinoma cells (Tanaka et al., Proc. Natl. Acad. Sci. USA 89: 8928, 1992); and FGF-9 as a mitogen for primary astrocytes (Miyamoto et al., Mol. Cell Biol. 13: 4251, 1993). Several of the FGFs, including aFGF and bFGF, lack a classical signal sequence; the mechanism by which they are secreted is not known.

All members of the FGF family share approximately 25% or more amino acid sequence identity, a degree of homology indicating that they are likely to share nearly identical three-dimensional structures. Support for this inference comes from a comparison of the three-dimensional structures of bFGF and interleukin 1-beta determined by x-ray diffraction (Eriksson et al., Proc. Natl. Acad. Sci USA 88: 3441, 1991; Zhang et al., Proc. Natl. Acad. Sci USA 88: 3446, 1991; Ago et al., J. Biochem. 110: 360, 1991). Although these proteins share only 10% amino acid identity, the alpha carbon backbones of the two crystal structures can be superimposed with a root-mean square deviation of less than 2 angstroms (Zhang et al., Proc. Natl. Acad. Sci USA 88: 3446, 1991). Both proteins consist almost entirely of beta-sheets, which form a barrel composed of three copies of a four-stranded beta-meander motif. The likely heparin- and receptor-binding regions are located on nearby regions on one face of the protein.

aFGF, bFGF, and FGF-7/KGF have been shown to exert some or all of their biological activity through high affinity binding to cell surface tyrosine kinase receptors Lee, P. et al., Science 245: 57, 1989; reviewed in Johnson, D.E.

and Williams, Adv. Cancer Res. 60: 1, 1993). Many members of the FGF family also bind tightly to heparin, and a terniary complex of heparin, FGF, and transmembrane receptor may be the biologically relevant signaling species. Thus pi- 3 far four different genes have been identified that encode receptors for FGF family members. Recent work has shown that receptor diversity is increased by differential mRNA splicing within the extracellular ligand binding domain, with the result that multiple receptor isoforms with different ligand binding properties can be encoded by the same gene (Johnson, D.E. and Williams, Adv. Cancer Res. 60: 1, 1993). In tissue culture systems, the binding of aFGF or bFGF to its cell surface receptor activates phospholipase C-gamma (Burgess, W.H. et al., Mol. Cell Biol. 10: 4770, 1990), a pathway known to integrate a variety of mitogenic signals.

Identification and characterization of new members of the FGF family will provide insights into the mechanisms by which cells and organs control their growth, survival, senescence, differentiation, and recovery from injury.

SUMMARY OF THE INVENTION The present invention provides a cell growth, survival or differentiation factor, FHF-3 and a polynucleotide sequence which encodes the factor. This factor is involved in the growth, survival, and or differentiation of cells S 20 within the central nervous system (CNS) as well as in peripheral tissues.

The invention provides a method for detecting alterations in FHF-3 gene expression which are diagnostic of neurodegenerative or neoplastic disorders.

In another embodiment, the invention provides a method for treating a 25 neurodegenerative or neoplastic disorder by modulating the expression or activity of FHF-3.

Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a 30 stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

BRIEF DESCRIPTION OF THE DRAWINGS 3a Figure 1 shows the nucleotide and predicted amino acid sequence of human FHF-3 (SEQ. ID NO: 1 and 2).

WO 97/35007 PCT/US97/04641 -4- Figure 2 shows the alignment of the amino acid sequence of human FHF-3 and each of the other nine members of the FGF family. Conserved residues are highlighted. The FGF family members are: aFGF/FGF-1 (Jaye et al., Science 233: 541, 1986), bFGF/FGF-2 (Abraham et al., Science 233: 545, 1986), int-2/FGF-3 (Smith et al., EMBO J. 7: 1013, 1988), FGF-4 (Delli-Bovi et al., Cell 50: 729, 1987), FGF-5 (Zhan et al., Mol. Cell Biol. 8: 3487, 1988), FGF-6 (Marics et al., Oncogene 4: 335, 1989); keratinocyte growth factor/ FGF-7 (Finch et al., Science 245: 752, 1989), FGF-8 (Tanaka et al., Proc. Natl. Acad. Sci. USA 89: 8928, 1992), and FGF-9 (Miyamoto et al., Mol. Cell Biol. 13: 4251, 1993).

Figure 3 shows a dendrogram in which the length of each path connecting any pair of FGF family members is proportional to the degree of amino acid sequence divergence of that pair.

Figure 4 shows that the gene encoding FHF-3 is located on human chromosome 17.

The human specific hybridization is found on chromosome 17.

Figure 5 shows the tissue specificity of FHF-3 expression. Ten micrograms of total RNA from the indicated mouse tissues was prepared (Chomczinski Sacchi. Anal.

Biochem. 162: 156, 1987) and used for RNAse protection (Ausabel et al., Current Protocols in Molecular Biology; New York: Wiley Interscience, 1987) with a mouse FHF-3 antisense probe that spanned 200 bases of cloned cDNA including bases of 5' untranslated sequences and 130 bases at the beginning of the coding region. RNAse protection at the size expected (arrowhead) was observed most strongly with RNA from brain and eye; weak protection was seen with RNA from lung and testis.

Figure 6 shows an immunoblot of FHF-3 produced in transiently transfected human embryonic kidney cells (line 293). Cells transfected with FHF-3 (right lane) synthesize an immunoreactive polypeptide with an apparent molecular mass of WO 97/35007 PCT/US97/04641 kD that is not found in cells transfected with a related FGF family member (FHF- 2; center lane) or in mock transfected cells (left lane). The apparent molecular mass in kD of prestained protein size standards are shown to the left.

Figures 7a and 7b show the nucleotide and deduced amino acid sequence of FHF-1 and FHF-2, respectively (SEQ ID NO:6-9).

DETAILED DESCRIPTION OF THE INVENTION The present invention provides a growth factor, FHF-3, and a polynucleotide sequence encoding FHF-3. FHF-3 is expressed at high levels in brain and eye tissues, and at a lower level in lung and testes.. In one embodiment, the invention provides a method for detection of a cell proliferative or degenerative disorder of central nervous system which is associated with FHF-3 expression or function. In another embodiment, the invention provides a method for treating. a cell proliferative or immunologic disorder by using an agent which suppresses or enhances FHF- 3 expression or activity.

The structural homology between the FHF-3 protein of this invention and the members of the FGF family, indicates that FHF-3 is a new member of the family of growth factors. Based on the known activities of many of the other members, it can be expected that FHF-3 will also possess biological activities that will make it useful as a diagnostic and therapeutic reagent.

Many growth factors have expression patterns or possess activities that relate to the function of the nervous system. For example, one growth factor in the TGF family, namely GDNF, has been shown to be a potent neurotrophic factor that can promote the survival of dopaminergic neurons (Lin, et al., Science, 260:1130).

Another family member, namely dorsalin-1, is capable of promoting the differentiation of neural crest cells (Basler, et al., Cell, 73:687, 1993). The inhibins and WO 97/35007 PCT/US97/04641 -6activins have been shown to be expressed in the brain (Meunier, et al., Proc.

Nat'l. Acad. Sci., USA, 85:247, 1988; Sawchenko, et al., Nature, 334:615, 1988), and activin has been shown to be capable of functioning as a nerve cell survival molecule (Schubert, et al., Nature, 344:868, 1990). Another TGF family member, namely GDF-1, is nervous system-specific in its expression pattern (Lee, Proc.

Nat'l. Acad. Sci., USA, 88:4250, 1991), and certain other family members, such as Vgr-1 (Lyons, et al., Proc. Nat'l. Acad. Sci., USA, 86:4554, 1989; Jones, et al., Development, 111:581, 1991), OP-1 (Ozkaynak, et al., J. Biol. Chem., 267:25220, 1992), and BMP-4 (Jones, et al., Development, 111:531, 1991), are also known to be expressed in the nervous system.

The expression of FHF-3 in brain and eye suggests that FHF-3 may also possess activities that relate to the function of the nervous system. FHF-3 may have neurotrophic activities for various neuronal populations. Hence, FHF-3 may have in vitro and in vivo applications in the treatment of neurodegenerative diseases, such as amyotrophic lateral sclerosis, or in maintaining cells or tissues in culture prior to transplantation.

In a first embodiment, the present invention provides a substantially pure fibroblast growth factor homologous factor-3 (FHF-3) characterized by having a molecular weight of about 26-28kD as determined by reducing SDS-PAGE and having essentially the amino acid sequence of SEQ ID NO:2 (FIGURE The term "substantially pure" as used herein refers to FHF-3 which is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. One skilled in the art can purify FHF-3 using standard techniques for protein purification. The substantially pure polypeptide will yield a single major band on a non-reducing polyacrylamide gel. The purity of the FHF-3 polypeptide can also be determined by amino-terminal amino acid sequence analysis. FHF-3 polypeptide includes functional fragments of the polypeptide, as long as the activity WO 97/35007 PCT/US97/04641 -7of FHF-3 remains. Smaller peptides containing the biological activity of FHF-3 are included in the invention.

The invention provides polynucleotides encoding the FHF-3 polypeptide. These polynucleotides include DNA, cDNA and RNA sequences which encode FHF-3. It is understood that all polynucleotides encoding all or a portion of FHF-3 are also included herein, as long as they encode a polypeptide with FHF-3 activity. Such polynucleotides include naturally occurring, synthetic, and intentionally manipulated polynucleotides. For example, FHF-3 polynucleotide may be subjected to sitedirected mutagenesis. The polynucleotide sequence for FHF-3 also includes antisense sequences. The polynucleotides of the invention include sequences that are degenerate as a result of the genetic code. There are 20 natural amino acids, most of which are specified by more than one codon. Therefore, all degenerate nucleotide sequences are included in the invention as long as the amino acid sequence of FHF-3 polypeptide encoded by the nucleotide sequence is functionally unchanged.

Specifically disclosed herein is a DNA sequence encoding the human FHF-3 polypeptide. The sequence contains an open reading frame encoding a polypeptide 225 amino acids in length. The human FHF-3 inititiator methionine codon shown in FIGURE 1 at position 74 is the first ATG codon in-frame; a good consensus ribosome binding site (GCGCTATGG; Kozak, Nucleic Acids Res., 15: 8125, 1987) is found at this position. The next methionine codon within the open reading frame is encountered 124 codons 3' of the putative initiator methionine codon. As observed for aFGF and bFGF, the amino-terminus of the primary translation product of FHF-3 does not conform to the consensus sequence for a signal peptide to direct cotranslational insertion across the endoplasmic reticulum membrane. The FHF-3 sequence lacks potential asn-X-ser/thr sites for asparagine-linked glycosylation. Preferably, the human FHF-3 nucleotide sequence is SEQ ID NO:1 and the deduced amino acid sequence is preferably SEQ ID NO:2 (see FIGURE 1).

WO 97/35007 PCT/US97/04641 -8- The polynucleotide encoding FHF-3 includes SEQ ID NO:1 as well as nucleic acid sequences complementary to SEQ ID NO:1. A complementary sequence may include an antisense nucleotide. When the sequence is RNA, the deoxynucleotides A, G, C, and T of SEQ ID NO:1 is replaced by ribonucleotides A, G, C, and U, respectively. Also included in the invention are fragments of the above-described nucleic acid sequences that are at least 15 bases in length, which is sufficient to permit the fragment to selectively hybridize to DNA that encodes the protein of SEQ ID NO:2 under physiological conditions. Specifically, the fragments should hybridize to DNA encoding FHF-3 protein under moderately stringent conditions.

The FGF family member most homologous to FHF-3 is FGF-9, which shares amino acid identity when aligned with 8 gaps. Minor modifications of the FHF-3 primary amino acid sequence may result in proteins which have substantially equivalent activity as compared to the FHF-3 polypeptide described herein. Such proteins include those as defined by the term "having essentially the amino acid sequence of SEQ ID NO:2". Such modifications may be deliberate, as by sitedirected mutagenesis, or may be spontaneous. All of the polypeptides produced by these modifications are included herein as long as the biological activity of FHF-3 still exists. Further, deletion of one or more amino acids can also result in a modification of the structure of the resultant molecule without significantly altering its biological activity. This can lead to the development of a smaller active molecule which would have broader utility. For example, one can remove amino or carboxy terminal amino acids which are not required for FHF-3 biological activity.

The FHF-3 polypeptide of the invention encoded by the polynucleotide of the invention includes the disclosed sequence (SEQ ID NO:2) and conservative variations thereof. The term "conservative variation" as used herein denotes the replacement of an amino acid residue by another, biologically similar residue.

WO 97/35007 PCT/US97/04641 -9- Examples of conservative variations include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as the substitution of arginine for lysine, glutamic for aspartic acid, or glutamine for asparagine, and the like. The term "conservative variation" also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid provided that antibodies raised to the substituted polypeptide also immunoreact with the unsubstituted polypeptide.

DNA sequences of the invention can be obtained by several methods. For example, the DNA can be isolated using hybridization techniques which are well known in the art. These include, but are not limited to: 1) hybridization of genomic or cDNA libraries with probes to detect homologous nucleotide sequences, 2) polymerase chain reaction (PCR) on genomic DNA or cDNA using primers capable of annealing to the DNA sequence of interest, and 3) antibody screening of expression libraries to detect cloned DNA fragments with shared structural features.

Preferably the FHF-3 polynucleotide of the invention is derived from a mammalian organism, and most preferably from human. Screening procedures which rely on nucleic acid hybridization make it possible to isolate any gene sequence from any organism, provided the appropriate probe is available. Oligonucleotide probes, which correspond to a part of the sequence encoding the protein in question, can be synthesized chemically. This requires that short, oligopeptide stretches of amino acid sequence must be known. The DNA sequence encoding the protein can be deduced from the genetic code, however, the degeneracy of the code must be taken into account. It is possible to perform a mixed addition reaction when the sequence is degenerate. This includes a heterogeneous mixture of denatured doublestranded DNA. For such screening, hybridization is preferably performed on either single-stranded DNA or denatured double-stranded DNA. Hybridization is particularly useful in the detection of cDNA clones derived from sources where an extremely low amount of mRNA sequences relating to the polypeptide of interest WO 97/35007 PCT/US97/04641 are present. In other words, by using stringent hybridization conditions directed to avoid non-specific binding, it is possible, for example, to allow the autoradiographic visualization of a specific cDNA clone by the hybridization of the target DNA to that single probe in the mixture which is its complete complement (Wallace, et al., Nucl. Acid Res., 9:879, 1981; Maniatis, et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y 1989).

The development of specific DNA sequences encoding FHF-3 can also be obtained by: 1) isolation of double-stranded DNA sequences from the genomic DNA; 2) chemical manufacture of a DNA sequence to provide the necessary codons for the polypeptide of interest; and 3) in vitro synthesis of a double-stranded DNA sequence by reverse transcription of mRNA isolated from a eukaryotic donor cell.

In the latter case, a double-stranded DNA complement of mRNA is eventually formed which is generally referred to as cDNA.

Of the three above-noted methods for developing specific DNA sequences for use in recombinant procedures, the isolation of genomic DNA isolates is the least common. This is especially true when it is desirable to obtain the microbial expression of mammalian polypeptides due to the presence of introns.

The synthesis of DNA sequences is frequently the method of choice when the entire sequence of amino acid residues of the desired polypeptide product is known.

When the entire sequence of amino acid residues of the desired polypeptide is not known, the direct synthesis of DNA sequences is not possible and the method of choice is the synthesis of cDNA sequences. Among the standard procedures for isolating cDNA sequences of interest is the formation of plasmid- or phage-carrying cDNA libraries which are derived from reverse transcription of mRNA which is abundant in donor cells that have a high level of genetic expression. When used in combination with polymerase chain reaction technology, even rare expression products can be cloned. In those cases where significant portions of the amino acid WO 97/35007 PCT/US97/04641 -11 sequence of the polypeptide are known, the production of labeled single or doublestranded DNA or RNA probe sequences duplicating a sequence putatively present in the target cDNA may be employed in DNA/DNA hybridization procedures which are carried out on cloned copies of the cDNA which have been denatured into a single-stranded form (Jay, et al., Nucl. Acid Res., 11:2325, 1983).

A cDNA expression library, such as lambda gtl 1, can be screened indirectly for FHF-3 peptides having at least one epitope, using antibodies specific for FHF-3.

Such antibodies can be either polyclonally or monoclonally derived and used to detect expression product indicative of the presence of FHF-3 cDNA.

DNA sequences encoding FHF-3 can be expressed in vitro by DNA transfer into a suitable host cell. "Host cells" are cells in which a vector can be propagated and its DNA expressed. The term also includes any progeny of the subject host cell. It is understood that all progeny may not be identical to the parental cell since there may be mutations that occur during replication. However, such progeny are included when the term "host cell" is used. Methods of stable transfer, meaning that the foreign DNA is continuously maintained in the host, are known in the art.

In the present invention, the FHF-3 polynucleotide sequences may be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to a plasmid, virus or other vehicle known in the art that has been manipulated by insertion or incorporation of the FHF-3 genetic sequences. Such expression vectors contain a promoter sequence which facilitates the efficient transcription of the inserted genetic sequence of the host. The expression vector typically contains an origin of replication, a promoter, as well as specific genes which allow phenotypic selection of the transformed cells. Vectors suitable for use in the present invention include, but are not limited to the T7-based expression vector for expression in bacteria (Rosenberg, et al., Gene, 56:125, 1987), the pMSXND expression vector for expression in mammalian cells (Lee and Nathans, J. Biol. Chem., 263:3521, WO 97/35007 PCT/US97/04641 -12- 1988) and baculovirus-derived vectors for expression in insect cells. The DNA segment can be present in the vector operably linked to regulatory elements, for example, a promoter T7, metallothionein I, or polyhedrin promoters).

Polynucleotide sequences encoding FHF-3 can be expressed in either prokaryotes or eukaryotes. Hosts can include microbial, yeast, insect and mammalian organisms.

Methods of expressing DNA sequences having eukaryotic or viral sequences in prokaryotes are well known in the art. Biologically functional viral and plasmid DNA vectors capable of expression and replication in a host are known in the art.

Such vectors are used to incorporate DNA sequences of the invention.

Transformation of a host cell with recombinant DNA may be carried out by conventional techniques as are well known to those skilled in the art. Where the host is prokaryotic, such as E. coli, competent cells which are capable of DNA uptake can be prepared from cells harvested after exponential growth phase and subsequently treated by the CaCl 2 method using procedures well known in the art.

Alternatively, MgCl 2 or RbCl can be used. Transformation can also be performed after forming a protoplast of the host cell if desired.

When the host is a eukaryote, such methods of transfection of DNA as calcium phosphate co-precipitates, conventional mechanical procedures such as microinjection, electroporation, insertion of a plasmid encased in liposomes, or virus vectors may be used. Eukaryotic cells can also be cotransformed with DNA sequences encoding the FHF-3 of the invention, and a second foreign DNA molecule encoding a selectable phenotype, such as the herpes simplex thymidine kinase gene. Another method is to use a eukaryotic viral vector, such as simian virus 40 (SV40) or bovine papilloma virus, to transiently infect or transform eukaryotic cells and express the protein. (see for example, Eukaryotic Viral Vectors, Cold Spring Harbor Laboratory, Gluzman ed., 1982).

WO 97/35007 PCT/US97/04641 -13- Isolation and purification of microbial expressed polypeptide, or fragments thereof, provided by the invention, may be carried out by conventional means including preparative chromatography and immunological separations involving monoclonal or polyclonal antibodies.

The FHF-3 polypeptides of the invention can also be used to produce antibodies which are immunoreactive or bind to epitopes of the FHF-3 polypeptides. Antibody which consists essentially of pooled monoclonal antibodies with different epitopic specificities, as well as distinct monoclonal antibody preparations are provided. Monoclonal antibodies are made from antigen containing fragments of the protein by methods well known in the art (Kohler, et al., Nature, 256:495, 1975; Current Protocols in Molecular Biology, Ausubel, et al., ed., 1989).

The term "antibody" as used in this invention includes intact molecules as well as fragments thereof, such as Fab, F(ab') 2 and Fv which are capable of binding the epitopic determinant. These antibody fragments retain some ability to selectively bind with its antigen or receptor and are defined as follows: Fab, the fragment which contains a monovalent antigen-binding fragment of an antibody molecule can be produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain; Fab', the fragment of an antibody molecule can be obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain; two Fab' fragments are obtained per antibody molecule; (Fab') 2 the fragment of the antibody that can be obtained by treating whole antibody with the enzyme pepsin without subsequent reduction; F(ab') 2 is a dimer of two Fab' fragments held together by two disulfide bonds; WO 97/35007 PCT/US97/04641 -14- Fv, defined as a genetically engineered fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains; and Single chain antibody defined as a genetically engineered molecule containing the variable region of the light chain, the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule.

Methods of making these fragments are known in the art. (See for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York (1988), incorporated herein by reference).

As used in this invention, the term "epitope" means any antigenic determinant on an antigen to which the paratope of an antibody binds. Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics.

Antibodies which bind to the FHF-3 polypeptide of the invention can be prepared using an intact polypeptide or fragments containing small peptides of interest as the immunizing antigen. The polypeptide or a peptide used to immunize an animal can be derived from translated cDNA (see for example, EXAMPLES 4 and 6) or chemical synthesis which can be conjugated to a carrier protein, if desired. Such commonly used carriers which are chemically coupled to the peptide include keyhole limpet hemocyanin (KLH), thyroglobulin, bovine serum albumin (BSA), and tetanus toxoid. The coupled peptide is then used to immunize the animal a mouse, a rat, or a rabbit).

WO 97/35007 PCT/US97/04641 If desired, polyclonal or monoclonal antibodies can be further purified, for example, by binding to and elution from a matrix to which the polypeptide or a peptide to which the antibodies were raised is bound. Those of skill in the art will know of various techniques common in the immunology arts for purification and/or concentration of polyclonal antibodies, as well as monoclonal antibodies (See for example, Coligan, et al., Unit 9, Current Protocols in Immunology, Wiley Interscience, 1994, incorporated by reference).

It is also possible to use the anti-idiotype technology to produce monoclonal antibodies which mimic an epitope. For example, an anti-idiotypic monoclonal antibody made to a first monoclonal antibody will have a binding domain in the hypervariable region which is the "image" of the epitope bound by the first monoclonal antibody.

The term "cell-proliferative disorder" denotes malignant as well as non-malignant cell populations which often appear to differ from the surrounding tissue both morphologically and genotypically. Malignant cells cancer) develop as a result of a multistep process. The FHF-3 polynucleotide that is an antisense molecule is useful in treating malignancies of the various organ systems, particularly, for example, cells in the central nervous system, including neural tissue, testes, and cells of the eye. Essentially, any disorder which is etiologically linked to altered expression of FHF-3 could be considered susceptible to treatment with a FHF-3 suppressing reagent. One such disorder is a malignant cell proliferative disorder, for example.

For purposes of the invention, an antibody or nucleic acid probe specific for FHF-3 may be used to detect FHF-3 polypeptide (using antibody) or polynucleotide (using nucleic acid probe) in biological fluids or tissues. The invention provides a method for detecting a cell proliferative disorder of neural tissue or testes, for example, which comprises contacting an anti-FHF-3 antibody or nucleic acid probe with a WO 97/35007 PCT/US97/04641 -16cell suspected of having a FHF-3 associated disorder and detecting binding to the antibody or nucleic acid probe. The antibody reactive with FHF-3 or the nucleic acid probe is preferably labeled with a compound which allows detection of binding to FHF-3. Any specimen containing a detectable amount of antigen or polynucleotide can be used. A preferred sample of this invention is CNS, e.g., neural tissue or cerebrospinal fluid or eye tissue. The level of FHF-3 in the suspect cell can be compared with the level in a normal cell to determine whether the subject has a FHF-3-associated cell proliferative disorder. Preferably the subject is human.

When the cell component is nucleic acid, it may be necessary to amplify the nucleic acid prior to binding with an FHF-3 specific probe. Preferably, polymerase chain reaction (PCR) is used, however, other nucleic acid amplification procedures such as ligase chain reaction (LCR), ligated activated transcription (LAT) and nucleic acid sequence-based amplification (NASBA) may be used.

The antibodies of the invention can be used in any subject in which it is desirable to administer in vitro or in vivo immunodiagnosis or immunotherapy. The antibodies of the invention are suited for use, for example, in immunoassays in which they can be utilized in liquid phase or bound to a solid phase carrier. In addition, the antibodies in these immunoassays can be detectably labeled in various ways.

Examples of types of immunoassays which can utilize antibodies of the invention are competitive and non-competitive immunoassays in either a direct or indirect format. Examples of such immunoassays are the radioimmunoassay (RIA) and the sandwich (immunometric) assay. Detection of the antigens using the antibodies of the invention can be done utilizing immunoassays which are run in either the forward, reverse, or simultaneous modes, including immunohistochemical assays on physiological samples. Those of skill in the art will know, or can readily discern, other immunoassay formats without undue experimentation.

PCT/US97/04641 WO 97/35007 -17- The antibodies of the invention can be bound to many different carriers and used to detect the presence of an antigen comprising the polypeptide of the invention.

Examples of well-known carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, agaroses and magnetite. The nature of the carrier can be either soluble or insoluble for purposes of the invention. Those skilled in the art will know of other suitable carriers for binding antibodies, or will be able to ascertain such, using routine experimentation.

There are many different labels and methods of labeling known to those of ordinary skill in the art. Examples of the types of labels which can be used in the present invention include enzymes, radioisotopes, fluorescent compounds, colloidal metals, chemiluminescent compounds, phosphorescent compounds, and bioluminescent compounds. Those of ordinary skill in the art will know of other suitable labels for binding to the antibody, or will be able to ascertain such, using routine experimentation.

Another technique which may also result in greater sensitivity consists of coupling the antibodies to low molecular weight haptens. These haptens can then be specifically detected by means of a second reaction. For example, it is common to use such haptens as biotin, which reacts with avidin, or dinitrophenyl, puridoxal, and fluorescein, which can react with specific antihapten antibodies.

In using the monoclonal antibodies of the invention for the in vivo detection of antigen, the detectably labeled antibody is given a dose which is diagnostically effective. The term "diagnostically effective" means that the amount of detectably labeled monoclonal antibody is administered in sufficient quantity to enable detection of the site having the antigen comprising a polypeptide of the invention for which the monoclonal antibodies are specific.

WO 97/35007 PCT/US97/04641 -18- The concentration of detectably labeled monoclonal antibody which is administered should be sufficient such that the binding to those cells having the polypeptide is detectable compared to the background. Further, it is desirable that the detectably labeled monoclonal antibody be rapidly cleared from the circulatory system in order to give the best target-to-background signal ratio.

As a rule, the dosage of detectably labeled monoclonal antibody for in vivo diagnosis will vary depending on such factors as age, sex, and extent of disease of the individual. Such dosages may vary, for example, depending on whether multiple injections are given, antigenic burden, and other factors known to those of skill in the art.

For in vivo diagnostic imaging, the type of detection instrument available is a major factor in selecting a given radioisotope. The radioisotope chosen must have a type of decay which is detectable for a given type of instrument. Still another important factor in selecting a radioisotope for in vivo diagnosis is that deleterious radiation with respect to the host is minimized. Ideally, a radioisotope used for in vivo imaging will lack a particle emission, but produce a large number of photons in the 140-250 keV range, which may readily be detected by conventional gamma cameras.

For in vivo diagnosis radioisotopes may be bound to immunoglobulin either directly or indirectly by using an intermediate functional group. Intermediate functional groups which often are used to bind radioisotopes which exist as metallic ions to immunoglobulins are the bifunctional chelating agents such as diethylenetriaminepentacetic acid (DTPA) and ethylenediaminetetraacetic acid (EDTA) and similar molecules. Typical examples of metallic ions which can be bound to the monoclonal antibodies of the invention are 97 Ru, 6 7 Ga, 68 Ga, 7 2 As, 9 Zr, and 20 T1.

WO 97/35007 PCT/US97/04641 -19- The monoclonal antibodies of the invention can also be labeled with a paramagnetic isotope for purposes of in vivo diagnosis, as in magnetic resonance imaging (MRI) or electron spin resonance (ESR). In general, any conventional method for visualizing diagnostic imaging can be utilized. Usually gamma and positron emitting radioisotopes are used for camera imaging and paramagnetic isotopes for MRI. Elements which are particularly useful in such techniques include "7Gd, 1 62 Dy, 5 2 Cr, and56Fe.

The monoclonal antibodies or polynucleotides of the invention can be used in vitro and in vivo to monitor the course of amelioration of a FHF-3-associated disease in a subject. Thus, for example, by measuring the increase or decrease in the number of cells expressing antigen comprising a polypeptide of the invention or changes in the concentration of such antigen present in various body fluids, it would be possible to determine whether a particular therapeutic regimen aimed at ameliorating the FHF-3-associated disease is effective. The term "ameliorate" denotes a lessening of the detrimental effect of the FHF-3-associated disease in the subject receiving therapy.

The present invention identifies a nucleotide sequence that can be expressed in an altered manner as compared to expression in a normal cell, therefore it is possible to design appropriate therapeutic or diagnostic techniques directed to this sequence.

Detection of elevated levels of FHF-3 expression is accomplished by hybridization of nucleic acids isolated from a cell suspected of having an FHF-3 associated proliferative disorder with an FHF-3 polynucleotide of the invention. Analysis, such as Northern Blot analysis, are utilized to quantitate expression of FHF-3. Other standard nucleic acid detection techniques will be known to those of skill in the art.

Treatment of an FHF-3 associated cell proliferative disorder include modulation of FHF-3 gene expression and FHF-3 activity. The term "modulate" envisions the suppression of expression of FHF-3 when it is over-expressed, or augmentation of WO 97/35007 PCT/US97/04641 FHF-3 expression when it is under-expressed. Where a cell-proliferative disorder is associated with the expression of FHF-3, nucleic acid sequences that interfere with FHF-3 expression at the translational level can be used. This approach utilizes, for example, antisense nucleic acid, ribozymes, or triplex agents to block transcription or translation of a specific FHF-3 mRNA, either by masking that mRNA with an antisense nucleic acid or triplex agent, or by cleaving it with a ribozyme. Such disorders include neurodegenerative diseases, for example.

Antisense nucleic acids are DNA or RNA molecules that are complementary to at least a portion of a specific mRNA molecule (Weintraub, Scientific American, 262:40, 1990). In the cell, the antisense nucleic acids hybridize to the corresponding mRNA, forming a double-stranded molecule. The antisense nucleic acids interfere with the translation of the mRNA, since the cell will not translate a mRNA that is double-stranded. Antisense oligomers of about 15 nucleotides are preferred, since they are easily synthesized and are less likely to cause problems than larger molecules when introduced into the target FHF-3-producing cell. The use of antisense methods to inhibit the in vitro translation of genes is well known in the art (Marcus-Sakura, Anal.Biochem., 172:289, 1988).

Use of an oligonucleotide to stall transcription is known as the triplex strategy since the oligomer winds around double-helical DNA, forming a three-strand helix.

Therefore, these triplex compounds can be designed to recognize a unique site on a chosen gene (Maher, et al., Antisense Res. and Dev., 1(3):227, 1991; Helene, C., Anticancer Drug Design, 6(6):569, 1991).

Ribozymes are RNA molecules possessing the ability to specifically cleave other single-stranded RNA in a manner analogous to DNA restriction endonucleases.

Through the modification of nucleotide sequences which encode these RNAs, it is possible to engineer molecules that recognize specific nucleotide sequences in an RNA molecule and cleave it (Cech, J.Amer.Med. Assn., 260:3030, 1988). A major WO 97/35007 PCT/US97/04641 -21advantage of this approach is that, because they are sequence-specific, only mRNAs with particular sequences are inactivated.

There are two basic types of ribozymes namely, tetrahymena-type (Hasselhoff, Nature, 334:585, 1988) and "hammerhead"-type. Tetrahymena-type ribozymes recognize sequences which are four bases in length, while "hammerhead"-type ribozymes recognize base sequences 11-18 bases in length. The longer the recognition sequence, the greater the likelihood that the sequence will occur exclusively in the target mRNA species. Consequently, hammerhead-type ribozymes are preferable to tetrahymena-type ribozymes for inactivating a specific mRNA species and 18-based recognition sequences are preferable to shorter recognition sequences.

The present invention also provides gene therapy for the treatment of cell proliferative or immunologic disorders which are mediated by FHF-3 protein. Such therapy would achieve its therapeutic effect by introduction of the FHF-3 antisense polynucleotide into cells having the proliferative disorder. Delivery of antisense FHF-3 polynucleotide can be achieved using a recombinant expression vector such as a chimeric virus or a colloidal dispersion system. Especially preferred for therapeutic delivery of antisense sequences is the use of targeted liposomes.

Various viral vectors which can be utilized for gene therapy as taught herein include adenovirus, herpes virus, vaccinia, or, preferably, an RNA virus such as a retrovirus. Preferably, the retroviral vector is a derivative of a murine or avian retrovirus. Examples of retroviral vectors in which a single foreign gene can be inserted include, but are not limited to: Moloney murine leukemia virus MoMuLV), Harvey murine sarcoma virus (HaMuSV), murine mammary tumor virus (MuMTV), and Rous Sarcoma Virus (RSV). Preferably, when the subject is a human, a vector such as the gibbon ape leukemia virus (GaLV) is utilized. A number of additional retroviral vectors can incorporate multiple genes. All of these vectors can transfer or incorporate a gene for a selectable marker so that transduced WO 97/35007 PCT/US97/04641 -22cells can be identified and generated. By inserting a FHF-3 sequence of interest into the viral vector, along with another gene which encodes the ligand for a receptor on a specific target cell, for example, the vector is now target specific.

Retroviral vectors can be made target specific by attaching, for example, a sugar, a glycolipid, or a protein. Preferred targeting is accomplished by using an antibody to target the retroviral vector. Those of skill in the art will know of, or can readily ascertain without undue experimentation, specific polynucleotide sequences which can be inserted into the retroviral genome or attached to a viral envelope to allow target specific delivery of the retroviral vector containing the FHF-3 antisense polynucleotide.

Since recombinant retroviruses are defective, they require assistance in order to produce infectious vector particles. This assistance can be provided, for example, by using helper cell lines that contain plasmids encoding all of the structural genes of the retrovirus under the control of regulatory sequences within the LTR. These plasmids are missing a nucleotide sequence which enables the packaging mechanism to recognize an RNA transcript for encapsidation. Helper cell lines which have deletions of the packaging signal include, but are not limited to Y2, PA317 and PA12, for example. These cell lines produce empty virions, since no genome is packaged. If a retroviral vector is introduced into such cells in which the packaging signal is intact, but the structural genes are replaced by other genes of interest, the vector can be packaged and vector virion produced.

Alternatively, NIH 3T3 or other tissue culture cells can be directly transfected with plasmids encoding the retroviral structural genes gag, pol and env, by conventional calcium phosphate transfection. These cells are then transfected with the vector plasmid containing the genes of interest. The resulting cells release the retroviral vector into the culture medium.

WO 97/35007 PCT/US97/04641 -23- Another targeted delivery system for FHF-3 antisense polynucleotides is a colloidal dispersion system. Colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. The preferred colloidal system of this invention is a liposome. Liposomes are artificial membrane vesicles which are useful as delivery vehicles in vitro and in vivo. It has been shown that large unilamellar vesicles (LUV), which range in size from 0.2-4.0 im can encapsulate a substantial percentage of an aqueous buffer containing large macromolecules.

RNA, DNA and intact virions can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form (Fraley, et al., Trends Biochem.

Sci., 6:77, 1981). In addition to mammalian cells, liposomes have been used for delivery of polynucleotides in plant, yeast and bacterial cells. In order for a liposome to be an efficient gene transfer vehicle, the following characteristics should be present: encapsulation of the genes of interest at high efficiency while not compromising their biological activity; preferential and substantial binding to a target cell in comparison to non-target cells; delivery of the aqueous contents of the vesicle to the target cell cytoplasm at high efficiency; and (4) accurate and effective expression of genetic information (Mannino, et al., Biotechniques, 6:682, 1988).

The composition of the liposome is usually a combination of phospholipids, particularly high-phase-transition-temperature phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used. The physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations.

Examples of lipids useful in liposome production include phosphatidyl compounds, such as phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides. Particularly useful are diacylphosphatidylglycerols, where the lipid moiety contains from WO 97/35007 PCT/US97/04641 -24- 14-18 carbon atoms, particularly from 16-18 carbon atoms, and is saturated.

Illustrative phospholipids include egg phosphatidylcholine, dipalmitoylphosphatidylcholine and distearoylphosphatidylcholine.

The targeting of liposomes can be classified based on anatomical and mechanistic factors. Anatomical classification is based on the level of selectivity, for example, organ-specific, cell-specific, and organelle-specific. Mechanistic targeting can be distinguished based upon whether it is passive or active. Passive targeting utilizes the natural tendency of liposomes to distribute to cells of the reticulo-endothelial system (RES) in organs which contain sinusoidal capillaries. Active targeting, on the other hand, involves alteration of the liposome by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein, or by changing the composition or size of the liposome in order to achieve targeting to organs and cell types other than the naturally occurring sites of localization.

The surface of the targeted delivery system may be modified in a variety of ways.

In the case of a liposomal targeted delivery system, lipid groups can be incorporated into the lipid bilayer of the liposome in order to maintain the targeting ligand in stable association with the liposomal bilayer. Various linking groups can be used for joining the lipid chains to the targeting ligand.

Due to the expression of FHF-3 in the testes, eye and brain, or neural tissue, there are a variety of applications using the polypeptide, polynucleotide, and antibodies of the invention, related to these tissues. Such applications include treatment of cell proliferative, degenerative, and immunologic disorders involving these and other tissues. In addition, FHF-3 may be useful in various gene therapy procedures.

Due to the high level of expression of FHF-3 in the testes, there are a variety of applications using the polypeptide, polynucleotide, and antibodies of the invention WO 97/35007 PCT/US97/04641 related to this tissue. Such applications include treatment of cell proliferative disorders associated with FHF-3 expression in the testes. Various testicular developmental or acquired disorders can also be subject to FHF-3 applications.

These may include, but are not limited to viral infection viral orchitis), autoimmunity, sperm production or dysfunction, trauma, and testicular tumors. The presence of high levels of FHF-3 in the testis suggests that FHF-3 or an analogue of FHF-3 could be used to increase or decrease male fertility.

The identification of a novel member of the FGF family provides a useful tool for diagnosis, prognosis and therapeutic strategies associated with FHF-3 mediated disorders. Measurement of FHF-3 levels using anti-FHF-3 antibodies is a useful diagnostic for following the progression or recovery from diseases of the nervous system, including: cancer, stroke, neurodegenerative diseases such as Parkinson's disease or Alzheimer's disease, retinal diseases such as retinitis pigmentosa, or viral encephalitis. The presence of high levels of FHF-3 in the central nervous system suggests that the observed low level of FHF-3 in a number of peripheral tissues could reflect FHF-3 in peripheral nerve and a presence in sensory neurons in the dorsal root and trigeminal ganglia, and therefore measurement of FHF-3 levels using anti-FHF-3 antibodies could be diagnostic for peripheral neuropathy. The presence of high levels of FHF-3 in the testis suggests that measurement of FHF-3 levels using anti-FHF-3 antibodies could be diagnostic for testicular cancer.

Like other members of the FGF family, FHF-3 likely has mitogenic and/or cell survival activity, therefore FHF-3 or an analogue that mimics FHF-3 action could be used to promote tissue repair or replacement. The presence of FHF-3 in the CNS suggests such a therapeutic role in diseases of the nervous system, including: stroke, neurodegenerative diseases such as Parkinson's disease or Alzheimer's disease, or in retinal degenerative diseases such as retinitis pigmentosa or macular degeneration, or in peripheral neuropathies. Conversely, blocking FHF-3 action either with anti-FHF-3 antibodies or with an FHF-3 antagonist might slow or WO 97/35007 PCT/US97/04641 -26ameliorate diseases in which excess cell growth is pathological, most obviously cancer.

The following examples are intended to illustrate but not limit the invention.

While they are typical of those that might be used, other procedures known to those skilled in the art may alternatively be used.

EXAMPLE 1 IDENTIFICATION OF FHF-3, A NOVEL MEMBER OF THE FGF FAM-

ILY

To identify novel gene products expressed in the human retina, random segments of human retina cDNA clones were partially sequenced, and the resulting partial sequences compared to the sequences available in the public databases.

In detail, an adult human retina cDNA library constructed in lambda gtlO (Nathans, et al., Science 232: 193, 1986) was amplified, and the cDNA inserts were excised en mass by cleavage with EcoR I and purified free of the vector by agarose gel electrophoresis. Following heat denaturation of the purified cDNA inserts, a synthetic oligonucleotide containing an EcoR I site at its 5' end and six random nucleotides at its 3' end GACGAGATATTAGAATTCTACTCGNNNNNN) (SEQ ID NO:3) was used to prime two sequential rounds of DNA synthesis in the presence of the Klenow fragment of E. coli DNA polymerase. The resulting duplex molecules were amplified using the polymerase chain reaction (PCR) with a primer corresponding to the unique 5' flanking sequence CCCCCCCCCGACGAGATATTAGAATTCTACTCG) (SEQ ID NO:4). These PCR products, representing a random sampling of the original cDNA inserts, were cleaved with EcoR I, size fractionated by preparative agarose gel electrophoresis to include only segments of approximately 500 bp in length, and cloned into lambda gtlO. Three thousand single plaques from this derivative library were arrayed in WO 97/35007 PCT/US97/04641 -27- 96-well trays and from these clones the inserts were amplified by PCR using flanking vector primers and then sequenced using the dideoxy method and automated fluorescent detection (Applied Biosystems). A single sequencing run from one end of each insert was conceptually translated on both strands in all three reading frames and the six resulting amino acid sequences were used to search for homology in the GenBank nonredundant protein database using the BLASTX searching algorithm.

One partial cDNA sequence was found that showed statistically significant homology to previously described members of the FGF family. Using this partial cDNA as a probe, multiple independent cDNA clones were isolated from the human retina cDNA library, including two that encompass the entire open reading frame and from which complete nucleotide sequences were determined. This sequence encodes a novel and highly divergent member of the FGF superfamily and has been named fibroblast growth factor homologous factor-1 (FHF-1). A second closely related sequence (FHF-2) was subsequently characterized on its similarity to the sequence of FHF-1. (SEQ ID NO:6-9; Figures 7a, 7b).

The FHF-1 and FHF-2 amino acid sequences were used to screen the publicly available Genbank database of conceptually translated DNA sequences (DBEST) for amino acid sequences with statistically significant similarity. A short region of human genomic DNA (DBEST accession number 76387) was found to have a translated sequence with significant homology to approximately 25% of the FHF-1 and FHF-2 amino acid sequences. This genomic segment was one among many genomic segments that were used as landmarks during the search for the breast cancer susceptibility gene on chromosome 17. Synthetic DNA primers based on sequence 76387 were used to amplify part of that region from human genomic DNA and from cDNA derived from the human retina. These PCR products were then used as probes to isolate full length cDNA clones from the the human retina cDNA library described above.

WO 97/35007 PCT/US97/04641 -28- EXAMPLE 2 DEDUCED PRIMARY STRUCTURE OF FHF-3 Figure 1 shows the sequence of human FHF-3 deduced from the nucleotide sequences of two independent human retina cDNA clones. The primary translation product of human FHF-3 is predicted to be 225 amino acids in length. The human FHF-3 initiator methionine codon shown in Figure 1 at position 74 is the first inframe ATG codon; a good consensus ribosome binding site (GCGCTATGG (SEQ ID NO:5); Kozak, Nucleic Acids Res. 15: 8125, 1987) is found at this position.

The next methionine codon within the open reading frame is encountered 124 codons 3' of the putative initiator methionine codon. As observed for aFGF and bFGF, the amino-terminus of the primary translation product of FHF-3 does not conform to the consensus sequence for a signal peptide to direct cotranslational insertion across the endoplasmic reticulum membrane. The FHF-3 sequence lacks asn-X-ser/thr sites for asparagine-linked glycosylation.

Alignment of FHF-3 with the other known members of the FGF family is shown in Figure 2 and a dendrogram showing the degree of amino acid similarity is shown in Figure 3. The most homologous FGF family member is FGF-9 which shows amino acid identity with FHF-3 when aligned with 8 gaps. Note that in the central region of each polypeptide, all FGF family members, including FHF-3, share approximately 50% amino acid identity.

EXAMPLE 3 CHROMOSOMAL LOCALIZATION OF FHF-3 The chromosomal location of FHF-3 was determined by probing a Southern blot containing restriction enzyme digested DNA derived from a panel of 24 human-mouse and human-hamster cell lines, each containing a different human WO 97/35007 PCT/US97/04641 -29chromosome (Oncor, Gaithersburg, MD). As seen in Figure 4, hybridization of the human FHF-3 probe to human, mouse, and hamster genomic DNA produces distinct hybridizing fragment sizes. Among the hybrid panels, the human-specific hybridization pattern is seen only in the lane corresponding to the hybrid cell line carrying human chromosome 17.

EXAMPLE 4 TISSUE DISTRIBUTION OF FHF-3 mRNA To determine the tissue distribution of FHF-3 mRNA, RNase protection analysis was performed on total RNA from mouse brain, eye, heart, kidney, liver, lung, spleen, and testis, as well as a yeast tRNA negative control. The probe used was derived from a segment of the mouse FHF-3 gene isolated from a mouse eye cDNA library by hybridization with the full-length human FHF-3 cDNA. As seen in Figure 5, the highest levels of FHF-3 expression are in the brain and eye. Low levels of FHF-3 expression were detected in lung and testis on a longer exposure of the autoradiogram.

EXAMPLE Figure 6 shows an immunoblot of FHF-3 produced in transiently transfected human embryonic kidney cells (line 293). Anti-FHF-3 antibodies were raised against a fusion protein containing the gene 10 protein from bacteriophage T7 joined at the carboxy-terminus to the entire FHF-3 protein (Studier and Moffatt, J. Molec. Biol.

189:113, 1986). The resulting fusion protein was purified by preparative polyacrylamide gel electrophoresis and injected into rabbits. To express FHF-3 in human cells, the complete open reading frame was inserted into the eukaryotic expression vector pCIS (Gorman, et al., DNA Protein Eng. Tech., 2:3, 1990). To increase the efficiency of translation, the region immediately 5' of the initiator methionine coding was converted to an optimal ribosome binding site (CCACCATGG) by PCR amplification with a primer that carried the desired sequence. Twenty-four WO 97/35007 PCT/US9/04641 hours after transient transfection of human embryonic kidney cells with the expression construct and a plasmid expressing the simian virus 40 (SV40) large Tantigen (pRSV-TAg; Gorman, et al., DNA Protein Eng. Tech., 2:3, 1990), cells were harvested and the proteins subjected to polyacrylamide gel electrophoresis and immunoblotting with rabbit anti FHF-3 antiserum at a dilution of 1:5,000. As shown in Figure 6, cells transfected with FHF-3 (right lane) synthesize an immunoreactive polypeptide with an apparent molecular mass of 30 kD that is not found in cells transfected with a related FGF family member (FHF-2; center lane) or in mock transfected cells (left lane). The apparent molecular mass in kD of prestained protein size standards are shown to the left. The apparent molecular mass of recombinant FHF-3 is 5 kD higher that the predicted molecular mass of the primary translation product (25 kD), a discrepancy that most likely reflects the high isoelectric point (10.275) of the protein.

Although the invention has been described with reference to the presently preferred embodiment, it should be understood that various modifications can be made without departing from the spirit of the invention. Accordingly, the invention is limited only by the following claims.

WO 97/35007 PCT/US97/04641 -31 SEQUENCE LISTING GENERAL INFORMATION: APPLICANT: The Johns Hopkins University School of Medicine (ii) TITLE OF INVENTION: FIBROBROBLAST GROWTH FACTOR HOMOLOGOUS FACTOR-3 (FHF-3) AND METHODS OF USE (iii) NUMBER OF SEQUENCES: 19 (iv) CORRESPONDENCE ADDRESS: ADDRESSEE: Fish Richardson P.C.

STREET: 4225 Executive Square, Suite 1400 CITY: La Jolla STATE: CA COUNTRY: USA ZIP: 92037 COMPUTER READABLE FORM: MEDIUM TYPE: Floppy disk COMPUTER: IBM PC compatible OPERATING SYSTEM: PC-DOS/MS-DOS SOFTWARE: Patentln Release Version #1.30 (vii) PRIOR APPLICATION DATA: APPLICATION NUMBER: US 08/621,143 FILING DATE: 21-MAR-1996

CLASSIFICATION:

(viii) ATTORNEY/AGENT INFORMATION: NAME: Haile, Lisa A.

REGISTRATION NUMBER: 38,347 REFERENCE/DOCKET NUMBER: 07265/083001 WO 97/35007 PCT/US97/04641 -32- (ix) TELECOMMUNICATION INFORMATION: TELEPHONE: 619/678-5070 TELEFAX: 619/678-5099 INFORMATION FOR SEQ ID NO:1: SEQUENCE CHARACTERISTICS: LENGTH: 961 base pairs TYPE: nucleic acid STRANDEDNESS: not relevant TOPOLOGY: linear (ix) FEATURE: NAME/KEY: CDS LOCATION: 74..748 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: GAATTCCGGC TCTTGGGGAG CCCAGCGCGC TCCGGGCGCC TGCCGGTTTG GGGGTGTCTC CTCCCGGGGC GCT ATG GCG GCG CTG GCC AGT AGC CTG ATC CGG CAG AAG 109 Met Ala Ala Leu Ala Ser Ser Leu Ile Arg Gin Lys 1 5 CGG GAG GTC CGC GAG CCC GGG GGC AGC CGG CCG GTG TCG GCG CAG CGG 157 Arg Glu Val Arg Glu Pro Gly Gly Ser Arg Pro Val Ser Ala Gin Arg 20 PCTIUS97/04641 WO 97/35007 PTU9/44 -33 GGC GTG TGT CCC GG GGG AGG AAG TCG CTT TGG GAG AAG GAG GTG GTG Arg Val Cys Pro Arg Gly Thr Lys Ser Leu Cys Gin Lys Gin Leu Leu ATG GTG CTG TCG AAG GTG CGA CTG TGC GGG GGG CGG CCC GGG COG CG TIe.Leu Leu Ser Lys Val Arg Leu Gys Gly Gly Arg Pro Ala Arg Pro GAG GGC GGC CG GAG GGT GAG CTG AAA GGC ATG GTG ACG AAA GTG TTG Asp Arg Giy Pro Gin Pro Gin Leu Lys Gly Ile Val Thr Lys Leu Phe TGC CGC GAG GGT TTG TAG GTG GAG GGG AAT CCC GAG GGA AGG ATG GAG Gys Arg Gin Gly Phe Tyr Leu Gin Ala Asn Pro Asp Gly Ser Ile Gin GGG AGG GCA GAG GAT AGG AGG TGG TTG AGC CAG TTG AAG GTG ATG GGT Gly Thr Pro Glu Asp Thr Ser Ser Phe Thr His Phe Asn Len Ile Pro 100 105 GTG GGG GTG GGT GTG GTG AGG ATG GAG AGC 0CC AAG CTG GGT GAG TAG Vai Gly Leu Arg Vai Vai Thr Ile Gin Ser Ala Lys Leu Gly His Tyr 110 115 120 ATG GGG ATG AAT GGT GAG OGA CTG GTG TAG AGT TCG CG GAT TTG AGA Met Ala Met Asn Ala Giu Gly Leu Leu Tyr Ser Ser Pro His Phe Thr 125 130 135 140 GGT GAG TGT CGC TTT AAG GAG TGT GTG FIT GAG AAT TAG TAG GTG GTG Ala Giu Gys Arg Phe Lys Glu Gys Val Phe Gin Asn Tyr Tyr Vai Leu 445 493 541 TAG GGC TGT GGT GTC TAG GG GAG GT GT TGT GGC CGG GG TGG TAG Tyr Ala Ser Ala Leu Tyr Arg Gin Arg Arg Ser Giy Arg Ala Trp Tyr 160 165 170 WO 97/35007 PCT/US97/04641 -34- CTC GGC CTG GAC AAG GAG GGC CAG GTC ATG AAG GGA AAC CGA GTT AAG 637 Leu Gly Leu Asp Lys Glu Gly Gin Val Met Lys Gly Asn Arg Val Lys 175 180 185 AAG ACC AAG GCA GCT GCC CAC TTT CTG CCC AAG CTC CTG GAG GTG GCC 685 Lys Thr Lys Ala Ala Ala His Phe Leu Pro Lys Leu Leu Glu Val Ala 190 195 200 ATG TAC CAG GAG CCT TCT CTC CAC AGT GTC CCC GAG GCC TCC CCT TCC 733 Met Tyr Gin Glu Pro Ser Leu His Ser Val Pro Glu Ala Ser Pro Ser 205 210 215 220 AGT CCC CCT GCC CCC TGAAATGTAG TCCCTGGACT GGAGGTTCCC TGCACTCCCA 788 Ser Pro Pro Ala Pro 225 GTGAGCCAGC CACCACCACA ACCTGTCTCC CAGTCCTGCT CTCACCCCTG CTGCCACACA 848 CAGCCAGGT CCCACTAGGT GCTCTACCCT GAGGGAGCCT AGGGGCTGAC 908 TGTGACTTCC GAGGCTGCTG AGACCCTTAG ATCTTTGGGC CTAGGAGGGA GTC 961 INFORMATION FOR SEQ ID NO:2: SEQUENCE CHARACTERISTICS: LENGTH: 225 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: Met Ala Ala Leu Ala Ser Ser Leu Ile Arg Gin Lys Arg Glu Val Arg 1 5 10 PCT/US97/04641 WO 97/35007 Gin Pro Gly Gly Ser Arg Pro Val Ser Ala Gin Arg Arg Val Cys Pro Arg Gly Thr Lys Ser Leu Cys Gin Lys Gin Leu Leu Ile Leu Leu Ser 40 Lys Val Arg Leu Cys Gly Gly Arg Pro Ala Arg Pro Asp Arg Gly Pro 55 Gin Pro Gin Leu Lys Gly Ie Val Thr Lys Len Phe Cys Arg Gin Gly Phe Tyr Len Gin Ala Asn Pro Asp Giy Ser Ile Gin Gly Thr Pro Giu 90 Asp Thr Ser Ser Phe Thr His Phe Asn Leu Ile Pro Val Gly Leu Arg 100 105 110 Val Val Thr Ile Gin Ser Ala Lys Leu Gly His Tyr Met Ala Met Asn 115 120 125 Ala Gin Gly Leu Leu Tyr Ser Ser Pro His Phe Thr Ala Giu Cys Arg 130 135 140 Phe Lys Glu Cys Val Phe Gin Asn Tyr Tyr Val Len Tyr Ala Ser Ala 145 150 155 160 Len Tyr Arg Gin Arg Arg Ser Gly Arg Ala Trp Tyr Leu Gly Len Asp Lys Gin Gly Gin Val Met Lys Gly Asn Arg Val Lys Lys Thr Lys Ala 180 185 190 Ala Ala His Phe Len Pro Lys Len Leu Giu Val Ala Met Tyr Gin Gin 195 1200 205 PCT/US97/04641 WO 97/35007 -36- Pro Ser Leu His Ser Val Pro Glu Ala Ser Pro Ser Ser Pro Pro Ala 210 215 220 Pro 225 INFORMATION FOR SEQ ID NO:3: SEQUENCE CHARACTERISTICS: LENGTH: 30 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: GACGAGATAT TAGAATTCTA CTCGNNNNNN INFORMATION FOR SEQ ID NO:4: SEQUENCE CHARACTERISTICS: LENGTH: 33 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: WO 97/35007 PCT/US97/04641 -37- CCCCCCCCCG ACGAGATATT AGAATTCTAC TCG INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 9 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID

GCGCTATGG

INFORMATION FOR SEQ ID NO:6: SEQUENCE CHARACTERISTICS: LENGTH: 1422 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ix) FEATURE: NAME/KEY: CDS LOCATION: 332..1061 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: WO 97/35007 PTU9/44 PCT/US97/04641 -38- GAATTCGGCA CACTGCGTTC GGGGTACGAA GTGGAAGGGG AAGAAGGATG CCCAAAATAA CAAGACGTGC GTGGGACGC GGGGCCGCGC GGCCGGG GGAGAGGTTG GGGAAGTTTA 120 CATCTGGATT TTCACACATT TTGTGGCGAC TGCCCAGAGT TTGAGTAAGC TTGTGAGGG 180 CGGGTTTTCG ATACTGGAGG GTGCTGAAAT TTTAGCAGTG GCTGGGGGCG ACTGCCGTTT 240 CCCTGGCCGG GGAGGTGGTG GGGTCGCGGC GGCGGAGGG AAGCGGGAGG, GCGCAGTAGA 300 GGCTGGGGCC TGAGGCGGTG GGTGAGGAGG T -ATG GCT GCG GGG ATA GGG AGC 352 Met Ala Ala Ala Ile Ala Ser 245 TCG TTG ATG CGG GAG AAG COG CAG GCG AGG GAG TGG AAC AGC GAG CGA 400 Ser Leu Ile Arg Gin Lys Arg Gin Ala Arg Giu Ser Asn Ser Asp Arg 250 255 260 265 GTG TCG GCC TGG AAG CG CG TCC AGC CCC AOC AAA GAG GGG GGC TGC 448 Val Ser Ala Ser Lys Arg Arg Ser Ser Pro Ser Lys Asp Gly Arg Ser 270 275 280 CTO TG GAG AGO GAG GTG CTCGG0 GTG TTC AGC AAA GTG CG TTC TG 496 Leu Gys Glu Arg His Val Leu Gly Val Phe Ser Lys Val Arg Phe Cys 285 290 295 AGG OC GG AAG AGO CGO GTG AGO GG AGA GGA OAA GGC CG CTG AAA 544 Ser Oly Arg Lys Arg Pro Val Arg Arg Arg Pro Glu Pro Gin Leu Lys 300 305 310 GOG ATT GTG ACA AGO TTA TTG AOC GAG GAG GGA TAG TTG CTG GAG ATO 592 Oly Ie Val Thr Arg Leu Phe Ser Gin Gin Gly Tyr Phe Leu Gin Met 315 320 325 WO 97/35007 PCT/US97/04641 -39- CAC CCA GAT GGT ACC ATT GAT GGG ACC AAG GAC GAA AAC AGC GAC TAC 640 His Pro Asp Gly Thr Ile Asp Gly Thr Lys Asp Glu Asn Ser Asp Tyr 330 335 340 345 ACT CTC TTC AAT CTA ATT CCC GTG GGC CTG CGT GTA GTG GCC ATC CAA 688 Thr Leu Phe Asn Leu Ile Pro Val Gly Leu Arg Val Val Ala Ile Gin 350 355 360 GGA GTG AAG GCT AGC CTC TAT GTG GCC ATG AAT GGT GAA GGC TAT CTC 736 Gly Val Lys Ala Ser Leu Tyr Val Ala Met Asn Gly Glu Gly Tyr Leu 365 370 375 TAC AGT TCA GAT GTT TTC ACT CCA GAA TGC AAA TTC AAG GAA TCT GTG 784 Tyr Ser Ser Asp Val Phe Thr Pro Glu Cys Lys Phe Lys Glu Ser Val 380 385 390 TTT GAA AAC TAC TAT GTG ATC TAT TCT TCC ACA CTG TAC CGC CAG CAA 832 Phe Glu Asn Tyr Tyr Val Ile Tyr Ser Ser Thr Leu Tyr Arg Gin Gin 395 400 405 GAA TCA GGC CGA GCT TGG TTT CTG GGA CTC AAT AAA GAA GGT CAA ATT 880 Glu Ser Gly Arg Ala Trp Phe Leu Gly Leu Asn Lys Glu Gly Gin Ile 410 415 420 425 ATG AAG GGG AAC AGA GTG AAG AAA ACC AAG CCC TCA TCA CAT TTT GTA 928 Met Lys Gly Asn Arg Val Lys Lys Thr Lys Pro Ser Ser His Phe Val 430 435 440 CCG AAA CCT ATT GAA GTG TGT ATG TAC AGA GAA CCA TCG CTA CAT GAA 976 Pro Lys Pro Ile Giu Val Cys Met Tyr Arg Glu Pro Ser Leu His Glu 445 450 455 ATT GGA GAA AAA CAA GGG CGT TCA AGG AAA AGT TCT GGA ACA CCA ACC 1024 Ile Gly Glu Lys Gin Gly Arg Ser Arg Lys Ser Ser Gly Thr Pro Thr 460 465 470 WO 97/35007 PCTIUJS97/04641 ATG AAT GGA GGC AAA GTT GTG AAT CAA GAT TCA ACA T AGCTGAGAAC 1071 Met Asn Gly Gly Lys Val Val Asn Gin Asp Ser Thr 475 480 485 TCTCCCCTTC TTCCCTCTCT CATCCCTTCC CCTTCCCTTC CTTCCCATTT ACCCATTTCC 1131 TTCCAGTAAA TCCACCCAAG GAGAGGAAAA TAAAATGACA ACGCAAGACC TAGTGGCTA 1191 GATTCTGCAC TCAAAATCTT CCTTTGTGTA GGACAAGAAA ATTGAACCAA AGCTTGCTTG 1251 TTGCAATGTG GTAGAAAATT CACGTGCACA AAGATTAGCA CACTTAAAAG CAAAGGAAAA 1311 AATAAATCAG AACTCCATAA ATATTAAACT AAACTGTATT GTTATTAGTA GAAGGCTAAT 1371 TGTAATGAAG ACATTAATAA AGATGAAATA AACTTATTAC TTTCGGAATT C 1422 INFORMATION FOR SEQ ID NO:7: SEQUENCE CHARACTERISTICS: LENGTH: 243 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: Met Ala Ala Ala Ile Ala Ser Ser Le Ile Arg Gin Lys Arg Gin Ala 1 5 10 Arg Giu Ser Asn Ser Asp Arg Vai Ser Ala Ser Lys Arg Arg Ser Ser 25 WO 97/35007 PCTIUS97/04641 -41- Pro Ser Lys Asp Gly Arg Ser Leu Cys Giu Arg His Val Leu Gly Vai Phe Ser Lys Val Arg Phe Cys Ser Gly Arg Lys Arg Pro Val Arg Arg 55 Arg Pro Giu Pro Gin Leu Lys Giy Ilie Val Thr Arg Leu Phe Ser Gin 70 75 Gin Giy Tyr Phe Leu Gin Met His Pro Asp Gly Thr Ile Asp Gly Thr 90 Lys Asp Giu Asn Ser Asp Tyr Thr Leu Phe Asn Leu Ie Pro Val Gly 100 105 110 Leu Arg Vai Val Aia Ile Gin Giy Val Lys Ala Ser Leu Tyr Vai Aia 115 120 125 Met Asn Gly Giu Giy Tyr Leu Tyr Ser Ser Asp Vai Phe Thr Pro Giu 130 135 140 Cys Lys Phe Lys Giu Ser Val Phe Giu Asn Tyr Tyr Vai Ie Tyr Ser Ser Thr Leu Tyr Arg Gin Gin Gin Ser Giy Arg Aia Trp Phe Leu Giy 165 170 175 Leu Asn Lys Giu Gly Gin Ile Met Lys Gly Asn Arg Vai Lys Lys Thr 180 185 190 Lys Pro Ser Ser His Phe Val Pro Lys Pro Ile Giu Vai Cys Met Tyr 195 200 205 Arg Giu Pro Ser Leu His Giu Ile Giy Giu Lys Gin Giy Arg Ser Arg 210 215 220 WO 97/35007 PCT/US97/04641 -42- Lys Ser Ser Gly Thr Pro Thr Met Asn Gly Gly Lys Val Val Asn Gin 225 230 235 240 Asp Ser Thr INFORMATION FOR SEQ ID NO:8: SEQUENCE CHARACTERISTICS: LENGTH: 1150 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ix) FEATURE: NAME/KEY: CDS LOCATION: 353..1088 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: AATTCCGCTT GCACAGTGTC CGCCGGGCGC AGGGGCCGAC CGCACGCAGT CGCGCAGTTC TGCCTCCGCC TGCCAGTCTC GCCCGCGATC CCGGCCCGGG GCTGTGGCGT CGACTCCGAC 120 CCAGGCAGCC AGCAGCCCGC GCGGGAGCCG GACCGCCGCC GGAGGAGCTC GGACGGCATG 180 CTGAGCCCCC TCCTTGGCTG AAGCCCGAGT GCGGAGAAGC CCGGGCAAAC GCAGGCTAAG 240 GAGACCAAAG CGGCGAAGTC GCGAGACAGC GGACAAGCAG CGGAGGAGAA GGAGGAGGAG300 GCGAACCCAG AGAGGGGCAG CAAAAGAAGC GGTGGTGGTG GGCGTCGTGG CC ATG 355 Met WO 97/35007 PCT/US97/04641 43 GGG GGG GCT ATG GCG AGC TGG CTC ATC GGT GAG AAG AGG GAA GGG GGC 403 Ala Ala Ala Ile Ala Ser Ser Leu Ile Arg Gin Lys Arg Gin Ala Arg 245 250 255 260 GAG COC GAG AAA TGG AACG0CC TGG AAG TGT GTC AGC AGG CCC AGC AAA 451 Glu Arg Glu Lys Ser Asn Ala Cys Lys Cys Vai Ser Ser Pro Ser Lys 265 270 275 GGC AAG ACC AGC TGG GAG AAA AAC AAG TTA AAT GTC TTT TGG CGG GTC 499 Gly Lys Thr Ser Cys Asp Lys Asn Lys Leu Asn Val Phe Ser Arg Val 280 285 290 AAA GTC TTG GGG TCC AAG AAG AGG CGC AGA AGA AGA CCA GAG CCT GAG 547 Lys Leu Phe Giy Ser Lys Lys Arg Arg Arg Arg Arg Pro Giu Pro Gin 295 300 305 CTT AAG GGT ATA GTT ACC AAG CTA TAC AGC CGA CAA GGG TAG GAG TTG 595 Leu Lys Giy Ile Vai Thr Lys Len Tyr Ser Mrg Gln Giy Tyr His Leu 310 315 320 WO 97/35007 PCT/US97/04641 -44- CAG CTG CAG GCG GAT GGA ACC ATT GAT GGC ACC AAA GAT GAG GAC AGC 643 Gin Leu Gin Ala Asp Gly Thr Ile Asp Gly Thr Lys Asp Glu Asp Ser 325 330 335 340 ACT TAC ACT CTG TTT AAC CTC ATC CCT GTG GGT CTG CGA GTG GTG GCT 691 Thr Tyr Thr Leu Phe Asn Leu Ile Pro Val Gly Leu Arg Val Val Ala 345 350 355 ATC CAA GGA GTT CAA ACC AAG CTG TAC TTG GCA ATG AAC AGT GAG GGA 739 Ile Gin Gly Val Gin Thr Lys Leu Tyr Leu Ala Met Asn Ser Glu Gly 360 365 370 TAC TTG TAC ACC TCG GAA CTT TTC ACA CCT GAG TGC AAA TTC AAA GAA 787 Tyr Leu Tyr Thr Ser Glu Leu Phe Thr Pro Glu Cys Lys Phe Lys Glu 375 380 385 TCA GTG TTT GAA AAT TAT TAT GTG ACA TAT TCA TCA ATG ATA TAC CGT 835 Ser Val Phe Glu Asn Tyr Tyr Val Thr Tyr Ser Ser Met Ile Tyr Arg 390 395 400 CAG CAG CAG TCA GGC CGA GGG TGG TAT CTG GGT CTG AAC AAA GAA GGA 883 Gin Gin Gin Ser Gly Arg Gly Trp Tyr Leu Gly Leu Asn Lys Glu Gly 405 410 415 420 GAG ATC ATG AAA GGC AAC CAT GTG AAG AAG AAC AAG CCT GCA GCT CAT 931 Glu Ile Met Lys Gly Asn His Val Lys Lys Asn Lys Pro Ala Ala His 425 430 435 TTT CTG CCT AAA CCA CTG AAA GTG GCC ATG TAC AAG GAG CCA TCA CTG 979 Phe Leu Pro Lys Pro Leu Lys Val Ala Met Tyr Lys Glu Pro Ser Leu 440 445 450 CAC GAT CTC ACG GAG TTC TCC CGA TCT GGA AGC GGG ACC CCA ACC AAG 1027 His Asp Leu Thr Glu Phe Ser Arg Ser Gly Ser Gly Thr Pro Thr Lys 455 460 465 WO 97/35007 PCTIUS97/04641 AGC AGA AGT GTC TCT GGC GTG CTG AAC GGA GGC AAA TCC ATG AGC CAC 1075 Ser Arg 5cr Val Ser Gly Val Leu Asn Gly Gly Lys Ser Met 5cr His 470 475 480 AAT GAA TCA ACG T AGCCAGTGAG GGCAAAAGAA GGGCTCTGTA ACAGAACCTT 1128 Asn Glu Scr Thr 485 ACCTCCAGGT GCTGTTGAAT TC 1150 INFORMATION FOR SEQ ID NO:9: SEQUENCE CHARACTERISTICS: LENGTH: 245 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: Met Ala Ala Ala lie Ala Ser Ser Leu Ile Arg Gln Lys Arg Gin Ala 1 5 10 Arg Glu Mrg Glu Lys 5cr Asn Ala Cys Lys Cys Val Ser Ser Pro Ser 25 Lys Gly Lys Thr 5cr Cys Asp Lys Asn Lys Leu Asn Val Phe Ser Arg 40 Val Lys Leu Phe Gly 5cr Lys Lys Mrg Arg Arg Arg Arg Pro Glu Pro 55 WO 97/35007 PTU9/44 PCT/US97/04641 -46 Gin Leu Lys Gly Ile Val Thr Lys Leu Tyr Ser Arg Gin Gly Tyr His 70 75 Leu Gin Leu Gin Ala Asp Gly Thr Ile Asp Giy Thr Lys Asp Giu Asp Ser Thr Tyr Thr Leu Phe Asn Leu Ile Pro Val Giy Leu Arg Vai Val 100 105 110 Ala Ile Gin Gly Vai Gin Thr Lys Leu Tyr Leu Ala Met Asn Ser Giu 115 120 125 Gly Tyr Leu Tyr Thr Ser Giu Leu Phe Thr Pro Giu Cys Lys Phe Lys 130 135 140 Glu Ser Val Phe Giu Asn Tyr Tyr Val Thr Tyr Ser Ser Met Ile Tyr 145 150 155 160 Arg Gin Gin Gin Ser Giy Arg Gly Trp Tyr Leu Giy Leu Asn Lys Giu 165 170 175 Gly Giu Ile Met Lys Gly Asn His Vai Lys Lys Asn Lys Pro Ala Ala 180 185 190 His Phe Leu Pro Lys Pro Leu Lys Val Ala Met Tyr Lys Giu Pro Ser 195 200 205 Leu His Asp Leu Thr Giu Phe Ser Arg Ser Giy Ser Giy Thr Pro Thr Lys Ser Arg Ser Val Ser Gly Val Leu Asn Gly Gly Lys Ser Met Ser 225 230 -235 240 His Asn Giu Ser Thr 245 WO 97/35007 PCT/US97/04641 -47- INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 216 amino acids TYPE: amino acid STRANDEDNESS: not relevant TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID Met Gly Ser Pro Arg Ser Ala Leu Ser Cys Leu Leu Leu His Leu Leu Val Leu Cys Leu Gin Ala Gin Val Thr Val Gin Ser Ser Pro Asn Phe 25 Thr Gin His Val Arg Glu Gin Ser Leu Val Thr Asp Gin Leu Ser Arg Arg Leu Ile Arg Thr Tyr Gin Leu Tyr Ser Arg Thr Ser Gly Lys His 55 Val Gin Val Leu Ala Asn Lys Arg Ile Asn Ala Met Ala Glu Asp Gly 70 75 Asp Pro Phe Ala Lys Leu Ile Val Glu Thr Asp Thr Phe Gly Ser Arg 90 Val Arg Val Arg Gly Ala Glu Thr Gly Leu Tyr Ile Cys Met Asn Lys 100 105 110 WO 97/35007 PCT/US97/04641 -48- Lys Gly Lys Leu Ile Ala Lys Ser Asn Gly Lys Gly Lys Asp Cys Val 115 120 125 Phe Ile Glu Ile Val Leu Glu Asn Asn Tyr Thr Ala Leu Gin Asn Ala 130 135 140 Lys Tyr Glu Gly Trp Tyr Met Ala Phe Thr Arg Lys Gly Arg Pro Arg 145 150 155 160 Lys Gly Ser Lys Thr Arg Gin His Gin Arg Glu Val His Phe Met Lys 165 170 175 Arg Leu Pro Arg Gly His His Thr Thr Glu Gin Ser Leu Arg Phe Glu 180 185 190 Phe Leu Asn Tyr His Pro Pro Phe Thr Arg Ser Leu Arg Gly Ser Gin 195 200 205 Arg Thr Trp Ala Pro Glu Pro Arg 210 215 INFORMATION FOR SEQ ID NO:11: SEQUENCE CHARACTERISTICS: LENGTH: 225 amino acids TYPE: amino acid STRANDEDNESS: not relevant TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: WO 97/35007 PCT/US97/04641 -49- Met Ala Ala Leu Ala Ser Ser Leu lie Arg Gin Lys Arg Giu Val Arg Giu Pro Gly Gly Ser Arg Pro Val Ser Ala Gin Arg Arg Val Cys Pro Arg Gly Thr Lys Ser Leu Cys Gin Lys Gin Leu Leu lie Len Leu Ser Lys Val Arg Leu Cys Gly Gly Arg Pro Ala Arg Pro Asp Arg Gly Pro 55 Gin Pro Gin Leu Lys Gly Ile Val Thr Lys Leu Phe Cys Arg Gin Gly Phe Tyr Leu Gin Ala Asn Pro Asp Gly Ser Ile Gin Gly Thr Pro Giu Asp Thr Ser Ser Phe Thr His Phe Asn Leu Ile Pro Val Gly Leu Arg 100 105 110 Val Val Thr Ile Gin Ser Ala Lys Leu Gly His Tyr Met Ala Met Asn 115 120 125 Ala Glu Gly Leu Leu Tyr Ser Ser Pro His Phe Thr Ala Glu Cys Arg 130 135 140 Phe Lys Gin Cys Val Phe Gin Asn Tyr Tyr Val Len Tyr Aia Ser Ala 145 150 155 160 Leu Tyr Arg Gin Arg Arg Ser Gly Arg Ala Trp, Tyr Len Gly Leu Asp 165 170 175 Lys Giu Gly Gin Vai Met Lys Gly Asn Arg Vai Lys Lys Thr Lys Ala 180 185 190 PCT/US97/04641 WO 97/35007 Ala Ala His Phe Leu Pro Lys Leu Leu Glu Val Ala Met Tyr Gin Glu Pro Ser Leu His Ser Val Pro Glu Ala Ser Pro Ser Ser Pro Pro Ala 210 215 220 Pro 225 INFORMATION FOR SEQ ID NO:12: SEQUENCE CHARACTERISTICS: LENGTH: 194 amino acids TYPE: amino acid STRANDEDNESS: not relevant TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: Met His Lys Trp Ile Leu Thr Trp Ile Leu Pro Thr Leu Leu Tyr Arg Ser Cys Phe His Ile Ile Cys Leu Val Gly Thr Ile Ser Leu Ala Cys 25 Asn Asp Met Thr Pro Glu Gin Met Ala Thr Asn Val Asn Cys Ser Ser 40 Pro Glu Arg His Thr Arg Ser Tyr Asp Tyr Met Glu Gly Gly Asp Ile Arg Val Arg Arg Leu Phe Cys Arg Thr Gin Trp Tyr Leu Arg Ile Asp 70 75 WO 97/35007 PCT/US97/04641 -51 Lys Arg Gly Lys Val Lys Gly Thr Gin Glu Met Lys Asn Asn Tyr Asn 90 Ile Met Glu Ile Arg Thr Val Ala Val Gly Ile Val Ala Ile Lys Gly 100 105 110 Val Glu Ser Glu Phe Tyr Leu Ala Met Asn Lys Glu Gly Lys Leu Tyr 115 120 125 Ala Lys Lys Glu Cys Asn Glu Asp Cys Asn Phe Lys Glu Leu Ile Leu 130 135 140 Glu Asn His Tyr Asn Thr Tyr Ala Ser Ala Lys Trp Thr His Asn Gly Gly Glu Met Phe Val Ala Leu Asn Gin Lys Gly Ile Pro Val Arg Gly 165 170 175 Lys Lys Thr Lys Lys Glu Gin Lys Thr Ala His Phe Leu Pro Met Ala 180 185 190 Ile Thr INFORMATION FOR SEQ ID NO:13: SEQUENCE CHARACTERISTICS: LENGTH: 245 amino acids TYPE: amino acid STRANDEDNESS: not relevant TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: PCT/US97/04641 WO 97/35007 52 Met Gly Lea lie Trp Leu Leu Leu Leu Ser Leu Lea Giu Pro Ser Trp 1 5 10 Pro Thr Thr Gly Pro Gly Thr Arg Leu Arg Arg Asp Ala Giy Gly Arg 25 Gly Gly Val Tyr Gia His Leu Gly Gly Ala Pro Arg Arg Arg Lys Leu 40 Tyr Cys Ala Thr Lys Tyr His Leu Gin Leu His Pro Ser Gly Arg Val 55 Asn Gly Ser Lea Gla Asn Ser Ala Tyr Ser Ile Lea Glu Ile Thr Ala 70 75 Val Glu Val Gly Val Val Ala Ile Lys Gly Leu Phe Ser Gly Arg Tyr Leu Ala Met Asn Lys Arg Gly Arg Leu Tyr Ala Ser Asp His Tyr Asn 100 105 110 Ala Gla Cys Giu Phe Val Giu Arg Ile His Gla Lea Gly Tyr Asn Thr 115 120 125 Tyr Ala Ser Arg Lea Tyr Arg Thr Gly Ser Ser Gly Pro Gly Ala Gin 130 135 140 Arg Gin Pro Gly Ala Gln Arg Pro Trp Tyr Val Ser Val Asn Gly Lys 145 150 155 160 Gly Arg Pro Mrg Pro Gly Phe Lys Thr Arg Arg Thr Gln Lys Ser Ser 165 170 175 Leu Phe Lea Pro Arg Val Lea Gly His Lys Asp His Gla Met Val Arg 180 185 190 WO 97/35007 PCT/US97/04641 -53- Leu Leu Gin Ser Ser Gin Pro Arg Ala Pro Gly Glu Gly Ser Gin Pro 195 200 205 Arg Gin Arg Arg Gin Lys Lys Gin Ser Pro Gly Asp His Gly Lys Met 210 215 220 Glu Thr Leu Ser Thr Arg Ala Thr Pro Ser Thr Gin Leu His Thr Gly 225 230 235 240 Gly Leu Ala Val Ala 245 INFORMATION FOR SEQ ID NO:14: SEQUENCE CHARACTERISTICS: LENGTH: 268 amino acids TYPE: amino acid STRANDEDNESS: not relevant TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: Met Ser Leu Ser Phe Leu Leu Leu Leu Phe Phe Ser His Leu Ile Leu 1 5 10 Ser Ala Trp Ala His Gly Glu Lys Arg Leu Ala Pro Lys Gly Gin Pro 25 Gly Pro Ala Ala Thr Asp Arg Asn Pro Ile Gly Ser Ser Ser Arg Gin 40 PCTIUS97/04641 WO 97/35007 -54 Ser Ser Ser Ser Ala Met Ser Ser Ser Ser Ala Ser Ser Ser Pro Ala Ala Ser Leu Giy Ser Gin Gly Ser Gly Leu Glu Gin Ser Ser Phe Gin Trp Ser Pro Ser Gly Arg Arg Thr Gly Ser Leu Tyr Cys Arg Val Gly 90 Ile Giy Phe His Leu Gin Ile Tyr Pro Asp Gly Lys Val Asn Gly Ser 100 105 110 His Giu Ala Asn Met Leu Ser Val Leu Glu Ile Phe Ala Val Ser Gin 115 120 125 Giy Ile Val Gly Ile Arg Gly Vai Phe Ser Asn Lys Phe Leu Ala Met 130 135 140 Ser Lys Lys Giy Lys Leu His Ala Ser Ala Lys Phe Thr Asp Asp Cys 145 150 155 160 Lys Phe Arg Glu Arg Phe Gin Giu Asn Ser Tyr Asn Thr Tyr Ala Ser 165 170 175 Ala Ile. His Arg Thr Giu Lys Thr Giy Arg Glu Trp Tyr Vai Ala Leu 180 185 190 Asn Lys Arg Giy Lys Ala Lys Arg Gly Cys Ser Pro Arg Val Lys Pro 195 200 205 Gin His Ile Ser Thr His Phe Leu Pro Arg Phe Lys Gin Ser Gin Gin 210 215 220 Pro Giu Leu Ser Phe Thr Val Thr Vai Pro Glu Lys Lys Asn Pro Pro 225 230 235 240 WO 97/35007 PCT/US97/04641 Ser Pro lie Lys Ser Lys lie Pro Leu Ser Ala Pro Arg Lys Asn Thr 245 250 255 Asn Ser Val Lys Tyr Arg Leu Lys Phe Arg Phe Gly 260 265 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 206 amino acids TYPE: amino acid STRANDEDNESS: not relevant TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID Met Ser Gly Pro Gly Thr Ala Ala Val Ala Leu Leu Pro Ala Val Leu 1 5 10 Leu Ala Leu Leu Ala Pro Trp Ala Gly Arg Gly Gly Ala Ala Ala Pro 25 Thr Ala Pro Asn Gly Thr Leu Glu Ala Glu Leu Glu Arg Arg Trp Glu 40 Ser Leu Val Ala Leu Ser Leu Ala Arg Leu Pro Val Ala Ala Gin Pro 55 Lys Glu Ala Ala Val Gin Ser Gly Ala Gly Asp Tyr Leu Leu Gly Ile 70 75 PCT/US97/04641 WO 97/35007 -56- Lys Arg Leu Arg Arg Leu Tyr Cys Asn Val Gly Ile Gly Phe His Leu 90 Gin Ala Leu Pro Asp Gly Arg Ile Gly Gly Ala His Ala Asp Thr Arg 100 105 110 Asp Ser Leu Leu Glu Leu Ser Pro Val Glu Arg Gly Val Val Ser Ile Phe Gly Val Ala Ser Arg Phe Phe Val Ala Met Ser Ser Lys Gly Lys Leu Tyr Gly Ser Pro Phe Phe Thr Asp Glu Cys Ile Phe Lys Glu Ile 145 150 155 160 Leu Leu Pro Asn Asn Tyr Asn Ala Tyr Glu Ser Tyr Lys Tyr Pro Gly Met Pro Ile Ala Leu Ser Lys Asn Gly Lys Thr Lys Lys Gly Asn Arg 180 185 190 Val Ser Pro Thr Met Lys Val Thr His Phe Leu Pro Arg Leu 195 200 205 INFORMATION FOR SEQ ID NO:16: SEQUENCE CHARACTERISTICS: LENGTH: 198 amino acids TYPE: amino acid STRANDEDNESS: not relevant TOPOLOGY: linear (ii) MOLECULE TYPE: protein PCTIUS97/04641 WO 97/35007 57 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 16: Met Ser Arg Gly Ala Gly Mrg Leu Gin Gly Thr Leu Trp Ala Leu Val Phe Leu Gly Ile Leu Val Gly Met Val Val Pro Ser Pro Ala Gly Thr Arg Ala Asn Asn Thr Leu Leu Asp Ser Arg Gly Trp, Gly Thr Leu Leu 40 Ser Arg Ser Arg Ala Gly Leu Ala Gly Giu Ile Ala Giy Val Asn Trp Giu Ser Gly Tyr Leu Val Gly Ile Lys Arg Gin Arg Arg Leu Tyr Cys Asn Val Gly Ile Gly Phe His Leu Gin Val Leu Pro Asp Giy Arg Ile 90 Ser Gly Thr His Giu Glu Asn Pro Tyr Ser Leu Leu Glu Ile Ser Thr 100 105 110 Vai Giu Arg Gly Val Val Ser Leu Phe Giy Val Mrg Ser Ala Leu Phe 115 120 125 Val Aia Met Asn Ser Lys Giy Arg Leu Tyr Ala Thr Pro Ser Phe Gin 130 135 140 Giu Giu Cys Lys Glu Arg Glu Thr Leu Leu Pro Asn Asn Tyr Asn Ala 145 150 155 160 Tyr Giu Ser Asp Leu Tyr Gin Gly Thr Tyr Ile Ala Leu Ser Lys Tyr 165 170 175 WO 97/35007 PCT/US97/04641 -58- Gly Arg Val Lys Arg Gly Ser Lys Val Ser Pro Ile Met Thr Val Thr 180 185 190 His Phe Leu Pro Arg Ile 195 INFORMATION FOR SEQ ID NO:17: SEQUENCE CHARACTERISTICS: LENGTH: 208 amino acids TYPE: amino acid STRANDEDNESS: not relevant TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: Met Ala Pro Leu Gly Glu Val Gly Asn Tyr Phe Gly Val Gin Asp Ala 1 5 10 Val Pro Phe Gly Asn Val Pro Val Leu Pro Val Asp Ser Pro Val Leu 25 Leu Ser Asp His Leu Gly Gin Ser Glu Ala Gly Gly Leu Pro Arg Gly 40 Pro Ala Val Thr Asp Leu Asp His Leu Lys Gly Ile Leu Arg Arg Arg 55 Gin Leu Tyr Cys Arg Thr Gly Phe His Leu Glu lie Phe Pro Asn Gly 70 75 WO 97/35007 PCT/US97/04641 -59- Thr Ile Gin Giy Thr Arg Lys Asp His Ser Arg Phe Gly Ilie Leu Giu 90 Phe Ie Ser Ile Ala Val Gly Leu Vai Ser Ile Arg Gly Val Asp Ser 100 105 110 Gly Leu Tyr Leu Gly Met Asn Giu Lys Gly Glu Leu Tyr Gly Ser Giu 115 120 125 Lys Leu Thr Gin Gin Cys Val Phe Arg Gin Gin Phe Giu Gin Asn Trp 130 135 140 Tyr Asn Thr Tyr Ser Ser Asn Len Tyr Lys His Vai Asp Thr Gly Arg 145 150 155 160 Arg Tyr Tyr Val Ala Len Asn Lys Asp Gly Thr Pro Arg Giu Giy Thr 165 170 175 Arg Thr Lys Arg His Gin Lys Phe Thr His Phe Len Pro Arg Pro Val 180 185 190 Asp Pro Asp Lys Val Pro Gin Leu Tyr Lys Asp Ile Leu Ser Gin Ser 195 200 205 INFORMATION FOR SEQ ID NO: 18: SEQUENCE CHARACTERISTICS: LENGTH: 155 amino acids TYPE: amino acid STRANDEDNESS: not relevant TOPOLOGY linear (ii) MOLECULE TYPE: protein PCT/US97/04641 WO 97/35007 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18: Met Ala Giu Gly Giu Ile Thr Thr Phe Thr Ala Leu Thr Glu Lys Phe 1 5 10 Asn Leu Pro Pro Gly Asn Tyr Lys Lys Pro Lys Leu Leu Tyr Cys Ser 25 Asn Gly Gly His Phe Leu Arg Ile Leu Pro Asp Gly Thr Val Asp Gly 40 Thr Arg Asp Arg Ser Asp Gin His Ile Gin Leu Gin Leu Ser Ala Giu 55 Ser Val Gly Giu Val Tyr le Lys Ser Thr Giu Thr Gly Gin Tyr Leu Ala Met Gin Thr Asp Gly Leu Leu Tyr Giy Ser Gin Thr Pro Asn Glu 90 Giu Cys Leu Phe Leu Glu Arg Leu Giu Glu Asn His Tyr Asn Thr Tyr 100 105 110 le Ser Lys Lys His Aia Giu Lys Asn Trp, Phe Val Gly Leu Lys Lys Asn Giy Ser Cys Lys Arg Gly Pro Arg Thr His Tyr Gly Gin Lys Ala Ile Leu Phe Leu Pro Leu Pro Vai Ser Ser Asp 145 150 155 INFORMvATION FOR SEQ ID NO: 19: PCT/US97/04641 WO 97/35007 -61- SEQUENCE CHARACTERISTICS: LENGTH: 155 amino acids TYPE: amino acid STRANDEDNESS: not relevant TOPOLOGY linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 19: Met Ala Ala Gly Ser Ile Thr Thr Leu Pro Ala Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu '25 Tyr Cys Lys Asn Gly Gly Phe Phe Leu Arg Ile His Pro Asp Gly Arg Val Asp Gly Val Arg Glu Lys Ser Asp Pro His Ile Lys Leu Gin Leu Gin Ala Giu Glu Arg Gly Val Val Ser Ie Lys Gly Val Cys Ala Asn Arg Tyr Leu Ala Met Lys Giu Asp Gly Arg Leu Leu Ala Ser Lys Cys 90 Val Thr Asp Gin Cys Phe Phe Phe Gin Arg Leu Gin Ser Asn Asn Tyr 100 105 110 PCTIUS97/04641 WO 97/35007 62 Asn Thr Tyr Arg Ser Arg Lys Tyr Thr Ser Trp Tyr Val Ala Leu Lys Arg Thr Gly Gin Tyr Lys Leu Gly Ser Lys Thr Gly Pro Gly Gin Lys Ala Ile Leu Phe Leu Pro Met Ser Ala Lys Ser 145 150 155

Claims (28)

1. A substantially pure fibroblast growth factor homologous factor-3 (FGF-3) polypeptide having the amino acid sequence as set forth in SEQ ID NO:2 (Figure 1) or a functional fragment of said polypeptide.

2. An isolated polynucleotide sequence encoding the FHF-3 polypeptide of claim 1, or a sequence complementary thereto.

3. The polynucleotide of claim 2, wherein the FHF-3 nucleotide sequence is selected from the group consisting of: a) SEQ ID NO:1 (Figure wherein T can also be U; b) nucleic acid sequences complementary to SEQ ID NO:1; and c) fragments of a sequence of a) or b) that are at least 15 bases in length and that will selectively hybridize to a nucleic acid sequence which encodes .the FHF-3 polypeptide of SEQ ID NO:2 (Figure but does not selectively hybridize to a nucleic acid sequence encoding a fibroblast growth factor or to a sequence complementary thereto.

4. The polynucleotide sequence of claim 2 or claim 3, wherein the polynucleotide is isolated from a mammalian cell.

5. The polynucleotide of claim 4, wherein the mammalian cell is a 25 human cell.

6. An expression vector including the polynucleotide according to any one of claims 2 to 30 7. The vector of claim 6, wherein the vector is a plasmid.

8. The vector of claim 6, wherein the vector is a virus.

9. A host cell stably transformed with the vector according to any one of claims 6 to 8. 64 The host cell of claim 9, wherein the cell is prokaryotic.

11. The host cell of claim 9, wherein the cell is eukaryotic.

12. An antibody that binds to the FHF-3 polypeptide of claim 1 or immunoreactive fragments thereof.

13. The antibody of claim 12, wherein the antibody is polyclonal.

14. The antibody of claim 12, wherein the antibody is monoclonal. A method of detecting a cell proliferative disorder associated with expression of an FHF-3 polypeptide, including contacting a specimen of a subject suspected of having a FHF-3 associated cell proliferative disorder with a reagent that binds to an FHF-3 polypeptide of claim 1 and detecting binding of the reagent to FHF-3. o

16. The method of claim 15, wherein the cell is selected from the group consisting of a brain, testes, lung or eye cell. S17. The method of claim 15 or claim 16, wherein the reagent is an antibody which binds to the FHF-3.

18. The method of claim 15 or claim 16, wherein the reagent is a 25 polynucleotide according to any one of claims 2 to 5 and 32. The method according to any one of claims 15 to 18, wherein the detecting is in vivo. 30 20. The method according to any one of claims 15 to 18, wherein the detecting is in vitro.

21. The method according to any one of claims 15 to 20, wherein the reagent includes a detectable label.

22. The method of claim 21, wherein the detectable label is selected from the group consisting of a radioisotope, a fluorescent compound, a bioluminescent compound and a chemiluminescent compound.

23. A method of using a reagent which suppresses FHF-3 activity to treat a cell proliferative disorder associated with expression of the FHF-3 polypeptide of claim 1, including contacting a cell having or suspected of having the disorder with the reagent.

24. The method of claim 23, wherein the reagent is an anti-FHF-3 antibody. The method of claim 23, wherein the reagent is a FHF-3 antisense sequence.

26. The method according to any one of claims 23 to 25, wherein the cell is a testes, brain, lung, or eye cell.

27. The method according to any one of claims 23 to 26, wherein the :V 20 reagent which suppresses FHF-3 activity is introduced to the cell using a vector.

28. The method of claims 27, wherein the vector is in a colloidal dispersion system.

29. The method of claim 27, wherein the vector is a virus.

30. The method of claim 29, wherein the virus is a retrovirus. 30 31. A polypeptide of claim 1, wherein the functional fragment is a FHF-3 epitope.

32. A polynucleotide selected from the group consisting of: a polynucleotide as set forth in SEQ ID NO: 1, wherein T also can be U; a polynucleotide complementary to the polynucleotide as set forth in SEQ ID NO: 1, wherein T also can be U; and a nucleotide sequence that can selectively hybridize to the polynucleotide as set forth in SEQ ID NO: 1 or polynucleotide complementary thereto, wherein said nucleotide sequence includes at least 15 nucleotides, and provided said nucleotide sequence does not selectively hybridize to a polynucleotide encoding a fibroblast growth factor or a polynucleotide complementary thereto.

33. A vector containing a polynucleotide or a nucleotide sequence of claim 32.

34. A method of identifying an FHF-3 polypeptide of claim 1 in a sample, including contacting the sample with a reagent that specifically binds with FHF-3 polypeptide or a polynucleotide encoding an FHF-3 polypeptide and detecting binding of the reagent to the polypeptide or the polynucleotide. The method of claim 34 wherein the reagent is an anti-FHF-3 antibody.

36. The method of claim 34, wherein the reagent is a polynucleotide 20 according to any one of claims 2 to 5 and 32.

37. The method according to any one of claims 34 to 36 wherein the sample is a biological fluid or tissue. *I Dated this seventh day of March 2000. The Johns Hopkins University School of Medicine Patent Attorneys for the Applicant: F B RICE CO