WO1997014797A2 - Nouvel inhibiteur de cysteine proteinase, la cystatine m - Google Patents
Nouvel inhibiteur de cysteine proteinase, la cystatine m Download PDFInfo
- Publication number
- WO1997014797A2 WO1997014797A2 PCT/US1996/016782 US9616782W WO9714797A2 WO 1997014797 A2 WO1997014797 A2 WO 1997014797A2 US 9616782 W US9616782 W US 9616782W WO 9714797 A2 WO9714797 A2 WO 9714797A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cystatin
- protein
- nucleic acid
- ofthe
- seq
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/81—Protease inhibitors
- C07K14/8107—Endopeptidase (E.C. 3.4.21-99) inhibitors
- C07K14/8139—Cysteine protease (E.C. 3.4.22) inhibitors, e.g. cystatin
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Definitions
- Metastasis of a primary tumor is a multistage process involving numerous aberrant functions ofthe tumor cell. These aberrant functions include tumor angiogenesis, attachment, adhesion to the vascular basement membrane, local proteolysis, degradation of extracellular matrix components, migration through the vasculature, invasion ofthe basement membrane, and proliferation at secondary sites (Poste, G. and Fidler, LJ. (1980) Nature 283: 139-146; Liotta, L.A. et al. (1991) Cell 64:327-336). Therefore, accumulative changes in the expression of multiple genes probably occur before tumor cells acquire the phenotype that enables them to metastasize.
- the lysosomal cysteine proteinases cathepsins B and L are normally intracellular but when they are overexpressed in tumor cells, they may be secreted or become associated with the plasma membrane where they may act cooperatively in directly degrading components ofthe extracellular matrix and basement membrane and indirectly, by activating latent metalloproteinases. Alterations in intracellular trafficking and increases in expression and secretion ofthe lysosomal proteinases cathepsin B, D and L have been observed in a variety of malignant tumors, including breast carcinoma (Kolar, Z. et al. (1989) Neoplasma 36:185-189).
- CPIs Cysteine Proteinase Inhibitors
- Cystatins are the endogenous inhibitors of mammalian lysosomal cysteine proteinases, such as cathepsins B, L, H, and S, and the plant cysteine proteinases papain, actinidin, and ficin found both intracellularly and extracellularly (for reviews see e.g., Barrett, A.J. (1987) Trends Biol. Sci. 12:13-196; Turk, V. and Bode, W. (1991) FEBS Lett. 285:213-219; Abrahamson, M. (1994) Methods Enzymol. 244:685-700).
- cystatins are members of one evolutionary superfamiiy (the cystatin superfamiiy) consisting of at least three distinct subfamilies of closely related proteins, referred to as stefins, cystatins and kininogens.
- Proteins of Family 1 the stefins, consist of about 100 amino acid residues with neither disulfide bonds nor carbohydrate groups.
- Proteins of Family 2 the cystatins, consist of about 115 amino acid residues which contain one or two disulfide loops near their C-terminus.
- Proteins of Family 3 the kininogens, are made up of three contiguous type-2 cystatin domains, followed by an additional domain of variable length containing a bradykinin sequence.
- the kininogens are multifunctional plasma glycoproteins involved in blood coagulation.
- cystatin C has been observed to be secreted from human colon carcinoma cell lines, as well as from a human fibrosarcoma cell line (Corticchiato, (1992) Int. J. Cancer, 52:645-652.
- cystatin superfamiiy also have been implicated in the pathology of other disease conditions.
- a mutant form of cystatin C is associated with the autosomal dominant disease, hereditary cystatin C amyloid angiopathy (HCCAA), and is deposited in amyloid fibrils ofthe patients, while native cystatin C was purified from cerebrospinal fluid (Ghiso, J. et al. (1986) Proc. Natl. Acad. Sci. USA 83:2974-2978; Olafsson, I. et al. (1990) Scand. J. Clin. Lab. Invest. 50:85-93).
- HCAA hereditary cystatin C amyloid angiopathy
- This invention provides an isolated nucleic acid molecule encoding a novel cysteine proteinase inhibitor, termed cystatin M, which is a member ofthe Family 2 cystatins.
- cystatin M a novel cysteine proteinase inhibitor
- a partial cystatin M cDNA was originally identified by its differential expression in a primary mammary epithelial tumor cell line, as compared to a metastatic mammary tumor cell line derived from the same patient, using the differential display method. Subsequently, a full- length cDNA was isolated and identified as being down-regulated in the metastatic cells as compared to their parental cells from the primary tumor.
- cystatin M gene is regulated at the transcriptional level, and its loss of expression is associated with the metastatic phenotype, consistent with a tumor/metastasis suppressor function ofthe normal protein product along the metastatic cascade.
- the cystatin M protein displays approximately 40% sequence homology to human cystatins of Family 2 and exhibits cysteine proteinase inhibitory activity against the prototypical cysteine proteinase papain.
- cystatin M mRNA is detectable in a variety of normal human tissues, undetectable in a variety of non-mammary tumor cell lines and markedly upregulated in replicatively senescent cells as compared to dividing or quiescent cells.
- isolated nucleic acid molecules e.g., cDNAs
- isolated nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO: 1 , or the coding region thereof, or encodes the amino acid sequence of SEQ ID NO: 2.
- the isolated nucleic acid molecule encodes a protein which comprises an amino acid sequence at least 60 % homologous to the amino acid sequence of SEQ ID NO: 2 and inhibits the activity of papain in vitro.
- the protein is at least 70 %, more preferably at least 80 %, even more preferably at least 90 % and most preferably at least 95 % homologous to the amino acid sequence of SEQ ID NO: 2.
- the isolated nucleic acid molecule is at least 15 nucleotides in length and hybridizes under stringent conditions to a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1.
- the isolated nucleic acid corresponds to a naturally-occurring nucleic acid. More preferably, the isolated nucleic acid encodes naturally-occurring human cystatin M. Moreover, given the disclosure herein of a cystatin M-encoding cDNA sequence
- antisense nucleic acid molecules i.e, molecules which are complimentary to the coding strand ofthe cystatin M cDNA sequence
- antisense nucleic acid molecules i.e, molecules which are complimentary to the coding strand ofthe cystatin M cDNA sequence
- Another aspect ofthe invention pertains to recombinant expression vectors containing the nucleic acid molecules ofthe invention and host cells into which such recombinant expression vectors have been introduced.
- a host cell is used to produce cystatin M protein by culturing the host cell in a suitable medium. If desired, cystatin M protein can be then isolated from the medium or the host cell.
- Yet another aspect ofthe invention pertains to transgenic non-human animals in which a cystatin M gene has been introduced or altered.
- the genome of the nonhuman animal has been altered by introduction of a nucleic acid molecule ofthe invention encoding cystatin M as a transgene.
- an endogenous cystatin M gene within the genome ofthe nonhuman animal has been altered, e.g., functionally disrupted, by homologous recombination.
- Still another aspect ofthe invention pertains to isolated cystatin M protein. The invention provides an isolated preparation of cystatin M.
- the cystatin M protein comprises amino acids 1-149 of SEQ ID NO: 2 or about amino acids 22- 149 of SEQ ID NO: 2 (lacking an amino-terminal signal sequence).
- the isolated cystatin M protein comprises an amino acid sequence at least 60 % homologous to the amino acid sequence of SEQ ID NO: 2 and inhibits the activity of papain in vitro.
- the protein is at least 70 %, more preferably at least 80 %, even more preferably at least 90 % and most preferably at least 95 % homologous to the amino acid sequence of SEQ ID NO: 2.
- the cystatin M protein is glycosylated.
- a cystatin M protein ofthe invention can be inco ⁇ orated into a pharmaceutical composition comprising the protein and a pharmaceutically acceptable carrier. Moreover, the invention provides a fusion protein comprising a cystatin M polypeptide operatively linked to a non-cystatin M polypeptide.
- the cystatin M proteins ofthe invention, or fragments thereof, can be used to prepare anti-cystatin M antibodies.
- the invention provides an antigenic peptide of cystatin M comprising at least 8 amino acid residues ofthe amino acid sequence shown in SEQ ID NO: 2 and encompassing an epitope of cystatin M such that an antibody raised against the peptide forms a specific immune complex with cystatin M.
- the antigenic peptide comprises at least 10 amino acid residues, more preferably at least 15 amino acid residues, even more preferably at least 20 amino acid residues, and most preferably at least 30 amino acid residues.
- the invention further provides an antibody that specifically binds cystatin M.
- the antibody is monoclonal.
- the antibody is coupled to a detectable substance.
- the antibody is inco ⁇ orated into a pharmaceutical composition comprising the antibody and a pharmaceutically acceptable carrier.
- Another aspect ofthe invention pertains to methods for detecting the presence of cystatin M in a biological sample.
- the method involves contacting a biological sample (e.g., a tumor sample) with an agent capable of detecting cystatin M protein or mRNA such that the presence of cystatin M is detected in the biological sample.
- the agent can be, for example, a labeled or labelable nucleic acid probe capable of hybridizing to cystatin M mRNA or a labeled or labelable antibody capable of binding to cystatin M protein.
- the invention further provides methods for diagnosis of a subject with a tumor based on detection of cystatin M protein or mRNA.
- the method involves contacting a tumor sample from the subject with an agent capable of detecting cystatin M protein or mRNA, determining the amount of cystatin M protein or mRNA expressed in the tumor sample, comparing the amount of cystatin M . protein or mRNA expressed in the tumor sample to a control sample and forming a diagnosis based on the amount of cystatin M protein or mRNA expressed in the tumor sample as compared to the control sample.
- the tumor sample is a mammary tumor sample. Kits for detecting cystatin M in a biological sample are also within the scope ofthe invention.
- the cystatin M protein ofthe invention can be used to modulate the cystatin M cysteine proteinase inhibitory activity associated with a cell (e.g., in the cell, secreted by the cell or in the extracellular milieu surrounding the cell).
- the invention provides a method for stimulating the cystatin M cysteine proteinase inhibitory (CPl) activity associated with a cell by contacting the cell with an agent that stimulates cystatin M CPl activity.
- an agent can be, for example, an active cystatin M protein which is cultured with the cell or a nucleic acid encoding cystatin M that has been introduced into the cell.
- cystatin M CPl activity is stimulated in tumor cells, such as mammary tumor cells, in which endogenous cystatin M expression is low or absent.
- the invention provides a method for inhibiting the cystatin M CPl activity associated with a cell by contacting the cell with an agent that inhibits cystatin M CPl activity.
- an agent can be, for example, an antisense cystatin M nucleic acid molecule or an anti-cystatin M antibody.
- the methods ofthe invention for modulating cystatin M activity can be applied in vitro (e.g., with cells in culture) or in vivo, wherein an agent that modulates cystatin M CPl activity is administered to the subject.
- the invention provides a method for inhibiting development or progression of a metastatic phenotype in a tumor cell comprising contacting the tumor cell with an agent which elevates the amount of cystatin M in or around the tumor cell.
- modulators of the cystatin M expression or cystatin M cysteine proteinase inhibitory activity are also encompassed by the invention.
- the modulator stimulates cystatin M expression or activity.
- the modulator inhibits cystatin M expression or activity.
- Figure I is the complete cDNA sequence and deduced amino acid sequence of human cystatin M (SEQ ID NOs: 1 and 2, respectively).
- Figure 2 is a comparison ofthe amino acid sequence of cystatin M to other proteins ofthe human cystatin Family 2 (cystatins C, D, S, SN and SA) and chicken cystatin.
- Figure 3 is a photograph of a Northern hybridization depicting the expression of cystatin M mRNA in normal mammary epithelial cell lines (76N, 70N), primary mammary epithelial tumor cell lines (21PT, 2 INT) and metastatic mammary epithelial tumor cell lines (21MT-2, 3BT479, MCF7, T-47D, ZR-75-1, BT474, MDA361, MDA157, MDA231, MDA-MB-435, MDA-MB-436), as well as normal breast fibroblasts (56NF) and normal leukocytes (Leuk.).
- Figure 4 is a photograph of a Northern hybridization depicting the expression of cystatin M mRNA in the following normal human tissues: heart, brain, placenta, lung, Hver, skeletal muscle, kidney and pancreas.
- Figure 5 A is a photograph of a Northern hybridization depicting the expression of cystatin M mRNA in passage 11 quiescents (days 2-12 post-plating) and in senescing cells (days 15-22 post-plating).
- Figure 5B is a bar graph depicting the relative expression of cystatin M mRNA in quiescent and senescent cells.
- Figure 6 is a photograph of an SDS-PAGE gel depicting lysate of bacteria cells transformed with pGEX-2T (lane 1) and glutathione-affinity-purified material therefrom (lane 2), lysate from bacterial cells transformed with pGEX-2T/cystatin M (lane 3) and glutathione-affinity-purified material therefrom (lane 4), and the GST-cystatin M fusion protein treated with thrombin for 0 minutes (lane 5), 2 minutes (lane 6), 30 minutes (lane 7) or 90 minutes (lane 8).
- Figure 7 A is a photograph of a Western blot depicting the expression of cystatin M protein in lysates (L) or supernatants (S) of a normal human mammary epithelial cell line (70N), a primary mammary epithelial tumor cell line (21PT) or malignant mammary epithelial tumor cell lines (MDA435, MDA157, BT549).
- Figure IB is a photograph of immunoprecipitates of culture supernatants of a primary mammary epithelial tumor cell line (21PT) or a malignant mammary epithelial tumor cell line (MDA435) with either preimmune serum or immune serum raised against recombinant cystatin M.
- 21PT primary mammary epithelial tumor cell line
- MDA435 malignant mammary epithelial tumor cell line
- Figure 8B is a Dixon plot graph for the estimation ofthe Ki value of recombinant cystatin M fusion protein for the inhibition of papain activity ("S” represents Z-Phe- Arg- MCA substrate: "FP” represents cystatin M fusion protein).
- Figure 9 is a photograph of a Western blot depicting cystatin M protein immunoprecipitated from 21PT cell culture supernatant that was incubated in the absence (lane 1) or presence (lane 2) of N-Glycosidase F. Cystatin M cleaved from rGST-cystatin M fusion protein by thrombin is shown in lane 3. The arrow on the right indicates glycosylated cystatin M.
- This invention pertains to a novel cysteine proteinase inhibitor (CPl) which is a member ofthe Family 2 cystatins.
- the CPl of the invention is named cystatin M but may also be referred to herein as 6A2, its clone designation.
- a partial cDNA encoding human cystatin M was originally isolated using the differential display method of Liang and Pardee (Science (1992) 257:967-970) in experiments designed to identify mRNA transcripts differentially expressed in a primary mammary epithelial tumor cell line (21PT) as compared to a metastatic mammary tumor cell line (21MT-1) derived fiOm the same patient.
- a full-length cDNA was subsequently isolated using the partial cDNA as a hybridization probe to screen a cDNA library prepared from the human mammary epithelial tumor cell line 21PT (described in further detail in Example 1).
- the nucleotide sequence of the isolated human cystatin M cDNA, and the predicted amino acid sequence ofthe human cystatin M protein, are shown in Figure 1 and in SEQ ID NOs: 1 and 2, respectively.
- cystatin M shares certain structural features with other members ofthe Family 2 human cystatins and chicken cystatin, but is only approximately 40% (or less) homologous to these proteins.
- cystatin M mRNA has a distinct expression pattern that distinguishes it from other cystatins (described in further detail in Example 2).
- Cystatin M has been expressed as a recombinant protein (see Example 3) and used an immunogen to raise anti-cystatin M antibodies (see Example 4). Immunoprecipitation experiments with these antibodies demonstrated that 21 PT cells express and secrete a native protein corresponding in size and immunoreactivity to the recombinant cystatin M (see Example 4).
- cystatin M is effective at inhibiting the activity ofthe prototypical cysteine proteinase papain (see Example 5), demonstrating that cystatin M can function as a CP
- cystatin M can function as a CP
- Approximately 30-40% of he native cystatin M protein occurs in a glycosylated form in a tumor cell line (see Example 6).
- transfection of a recombinant expression vector encoding cystatin M into a metastatic breast tumor cell line that does not express endogenous cystatin M leads to secretion of glycosylated recombinant cystatin M from the tumor cell line (see Example 7).
- nucleic acid molecules that encode cystatin M or biologically active portions thereof, as well as nucleic acid fragments sufficient for use as hybridization probes to identify cystatin M-encoding nucleic acid (e.g., cystatin M mRNA).
- nucleic acid molecule is intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mRNA).
- the nucleic acid molecule may be single-stranded or double-stranded, but preferably is double-stranded DNA.
- an "isolated" nucleic acid molecule is free of sequences which naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends ofthe nucleic acid) in the genomic DNA ofthe organism from which the nucleic acid is derived.
- the isolated cystatin M nucleic acid molecule may contain less than about 5 kb, 4kb, 3kb, 2kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA ofthe cell from which the nucleic acid is derived (e.g., a human mammary epithelial cell).
- an "isolated" nucleic acid molecule such as a cDNA molecule, may be free of other cellular material.
- an isolated nucleic acid molecule ofthe invention comprises the nucleotide sequence shown in SEQ ID NO: 1.
- the sequence of SEQ ID NO: 1 corresponds to the human cystatin M cDNA.
- This cDNA comprises sequences encoding the cystatin M protein (i.e., "the coding region", from nucleotides 24 to 470), as well as 5' untranslated sequences (nucleotides 1 to 23) and 3' untranslated sequences (nucleotides 471 to 598).
- the nucleic acid molecule may comprise only the coding region of SEQ ID NO: 1 (e.g., nucleotides 24 to 470).
- the nucleic acid molecule ofthe invention can comprise only a portion of the coding region of SEQ ID NO: 1, for example a fragment encoding a biologically active portion of cystatin M.
- biologically active portion of cystatin M is intended to include portions of cystatin M that retain the ability to inhibit cysteine proteinase activity.
- the ability of portions of cystatin M to inhibit cysteine proteinase activity can be determined in standard in vitro cysteine proteinase assays, for example using papain as the cysteine proteinase (described further below and in Example 5).
- the biologically active portion of cystatin M is a mature form of cystatin M in which a hydrophobic, amino-terminal signal sequence (encompassing approximately amino acids 1 - 21) is absent.
- the mature form of cystatin M preferably comprises about amino acid residues 22 to 149 (i.e., the nucleic acid molecule comprises nucleotides 87-470 of SEQ ID NO: 1).
- Leu-22 preferably is the N-terminal residue ofthe mature protein, although more than one native isoform differing in the length ofthe N-terminal sequence may exist for cystatin M, as has been reported for other cystatins.
- cystatin M lacking a signal sequence.
- the mature form may begin with Ala-21 or Pro-23.
- Additional nucleic acid fragments encoding biologically active portions of cystatin M can be prepared by isolating a portion of SEQ ID NO: 1, expressing the encoded portion of cystatin M protein or peptide (e.g., by recombinant expression in vitro) and assessing the cysteine proteinase inhibitory activity ofthe encoded portion of cystatin M protein or peptide.
- the invention further encompasses nucleic acid molecules that differ from SEQ ID NO:l (and portions thereof) due to degeneracy ofthe genetic code and thus encode the same cystatin M protein as that encoded by SEQ ID NO: 1. Accordingly, in another embodiment, an isolated nucleic acid molecule ofthe invention has a nucleotide sequence encoding a protein having an amino acid sequence shown in SEQ ID NO: 2. Moreover, the invention encompasses nucleic acid molecules that encode biologically active portions of SEQ ID NO: 2.
- the nucleic acid molecule encodes a portion ofthe amino acid sequence shown in SEQ ID NO: 2 corresponding to a mature form of cystatin M in which a hydrophobic, N-terminal signal sequence (e.g., about amino acid residues 1-21) is absent.
- this mature form encompasses about amino acid residues 22-149 of SEQ ID NO: 2.
- a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 1 , or a portion thereof, can be isolated using standard molecular biology techniques and the sequence information provided herein.
- a human cystatin cDNA can be isolated from a normal mammary epithelial cell line cDNA library using all or portion of SEQ ID NO: 1 as a hybridization probe and standard hybridization techniques (e.g., as described in Sambrook, J., Fritsch, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989).
- a nucleic acid molecule encompassing all or a portion of SEQ ID NO: 1 can be isolated by the polymerase chain reaction using oligonucleotide primers designed based upon the sequence of SEQ ID NO: 1.
- mRNA can be isolated from normal mammary epithelial cells (e.g., by the guanidinium-thiocyanate extraction procedure of Chirgwin et al. (1979) Biochemistry 18: 5294-5299) and cDNA can be prepared using reverse transcriptase (e.g. , Moloney MLV reverse transcriptase, available from Gibco/BRL, Bethesda, MD; or AMV reverse transcriptase, available from Seikagaku America, Inc., St.
- reverse transcriptase e.g. , Moloney MLV reverse transcriptase, available from Gibco/BRL, Bethesda, MD; or AMV reverse transcriptase, available from Seikagaku America, Inc., St.
- Synthetic oligonucleotide primers for PCR amplification can be designed based upon the nucleotide sequence shown in SEQ ID NO: 1.- For example, primers suitable for amplification ofthe segment of SEQ ID NO: 1 encoding amino acid residues 22 to 149 are shown in SEQ ID NOs: 3 and 4.
- a nucleic acid ofthe invention can be amplified using cDNA or, alternatively, genomic DNA, as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis.
- oligonucleotides corresponding to cystatin M nucleotide sequence can be prepared by standard synthetic techniques, e.g. , using an automated DNA synthesizer.
- cystatin M nucleotide sequence shown in SEQ ID NO: 1
- DNA sequence polymo ⁇ hisms that lead to changes in the amino acid sequences of cystatin M may exist within a population (e.g., the human population).
- Such genetic polymo ⁇ hism in the cystatin M gene may exist among individuals within a population due to natural allelic variation.
- Natural allelic variation has been observed with other members ofthe Family 2 cystatins.
- two allelic variants ofthe cystatin D gene, resulting in an amino acid polymo ⁇ hism at the protein level have been described (Balbin, M. et al. (1993) Hum. Genet. 90:668-669; Balbin, M.
- nucleotide sequence ofthe a gene can typically result in 1-5 % variance in the nucleotide sequence ofthe a gene. Any and all such nucleotide variations and resulting amino acid polymo ⁇ hisms in cystatin M that are the result of natural allelic variation and that do not alter the functional activity of cystatin M are intended to be within the scope ofthe invention. Moreover, nucleic acid molecules encoding cystatin M proteins from other species, and thus which have a nucleotide sequence which differs from the human sequence of SEQ ID NO: 1, are intended to be within the scope ofthe invention.
- Nucleic acid molecules corresponding to natural allelic variants and nonhuman homologues ofthe human cystatin M cDNA ofthe invention can be isolated based on their homology to the human cystatin M nucleic acid disclosed herein using the human cDNA, or a portion thereof, as a hybridization probe according to standard hybridization techniques under stringent hybridization conditions. Accordingly, in another embodiment, an isolated nucleic acid molecule of the invention is at least 15 nucleotides in length and hybridizes under stringent conditions to the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1. In other embodiment, the nucleic acid is at least 30, 50, 100, 250 or 500 nucleotides in length.
- hybridizes under stringent conditions is intended to describe conditions for hybridization and washing under which nucleotide sequences at least 60 % homologous to each other typically remain hybridized to each other.
- the conditions are such that at least sequences at least 65 %, more preferably at least 70 %, and even more preferably at least 75 % homologous to each other typically remain hybridized to each other.
- stringent conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
- a preferred, non-limiting example of stringent hybridization conditions are hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45°C, followed by one or more washes in 0.2 X SSC, 0.1 % SDS at 50-65°C.
- an isolated nucleic acid molecule ofthe invention that hybridizes under stringent conditions to the sequence of SEQ ID NO: 1 corresponds to a naturally-occurring nucleic acid molecule.
- a "naturally-occurring" nucleic acid molecule refers to an RNA or DNA molecule having a nucleotide sequence that occurs in nature (e.g., encodes a natural protein).
- the nucleic acid encodes a natural human cystatin M.
- the nucleic acid molecule encodes a murine homologue of human cystatin M.
- allelic variants ofthe cystatin M sequence that may exist in the population
- changes may be introduced by mutation into the nucleotide sequence of SEQ ID NO: 1, thereby leading to changes in the amino acid sequence ofthe encoded cystatin M protein, without altering the functional ability ofthe cystatin M protein.
- nucleotide substitutions leading to amino acid substitutions at "non-essential" amino acid residues may be made in the sequence of SEQ ID NO: 1.
- a "non-essential" amino acid residue is a residue that can be altered from the wild-type sequence of cystatin (e.g.
- cystatin M that are strongly conserved among members ofthe Family 2 cystatins (e.g., conserved in 6 of 7 ofthe family members whose amino acid sequences are aligned and compared in Figure 2) are predicted to be essential in cystatin M and thus are not likely to be amenable to alteration.
- all members ofthe Family 2 cystatins, including cystatin M characteristically contain four cysteine residues that participate in the formation of two intrachain disulfide bridges.
- cystatin M Reduction of both disulfide bonds of chicken cystatin destroys the cysteine proteinase binding ability ofthe protein (Bjork, I. and Ylinenjarvi, K. (1992) Biochemistry 3J,:8597-8602). Accordingly, these conserved cysteine residues in cystatin M (cys-98, cys-1 13, cys- 126 and cys- 146) are not likely to be amenable to mutation.
- the enzyme- inhibitor complex is formed mainly by hydrophobic interactions between cystatin and papain, with contributions from the N-terminal segment of chicken cystatin (Leu8-Gly9 of the mature protein) in a substrate-like interaction with the active-site cleft of papain, as well as the first hai ⁇ in loop (Glu53-Gly57), a conserved region in all these inhibitors, and the second hai ⁇ in loop (Pro 103 -Leu 105).
- the N-terminal segments of cystatin C and chicken cystatin interact in a substrate-like manner with the subsites S3 and S2 ofthe proteinase.
- mutagenesis studies have demonstrated the importance of Gly 1 1 in human cystatin C (corresponding to Gly9 in chicken cystatin) in the ability ofthe protein to adopt a conformation suitable for interaction with the substrate-binding pockets of cysteine proteinases (Hall, A. et al. (1993) Biochem. J. 29LT23-129).
- mutagenesis of residues outside the N-terminal region and the first and second hai ⁇ in loops may be inconsequential for the CPl activity ofthe protein.
- an Arg to T ⁇ substitution made at position 117 of human cystatin S had no effect on the inhibitory activity ofthe protein (Saitoh, E. and Isemura, S. (1994) j. Biochem. 116:399-405).
- Cystatin M like all other members ofthe family, shares all three conserved domains important for CPl activity, namely the N-terminal region and the first and second hai ⁇ in loops.
- Gly-36 of SEQ ID NO: 2 near the N-terminal domain of the cystatin M preprotein, corresponds to the conserved Gly-11 of mature cystatin C and Gly-9 of mature chicken cystatin.
- Cystatin M also contains the first and second hai ⁇ in loop motifs associated with cysteine proteinase inhibitory activity: the 'QXVXG' motif in the middle of the molecule (QLVAG at positions 80 to 84 of cystatin M shown in SEQ ID NO: 2; QIVAG in cystatin C, QLVSG in chicken cystatin), as well as the VPW sequence near the carboxy terminal (positions 133 to 135 of SEQ ID NO: 2), which is also conserved in all - 12 - known cystatins.
- these highly conserved regions in cystatin M necessary for the CPl activity ofthe protein are not likely to be amenable to mutation.
- Other amino acid residues may not be essential for CPl activity and thus are likely to be amenable to alteration.
- nucleic acid molecules encoding cystatin M proteins that contain changes in amino acid residues that are not essential for CPl activity , e.g., residues that are not conserved or only semi -conserved among members ofthe Family 2 cystatins.
- cystatin M proteins differ in amino acid sequence from SEQ ID NO: 2 yet retain CPl activity.
- the isolated nucleic acid molecule comprises a nucleotide sequence encoding a protein, wherein the protein comprises an amino acid sequence at least 60 % homologous to the amino acid sequence of SEQ ID NO: 2 inhibits the activity of papain in vitro.
- the protein encoded by the nucleic acid molecule is at least 70 % homologous to SEQ ID NO: 2, more preferably at least 80 % homologous to SEQ ID NO: 2, even more preferably at least 90 % homologous to SEQ ID NO: 2, and most preferably at least 95 % homologous to SEQ ID NO: 2.
- the sequences are aligned for optimal comparison pu ⁇ oses (e.g. , gaps may be introduced in the sequence of one protein for optimal alignment with the other protein).
- the amino acid residues at corresponding amino acid positions are then compared.
- a position in one sequence e.g., SEQ ID NO: 2
- amino acid residues are then occupied by the same amino acid residue as the corresponding position in the other sequence (e.g., a mutant form of cystatin M)
- the molecules are homologous at that position (i.e., as used herein amino acid "homology” is equivalent to amino acid "identity").
- An isolated nucleic acid molecule encoding a cystatin M protein homologous to the protein of SEQ ID NO: 2 can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of SEQ ID NO: 1 such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations can be introduced into SEQ ID NO: 1 by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more predicted non-essential amino acid residues. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain.
- Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
- basic side chains e.g., lysine, arginine, histidine
- acidic side chains e.g., aspartic acid
- a predicted nonessential amino acid residue in cystatin M is preferably replaced with another amino acid residue from the same side chain family.
- mutations can be introduced randomly along all or part of a cystatin M coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for proteolytic activity to identify mutants that retain proteolytic activity.
- the encoded protein can be expressed recombinantly (e.g. , as described in Example 3) and the cysteine proteinase inhibitory activity ofthe protein can be determined.
- cystatin M protein e.g. , a mutated or truncated form of SEQ ID NO: 2
- papain commercially available from Boehringer Mannheim
- a synthetic substrate for papain such as the fluorogenic substrate Z-Phe- Arg-MCA (commercially available from Sigma Chemical Co., St. Louis, MO).
- the amount of 7- amino-4-methylcoumarin liberated from the synthetic substrate is then determined fluorometrically as a measure ofthe cysteine proteinase activity of papain.
- the papain activity in the presence ofthe cystatin M protein is compared with the papain activity in the absence ofthe cystatin M protein.
- an antisense nucleic acid comprises a nucleotide sequence which is complementary to a "sense” nucleic acid encoding a protein, e.g., complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA sequence. Accordingly, an antisense nucleic acid can hydrogen bond to a sense nucleic acid.
- the antisense nucleic acid can be complementary to an entire cystatin M coding strand, or to only a portion thereof.
- an antisense nucleic acid molecule is antisense to a "coding region" ofthe coding strand of a nucleotide sequence encoding cystatin M.
- the term "coding region” refers to the region ofthe nucleotide sequence comprising codons which are translated into amino acid residues (e.g., the entire coding region of SEQ ID NO: 1 comprises nucleotides 24-470).
- the antisense nucleic acid molecule is antisense to a "noncoding region" ofthe coding strand of a nucleotide sequence encoding cystatin M.
- noncoding region refers to 5' and 3' sequences which flank the coding region that are not translated into amino acids (i.e., also referred to as 5' and 3' untranslated regions).
- antisense nucleic acids ofthe invention can be designed according to the rules of Watson and Crick base pairing.
- the antisense nucleic acid molecule may be complementary to the entire coding region of cystatin M mRNA, but more preferably is an oligonucleotide which is antisense to only a portion ofthe coding or noncoding region of cystatin M mRNA.
- the antisense oligonucleotide may be complementary to the region surrounding the translation start site of cystatin M mRNA.
- An antisense oligonucleotide can be, for example, about 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length.
- An antisense nucleic acid ofthe invention can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art.
- an antisense nucleic acid e.g., an antisense oligonucleotide
- an antisense nucleic acid e.g., an antisense oligonucleotide
- the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection).
- an antisense nucleic acid ofthe invention is a ribozyme.
- Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region.
- a ribozyme having specificity for a cystatin M-encoding nucleic acid can be designed based upon the nucleotide sequence of a cystatin M cDNA disclosed herein (i.e., SEQ ID NO: 1).
- a derivative of a Tetrahymena L-l 9 IVS RNA can be constructed in which the base sequence ofthe active site is complementary to the base sequence to be cleaved in a cystatin M-encoding mRNA.
- cystatin M mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See for example Bartel, D. and Szostak, J.W. (1993) Science 261 : 1411-1418.
- vectors preferably expression vectors, containing a nucleic acid encoding cystatin M (or a portion thereof).
- vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
- vector is a "plasmid", O 97/14797 PC17US96/16782
- vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked.
- expression vectors are referred to herein as "expression vectors".
- expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
- plasmid and vector may be used interchangeably as the plasmid is the most commonly used form of vector.
- the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g. , replication defective retroviruses, adenoviruses and adeno- associated viruses), which serve equivalent functions.
- the recombinant expression vectors ofthe invention comprise a nucleic acid ofthe invention in a form suitable for expression ofthe nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operatively linked to the nucleic acid sequence to be expressed.
- "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner which allows for expression ofthe nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).
- regulatory sequence is intended to includes promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cell and those which direct expression ofthe nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design ofthe expression vector may depend on such factors as the choice ofthe host cell to be transformed, the level of expression of protein desired, etc.
- the expression vectors ofthe invention can be introduced into host cells to thereby produce proteins or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., cystatin M proteins, mutant forms of cystatin M, fusion proteins, etc.).
- proteins or peptides including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., cystatin M proteins, mutant forms of cystatin M, fusion proteins, etc.).
- the recombinant expression vectors ofthe invention can be designed for expression of cystatin M in prokaryotic or eukaryotic cells.
- cystatin M can be expressed in bacterial cells such as E. coli, insect cells (using baculovirus expression vectors) yeast cells or mammalian cells. Suitable host cells are discussed further in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
- the recombinant expression vector may be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase. Expression of proteins in prokaryotes is most often carried out in E.
- Fusion vectors add a number of amino acids to a protein encoded therein, usually to the amino terminus ofthe recombinant protein.
- Such fusion vectors typically serve three pu ⁇ oses: 1) to increase expression of recombinant protein; 2) to increase the solubility ofthe recombinant protein; and 3) to aid in the purification ofthe recombinant protein by acting as a ligand in affinity purification.
- a proteolytic cleavage site is introduced at the junction ofthe fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification ofthe fusion protein.
- enzymes, and their cognate recognition sequences include Factor Xa, thrombin and enterokinase.
- Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc.; Smith, D.B. and Johnson, K.S.
- the coding sequence ofthe mature form of cystatin M (i.e.. encompassing amino acids 22-149) is cloned into a pGEX expression vector to create a vector encoding a fusion protein comprising, from the N-terminus to the C- terminus, GST-thrombin cleavage site-cystatin M.
- the fusion protein can be purified by affinity chromatography using glutathione-agarose resin. Recombinant cystatin M unfused to GST can be recovered by cleavage ofthe fusion protein with thrombin.
- Suitable inducible non-fusion E. coli expression vectors include pTrc (Amann et al. (1988) Gene 69:301-315) and pET 1 Id (Studier et al.. Gene Expression Technology: Methods in Enzymology 185. Academic Press, San Diego, California (1990) 60-89).
- Target gene expression from the pTrc vector relies on host RNA polymerase transcription from a hybrid t ⁇ -lac fusion promoter.
- Target gene expression from the pET l id vector relies on transcription from a T7 gnlO-lac fusion promoter mediated by a coexpressed viral RNA polymerase (T7 gnl).
- This viral polymerase is supplied by host strains BL21(DE3) or HMS174(DE3) from a resident ⁇ prophage harboring a T7 gnl gene under the transcriptional control ofthe lacUV 5 promoter.
- One strategy to maximize recombinant protein expression in E. coli is to express the protein in a host bacteria with an impaired capacity to proteolytically cleave the recombinant protein (Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 119-128).
- Another strategy is to alter the nucleic acid sequence ofthe nucleic acid to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized in E. coli (Wada et al., ( ⁇ 992) Nuc. Acids Res. 20:2111-2118).
- Such alteration of nucleic acid sequences of the invention can be carried out by standard DNA synthesis techniques.
- the cystatin M expression vector is a yeast expression vector.
- yeast expression vectors for expression in yeast S. cerivisae include pYepSecl
- cystatin M can be expressed in insect cells using baculovirus expression vectors.
- Baculovirus vectors available for expression of proteins in cultured insect cells include the pAc series (Smith et al, (1983) Mol. Cell Biol 3:2156-2165) and the pVL series (Lucklow, V.A., and Summers, M.D., (1989) Virology 170:31-39).
- a nucleic acid ofthe invention is expressed in mammalian cells using a mammalian expression vector.
- mammalian expression vectors include pCDM8 (Seed, B., (1987) Nature 329:840) and pMT2PC (Kaufman et al. (1987), EMBOJ. 6:187-195).
- the expression vector's control functions are often provided by viral regulatory elements.
- commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40.
- the recombinant mammalian expression vector is capable of directing expression ofthe nucleic acid preferentially in a particular cell type (e.g. , tissue-specific regulatory elements are used to express the nucleic acid).
- tissue-specific regulatory elements are known in the art.
- suitable tissue-specific promoters include the albumin promoter (liver- specific; Pinkert et al. (1987) Genes Dev. 1:268-277), lymphoid-specific promoters
- mammary gland-specific promoters e.g., milk whey promoter; U.S. Patent No. 4,873,316 and European Application Publication No. 264,166.
- Developmentally-regulated promoters are also encompassed, for example the murine hox promoters (Kessel and Gruss (1990) Science 249:374-379) and the ⁇ -fetoprotein promoter (Campes and Tilghman (1989) Genes Dev. 3:537-546).
- the invention further provides a recombinant expression vector comprising a DNA molecule of the invention cloned into the expression vector in an antisense orientation. That is, the DNA molecule is operatively linked to a regulatory sequence in a manner which allows for expression (by transcription ofthe DNA molecule) of an RNA molecule which is antisense to cystatin mRNA.
- Regulatory sequences operatively linked to a nucleic acid cloned in the antisense orientation can he chosen which direct the continuous expression ofthe antisense RNA molecule in a variety of cell types, for instance viral promoters and/or enhancers, or regulatory sequences can be chosen which direct constitutive, tissue specific or cell type specific expression of antisense RNA.
- the antisense expression vector can be in the form of a recombinant plasmid, phagemid or attenuated virus in which antisense nucleic acids are produced under the control of a high efficiency regulatory region, the activity of which can be determined by the cell type into which the vector is introduced.
- a high efficiency regulatory region the activity of which can be determined by the cell type into which the vector is introduced.
- a host cell may be any prokaryotic or eukaryotic cell.
- cystatin M protein may be expressed in bacterial cells such as E. coli, insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells).
- bacterial cells such as E. coli, insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells).
- mammalian cells such as Chinese hamster ovary cells (CHO) or COS cells.
- Other suitable host cells are known to those skilled in the art.
- Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques.
- transformation and “transfection” are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting host cells can be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press (1989)), and other laboratory manuals.
- a gene that encodes a selectable marker (e.g. , resistance to antibiotics) is generally introduced into the host cells along with the gene of interest.
- selectable markers include those which confer resistance to drugs, such as G418, hygromycin and methotrexate.
- Nucleic acid encoding a selectable marker may be introduced into a host cell on the same vector as that encoding cystatin M or may be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g, cells that have inco ⁇ orated the selectable marker gene will survive, while the other cells die).
- a host cell ofthe invention such as a prokaryotic or eukaryotic host cell in culture, can be used to produce (i.e., express) cystatin M protein.
- the invention further provides methods for producing cystatin M protein using the host cells ofthe invention.
- the method comprises culturing the host cell of invention (into which a recombinant expression vector encoding cystatin M has been introduced) in a suitable medium until cystatin M is produced.
- the method further comprises isolating cystatin M from the medium or the host cell.
- the host cells ofthe invention can also be used to produce nonhuman transgenic animals.
- a host cell ofthe invention is a fertilized oocyte or an embryonic stem cell into which cystatin M-coding sequences have been introduced.
- Such host cells can then be used to create non-human transgenic animals in which exogenous cystatin M sequences have been introduced into their genome or homologous recombinant animals in which endogenous cystatin M sequences have been altered.
- Such animals are useful for studying the function and/or activity of cystatin M and for identifying and/or evaluating modulators of cystatin M activity.
- a ⁇ ransgenic animal is a non-human animal, preferably a mammal, more preferably a mouse, in which one or more ofthe cells ofthe animal includes a transgene.
- a transgene is exogenous DNA which is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome ofthe mature animal, thereby directing the expression of an encoded gene product in one or more cell types or tissues ofthe transgenic animal.
- a "homologous recombinant animal” is a non-human animal, preferably a mammal, more preferably a mouse, in which an endogenous cystatin M gene has been altered by homologous recombination between the endogenous gene and an exogenous DNA molecule introduced into a cell ofthe animal, e.g., an embryonic cell of the animal, prior to development ofthe animal.
- a transgenic animal ofthe invention can be created by introducing cystatin M- encoding nucleic acid into the male pronuclei of a fertilized oocyte, e.g., by microinjection, and allowing the oocyte to develop in a pseudopregnant female foster animal.
- the human cystatin M cDNA sequence of SEQ ID NO: 1 can be introduced as a transgene into the genome of a non-human animal.
- a nonhuman homologue ofthe human cystatin M gene such as a mouse cystatin M gene, can be isolated based on hybridization to the human cystatin cDNA (described further in subsection I above) and used as a transgene.
- Intronic sequences and polyadenylation signals can also be included in the transgene to increase the efficiency of expression ofthe transgene.
- a tissue-specific regulatory sequence(s) can be operably linked to the cystatin M transgene to direct expression of cystatin M protein to particular cells.
- transgenic founder animal can be identified based upon the presence ofthe cystatin M transgene in its genome and or expression of cystatin M mRNA in tissues or cells ofthe animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene encoding cystatin M can further be bred to other transgenic animals carrying other transgenes.
- a vector which contains at least a portion of a cystatin M gene into which a deletion, addition or substitution has been introduced to thereby alter, e.g., functionally disrupt, the cystatin M gene.
- the cystatin M gene may be a human gene (e.g., from a human genomic clone isolated from a human genomic library screened with the cDNA of SEQ ID NO: 1 ), but more preferably, is a non ⁇ human homologue of a human cystatin M gene.
- a mouse cystatin M gene can be isolated from a mouse genomic DNA library using the human cystatin M cDNA of SEQ ID NO: 1 as a probe.
- the mouse cystatin M gene then can be used to construct a homologous recombination vector suitable for altering an endogenous cystatin M gene in the mouse genome.
- the vector is designed such that, upon homologous recombination, the endogenous cystatin M gene is functionally disrupted (i.e., no longer encodes a functional protein; also referred to as a "knock out" vector).
- the vector can be designed such that, upon homologous recombination, the endogenous cystatin M gene is mutated or otherwise altered but still encodes functional protein (e.g. , the upstream regulatory region can be altered to thereby alter the expression ofthe endogenous cystatin M protein).
- the altered portion ofthe cystatin M gene is flanked at its 5' and 3' ends by additional nucleic acid ofthe cystatin M gene to allow for homologous recombination to occur between the exogenous cystatin M gene carried by the vector and an endogenous cystatin gene in an embryonic stem cell.
- the additional flanking cystatin M nucleic acid is of sufficient length for successful homologous recombination with the endogenous gene.
- flanking DNA both at the 5' and 3' ends
- are included in the vector see e.g., Thomas, K.R. and Capecchi, M. R. (1987) Cell 5 .
- the vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced cystatin gene has homologously recombined with the endogenous cystatin M gene are selected (see e.g., Li, E. et al. (1992) Cell 69:915).
- the selected cells are then injected into a blastocyst of an animal (e.g., a mouse) to form aggregation chimeras (see e.g., Bradley, A. in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E.J. Robertson, ed.
- a chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term.
- Progeny harboring the homologously recombined DNA in their germ cells can be used to breed animals in which all cells ofthe animal contain the homologously recombined DNA by germline transmission ofthe transgene. Methods for constructing homologous recombination vectors and homologous recombinant animals are described further in Bradley, A.
- Another aspect ofthe invention pertains to isolated cystatin M proteins, and biologically active portions thereof, as well as peptide fragments suitable as immunogens to raise anti-cystatin M antibodies.
- the invention provides an isolated preparation of cystatin M, or a biologically active portion thereof.
- An "isolated" protein is substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized.
- the cystatin M protein has an amino acid sequence shown in SEQ ID NO: 2.
- the cystatin M protein is substantially homologous to SEQ ID NO: 2 and retains the functional activity ofthe protein of SEQ ID NO: 2 yet differs in amino acid sequence due to natural allelic variation or mutagenesis, as described in detail in subsection I above. Accordingly, in another embodiment, the cystatin M protein is a protein which comprises an amino acid sequence at least 60 % homologous to the amino acid sequence of SEQ ID NO: 2 and inhibits the activity of papain in vitro.
- the protein is at least 70 % homologous to SEQ ID NO: 2, more preferably at least 80 % homologous to SEQ ID NO: 2, even more preferably at least 90 % homologous to SEQ ID NO: 2, and most preferably at least 95 % homologous to SEQ ID NO: 2.
- An isolated cystatin M protein may comprise the entire amino acid sequence of SEQ ID NO: 2 (i.e., amino acids 1-149) or a biologically active portion thereof.
- a biologically active portion of cystatin M can comprise a mature form of cystatin M in which a hydrophobic, amino-terminal signal sequence is absent.
- such a mature form of cystatin M comprises about amino acids 22-149 of SEQ ID NO: 2.
- the term "about amino acids 22-149" is intended to indicate that there is some flexibility in the amino-terminal residue, as discussed further in subsection I above.
- other biologically active portions, in which other regions ofthe protein are deleted can be prepared by recombinant techniques and evaluated for cysteine proteinase inhibitory activity as described in detail above.
- the cystatin M protein ofthe invention is glycosylated.
- Native cystatin M has been found to exist both as a 14.5 kDa form and as a 20-22 kDa form, the latter representing a glycosylated form.
- Recombinant expression of cystatin M protein in mammalian cells e.g., a metastatic breast tumor cell line
- Cystatin M proteins are preferably produced by recombinant DNA techniques. For example, a nucleic acid molecule encoding the protein is cloned into an expression vector (as described above), the expression vector is introduced into a host cell (as described above) and the cystatin M protein is expressed in the host cell. The cystatin M protein can then be isolated from the cells by an appropriate purification scheme using standard protein purification techniques. Alternative to recombinant expression, a cystatin M protein or polypeptide can be synthesized chemically using standard peptide synthesis techniques. Moreover, native cystatin M protein can be isolated from cells (e.g., cultured human mammary epithelial cells), for example using an anti-cystatin M antibody (discussed further below).
- cystatin M fusion proteins As used herein, a cystatin M “fusion protein” comprises a cystatin M polypeptide operatively linked to a non-cystatin M polypeptide.
- a “cystatin M polypeptide” refers to a polypeptide having an amino acid sequence corresponding to cystatin M
- a “non-cystatin M polypeptide” refers to a polypeptide having an amino acid sequence corresponding to another protein.
- the term "operatively linked” is intended to indicate that the cystatin M polypeptide and the non-cystatin M polypeptide are fused in-frame to each other.
- the non- cystatin M polypeptide may be fused to the N-terminus or C-terminus ofthe cystatin M polypeptide.
- the fusion protein is a GST-cystatin M fusion protein in which the cystatin M sequences are fused to the C-terminus ofthe GST sequences (see Example 3).
- Such fusion proteins can facilitate the purification of recombinant cystatin M.
- the fusion protein is a cystatin M protein containing a heterologous signal sequence at its N-terminus.
- the native cystatin M signal sequence i.e, about amino acids 1-21 can be removed and replaced with a signal sequence from another protein.
- expression and/or secretion of cystatin M may be increased through use of a heterologous signal sequence.
- a cystatin M fusion protein ofthe invention is produced by standard recombinant DNA techniques.
- DNA fragments coding for the different polypeptide sequences are ligated together in-frame in accordance with conventional techniques, for example employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation.
- the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers.
- PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al. John Wiley & Sons: 1992).
- anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence
- many expression vectors are commercially available that already encode a fusion moiety (e.g., a GST polypeptide).
- a cystatin M-encoding nucleic acid can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the cystatin M protein.
- cystatin M protein can be used as an immunogen to generate antibodies that bind cystatin M using standard techniques for polyclonal and monoclonal antibody preparation.
- the full-length cystatin M protein can be used or, alternatively, the invention provides antigenic peptide fragments of cystatin M for use as immunogens.
- the antigenic peptide of cystatin M comprises at least 8 amino acid residues ofthe amino acid sequence shown in SEQ ID NO: 2 and encompasses an epitope of cystatin M such that an antibody raised against the peptide forms a specific immune complex with cystatin M.
- the antigenic peptide comprises at least 10 amino acid residues, more preferably at least 15 amino acid residues, even more preferably at least 20 amino acid residues, and most preferably at least 30 amino acid residues.
- Preferred epitopes encompassed by the antigenic peptide are regions of cystatin M that are located on the surface ofthe protein, e.g., hydrophilic regions.
- a hydrophobicity analysis ofthe cystatin M protein sequence indicates three hydrophilic regions that are preferred for use as antigenic peptides: amino acid residues 22-49 (corresponding to the amino-terminus ofthe mature cystatin M protein), amino acid residues 90-104 and amino acid residues 1 12-126 of SEQ ID NO: 2.
- a cystatin M immunogen typically is used to prepare antibodies by immunizing a suitable subject, (e.g., rabbit, goat, mouse or other mammal) with the immunogen.
- An appropriate immunogenic preparation can contain, for examples, recombinantly expressed cystatin M protein or a chemically synthesized cystatin M peptide.
- the preparation can further include an adjuvant, such as Freund's complete or incomplete adjuvant, or similar immunostimulatory agent. Immunization of a suitable subject with an immunogenic cystatin M preparation induces a polyclonal anti-cystatin M antibody response. Accordingly, another aspect ofthe invention pertains to anti-cystatin M antibodies.
- antibody refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site which specifically binds (immunoreacts with) an antigen, such as cystatin M.
- the invention provides polyclonal and monoclonal antibodies that bind cystatin M.
- the term "monoclonal antibody” or “monoclonal antibody composition”, as used herein, refers to a population of antibody molecules that contain only one species of an antigen binding site capable of immunoreacting with a particular epitope of cystatin M. A monoclonal antibody composition thus typically displays a single binding affinity for a particular cystatin M protein with which it immunoreacts.
- Polyclonal anti-cystatin M antibodies can be prepared as described above by immunizing a suitable subject with a cystatin M immunogen (see also Example 4).
- the anti-cystatin M antibody titer in the immunized subject can be monitored over time by standard techniques, such as with an enzyme linked immunosorbent assay (ELISA) using immobilized cystatin M.
- ELISA enzyme linked immunosorbent assay
- the antibody molecules directed against cystatin M can be isolated from the mammal (e.g., from the blood) and further purified by well known techniques, such as protein A chromatography to obtain the IgG fraction.
- antibody-producing cells can be obtained from the subject and used to prepare monoclonal antibodies by standard techniques, such as the hybridoma technique originally described by Kohler and Milstein (1975, Nature 256:495-497) (see also, Brown et al. (1981) J. Immunol 127:539-46; Brown et al. (1980) J Biol Chem 255:4980-83; Yeh et al (1976) PNAS 76:2927-31; and Yeh et al. (1982) Int. J.
- an immortal cell line typically a myeloma
- lymphocytes typically splenocytes
- the culture supernatants ofthe resulting hybridoma cells are screened to identify a hybridoma producing a monoclonal antibody that binds cystatin M.
- Any of the many well known protocols used for fusing lymphocytes and immortalized cell lines can be applied for the pu ⁇ ose of generating an anti-cystatin M monoclonal antibody (see, e.g., G. Galfre et al.
- the immortal cell line e.g., a myeloma cell line
- murine hybridomas can be made by fusing lymphocytes from a mouse immunized with an immunogenic preparation ofthe present invention with an immortalized mouse cell line.
- Preferred immortal cell lines are mouse myeloma cell lines that are sensitive to culture medium containing hypoxanthine, aminopterin and thymidine ("HAT medium"). Any of a number of myeloma cell lines may be used as a fusion partner according to standard techniques, e.g., the P3-NSl/l-Ag4-l, P3-x63- Ag8.653 or Sp2/O-Agl4 myeloma lines. These myeloma lines are available from the American Type Culture Collection (ATCC), Rockville, Md. Typically, HAT-sensitive mouse myeloma cells are fused to mouse splenocytes using polyethylene glycol ("PEG").
- PEG polyethylene glycol
- Hybridoma cells resulting from the fusion are then selected using HAT medium, which kills unfused and unproductively fused myeloma cells (unfused splenocytes die after several days because they are not transformed).
- Hybridoma cells producing a monoclonal antibody ofthe invention are detected by screening the hybridoma culture supernatants for antibodies that bind cystatin M, e.g., using a standard ELISA assay.
- a monoclonal anti-cystatin M antibody can be identified and isolated by screening a recombinant combinatorial immunoglobulin library (e.g., an antibody phage display library) with cystatin M to thereby isolate immunoglobulin library members that bind cystatin M.
- Kits for generating and screening phage display libraries are commercially available (e.g., the Pharmacia Recombinant Phage Antibody System, Catalog No. 27-9400-01; and the Stratagene SurfZAPTM Phage Display Kit, Catalog No. 240612).
- examples of methods and reagents particularly amenable for use in generating and screening antibody display library can be found in, for example, Ladner et al. U.S. Patent No. 5,223,409; Kang et al. International Publication No. WO 92/18619; Dower et al. International Publication No. WO 91/17271 ; Winter et al. International Publication WO 92/20791 ; Markland et al. International Publication No. WO 92/15679; Breitling et al. International Publication WO 93/01288; McCafferty et al. International Publication No. WO 92/01047; Garrard et al. International Publication No.
- WO 92/09690 Ladner et al International Publication No. WO 90/02809; Fuchs et al. (1991) Bio/Technology 9:1370-1372; Hay et al. (1992) Hum Antibod Hybridomas 3:81-85; Huse et al. (1989) Science 246:1275-1281 ; Griffiths et al. (1993) EMBO J 12:725-734; Hawkins et al. (1992) J Mol Biol 226:889-896; Clarkson et al (1991) Nature 352:624-628; Gram et al. (1992) PNAS 89:3576-3580; Garrad et al.
- recombinant anti-cystatin M antibodies such as chimeric and humanized monoclonal antibodies, comprising both human and non-human portions, which can be made using standard recombinant DNA techniques, are within the scope ofthe invention.
- Such chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art, for example using methods described in Robinson et al. International Patent Publication PCT/US86/02269; Akira, et al. European Patent Application 184,187; Taniguchi, M., European Patent Application 171 ,496;
- An anti-cystatin M antibody (e.g., monoclonal antibody) can be used to isolate cystatin M by standard techniques, such as affinity chromatography or immunoprecipitation (see e.g., Example 4).
- An anti-cystatin M antibody can facilitate the purification of natural cystatin M from cells and of recombinantly produced cystatin M expressed in host cells.
- an anti-cystatin M antibody can be used to detect cystatin M protein (e.g., in a cellular lysate or cell supernatant). Detection may be facilitated by coupling (i.e., physically linking) the antibody to a detectable substance.
- detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials and radioactive materials.
- suitable enzymes include horseradish peroxidase, alkaline phosphatase, ⁇ -galactosidase, or acetylcholinesterase
- suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin
- suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin
- an example of a luminescent material includes luminol
- suitable radioactive material include 125 I, 13 'i, 35 S or 3 H.
- compositions suitable for administration can be inco ⁇ orated into pharmaceutical compositions suitable for administration.
- compositions typically comprise the protein or antibody and a pharmaceutically acceptable carrier.
- pharmaceutically acceptable carrier is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and abso ⁇ tion delaying agents, and the like, compatible with pharmaceutical administration.
- the use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be inco ⁇ orated into the compositions.
- solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose.
- a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents
- antibacterial agents such as benzyl alcohol or methyl parabens
- antioxidants such as ascorbic acid or sodium bisulfite
- chelating agents such as ethylene
- compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
- suitable carriers include physiological saline, bacteriostatic water, Cremophor EL *M (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists.
- the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof.
- the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance ofthe required particle size in the case of dispersion and by the use of surfactants.
- Prevention ofthe action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, ehlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
- isotonic agents for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition.
- Prolonged abso ⁇ tion ofthe injectable compositions can be brought about by including in the composition an agent which delays abso ⁇ tion, for example, aluminum monostearate and gelatin.
- Sterile injectable solutions can be prepared by inco ⁇ orating the active compound (e.g. , a cystatin protein or anti-cystatin antibody) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
- the active compound e.g. , a cystatin protein or anti-cystatin antibody
- dispersions are prepared by inco ⁇ orating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above.
- the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder ofthe active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
- Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the pu ⁇ ose of oral therapeutic administration, the active compound can be inco ⁇ orated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part ofthe composition.
- the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
- a binder such as microcrystalline cellulose, gum tragacanth or gelatin
- an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch
- a lubricant such as magnesium stearate or Sterotes
- a glidant such as colloidal silicon dioxide
- the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
- a controlled release formulation including implants and microencapsulated delivery systems.
- Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art.
- the materials can also be obtained commercially from Alza Co ⁇ oration and Nova Pharmaceuticals, Inc.
- Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These may be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.
- Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
- the specification for the dosage unit forms ofthe invention are dictated by and directly dependent on (a) the unique characteristics ofthe active compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active compound for the treatment of individuals.
- cystatin M exhibits cysteine proteinase inhibitory activity. Accordingly, cystatin M is useful as a cysteine proteinase inhibitor, either in vitro or in vivo.
- the isolated nucleic acid molecules ofthe invention can be used to express cystatin M protein (e.g., via a recombinant expression vector in a host cell), to detect cystatin M mRNA (e.g., in a biological sample) and to modulate cystatin M activity, as discussed further below.
- the anti- cystatin M antibodies ofthe invention can be used to detect and isolate cystatin M protein and modulate cystatin M activity, also discussed further below.
- the invention provides a method for detecting the presence of cystatin M in a biological sample.
- the method involves contacting the biological sample with an agent capable of detecting cystatin M protein or mRNA such that the presence of cystatin M is detected in the biological sample.
- a preferred agent for detecting cystatin M mRNA is a labeled or labelable nucleic acid probe capable of hybridizing to cystatin M mRNA.
- the nucleic acid probe can be, for example, the full-length cystatin M cDNA of SEQ ID NO: 1, or a portion thereof, such as an oligonucleotide of at least 15, 30, 50, 100, 250 or 500 nucleotides in length and sufficient to specifically hybridize under stringent conditions to cystatin M mRNA.
- a preferred agent for detecting cystatin M protein is a labeled or labelable antibody capable of binding to cystatin M protein.
- Antibodies can be polyclonal, or more preferably, monoclonal. An intact antibody, or a fragment thereof (e.g., Fab or F(ab')2) can be used.
- the term "labeled or labelable", with regard to the probe or antibody, is intended to encompass direct labeling ofthe probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, as well as indirect labeling ofthe probe or antibody by reactivity with another reagent that is directly labeled.
- Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin such that it can be detected with fluorescently labeled streptavidin.
- biotin a biological sample
- biological sample is intended to include tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject. That is, the detection method ofthe invention can be used to detect cystatin M mRNA or protein in a biological sample in vitro as well as in vivo.
- in vitro techniques for detection of cystatin M mRNA include Northern hybridizations and in situ hybridizations.
- cystatin M protein can be detected in vivo in a subject by introducing into the subject a labeled anti-cystatin M antibody.
- the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.
- the biological sample is a tumor sample.
- the tumor sample may comprise tumor tissue or a suspension of tumor cells.
- a tissue section for example, a freeze-dried or fresh frozen section of tumor tissue removed from a patient, can be used as the tumor sample.
- the tumor sample may comprise a biological fluid obtained from a tumor-bearing subject. Since cystatin M contains a signal sequence and is detectable in culture supernatants of a primary mammary epithelial tumor cell line (see the Examples), the protein is thought to be secreted and thus is likely to be detectable in biological fluids. Following collection, tumor samples can be stored at temperatures below -20°C to prevent degradation until the detection method is to be performed.
- a preferred tumor sample in which cystatin M mRNA or protein is to be detected is a mammary tumor sample.
- the detection methods ofthe invention described above can be used as the basis for a method of diagnosis of a subject with a tumor.
- the expression pattern of cystatin M mRNA can differ between normal cells and malignant cells and between primary tumor cells and metastatic tumor cells.
- cystatin M mRNA levels are detectable in several normal mammary epithelial cell lines, elevated in several primary mammary epithelial tumor cell lines and undetectable in several metastatic mammary epithelial tumor cell lines.
- Immunoprecipitation experiments indicate that the cystatin M protein expression pattern mimics the mRNA expression pattern.
- cystatin M mRNA is expressed in many normal non-mammary tissues (such as lung, pancreas, ovaries and prostate) and undetectable in many malignant non-mammary tissues (including tumor cells from lung, pancreas, ovaries and prostate).
- the invention provides a diagnostic method comprising: contacting a tumor sample from a subject with an agent capable of detecting cystatin M protein or mRNA; determining the amount of cystatin M protein or mRNA expressed in the tumor sample; comparing the amount of cystatin M protein or mRNA expressed in the tumor sample to a control sample; and forming a diagnosis based on the amount of cystatin M protein or mRNA expressed in the tumor sample as compared to the control sample.
- the control is from normal cells and the tumor sample is a suspected primary tumor sample.
- Primary malignancy ofthe tumor cell sample can be diagnosed based on an increase in the level of expression of cystatin M mRNA or protein in the tumor sample as compared to the control.
- the control is from normal cells or a primary tumor and the tumor sample is a suspected metastatic tumor sample. Acquisition of the metastatic phenotype by the suspected metastatic tumor sample can be diagnosed based on a decrease in the level of, or absence of, cystatin M mRNA or protein in the tumor sample compared to the control.
- kits for detecting the presence of cystatin-M in a biological sample e.g., a tumor sample
- the kit can comprise a labeled or labelable agent capable of detecting cystatin M protein or mRNA in a biological sample; means for determining the amount of cystatin M in the sample; and means for comparing the amount of cystatin M in the sample with a standard.
- the agent can be packaged in a suitable container.
- the kit can further comprise instructions for using the kit to detect cystatin M mRNA or protein.
- Another aspect ofthe invention pertains to methods of modulating cystatin M cysteine proteinase inhibitory activity associated with a cell, e.g. , for therapeutic pu ⁇ oses.
- Cystatin M cysteine proteinase inhibitory (CPl) activity "associated with a cell” is intended to include cystatin M CPl activity within the cell, secreted by the cell and in the extracellular milieu surrounding the cell.
- the modulatory method ofthe invention involves contacting the cell with an agent that modulates cystatin M cysteine proteinase inhibitory (CPl) activity associated with the cell.
- the agent stimulates cystatin M cysteine proteinase inhibitory activity.
- Such stimulatory agents include active cystatin M protein and a nucleic acid molecule encoding cystatin M that has been introduced into the cell.
- the agent inhibits the cystatin M CPl activity .
- inhibitory agents include antisense cystatin M nucleic acid molecules and anti-cystatin M antibodies.
- Stimulation of cystatin M CPl activity is desirable in situations in which cystatin M is abnormally downregulated and/or in which increased cystatin M activity is likely to have a beneficial effect.
- One example of such a situation is in tumor cells, and in particular in inhibiting or preventing tumor cell metastasis.
- acquisition of a metastatic phenotype by tumor cells is associated with downregulation of cystatin M expression.
- increasing the expression and/or activity of cystatin M in or around the tumor cells is expected to inhibit the development or progression ofthe metastatic phenotype.
- the invention provides a method for inhibiting development or progression of a metastatic phenotype in a tumor cell comprising contacting the tumor cell with an agent which elevates the amount of cystatin M in or around the tumor cell.
- the term "in or around the tumor cell” is intended to include cystatin M within the cell, secreted by the cell and in the extracellular milieu surrounding the cell.
- the agent that elevates cystatin M in or around the tumor cell can be cystatin M protein itself. For example, since cystatin M is a secreted protein, it is likely that it exerts tumor suppressive effects extracellularly.
- cystatin M preferably in a pharmaceutically acceptable carrier, can be administered to a tumor-bearing subject by an appropriate route to inhibit the development or progression ofthe metastatic phenotype of the tumor.
- Suitable routes of administration include intravenous, intramuscular or subcutaneous injection, injection directly into the tumor site or implantation of a device containing a slow-release formulation.
- the cystatin M preparation can also be inco ⁇ orated into liposomes or other carrier vehicles to facilitate delivery to the tumor site.
- a non- limiting dosage range is 0.001 to 100 mg/kg/day, with the most beneficial range to be determined by routine pharmacological methods.
- cystatin M protein Alternative to administration of cystatin M protein itself, the development or progression ofthe metastatic phenotype can be inhibited in tumor cells by modifying them to express cystatin M by introducing into the tumor cells a nucleic acid encoding cystatin M (e.g. , via a recombinant expression vector).
- Expression vectors suitable for gene therapy including retroviral and adenoviral vectors carrying appropriate regulatory elements, can be used to deliver the cystatin M-encoding nucleic acid to the tumor cells.
- cystatin M protein or DNA can be evaluated using in vivo and in vitro assays known in the art.
- a suitable in vivo assay utilizes the mammary epithelial tumor cell line MDA- MB-435, which forms tumors at the site of orthotopic injection and metastasizes in nude mice (described further in Price et al. (1990) Cancer Res. 50:717).
- MDA-MB-435 cells which do not express detectable cystatin M mRNA, can be transfected with a cystatin M expression vector and stable transfectants can be selected (described further in Example 7). These transfectants can then be injected into nude mice.
- mice are sacrificed and their tumors are excised and weighed to determine the effect of cystatin M expression on tumor progression and metastasis.
- a suitable in vitro assay is tumor cell invasion through reconstituted basement membrane matrix (e.g., Matrigel) as described in Hendrix et al. ( 1987) Cancer Letters 38:137.
- the invasive ability of cystatin M-transfected MDA-MB-435 cells can be compared to untransfected MDA-MB-435 cells to determine the effect of cystatin M expression on tumor invasiveness.
- cystatin M CPl activity may be desirable.
- Other members ofthe Family 2 cystatins, or portions thereof, have been shown to have anti-bacterial and/or anti-viral activity.
- cystatin C and a tripeptide derivative thereof have been shown to inhibit he ⁇ es simplex virus replication (Bjorck, L et al. (1990) J. Virol. 64:941-943).
- the same tripeptide derivative has been shown to block the growth of several bacterial strains (Bjorck, L et al. (1989) Nature 337:385-386).
- Antiviral effects have also been reported for chicken cystatin C (see e.g. , U.S. Patent No.
- cystatin M may be useful as an anti-bacterial and/or anti-viral agent.
- Cystatins have also been reported to have a therapeutically beneficial effect in periodontal disease (see e.g., Lah, T.T. (1993) J. Periodontol 64:485-491), in reducing dental caries (see e.g., PCT International Publication No. WO 94/15578 by Revis et al ) and in the treatment of gastrointestinal ulcers (see e.g. , U.S. Patent No. 4,891,356 and PCT International Publication No.
- cystatin M administered as a mouthwash or oral formulation, may be useful in treating gingivitis, dental caries or gastrointestinal ulcers.
- Cystatins also have been reported to protect plants from various pests (e.g., parasites, helminths, protozoans) (see e.g. , PCT International Publication No. WO 95/23229 by Atkinson et al. and EP 348 348 by Fowler et al).
- cystatin M also may have agricultural use in combating plant pests.
- cystatin M activity is decreased using an inhibitory method ofthe invention.
- cystatin mRNA expression is markedly upregulated in senescent cells.
- inhibiting the expression or activity of cystatin M in cells may be useful for inhibiting or delaying the onset of senescence in the cells.
- the in vitro growth of particular cells which normally undergo senescence in culture could be maintained and prolonged by the use of cystatin M inhibitory agents to inhibit or delay the onset of senescence in the cells.
- the invention still further provides a method for identifying modulators of cystatin M expression or cysteine proteinase inhibitory (CPl) activity.
- modulators of cystatin M CPl activity are identified in a method wherein cystatin M, a cysteine proteinase, a substrate for the cysteine proteinase and a test substance are incubated under conditions suitable for the cysteine proteinase to cleave the substrate. Cleavage ofthe substrate is then measured and the amount of cleavage ofthe substrate in the presence of the test substance is compared to the amount of cleavage ofthe substrate in the absence ofthe test substance. The test substance can then be identified as a modulator of cystatin M CPl activity based on this comparison.
- the test substance when the amount of cleavage ofthe substrate in the presence ofthe test substance is less than the amount of cleavage ofthe substrate in the absence ofthe test substance, the test substance can thereby be identified as a stimulator ofthe CPl activity of cystatin M.
- the test substance when the amount of cleavage ofthe substrate in the presence ofthe test substance is greater than the amount of cleavage ofthe substrate in the absence ofthe test substance, the test substance can thereby be identified as an inhibitor ofthe cysteine proteinase inhibitory activity of cystatin M.
- a preferred cysteine proteinase for use in the method is papain.
- a preferred substrate for papain is the fluorogenic synthetic substrate Z-Phe- Arg-MCA.
- modulators of cystatin M expression are identified in a method wherein a cell is contacted with a test substance and the expression of cystatin M mRNA or protein in the cell is determined. The level of expression of cystatin M mRNA or protein in the presence ofthe test substance is compared to the level of expression of cystatin M mRNA or protein in the absence ofthe test substance. The test substance can then be identified as a modulator of cystatin M expression based on this comparison. For example, when expression of cystatin mRNA or protein is greater in the presence ofthe test substance than in its absence, the test substance is identified as a stimulator of cystatin M mRNA or protein expression.
- cystatin M mRNA or protein expression when expression of cystatin mRNA or protein is less in the presence ofthe test substance than in its absence, the test substance is identified as an inhibitor of cystatin M mRNA or protein expression.
- the level of cystatin M mRNA or protein expression in the cells can be determined by methods described above for detecting cystatin M mRNA or protein.
- a partial cDNA erfcoding human cystatin M was first isolated by differential expression cloning using the differential display (DD) method.
- the partial cDNA was used as a hybridization probe in Northern blots to confirm the differential expression of cystatin M mRNA in a primary mammary epithelial tumor cell line as compared to a metastatic cell line derived from the same patient.
- the partial cDNA was then used as a probe to isolate a full-length cDNA, the sequence of which was then determined and analyzed.
- RNAs expressed by a primary mammary epithelial tumor cell line, 21PT, and a metastatic cell line, 21MT-1, derived from the same patient were compared by DD. These cell lines are described further in Band, V. et al. (1990) Cancer Res. 50:7351- 7357. The differential display method is described further in Liang, L. and Pardee, A.B. (1992) Science 257:967-970 and in Sager, R. et al. (1993) FASEB J. 7:964-970. Total cellular RNA was isolated from exponentially growing cultures ofthe 21PT and 21MT-1 cell lines by standard techniques.
- RNA was extracted with phenol/chloroform, precipitated with ethanol and redissolved in DEPC-treated water. Purified total RNA was subsequently reverse transcribed using a 3'-anchoring primer T12MA (where M is degenerate for G, C, or A). The resultant partial cDNAs were amplified by PCR using
- T12MA as the 3' primer and an arbitrary 10-mer, OM6 (Operon Technologies, Inc.) as the 5' primer in the presence of [35s]dATP.
- the PCR products were compared side-by-side on a 6% acrylamide sequencing gel as 35s-labelled partial cDNA fragments corresponding to the 3 '-end ofthe mRNAs.
- Each lane contained 50-100 bands, most of which are identical in size and intensity between the two cell populations. A small number of bands ( ⁇ l-2%) appeared in only one ofthe cell lines.
- one differentially displayed cDNA of about 0.3 kb, named 6A2 was seen in the primary tumor cells 21PT but was absent in the metastatic tumor cells 21MT-1.
- the band corresponding to 6A2 was recovered from the dried gel, reamplified by PCR, 32 P-labeled by the oligo-labeling method (Freinberg, A.P., and Vogelstein, B.A. (1983) Anal. Biochem. 132: 6) and used as a probe for hybridization of Northern blots containing RNA from 21PT and 21MT-1. A transcript of 0.6 kb was differentially expressed in 21 PT as compared to 21MT-1.
- the 6A2 partial cDNA obtained from DD was reamplified by PCR, cloned into the PCRII vector using the TA cloning system (Invitrogen) and sequenced on both strands with T7 and SP6 primers.
- a cDNA library from the human mammary epithelial tumor cell line 21PT, constructed in Lambda Zap II (Stratagene, San Diego, CA) was screened according to standard cDNA library screening methods using the cloned PCR product as a probe. Several full-length cDNA clones were isolated.
- the full-length nucleotide sequence and deduced amino acid sequence ofthe cystatin M clone 6A2-17 are shown in Figure 1 and in SEQ ID NOs: 1 and 2, respectively. Assuming that translation starts at the first ATG codon which lies in a Kozak consensus sequence, the full-length 6A2-17 cDNA clone contains an open reading frame of consisting of 447 nucleotides (24-470), a short 5 '-untranslated sequence (1-23), and a 3 '-untranslated sequence of 128 nucleotides, with a polyadenylation signal (AAT AAA) (552-557) and a poly A tail.
- AAT AAA polyadenylation signal
- the partial 6A2 cDNA originally obtained from DD corresponds to nt 299- 598.
- the amino acid sequence inferred from the nucleotide sequence ofthe full-length cDNA encodes a protein of 149 amino acid residues long with four cysteine residues towards its carboxy terminal domain.
- the first ATG codon is probably the major transcription start site, since the translated sequence aligns optimally with other human cystatins. In contrast, intemal ATGs do not lie in a fair Kozak consensus.
- the BLAST algorithm via Autosearch was used for nucleic acid sequence comparisons. Protein sequence comparisons were performed on GCG with final alignments on PILEUP and PRETTYPLOT (Altschul, S.F. et al. (1990) J. Mol Biol.
- Figure 2 depicts a comparison by the PILEUP and PRETTYPLOT programs ofthe primary sequence of cystatin M preprotein with those of other Family 2 human cystatins; chicken cystatin was included in this alignment because its stmcture and function have been studied extensively.
- cystatin C A33400
- cystatin D A47142
- cystatin S SI 7667
- Cystatin M like all other members ofthe family, shares all three conserved domains, including a conserved glycine near the N-terminal domain, Gly-36 of cystatin M preprotein (Gly-11 of mature cystatin C and Gly-9 of mature chicken cystatin).
- Cystatin M also contains two other structural motifs associated with cysteine proteinase inhibitory activity: the 'QXVXG' motif in the middle ofthe molecule, QLVAG in cystatin M (QIVAG in cystatin C, QLVSG in chicken cystatin), as well as the VPW sequence near the carboxy terminal, which is also conserved in all known cystatins. Additionally, all previously characterized members ofthe cystatin Family 2 contain about 120 amino acid residues with four cysteine residues near the carboxy terminal domain. These cysteine residues participate in the formation of two intrachain disulfide bridges, a characteristic structural feature ofthe family.
- Cystatin M indeed contains four cysteine residues near the carboxy terminal domain: cys-98, cys-113, cys-126 and cys-146.
- the overall homology between cystatin M and other cystatin preproteins ranges from 30 to 40% for conserved amino acid residues and 25 to 33% for identical amino acids.
- the highest homology at the nucleotide level is 40-45% to human cystatins and 42% to chicken cystatin.
- a total of 30 amino acid residues are conserved and 23 residues (15%) are identical between all members of Family 2 cystatins and chicken cystatin, while 52 amino acids (30%) are identical in six out of seven proteins.
- Cystatin M and chicken cystatin share 48 identical amino acid residues.
- cystatin M The overall homology of cystatin M to cystatin A and cystatin B is 25%. The homology between cystatins from different species including chicken, mouse, rat, puff adder, and is 39-48 % for conserved amino acid residues (alignment not shown in Figure 2).
- the novel cystatin M displays all the characterized structural features of human cystatins, and can be considered a new member ofthe family. Following the internationally accepted nomenclature proposal (Barrett, A.J. et al (1986) Biochem. J. 236:312), this novel cystatin was designated cystatin M, because it was cloned from Mammary epithelial cells. Cystatin C appears the closest homolog to cystatin M.
- the two proteins share 33% identical and 38% conserved amino acid residues.
- a Hopp and Woods hydrophilicity plot ofthe cystatin M protein sequence revealed the presence of a hydrophobic sequence consisting of 20 residues close to the initiation methionine which could function as a secretory signal peptide. It contains only one eharged amino acid in the N-terminal region (arginine at position 3) and a cysteine at position 18. The signal peptide indicates that this protease inhibitor is synthesized as a precursor protein and probably has extracellular function(s).
- Cleavage of precystatin M is predicted to occur at position 21/22, with alanine at position -1 and leucine at position -3 from the cleavage site, both residues with small and uncharged side chains, resulting in mature cystatin M consisting of 127 amino acid residues.
- Leu-22 thus would be the putative N-terminal residue of the mature/secreted protein, although more than one native isoform differing in the length ofthe N-terminal sequence might exist, as has been reported for other cystatins.
- the predicted Mr for the precursor protein is 16,500, if the protein is not modified (e.g., not glycosylated or phosphorylated) and approximately 14,300 for the putative mature protein.
- cystatin M gene To analyze the stmcture ofthe cystatin M gene, genomic DNAs were digested with restriction enzymes (EcoRI, Hindlll, PvuII, Ncol) and hybridized with a cystatin cDNA probe by standard methods. A single major band hybridizing with the cystatin M cDNA probe was detected in a series of normal and tumor mammary epithelial cell lines with both EcoRI ( ⁇ 7.0 kb) and Hindlll ( ⁇ 15.0 kb) total genomic digests. Based on these results, the cystatin M gene does not appear grossly rearranged or deleted in tumor cell lines.
- restriction enzymes EcoRI, Hindlll, PvuII, Ncol
- cystatin M mRNA in various cell lines and tissues was examined by standard Northern hybridization using the cystatin M cDNA as a probe.
- Total cellular RNA was purified by standard guanidinium isothiocyanate and cesium chloride centrifugation.
- 36B4 a gene encoding a ribosomal protein whose expression is not affected by growth conditions or estrogen receptor expression, was used (Masiakowski, P. et al. (1982) Nucl. Acids Res. 10: 7895-7903).
- Densitometric scans of autoradiographs were obtained with an imaging densitometer (BioRad GS-700) using the Molecular Analyst® software.
- cystatin M mRNA was examined in exponentially growing, subconfluent normal and tumor mammary epithelial cell lines.
- Cell lines examined included normal human mammary epithelial cell strains (8 IN, 76N, and 70N) derived from reduction mammoplasty specimens, primary (2 INT, 21PT), and metastatic (21MT-1, 21MT-2) tumor cell lines from the same patient and established in long-term culture, and metastatic tumor mammary epithelial cell lines MCF7, BT474,
- BT549, T47D, ZR-75-1, MDA-MB-157, MDA-MB-231 , MDA-MB-361, MDA-MB-435, and MDA-MB-436 obtained from the American Tissue Culture Collection (ATCC/Rockville, MD).
- Immortal mammary epithelial cells were obtained by transfection of 76N cells with a plasmid containing the human papilloma vims (HPV)- 16 E6 gene (Band, V. et al, (1991) J. Virol. 65:6671-6676).
- FIG. 3 Representative results of the Northern blot analysis of cystatin M expression in normal and tumor human mammary epithelial cell lines are shown in Figure 3. Each lane contains 15 ⁇ g of total cellular RNA from normal and tumor cells. The blot was hybridized with a 32p_iabeled full-length cystatin M cDNA probe. Hybridizations were performed in formamide at 37 °C ovemight. The blot was washed at 65 °C for 1 hour in 2 X SSC containing 0.1% SDS. The filter then was stripped and rehybridized to a 36B4 probe as a loading control.
- cystatin M mRNA was detected in all three normal cell strains tested, 76N, 70N, and 8 IN, but was absent in many metastatic mammary tumor cell lines: 21MT-1, 3BT479, MCF7, ZR-75, Hs578T, T47D, BT474, BT549, MDA-MB-157, MDA-MB-361, MDA-MB-435, MDA-MB-436 (trace transcript levels were detected in MDA-MB-231). Downregulation of cystatin M mRNA in tumor cells does not seem to correlate with the estrogen receptor status.
- cystatin M mRNA levels in human papilloma vims-immortalized normal 76N cells are comparable to the levels of its expression in the corresponding normal cells.
- the expression ofthe cystatin M mRNA also was examined in a panel of tumor cell lines from non-mammary tissues.
- Cystatin M mRNA was not detected in the following tumor cell lines: PC-3 (prostate adenocarcinoma; ATCC# CRL1435); MIA Pa-CA-2 (pancreatic carcinoma; ATCC# CCL1420); HuTu 80 (duodenal adenocarcinoma); T24 (bladder transitional cell carcinoma); A549 (lung carcinoma; ATCC# CCL185); Calu-1 (lung epidermoid carcinoma); Oat 4 (lung small cell carcinoma); G-361 (malignant melanoma); SKME 30 (malignant melanoma); A2058 (malignant melanoma); SCC-25 (tongue squamous cell carcinoma); RD (rhabdomyosarcoma of pelvis); and Kaposi (Kaposi's sarcoma). Trace amount of cystatin M mRNA were detected in WiDr (ATCC# CCL218) and S W480 (ATCC# 228), both colon adenocarcinomas.
- each lane contains approximately 2 ⁇ g of pure poly A+ RNA from the following human tissues: heart, brain placenta, lung, liver, skeletal muscle, kidney, pancreas (lanes 1,2,3,4,5,6,7, and 8, respectively).
- the RNAs were n on a denaturing formaldehyde/ 1.2% agarose gel and blotted onto a nylon membrane (Human MTN Blot, Clontech, #7760-1). The blot was hybridized to a probe corresponding to the full length cDNA ofthe cystatin M gene. Then, the filter was stripped and hybridized to a 36B4 probe as a loading control.
- the blot was washed at 65 °C for 1 hour in 2xSSC containing 0.1% SDS. Numbers in the left margin refer to the sizes ofthe molecular weight markers. Relatively high levels of 6A2 mRNA were present in various tissues, including placenta, lung, skeletal muscle, kidney and pancreas, although the sizes of the transcripts detected in skeletal muscle and kidney were larger. A second transcript of slightly larger size was detectable in all the above tissues. The abundance ofthe message was much lower in heart, while trace amounts were detectable in liver. Whether cystatin M is expressed in brain tissue cannot be determined from the blot shown in Figure 4, since the brain RNA on this blot is underloaded. Additionally, no expression of cystatin M mRNA was observed in normal breast fibroblasts (56NF cells; see Figure 3), normal foreskin fibroblasts (FS3 cells) or normal leukocytes (see Figure 3).
- 76N cells from passages 15-22 were collected for RNA preparation at approximately 75 % confluency.
- Cells from passage 19 and after are considered replicatively senescent, since they show a nuclear labeling index of 12 % or less and can no longer achieve a single population doubling over a time span of 2-3 weeks.
- the labeling index of mid-lifespan (passage 1 1-12) 76N cells is 22-25 % in S-phase (1 hour pulse). At passage 22, which is equivalent to 50-60 population doublings, cells can no longer be passaged and cultured for RNA isolation.
- Figure 5A shows Northern blots containing 10 ⁇ g of total RNA from quiescent and senescent 76N cells per lane.
- the blot was initially hybridized to a full-length cystatin M cDNA and, subsequently, to loading control probe 36B4.
- levels of cystatin M expression were normalized against 36B4 control, and are presented in Figure 5B as a bar graph depicting the ratio of cystatin M/36B4.
- Tritium uptake for the quiescent series was calculated in cpm/cell, and is given at the bottom across the x-axis.
- cystatin M is greatly reduced in quiescent cells as compared to replicatively senescent cells.
- Cystatin M mRNA level is slightly reduced in quiescent cells compared to subconfluent, actively dividing early- passage 76N cells. Cystatin M expression increases about 10-fold in senescent cells between passages 19-22 that correspond to the end ofthe lifespan of these cells. Accumulation ofthe cystatin M message is more dramatic at passage 22. The 10-fold accumulation of cystatin M mRNA in senescent cells was confirmed with a serially passaged 76N senescent cell series from an independent experiment.
- cystatin M was expressed as a recombinant glutathione-S- transferase (GST) fusion protein in Escherichia coli and the fusion protein was isolated and characterized.
- GST glutathione-S- transferase
- the cystatin M open reading frame cDNA sequence encoding the putative mature protein (Leu22-Metl49) was amplified by PCR using a sense primer having the nucleotide sequence: 5'-GGAATTCTGCCACGAGATGCCCGGGC-3' (SEQ ID NO: 3), and an antisense primer having the nucleotide sequence: 5'- CCCTCGAATTCTTATCACAT CTGCAC-3' (SEQ ID NO: 4).
- This pair of gene-specific synthetic oligonucleotides correspond to the sequences on the sense strand upstream ofthe ATG start site and to the antisense strand downstream to the stop codon.
- the N-terminal amino acid consists ofthe residue Leu-22.
- the amplified region ofthe cDNA sequence does not contain the hydrophobic signal peptide of cystatin M.
- These 26-mer oligonucleotide primers were designed to create EcoRI overhangs on the resultant PCR product, thereby allowing for cloning ofthe PCR product into an EcoRI site.
- the amplification included two initial cycles at low stringency (42 °C) and thirty-eight cycles at higher stringency (60 °C).
- the amplified product was sequenced to ensure that it contained no PCR-induced mutations.
- the PCR product was then digested with EcoRI and ligated into the pGEX-2T vector that was EcoRI-digested and linearized (Pharmacia Biotech Inc.) (Smith, D.B. and Johnson, K.S. (1988) Gene 67:31-40).
- This resulted in the expression plasmid pG ⁇ X-2T/cystatin M encoding a fusion protein comprising, from the N-terminus to the C-terminus: GST-a thrombin cleavage site-cystatin M.
- coli XL-1 Blue bacteria (Stratagene, La Jolla, CA) were transformed with either the parental vector (pGEX-2T) or the recombinant vector (pGEX-2T/cystatin M) and propagated in Luria Broth (LB) (Sambrook, J., Fritsch, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989) in the presence of 100 ⁇ g/ml ampicillin for selection ofthe cells transformed with the vector.
- LB Luria Broth
- the bacteria were harvested by centrifugation, washed twice with MTPBS and resuspended in lysis buffer, MTPBS (150 mM NaCl, 16 mM Na2HPO4, 4mM NaH PO4 pH 7.4) containing 1 mM DTT, 1 mM PMSF, and 2 % Triton X-l 00.
- Cells were lysed on ice by mild sonication and the suspension was centrifuged at 14.500xg for 15 min to remove unlysed cells. All subsequent purification steps were carried out at 4 °C.
- the recombinant fusion protein was purified from crude bacterial lysates by affinity chromatography on glutathione agarose resin (Sigma Chemical Co., St. Louis, MO). The clear bacterial lysate was collected and bound by glutathione agarose beads. The glutathione column was washed with MTPBS containing 350 mM NaCl and the fusion protein was eluted with 50 mM Tris. HCl pH 8.0 containing 5 mM reduced glutathione. Purified rGST-Cystatin M was dialyzed against MTPBS containing 10% glycerol, sterilized by filtration through 0.22 ⁇ m filters (Costar, Cambridge, MA), and stored at -20 °C.
- the concentration ofthe purified protein was determined by Bradford assay (BioRad) using ⁇ - globulin as a standard.
- the fusion protein (rGST-cystatin M) was sufficiently soluble to be purified from cmde bacterial lysates by affinity chromatography on a glutathione -affinity column under non-denaturing conditions with estimated yield of approximately 3-5 mg per liter of bacterial culture.
- the protein composition ofthe lysate was analyzed by SDS-PAGE.
- the reagents for protein SDS-PAGE analysis and protein concentration determination were purchased from BioRad, Hercules, CA.
- Lane 1 shows lysates from cells transformed with the parental pGEX-2T vector.
- Lane 2 shows the material from the pGEX- 2T lysate that bound to the glutathione-agarose resin.
- Lane 3 shows lysates from cells transformed with the pGEX-2T/cystatin M expression vector.
- Lane 4 shows the material from the pGEX-2T/cystatin M lysate that bound to the glutathione-agarose resin.
- Thrombin treatment was carried out at room temperature in the presence of 150 mM NaCl, 2.1 mM CaCl2, with 1 ⁇ g/ ⁇ l fusion protein and 3.2 NIH thrombin units/ml for about 2 hours.
- the reaction was stopped with 0.1 mM EGTA and cleavage was monitored by SDS-PAGE.
- the rCystatin M was further purified by abso ⁇ tion of rGST and any traces of uncleaved rGST-cystatin M on immobilized glutathione.
- the thrombin-cleaved material was analyzed by SDS-PAGE, the results of which are shown in Figure 6, lanes 5-8, which shown the cleavage products after thrombin treatment for 0, 2, 30 or 90 minutes, respective.
- the rCystatin M cleaved from the fusion protein was resolved on a reducing SDS gel as a single band with a M(r) of approximately 14 kDa.
- a polyclonal antisera was raised against the recombinant GST- cystatin M fusion protein described in the previous example.
- the purified fusion protein was used to immunize New Zealand white rabbits 3-9 months old.
- Antiserum was recovered from the immunized animals and affinity-purified, first on a GST-glutathione agarose column (to remove antibodies specific for the GST portion ofthe fusion protein) and then on a GST/Cystatin M-glutathione agarose column (to select for antibodies specific for the cystatin M portion ofthe fusion protein) (as described in Krek, W. et al. (1993)
- the purified antibody was dialyzed against PBS containing 50% glycerol, and 0.02% NaN ⁇ was added, and stored at 4 °C.
- the anti-cystatin M antisera was used in immunoprecipitation and Western blot (immunoblot) experiments.
- lysis buffer 50 mM Tris pH 8.0, containing 120 mM NaCl, 0.5% Nonidet P-40, 5 ⁇ g/ml leupeptin, Na-ortho-vanidate, and 100 mM NaF. Lysed cells were rocked for 30 min, centrifuged at 14,000 x ⁇ m for 15 min, and the supernatants were assayed immediately. All steps were performed at 4 °C.
- proteins from cell culture were precipitated with trichloroacetic acid, resuspended in lysis buffer and analyzed by Western blotting.
- Protease inhibitors were added to the supernatants immediately after collection to prevent proteolytic degradation of cystatin M and were stored at -70 °C.
- proteins separated by SDS-PAGE were transferred to PDVF membrane (0.2 micron, BioRad) and reacted with polyclonal antiserum and preimmune serum.
- Anti-rabbit Ig horseraddish peroxidase linked, whole antibody was used as secondary antibody (1 :2000) and immunoreactive proteins were detected with the ECI system (enhanced chemiluminescence, Amersham).
- Transfer and quantitation of proteins were assessed by staining with 0.1 %w/v amidoblack in 25 % isopropanol and 10 % acetic acid and destained with 50 % methanol and 7.5 % acetic acid in H2O.
- Figure 7A illustrates Western blot detection of cystatin M protein levels in either the lysate (L) or supematant (S) from a normal human mammary epithelial cell line (70N), a primary mammary epithelial tumor cell line (21PT) or a malignant mammary epithelial tumor cell line (MDA435).
- FIG. 7B illustrates representative immunoprecipitates with preimmune semm (lanes 1 and 3) and with affinity- purified polyclonal antibody raised against rGST-cystatin M (lanes 2 and 4) from culture supernatants of 21PT cells (lanes 1 and 2) or MDA435 cells (lanes 3 and 4).
- the results of the immunoprecipitation experiments indicate the presence of a native immunoreactive protein in the supematant of 21 PT cells, but not MDA435 cells, whose size is consistent with the predicted size of cystatin M. mature protein, demonstrating that 21PT cells express and secrete a native protein corresponding in size and immunoreactivity to cystatin M.
- cystatin M to inhibit the cysteine proteinase activity of papain was examined.
- Papain isolated from papaya latex was purchased from Boehringer Mannheim.
- Papain activity was assayed at room temperature in 125 mM phosphate buffer, pH 6.8 containing 4 mM DTT, 1 mM EDTA, and 0.05% Brij 35 using the fluorogenic synthetic substrate Z-Phe-Arg-MCA (purchased from Sigma Chemical Co., St. Louis, MO).
- papain solutions (5-100 pM or 10 nM) were preincubated with increasing amounts of rGST- cystatin M (0-5 nM or 0-1 ⁇ M, prepared as described in Example 3), in a total volume of 50 ⁇ l, for 5 min at room temperature, then added to 2 ml assay buffer containing 2.5-150 ⁇ M Z-Phe-Arg-MCA substrate. The reaction mixture was stirred during the assay. The initial reaction rates were monitored for 1 -2 min by the increase in the intensity of relative fluorescence with a fluorimeter (Model SFM25, Kontron Instmments). The excitation and emission wavelengths were 380nm and 440nm, respectively.
- the amount of 7-amino-4- methylcoumarin liberated from the synthetic substrate was determined from a standard curve.
- concentration of active cysteine proteinase in the papain solution was determined by active-site titration with E-64 L-3-carboxy-tr ⁇ «s-2,3-epoxy-propionyl- leucylamido-(4-guanidino)butane (Barrett, A.J. and Kirschke, H. (1981) Meth. Enzymol. 80:535-561 ).
- the self-hydrolysis ofthe Z-Phe-Arg-MCA substrate was negligible for the applied reaction times.
- As a negative control the inhibitory effects of GST and BSA were tested under the same assay conditions.
- v is the initial reaction rate and was expressed by the increase of relative fluorescence intensity at 440 nm per im, with an excitation wavelength at 380 nm.
- Ki inhibition constants
- the Ki value corresponds to the inhibitor concentration at which the three lines intersect, with computer-aided linear regression, using Cricket graph. Linear regression coefficients were greater than 0.980. All determinations were based on assays with less than 1% substrate self-hydrolysis at the applied substrate concentration.
- a Ki value of 0.5 nM was estimated from Dixon plots of continuous and stopped flow assays at 100 pM papain, suggestive of tight binding of native cystatin M to papain.
- Lane 1 represents native cystatin M not treated with N-Glycosidase F.
- Lane 2 represents native cystatin M treated with N-Glycosidase F.
- Lane 3 represents cystatin M cleaved from the recombinant GST-cystatin M (rGST-cystatin M) fusion protein by thrombin.
- the proteins were immunoblotted with anti-rGST- cystatin M serum. Bound antibody was detected by ECL (Amersham). The molecular weights ofthe immunoreactive proteins were estimated based on their mobility relative to prestained molecular weight markers shown in kilobases on the left in Figure 9.
- Cystatin M cleaved from rGST-cystatin M (lane 3) migrated with the expected apparent size of 14.5 kDa.
- the untreated native cystatin M (lane 1) comprises both the 14.5 kDa form and the 20-22 kDa form.
- Treatment ofthe native cystatin M with N-Glycosidase F (lane 2) completely abolished the 20-22 kDa form, indicating that this form represents an N- glycosylated form of cystatin M.
- the N-glycosylated form accounts for about 30-40% of total native cystatin M protein in 21PT cells.
- a potential site for N-linked glycosylation of cystatin M is Asn 137 , near the C-terminus and in close proximity to the conserved Val 133 -Pro-T ⁇ 135 motif.
- Asn' 37 is located between the cysteine residues that form the disulfide bridge, which is important in maintaining the conformation required for inhibitory activity of cystatins.
- the increase in size of glycosylated cystatin M by 6 kDa could be accounted for by two carbohydrate moieties, although the presence of charged sugars like sialic acid would change the net charge ofthe protein and thus modify its electrophoretic mobility.
- the mammary epithelial tumor cell line MDA-MB-435 (Price et al. (1990) Cancer Res. 50:717), which does not express endogenous cystatin M mRNA transcript, was used as the host cell to create a series of stable cystatin M transfectant clones.
- DNA encoding cystatin M was introduced into the expression vector pCMVneo and the resultant cystatin M expression vector (pCMVneo/cystatin M) was transfected into MDA-MB-435 cells. Stable clones were selected with G418.
- the clones express varying levels of cystatin M transcript and protein (similar, or 2-30 fold higher than endogenous cystatin M in 21PT cells, the cell line from which the cystatin M cDNA was cloned).
- the protein produced by the transfectants is secreted and glycosylated, similar to the endogenous protein in 21PT cells.
- the recombinant protein can be isolated from the culture supematant by standard methods.
- Stable cystatin M transfectants of metastatic breast tumor cells can be used to evaluate phenotypic changes induced by cystatin M, such as the invasive potential ofthe cells, migration ofthe cells, growth rate in culture and tumor formation in nude mice.
- the parental cell line e.g., MDA-MB-435 cells
- parental vector transfectants e.g., MDA-MB-435 cells transfected with pCMVneo
- the MDA-MB-435 transfectants can be injected into nude mice.
- the parental cell line is known to form tumors at the site of orthotopic injection and metastasizes in nude mice (described further in Price et al (1990) Cancer Res. 50:717).
- the mice can be sacrificed and their tumors excised and weighed to determine the effect of cystatin M expression on tumor progression and metastasis.
- a suitable in vitro assay is tumor cell invasion through reconstituted basement membrane matrix (e.g., Matrigel) as described in Hendrix et al. (1987) Cancer Letters 38:137.
- the invasive ability of cystatin M-transfected MDA-MB-435 cells can be compared to untransfected MDA-MB-435 cells to determine the effect of cystatin M expression on tumor invasiveness.
- MOLECULE TYPE oligonucleotide primer
Abstract
Molécules d'acide nucléique isolées codant un nouvel inhibiteur de cystéine protéinase, la cystatine M, qui est un membre des cystatines de la famille 2. La cystatine M présente une activité inhibitrice de la cystéine protéinase contre la papaïne, est régulée à la baisse dans les cellules tumorales épithéliales mammaires métastasiques, ainsi que dans d'autres cellules tumorales, et est régulée à la hausse dans les cellules sénescentes. Outre des molécules isolées d'acide nucléique, la présente invention concerne des molécules d'acide nucléique antisens, des vecteurs d'expression de recombinaison contenant une molécule d'acide nucléique de la présente invention, des cellules hôtes dans lesquelles les vecteurs d'expression ont été introduits et des animaux transgéniques non humains dans lesquels un gène de cystatine M a été introduit ou dissocié. La présente invention concerne encore des protéines de cystatine M, des protéines de fusion, des peptides antigéniques et des anticorps anti-cystatine M isolés. Des procédés de diagnostique, d'analyse et thérapeutiques utilisant des compositions de la présente invention sont également décrits.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU74579/96A AU7457996A (en) | 1995-10-20 | 1996-10-18 | Cystatin m, a novel cysteine proteinase inhibitor |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US54600095A | 1995-10-20 | 1995-10-20 | |
US08/546,000 | 1995-10-20 |
Publications (3)
Publication Number | Publication Date |
---|---|
WO1997014797A2 true WO1997014797A2 (fr) | 1997-04-24 |
WO1997014797A3 WO1997014797A3 (fr) | 1997-10-02 |
WO1997014797A9 WO1997014797A9 (fr) | 1997-10-30 |
Family
ID=24178431
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1996/016782 WO1997014797A2 (fr) | 1995-10-20 | 1996-10-18 | Nouvel inhibiteur de cysteine proteinase, la cystatine m |
Country Status (2)
Country | Link |
---|---|
AU (1) | AU7457996A (fr) |
WO (1) | WO1997014797A2 (fr) |
Cited By (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999057274A1 (fr) * | 1998-05-01 | 1999-11-11 | Incyte Pharmaceuticals, Inc. | Proteines associees a la protease humaine |
WO1999057140A2 (fr) * | 1998-05-07 | 1999-11-11 | Incyte Pharmaceuticals, Inc. | Precurseur de chaine lourde d'inhibiteur de protease associe a la croissance |
EP1040833A1 (fr) * | 1999-03-30 | 2000-10-04 | Snow Brand Milk Products, Co., Ltd. | Agent pour l'inhibition de la résorption osseuse |
WO2001010903A2 (fr) * | 1999-08-09 | 2001-02-15 | Incyte Genomics, Inc. | Proteases et inhibiteurs de proteases |
WO2002003792A2 (fr) * | 2000-07-11 | 2002-01-17 | Deltagen, Inc. | Souris transgeniques contenant des disruptions de genes cibles d'inhibiteurs de proteinases |
JP2003536284A (ja) * | 1999-03-31 | 2003-12-02 | クゥアルコム・インコーポレイテッド | 衛星通信システムにおける往復遅延を測定するためのシステム及び方法 |
US6943277B2 (en) | 2000-07-11 | 2005-09-13 | Deltagen, Inc. | Transgenic mice containing stefin homolog protease inhibitor gene disruptions |
US8304211B2 (en) | 2002-01-23 | 2012-11-06 | Mohamed Raafat El-Gewely | Methods of screening molecular libraries and active molecules identified thereby |
CN112379093A (zh) * | 2020-10-22 | 2021-02-19 | 上海良润生物医药科技有限公司 | CST-Cathepsin复合物作为肿瘤诊断标志物的应用 |
CN113957077A (zh) * | 2021-10-18 | 2022-01-21 | 中国热带农业科学院环境与植物保护研究所 | 一种剑麻半胱氨酸蛋白酶抑制剂基因及应用 |
CN116023472A (zh) * | 2023-02-20 | 2023-04-28 | 大连工业大学 | 一种高效表达生产半胱氨酸蛋白酶抑制剂的方法 |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE3724581A1 (de) * | 1987-07-24 | 1989-02-02 | Gruenenthal Gmbh | Dna-sequenzen, die fuer proteine mit den biologischen eigenschaften des cystatin c codieren, herstellung dieser dna-sequenzen, expression des cystatin c sowie dieses enthaltende pharmazeutische zubereitungen |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP3460851B2 (ja) * | 1993-04-28 | 2003-10-27 | 雪印乳業株式会社 | 新規システインプロテアーゼインヒビター |
-
1996
- 1996-10-18 AU AU74579/96A patent/AU7457996A/en not_active Abandoned
- 1996-10-18 WO PCT/US1996/016782 patent/WO1997014797A2/fr active Application Filing
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE3724581A1 (de) * | 1987-07-24 | 1989-02-02 | Gruenenthal Gmbh | Dna-sequenzen, die fuer proteine mit den biologischen eigenschaften des cystatin c codieren, herstellung dieser dna-sequenzen, expression des cystatin c sowie dieses enthaltende pharmazeutische zubereitungen |
Non-Patent Citations (3)
Title |
---|
1ST WORLD CONGRESS ON ADVANCES IN ONCOLOGY, ATHENS, GREECE, OCTOBER 22-26, 1995. INTERNATIONAL JOURNAL OF ONCOLOGY 7 (SUPPL.). 1995. 969. ISSN: 1019-6439, XP000672818 SOTIROPOULOU G ET AL: "Isolation of a novel protease inhibitor involved in breast cancer and senescence." * |
DATABASE WPI Week 9528 Derwent Publications Ltd., London, GB; AN 95-212959 XP002031097 & JP 07 126 294 A (SNOW BRAND MILK PROD CO LTD) , 16 May 1995 * |
EMBL DATABASE, Accession no U62800. 26 Aug 1996. SOTIROPOULOU G. et al: "Identification, cloning and characterization of cystatin M ...." XP002031096 * |
Cited By (16)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999057274A1 (fr) * | 1998-05-01 | 1999-11-11 | Incyte Pharmaceuticals, Inc. | Proteines associees a la protease humaine |
WO1999057140A2 (fr) * | 1998-05-07 | 1999-11-11 | Incyte Pharmaceuticals, Inc. | Precurseur de chaine lourde d'inhibiteur de protease associe a la croissance |
WO1999057140A3 (fr) * | 1998-05-07 | 1999-12-29 | Incyte Pharma Inc | Precurseur de chaine lourde d'inhibiteur de protease associe a la croissance |
US6607743B1 (en) | 1999-03-30 | 2003-08-19 | Snow Brand Milk Products Co., Ltd. | Bone resorption suppressing agent |
EP1040833A1 (fr) * | 1999-03-30 | 2000-10-04 | Snow Brand Milk Products, Co., Ltd. | Agent pour l'inhibition de la résorption osseuse |
JP2003536284A (ja) * | 1999-03-31 | 2003-12-02 | クゥアルコム・インコーポレイテッド | 衛星通信システムにおける往復遅延を測定するためのシステム及び方法 |
WO2001010903A2 (fr) * | 1999-08-09 | 2001-02-15 | Incyte Genomics, Inc. | Proteases et inhibiteurs de proteases |
WO2001010903A3 (fr) * | 1999-08-09 | 2001-09-27 | Incyte Genomics Inc | Proteases et inhibiteurs de proteases |
WO2002003792A3 (fr) * | 2000-07-11 | 2003-04-10 | Deltagen Inc | Souris transgeniques contenant des disruptions de genes cibles d'inhibiteurs de proteinases |
WO2002003792A2 (fr) * | 2000-07-11 | 2002-01-17 | Deltagen, Inc. | Souris transgeniques contenant des disruptions de genes cibles d'inhibiteurs de proteinases |
US6943277B2 (en) | 2000-07-11 | 2005-09-13 | Deltagen, Inc. | Transgenic mice containing stefin homolog protease inhibitor gene disruptions |
US8304211B2 (en) | 2002-01-23 | 2012-11-06 | Mohamed Raafat El-Gewely | Methods of screening molecular libraries and active molecules identified thereby |
CN112379093A (zh) * | 2020-10-22 | 2021-02-19 | 上海良润生物医药科技有限公司 | CST-Cathepsin复合物作为肿瘤诊断标志物的应用 |
CN113957077A (zh) * | 2021-10-18 | 2022-01-21 | 中国热带农业科学院环境与植物保护研究所 | 一种剑麻半胱氨酸蛋白酶抑制剂基因及应用 |
CN113957077B (zh) * | 2021-10-18 | 2023-05-16 | 中国热带农业科学院环境与植物保护研究所 | 一种剑麻半胱氨酸蛋白酶抑制剂基因及应用 |
CN116023472A (zh) * | 2023-02-20 | 2023-04-28 | 大连工业大学 | 一种高效表达生产半胱氨酸蛋白酶抑制剂的方法 |
Also Published As
Publication number | Publication date |
---|---|
AU7457996A (en) | 1997-05-07 |
WO1997014797A3 (fr) | 1997-10-02 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US5948639A (en) | TGF-β pathway genes | |
AU733100B2 (en) | A transcriptional coactivator that interacts with tat protein and regulates its binding to tar RNA | |
EP1109908B1 (fr) | Methodes de la determination des composes pour la modulation du poids corporel | |
JP2006061159A (ja) | 新規なアポトーシス調整タンパク質、そのタンパク質をコードするdnaおよびその使用方法 | |
JP2010011853A (ja) | Crspタンパク質(システインに富む分泌性タンパク質)、それらをコードする核酸分子およびその用途 | |
US6210921B1 (en) | CAR: a novel coxsackievirus and adenovirus receptor | |
WO1997014797A2 (fr) | Nouvel inhibiteur de cysteine proteinase, la cystatine m | |
WO1997014797A9 (fr) | Nouvel inhibiteur de cysteine proteinase, la cystatine m | |
WO1998011221A9 (fr) | Car, un nouveau recepteur du virus de coxsackie et d'adenovirus | |
EP1066378A2 (fr) | Complexes de proteine lyst et proteines a interaction lyst | |
WO1998011238A2 (fr) | Protease m, une nouvelle serine protease | |
WO1998011238A9 (fr) | Protease m, une nouvelle serine protease | |
AU728352B2 (en) | BRCA1 associated protein (BAP-1) and uses therefor | |
US7371529B2 (en) | Methods and compositions for modulating gluconeogenesis using PGC-1 | |
US6090561A (en) | NF-AT-interacting protein NIP45 and methods of use therefor | |
WO1994021791A1 (fr) | Agents de prevention et de traitement du cancer du sein | |
WO2001081595A2 (fr) | Compositions a base de caspase-14 d'origine humaine | |
JP2002503466A (ja) | 網膜芽細胞腫タンパク質複合体および網膜芽細胞腫相互作用タンパク質 | |
US5942415A (en) | SKAP55 compositions and methods of use therefor | |
CA2183900A1 (fr) | Agents pour le diagnostic presymptomatique, la prevention et le traitement du cancer du sein chez l'humain | |
AU784993B2 (en) | CRSP protein (cysteine-rich secreted proteins), nucleic acid molecules encoding them and uses therefor | |
EP0646015A1 (fr) | Vaccin contraceptif | |
WO1998008861A1 (fr) | Compositions contenant le gene rp et utilisations therapeutiques et diagnostiques correspondantes |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AU CA JP |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
COP | Corrected version of pamphlet |
Free format text: PAGES 1/11-11/11,DRAWINGS,REPLACED BY NEW PAGES 1-12-12/12;DUE TO LATE TRANSMITTAL BY THE RECEIVINGOFFICE |
|
NENP | Non-entry into the national phase in: |
Ref country code: JP Ref document number: 97516063 Format of ref document f/p: F |
|
122 | Ep: pct application non-entry in european phase |