WO1996002566A1 - Proteine se fixant a la vitronectine - Google Patents

Proteine se fixant a la vitronectine Download PDF

Info

Publication number
WO1996002566A1
WO1996002566A1 PCT/SE1995/000861 SE9500861W WO9602566A1 WO 1996002566 A1 WO1996002566 A1 WO 1996002566A1 SE 9500861 W SE9500861 W SE 9500861W WO 9602566 A1 WO9602566 A1 WO 9602566A1
Authority
WO
WIPO (PCT)
Prior art keywords
vitronectin
binding protein
protein
quinquedecapeptide
vitronectin binding
Prior art date
Application number
PCT/SE1995/000861
Other languages
English (en)
Other versions
WO1996002566A9 (fr
Inventor
Jan-Ingmar Flock
Torkel Wadström
Olin Liang
Original Assignee
Flock Jan Ingmar
Wadstroem Torkel
Olin Liang
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Flock Jan Ingmar, Wadstroem Torkel, Olin Liang filed Critical Flock Jan Ingmar
Priority to JP8504958A priority Critical patent/JPH10505581A/ja
Priority to EP95926088A priority patent/EP0776336A1/fr
Publication of WO1996002566A1 publication Critical patent/WO1996002566A1/fr
Publication of WO1996002566A9 publication Critical patent/WO1996002566A9/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56911—Bacteria
    • G01N33/56944—Streptococcus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/305—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F)
    • C07K14/31—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F) from Staphylococcus (G)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/78—Connective tissue peptides, e.g. collagen, elastin, laminin, fibronectin, vitronectin or cold insoluble globulin [CIG]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies

Definitions

  • the present invention relates to a vitronectin binding protein, a method for preparation thereof, a quinquedecapeptide that is useful for preparing the protein, an antibody against the protein, pharmaceutical compositions and a diagnostic or analytical kit comprising said protein, use of the protein for the preparation of a pharmaceutical composition, a diagnostic or analytical kit comprising an antibody against said protein and a method for purifying vitronectin.
  • Vitronectin is a plasma protein that occurs in concentrations around 300 mg/l.
  • the major part of the plasma form of vitronectin does not bind to heparin or Staphylococc s aureus .
  • a denatured or immobilized form of vitronectin supports binding of heparin and S . aureus .
  • S. aureus can bind to vitronectin when it is included as a stationary matrix protein. It is highly likely that blocking of S . aureus binding to vitronectin in matrix, severly hampers the infectious process.
  • Extracellular matrix is composed of a complex mixture of macromolecules that serve as a substrate for cellular adhesion.
  • Many potentially pathogenic staphylococcal strains have the ability to bind to ECM proteins such as fibronectin [1, 2], collagen [3, 4, 5], laminin [6], fibrinogen [7] and vitronectin (Vn) [8, 9], as well as heparan sulphate glycosaminoglycans [10] presented in ECM and on eukaryotic cell surface.
  • Bacteria possess specific binding molecules which interact with distinct sites of the proteins in the ECM of the host [11]. It has been shown earlier that this adherence is of vital importance for the infectious process. Thus these binding functions are suitable targets for antimicrobial therapy and prophylactic treatment.
  • Another procedure for its purification is based on an FPLC Mono-Q column to separate the staphylococcal cell surface proteins, and to obtain the 60 kDa bacterial protein retaining Vn-binding ability.
  • a 60 kDa protein that bind to vitronectin is already known [9]. However the protein has neither been purified nor characterized.
  • bacteria colonise body sites by sequentially engaging their surface-bound adhesins with specific substances availabe on epithelial cells, endothelial cells, leukocytes, or the ECM. It is generally accepted that this recognition process is required to establish bacteria at a given site. Aside from the ability to recognise a host component, these binding proteins play a substantial role in determining the outcome of the host-parasite interacion. They may initiate invasion by the pathogen, either themselves or by engaging a cascade of secondary molecules. Undoubtedly many bacterial cell surface binding proteins have not yet been discovered, identified, isolated or characterized.
  • the present invention provides both a new protein that binds to vitronectin and a new quinquedecapeptide that is derived from the heparin binding domain of vitronectin.
  • the quinquedecapeptide constitutes the vitronectin region that is responsible for binding the new protein.
  • a first aspect of the invention consists of a vitronectin binding protein having an apparent molecular weight of 60 kDa and having affinity to the quinquedecapeptide AKKQRFRHRNRKGYR and having the N-terminal sequence MNKTDLINAVAEVADLVGKV, or variants, subfragments, multiples or mixtures thereof.
  • a part of the vitronectin binding region of the protein has been found to be encoded by the nucleotide sequence 5'- CCCTCAACTGTTTCAAACAATATAATTGATGAACTTAAACAAGTTGG TGAATACAATCAAATTTTCACAACTGAAGTTGACGGTACAGTCATAAACAATTTATGT AAATNCAAAATGCCAAGAAGACATTGGATTACTTCCATTGCTTCTTGGCATTTTTTCA GGG -3'. With the reading frame begining at the first nucleotide this corresponds to the amino acid sequence
  • nucleotide sequence is an unidentified nucleotide, corresponding to X in the amino acid sequence, which is an unidentified amino acid.
  • the four possible nucleotides give the four possible amino acids: phenylalanine, serine, tyrosine or cysteine. A clone was obtained and the nucleotide sequence was determined according to the general method described in K. Jacobsson and L. Frykberg, 1995, BioTechniques, Cloning of Ligand-Binding Domains of Bacterial Receptors by Phage Display, Vol. 18. No. 5, pages 878-885.
  • subfragment in the description and claims meant a part- fragment of the given domains or fragments which include parts from the various domains having mutually the same binding properties.
  • variant in the desciption and claims meant proteins or peptides in which the original amino acid sequence has been modified or changed by insertion, addition, substitution, inversion or exclusion of one or more amino acids, although while retaining or improving the binding properties, also including functional derivatives.
  • the invention also relates to those proteins which contain several arrays (multiples) of the binding domains or mixtures of the binding domains with retained binding properties.
  • the invention also relates to mixtures of the various domains of amino acid sequences having mutually the same binding properties.
  • a second aspect of the invention consists of a method for preparing a vitronectin binding protein according to the first aspect. This can be done by a method comprising culturing a staphylococcal bacterial strain, preferably Staphylococcus aureus. strain V8, preparing a cell surface protein extract of the bacteria and either applying said extract to an affinity purification step using the peptide AKKQRFRHRNRKGYR or applying said extract to an ion-exchange purification step. From a culture of 100 ml 0.2 g protein extract of cell wall proteins was obtained and therefrom 2-3 ⁇ g of the protein according to the invention was obtained, as in the Examples described below.
  • bacteria than S. aureus can be used for the production of the protein, such as other bacteria from the genus Staphylococcus ⁇
  • Various media can be used, such as Brain-Heart Infusion, Luria Broth or Todd-Hewitt Broth (THB) .
  • a preferred medium is especially THB.
  • the medium used should preferably be a rich and complex medium.
  • the bacteria can be grown at temperatures between 33 and 42°C, preferably between 35 and 39°C and most preferably at 37°C.
  • the pH is suitably ranging from 6.7 to 7.8, preferably from 7.0 to 7.5 and most preferably the culture is performed at the physiological pH, which is 7.3.
  • enzymatic digestion can be used.
  • the protein according to the invention may also be produced by cultivation of a genetically engineered host, e. g. E. coli, that has been provided with the gene for the protein of the invention.
  • the protein may be provided as an extracellular or intracellular protein.
  • An alternative to removing the protein from the cell surface is to disintegrate the cells and then clarifying the disintegrate by for example centrifugation, filtration or extraction.
  • the disintegration can be performed by chemical methods using for example lysozymes, lysostaphin, alkalis, solvents or surfactants, physical methods such as osmotic shock, drying or freeze-thawing, mechanical methods such as high pressure, bead milling or ultrasonication.
  • lysostaphin In a preferred method for disintegration lysostaphin is used.
  • the method described in Example 2 below can be altered by substituting one or more steps or adding one or more steps by one or more of the following steps: precipitation, extraction of different kinds, adsorption, isoelectric focusing and evaporation.
  • precipitation As further alternatives to the chromatography mehods described in Example 3 and 4 below can be mentioned gel filtration, reverse phase HPLC, hydrofobic chromatography etc.
  • a third aspect of the invention consists of the quinquedecapeptide AKKQRFRHRNRKGYR or a variant thereof, a pharmaceutical composition comprising an effective amount of said quinquedecapeptide or a variant thereof and pharmaceutically acceptable excipients, diluents and carriers.
  • the excipients, diluents and carriers may include all known agents suitable for use as such in lotions, pastes, creams, ointments, rinsing fluids, e.g. for use in the eyes or in the nose, and other compositions for topical use.
  • the composition may also be administered rectally or on a plaster.
  • additives and administration forms are not to be understood as limiting, but merely illustrative.
  • a purpose with the third aspect is to inhibit bacterial adhesion to stationary vitronectin in connection with infections.
  • the aspect defines a peptide that can be used for such a purpose.
  • a fourth aspect of the invention consists of an antibody, such as a monoclonal or polyclonal antibody, against a vitronectin binding protein according to the first aspect.
  • the antibodies could be produced by immunizing an animal, e. g. as in Example 8 a rat, by administration of the protein of interest. It is well known how to immunize an animal with an antigen, in this case the protein according to the invention, collect the blood, isolate the serum and use the antibodies that react with the protein.
  • monoclonal antibodies could be produced by a) immunizing mice with the protein according to the invention, and further by a method known per se b) isolating a lymphocyte mixture from the mice, c) fusing B-lymphocytes with B-myeloma mouse cells to produce a hybridoma, d) transferring the mixture of produced hybridomas and non- hybridized B-myeloma cells to a culture medium for the produced hybridomas, and cultivating and selecting the produced hybridomas over the non-hybridized B-myeloma cells, e) subcloning the hybridoma that produces the antibody that is directed specifically against the protein according to the invention, and at will f) isolating the antibody.
  • the antibody according to the invention can be used in a diagnostic or analytical kit as described below. They can also be used as a prophylactic or therapeutic agent for e.g. intravenous, intramuscular or subcutaneous administration. Administered in this way, the antibodies according to the invention can provide passive immunization to the organism being treated.
  • the third and fourth aspects concern providing means to inhibit the in vivo invasion of the human or animal body, of particularly S . aureus , although other microbial infections where the microbe binds to vitronectin are included in the invention.
  • Many micoorganisms do bind to vitronectin when initiating invasion of an organism.
  • Those microbes may interact with the quinquedecapeptide according to the third aspect and the interaction of such microbes with the substances according to the invention is therefore included in the invention. All such microorganisms could also cross-react with the antibodies according to the fourth aspect of the invention.
  • these aspects concern all pathogens that interact with vitronectin.
  • a fifth aspect of the invention consists of a pharmaceutical composition comprising an effecive amount of a vitronectin binding protein according to the first aspect and pharmaceutically acceptable excipients, diluents or carriers, and a vaccine composition comprising an effecitive amount of a vitronectin binding protein according to the first aspect, and possibly pharmaceutically acceptable adjuvants and excipients.
  • the excipients, diluents and carriers for the pharmaceutical composition may include all known agents suitable for use as such in lotions, pastes, creams, ointments, rinsing fluids, e.g. for use in the eyes or in the nose, and other compositions for topical use.
  • the composition may also be administered rectally or on a plaster.
  • Suitable adjuvants are those conventionally used in the field.
  • suitable excipients are annitol, lactose, starch, cellulose, glucose etc., only to mention a few. The examples given are not to be regarded as limiting the invention.
  • a purpose with the fifth aspect is to competitively inhibit the adhesion of bacteria.
  • the pharmaceutical composition can be applied locally or adminstered intravenously, intramuscularly, subcutaneously, etc. to inhibit bacterial invasion.
  • the vaccine can be used to immunize a mammal including the human body, or other vertebrates.
  • a sixth aspect of the invention consists of a diagnostic or analytical kit comprising a vitronectin binding protein according to the first aspect or the quinquedecapeptide according to the third aspect, or a diagnostic or analytical kit comprising an antibody.
  • the kit may for instance be used for assaying antibodies against the VnBP according to the first aspect. In this way it could be indicated that the organism has been infected with the bacteria of interest, or that the organism has sufficient immunological protection against future infections. For example it is possible to determine if a pregnant woman has antibodies enough to protect her baby from such an infection. Various samples could also be assayed for the presence of the VnBP according to the first aspect. Antibodies or the quinquedecapeptide can be used for this purpose. In the kit serum or solutions containing the protein according to the first aspect may be present for use as a standard.
  • a seventh aspect of the invention consists of a method for purifying vitronectin by using immobilized vitronectin binding protein in an affinity column.
  • Vitronectin is unstable and difficult to purify, e. g. because of its high molecular weight and the fact that it tends to aggregate. With this aspect of the invention vitronectin could be produced more easily and cheaper.
  • Fig. 1 represents the isolation of a bacterial protein recognising the quinquedecapeptide.
  • a 60 kD staphylococcal protein was isolated using a peptide affinity column.
  • Left lane shows molecular weight markers.
  • Fig. 2 illustrates the separation of staphylococcal cell surface proteins using FPLC on a Mono-Q column.
  • the putative vitronectin- binding protein was indicated as VnBP.
  • Fig. 3 represents the results of SDS-PAGE and western blot analysis of the putative VnBP.
  • Lane a molecular weight markers
  • Lane b silver staining of the fraction having the ability to bind immobilised Vn, revealing a single band having a molecular mass of 60 kDa.
  • the protein transblotted onto a nitrocellular membrane was able to bind soluble Vn, which was subsequently detected using rabbit anti-Vn polyclonal antibodies (lane c) , or monoclonal antibody against Vn (lane d) .
  • Lanes e and f were respective controls when Vn was ommitted.
  • Fig. 4 represents the detection of the putative VnBP from the staphylococcal cell surface protein extract.
  • Lane a the LiCl- extract profile was stained with Coomassie Blue on a nitrocellular membrane after SDS-PAGE separation;
  • Lane b the separated proteins were probed with Vn and was subsequently detected using rabbit anti-Vn polyclonal antibodies;
  • Lane c control experiment of the rabbit antibodies when Vn was ommitted;
  • Lane d high concentration of normal rabbit serum (1:200) was used to detect staphylococcal protein A (SpA) from the strain V8.
  • SpA staphylococcal protein A
  • Fig. 5 illustrates the effects of synthetic peptides on binding of ⁇ H-labelled S . aureus cells to immobilised Vn, fibronectin or fibrninogen on microtiter plates. The results of the peptide competition are expressed as relative inhibition compared with a PBS control. 15-mer: quinquedecapeptide; 13-mer: tridecapeptide.
  • Fig. 6 illustrates the detection of the putative VnBP using a microtiterplate assay. Captured bacterial protein by immobilised Vn on the microtiterplates was detected using rat antibodies against the LiCl-protein extract, which was then probed with secondary antibodies against rat Igs.
  • Staphylococcus aureus prototype strain V8 a well-known protease producer, was obtained from Dr. Staffan Arvidsson, Karolinska Institute, Sweden. The bacteria were grown in Todd- Hewitt Broth (THB) (Difco, Detroit, MI, USA) with 100 ml inoculum in 2 liter flasks at 37°C for 20 h on a gyratory shaker (New Brunswick, USA) with vigorous agitation [12]. Bacterial cells were harvested at the late stationary phase by centrifugation (5,000 X g for 30 min at 4°C) and washed twice with 0.1 M phosphate buffer saline (PBS, pH 7.0). All common chemicals were of analytical grade, purchased from KEBO (Spanga, Sweden) .
  • LiCl-extract of staphylococcal cell surface protein was prepared as described elsewhere [10]. Briefly, every 1 g of bacteria was resuspended in 5 ml 1 M LiCl and the mixture was incubated at 37°C for 2 h on a gyratory shaker (New Brunswick, USA) with vigorous agitation. After centrifugation (5000 x g for 15 min at 4°C) sedimenting the bacteria, the supernatant was dialysed (membrane tubing MWCO: 12- 14 000, Spectrum Medical Industries Inc., Los Angeles, CA, USA) against 0,02 M Tris-HCl buffer pH 9.0 over night to remove LiCl.
  • the sample was centrifuged (5000 x g for 15 min at 4 °C) , and the protein concentration in the clear supernatant was determined using Bio-Rad protein assay. The extract was then stored at -20°C as 2 ml aliquots.
  • VnBP was purified on a HiTrap NHS column (Pharmacia) coupled to the quinquedecapeptide (AKKQRFRHRNRKGYR) comprising the heparin binding consensus sequence of human vitronectin.
  • the VnBP purified this way is shown in Figure 1.
  • Bacterial protein recognising the synthetic peptide (Ala ⁇ '-Arg ⁇ 0 *) was isolated by the following procedure.
  • HiTrapTM N-hydroxysuccinimide (NHS)-activated affinity columns were purchased from Pharmacia, Uppsala, Sweden. Five milligrams of the synthetic peptide was used to couple to a 1 ml column followed by washing and deactivation according to the manufacturer's instruction. Coupling efficiency was generally higher than 85%. About 20 ml LiCl-extract containing approximately 2 mg protein (Bio-Rad protein assay) was applied to the peptide-column through a P-3 peristaltic pump (Pharmacia) , followed by equilibration with PBS at 4°C.
  • Staphylococcal cell surface proteins were separated using FPLC on
  • the chromatography procedure was as follwed: 5 min buffer A equilibration, 4 min sample loading onto the Mono-Q column, again 5 min buffer A returning to base-line, 30 min gradient 0-70 % buffer B, 10 min gradient 70-77.5 % buffer B, 13 min gradient 77.5-100 % buffer B, 5 min 100 % buffer B, and 2 min 100 % buffer A.
  • a 10-ml super-loading loop (Pharmacia) was used with 20 min sample loading time, and the protein separation pattern was proved to be reproducible.
  • FIG. 2 A separation profile of an LiCl-extract of S . aureus is shown in Fig. 2.
  • the chromatography achieved optimal resolution of a number of bacterial proteins from staphylococcal cell surface. Occasionally some peaks drifted earlier or later with a margin of 1-2 min (0,5-2 ml). In both our pilot experiments and later scale-up runs the chromatogram was proved to be easily reproducible, and was therefore complementary to the SDS-PAGE profile of the staphylococcal cell surface proteins published previously [10]. As such there has been developed a convenient, inexpensive and reliable method to release and analyze bacterial cell surface proteins, many of which are yet to be identified and characterized.
  • Human Vn was purified as described by Yatohgo et al [16]. The purified preparation was homogeneous as judged by SDS-PAGE (two bands corresponding to 65 and 75 kDa) and western blot analysis with mouse anti-human Vn monoclonal antibody (Boehringer Mannheim GmbH, Germany) and did not cross-react with antibodies against fibronectin.
  • the LiCl-protein extract was separated using the Mini-PROTEAN II cell (Bio-Rad) with 4% stacking gel and 7.5% separating gel. In western blot experiments, the separated protein was tranferred to nitrocellulose membranes (Schleicher & Schuell) at 65°C for 30 min following SDS-PAGE.
  • the membranes were blocked with 3% BSA in PBS for aproximatly 3h at room temperature, and then incubated with 5 ⁇ g/ml Vn in PBST for 1 h at room temperature.
  • the membranes were then incubated with 5 ⁇ g/ml rabbit anti-Vn polyclonal antibodies (Calbiochem) or monoclonal antibody aganist Vn (Boehringer Mannheim Biochemica) in PBS for 1 h at room temperature with gentle agitation. Secondary antibodies against rabbit or mouse Igs conjugated with alkaline phosphatase in 1:1000 dilution were added to the membranes.
  • the membranes were developed with bromochloroindolyl phosphate/nitro blue tetrazolium (Bio-Rad) according to the manufacturers' recomendation. Between each step the membranes were washed twice with 5 ml PBST for 5 min. As shown in Fig. 3, a single protein band having a molecular mass of 60 kDa was revealed after silver staining (lane b) , and in the western blot experiments.
  • This protein transblotted onto a nitrocellular membrane, had the ability to bind soluble Vn at a concentration of 5 ⁇ g/ml in PBS, which was subsequently detected using either rabbit anti-Vn polyclonal antibodies or monoclonal antibody directed against Vn (lane c and e) .
  • Control experiments with both anti-Vn mentioned above, omitting Vn were performed (lane d and f) .
  • an LiCl-extract transblotted onto a nitrocellular membrane was stained with Coomassie blue (Fig. 4, lane a).
  • aureus strain V8 the strain employed in the present study, has a novel structure lacking an IgG-binding domain (58 amino acid) and two octapeptide repetitions located in the membrane attaching region.
  • IgG-binding domain 58 amino acid
  • two octapeptide repetitions located in the membrane attaching region.
  • staphylococcal protein A from the strain V8 having a molecular mass slightly above 45 kDa (lane d) , which coincided with published data [13].
  • lane d staphylococcal protein A from the strain V8 having a molecular mass slightly above 45 kDa
  • Amino acid analysis was performed as follows. About 50 ⁇ g of the purified 60 kDa Vn-binding protein was hydrolyzed with 6 M HC1 containing 2 mg/ml phenol for 24 h at 110°C. The amino acid composition was determined by the Protein and Peptide Unit at the Deptartment of Medical Biochemistry and Biophysics, Karolinska Institute, Sweden. Approximately 1.5 nmol purified protein was used for N-terminal sequence determination after methanolic HCl de-blocking treatment [18]. Briefly, the protein sample was dissolved in 1 N HCl in anhydrous methanol and the mixture was incubated at 37°C for 5 h followed by dialysis against deionized water overnight at 4°C and lyophilization. The freeze-dried sample was dissolved in 30 % Acetonitrile and sequencing was performed by the Biomolecular Resource Facility at Lund University, Lund, Sweden.
  • S . aureus has the ability to bind to heparin and heparan sulphate [10].
  • a heparin binding protein was purified from an S . aureus extract by passing it through a heparin column. The purified protein was subjected to N-terminal amino acid analysis according to Example 6, and as shown in Table II the heparan sulphate binding protein and the VnBP seem to be the same protein.
  • Antibodies aganist the LiCl-extract were produced in Wistar rats according to standard methods. Briefly, each of four rats was immunized with 100 ⁇ g staphylococcal protein extract subcutaneously at three occasions with a three-week span in between. The antigens were given with Freund's complete adjuvant (Sigma) at the first and with incomplete adjuvant (Sigma) at the following two injections. The antibody titer aganist the LiCl- extract was monitered using ELISA on microtiterplates coated with the bacterial protein extract and detected using anti-rat Igs conjugated with horseradish peroxidase (The Binding Sites, Birmingham, UK) as secondary antibodies. The rat sera were pooled and stored at -20°C as 0.5 ml aliquots.
  • a 15 amino acid long peptide (Ala-* 4 '-Arg-'" 1 ) was synthesised using t-butoxycarbonyl-protected amino acids with an automated peptide synthesiser (model 430A, Applied Biosystems, Inc.), and was subsequently purified on FPLC.
  • the amino acid sequence of the synthetic peptide was determined according to the manufacturer's instructions from Applied Biosystems.
  • a 13 amino acid long peptide (Asn ⁇ ' ⁇ -Leu ⁇ ") was kindly provided by Dr. W. St ⁇ ber (Behringwerke. Marburg, Germany) .
  • Microtiter plates (96-well) (Costar, Cambridge, MA, USA) were coated with 0.2 ⁇ g/well of Vn 1 preparation, fibronectin (Sigma Chemical Co) of fibrinogen (Kabi, Sweden) in lOO ⁇ l PBS overnight at 4"C and additional binding sites were blocked using 3% BSA in PBS containing 0.05% Tween-20 for 2 h at 37 * C, similar to a published procedure [17].
  • Fifty microliter of ⁇ H-labelled bacteria (approximately 5 x 10"
  • VnBP vitronectin binding protein
  • the plates were developed with 1.2- phenylendiamine (DAKO, Glostrup, Denmark) in 0.1 M citric acid- phosphate buffer pH 5.0 and approximately 0.01% hydrogen peroxide (KEBO) as recomended by the manufacturer.
  • the plates were read at 490 nm with a Bio-Rad ELISA reader. Several repetitions of duplicate determinations were made and averaged in all cases.
  • MOLECULE TYPE protein
  • HYPOTHETICAL NO
  • FRAGMENT TYPE N-terminal
  • ORGANISM Staphylococcus aureus
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • ORGANISM Staphylococcus aureus
  • ORGANISM Staphylococcus aureus

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • Oncology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Microbiology (AREA)
  • Toxicology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Communicable Diseases (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention concerne une nouvelle protéine se fixant à la vitronectine et provenant de Streptococcus aureus. Cette protéine intervient dans le processus d'infection par ce micro-organisme. L'invention concerne également un procédé de préparation de cette protéine et d'un pentadécapeptide qui a la séquence d'acides aminés AKKQRFRHRNRKGYR et qui est utile pour préparer la protéine et pour bloquer le site de fixation de la protéine à la vitronectine. En outre, l'invention concerne un anticorps dirigé contre la protéine, des compositions pharmaceutiques, un coffret de diagnostic ou d'analyse comprenant ladite protéine, peptide ou anticorps, ainsi qu'un vaccin. Finalement, l'invention concerne un procédé pour purifier la vitronectine en utilisant la protéine se fixant à la vitronectine, dans une colonne d'affinité.
PCT/SE1995/000861 1994-07-15 1995-07-14 Proteine se fixant a la vitronectine WO1996002566A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
JP8504958A JPH10505581A (ja) 1994-07-15 1995-07-14 ビトロネクチン結合タンパク質
EP95926088A EP0776336A1 (fr) 1994-07-15 1995-07-14 Proteine se fixant a la vitronectine

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
SE9402490A SE9402490D0 (sv) 1994-07-15 1994-07-15 Vitronection binding protein
SE9402490-8 1994-07-15

Publications (2)

Publication Number Publication Date
WO1996002566A1 true WO1996002566A1 (fr) 1996-02-01
WO1996002566A9 WO1996002566A9 (fr) 1997-02-13

Family

ID=20394737

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SE1995/000861 WO1996002566A1 (fr) 1994-07-15 1995-07-14 Proteine se fixant a la vitronectine

Country Status (4)

Country Link
EP (1) EP0776336A1 (fr)
JP (1) JPH10505581A (fr)
SE (1) SE9402490D0 (fr)
WO (1) WO1996002566A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001060852A1 (fr) * 2000-02-17 2001-08-23 Biostapro Ab Une proteine 52 kda derivee de staphylocoque a coagulase negative et des fragments de celle-ci
AU2001242392B2 (en) * 2000-02-15 2005-02-10 Tiense Suikerraffinaderij N.V. Inulin products with improved nutritional properties
US7834151B2 (en) * 1997-11-26 2010-11-16 The Texas A&M University System SDRD protein from Staphylococcus aureus and diagnostic kits including same

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994006830A1 (fr) * 1992-09-21 1994-03-31 Alfa-Laval Agri International Aktiebolag Proteine de liaison du fibrinogene
WO1994018327A1 (fr) * 1993-02-05 1994-08-18 Smithkline Beecham Plc Proteine de liaison de fibronectine, anticorps monoclonal et leur utilisation pour prevenir l'adherence bacterienne

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994006830A1 (fr) * 1992-09-21 1994-03-31 Alfa-Laval Agri International Aktiebolag Proteine de liaison du fibrinogene
WO1994018327A1 (fr) * 1993-02-05 1994-08-18 Smithkline Beecham Plc Proteine de liaison de fibronectine, anticorps monoclonal et leur utilisation pour prevenir l'adherence bacterienne

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BIOCHIMICA ET BIOPHYSICA ACTA, Volume 1225, 1993, OLIN D. LIANG et al., "Multiple Interactions Between Human Vitronectin and Staphylococcus Aureus", pages 57-63. *
THE JOURNAL OF CELL BIOLOGY, Volume 121, No. 2, April 1993, BRUCE E. VOGEL et al., "A Novel Integrin Specificity Exemplified by Binding of the alfa v beta 5 Intergrin to the Basic Domain of the HIV Tat Protein and Vitronectin", pages 461-468. *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7834151B2 (en) * 1997-11-26 2010-11-16 The Texas A&M University System SDRD protein from Staphylococcus aureus and diagnostic kits including same
AU2001242392B2 (en) * 2000-02-15 2005-02-10 Tiense Suikerraffinaderij N.V. Inulin products with improved nutritional properties
WO2001060852A1 (fr) * 2000-02-17 2001-08-23 Biostapro Ab Une proteine 52 kda derivee de staphylocoque a coagulase negative et des fragments de celle-ci

Also Published As

Publication number Publication date
SE9402490D0 (sv) 1994-07-15
EP0776336A1 (fr) 1997-06-04
JPH10505581A (ja) 1998-06-02

Similar Documents

Publication Publication Date Title
Boulnois Pneumococcal proteins and the pathogenesis of disease caused by Streptococcus pneumoniae
FI102768B (fi) Hybridi-DNA-molekyyli ja menetelmä fibronektiiniä sitovan proteiinin v almistamiseksi
Courtney et al. Cloning, sequencing, and expression of a fibronectin/fibrinogen-binding protein from group A streptococci
Leppla Large-scale purification and characterization of the exotoxin of Pseudomonas aeruginosa
Ben Nasr et al. Human kininogens interact with M protein, a bacterial surface protein and virulence determinant
US5776712A (en) Methods and materials for the detection of Staphylococcus aureus
US6291654B1 (en) Method for isolating a C3 binding protein of streptococcus pneumoniae
US5440014A (en) Fibronectin binding peptide
Yu et al. The interaction between human transferrin and transferrin binding protein 2 from Moraxella (Branhamella) catarrhalis differs from that of other human pathogens
WO1998021337A9 (fr) Proteine de liaison c3 de streptococcus pneumoniae
US5413918A (en) Gene and method for production of a 40-45-kDa IgA binding protein
JP4173549B2 (ja) コアグラーゼ陰性ブドウ球菌に由来する、新規フィブリノーゲン結合たん白質
CZ2001951A3 (cs) Prostředky obsahující streptokokový Cbeta protein
Liang et al. Isolation and characterisation of a vitronectin-binding surface protein from Staphylococcus aureus
WO1987007146A1 (fr) INHIBITEUR DE L'ACTIVITE DE LA CHEMOTAXINE C5a
AU678362B2 (en) Antibiotic cryptdin peptides and methods of their use
Calderone et al. Adherence moleculaes of Candida albicans
WO1996002566A1 (fr) Proteine se fixant a la vitronectine
WO1994013310A9 (fr) Proteine de liaison de sialoproteine osseuse et son procede de preparation
WO1996002566A9 (fr) Proteine se fixant a la vitronectine
WO1994013310A1 (fr) Proteine de liaison de sialoproteine osseuse et son procede de preparation
KR19990071959A (ko) 말라세지아에서 유래된 항원성 단백질
Clyne et al. Characterization of staphylococcal λ-lysin
CA2277554C (fr) Mutants de streptokinase
Glurich et al. Identification of Streptococcus pyogenes proteins that bind to rabbit kidney in vitro and in vivo

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 1995926088

Country of ref document: EP

COP Corrected version of pamphlet

Free format text: PAGE 1/3,DRAWINGS,REPLACED BY CORRECT PAGE 1/3

WWP Wipo information: published in national office

Ref document number: 1995926088

Country of ref document: EP

ENP Entry into the national phase

Ref country code: US

Ref document number: 1997 776278

Date of ref document: 19970612

Kind code of ref document: A

Format of ref document f/p: F

WWW Wipo information: withdrawn in national office

Ref document number: 1995926088

Country of ref document: EP