WO1995029234A1

WO1995029234A1 - Human gamma 3 gaba-a receptor subunit and stably co-transfected cell lines

Info

Publication number: WO1995029234A1
Application number: PCT/GB1995/000834
Authority: WO
Inventors: Paul John Whiting
Original assignee: Merck Sharp & Dohme Limited
Priority date: 1994-04-22
Filing date: 1995-04-12
Publication date: 1995-11-02
Also published as: CA2188258A1; EP0756626A1; GB9408064D0; JPH10500007A

Abstract

The present invention relates to the cloning of a novel cDNA sequence encoding the η3 receptor subunit of the human GABAA receptor; to stably co-transfected eukaryotic cell lines capable of expressing a human GABAA receptor, which receptor comprises at least one α receptor subunit, at least one β receptor subunit and the η3 receptor subunit; and to the use of such cell lines in screening for and designing medicaments which act upon the human GABAA receptor.

Description

Human gamma 3 GABA-A receptor subunit and stably co-transfected cel l l i nes

This invention concerns the cloning of a novel cDNA 5 sequence encoding a particular subunit of the human GABA^ receptor. In addition, the invention relates to a stable cell line capable of expressing said cDNA and to the use of the cell line in a screening technique for the design and development of subtype-specific medicaments.

Gamma-amino butyric acid (GABA) is a major inhibitory 0 neurotransmitter in the central nervous system. It mediates fast synaptic inhibition by opening the chloride channel intrinsic to the GABA^ receptor. This receptor comprises a multimeric protein of molecular size 230-270 kDa with specific binding sites for a variety of drugs including benzodiazepines, barbiturates and β-carbolines, in addition to sites for the 5 agonist ligand GABA (for reviews see Stephenson, Biochem. J., 1988, 249. 21; Olsen and Tobin, Faseb J., 1990, 4, 1469; and Sieghart, Trends in Pharmacol. Sci., 1989, 10, 407).

Molecular biological studies demonstrate that the receptor is composed of several distinct types of subunit, which are divided into four 0 classes (α, β, γ, and δ) based on their sequence similarities. To date, six types of α (Schofield et al., Nature (London), 1987, 328. 221; Levitan et al., Nature (London), 1988, 335, 76; Ymer et al., EMBO J., 1989, 8, 1665; Pritchett & Seeberg, J. Neurochem., 1990, 54. 802; Luddens et al., Nature (London), 1990, 346, 648; and Khrestchatisky et al, Neuron, 1989, 3, 745), 5 three types of β (Ymer et al, EMBO J., 1989, 8, 1665), two types of γ

(Ymer et al., EMBO J., 1990, 9, 3261; and Shivers et al., Neuron, 1989, 3, 327) and one δ subunit (Shivers et al., Neuron, 1989, 3, 327) have been identified.

The differential distribution of many of the subunits has

30 been characterised by in situ hybridisation (Sequier et al., Proc. Natl. Acad. Sci. USA, 1988, 85, 7815; Malherbe et al, J. Neurosci., 1990, 10, 2330; and Shivers et al, Neuron, 1989, 3, 327) and this has permitted it to be speculated which subunits, by their co-localisation, could theoretically exist in the same receptor complex. Various combinations of subunits have been co-transfected into cells to identify synthetic combinations of subunits whose pharmacology parallels that of bona fide GABAA receptors in vivo

(Pritchett et al, Science, 1989, 245. 1389; Malherbe et al, J. Neurosci., 1990, 10, 2330; Pritchett and Seeberg, J. Neurochem., 1990, 54, 1802; and Luddens et al, Nature (London), 1990, 346. 648). This approach has revealed that, in addition to an α and β subunit, either or γ (Pritchett et al, Nature (London), 1989, 338, 582; Ymer et al, EMBO J., 1990, 9, 3261; and Malherbe et al, J. Neurosci., 1990, 10, 2330) or 73 (Herb et al,

Proc. Natl. Acad. Sci. USA, 1992, 89, 1433; Knofiach et al, FEBS Lett., 1991, 293, 191; and Wilson-Shaw et al, FEBS Lett., 1991, 284, 211) is also generally required to confer benzodiazepine sensitivity, and that the benzodiazepine pharmacology of the expressed receptor is largely dependent on the identity of the α and γ subunits present. Receptors containing a δ subunit (i.e. αβδ) do not appear to bind benzodiazepines (Shivers et al, Neuron, 1989, 3, 327). Combinations of subunits have been identified which exhibit the pharmacological profile of a BZi type receptor

(^αlβlY2) ^an(i ^a BZ2 type receptor (α2βiY2 or α3β] 2> Pritchett et al, Nature (London), 1989, 338. 582), as well as two GABA^. receptors with a novel pharmacology, o^2Y2 (Pritchett and Seeberg, J. Neurochem., 1990, 54, 1802) and o^2Y2 (Luddens et al, Nature (London), 1990, 346, 648).

Although the pharmacology of these expressed receptors appears similar to that of those identified in brain tissue by radioligand binding, it has nonetheless not been shown that these receptor subunit combinations exist in vivo. A combination of subunits comprising the human 73 GABAA receptor subunit has not hitherto been possible due to the non-availability of the human 73 cDNA. This has consequently limited the use of cell lines in screening for subtype-specific medicaments, it being impossible to study the pharmacological profile of subunit combinations comprising the 73 subunit.

We have now ascertained the cDNA sequence of the 73 subunit of the human GABAA receptor. This nucleotide sequence, together with the deduced amino acid sequence corresponding thereto, is depicted in Figure 2 of the accompanying drawings.

The present invention accordingly provides, in a first aspect, a DNA molecule encoding the 73 subunit of the human GABAA receptor comprising all or a portion of the sequence depicted in Figure 2, or a m lified human sequence. The sequencing of the novel cDNA molecule in accordance with the invention can conveniently be carried out by the standard procedure described in accompanying Example 1; or may be accomplished by alternative molecular cloning techniques which are well known in the art, such as those described by Maniatis et al. in Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, New York, 2nd edition, 1989.

In another aspect, the invention provides a recombinant expression vector comprising the nucleotide sequence of the GABAA receptor 73 subunit together w h additional sequences capable of directing the synthesis of the said GABAA receptor 73 subunit in cultures of stably co-transfected eukaryotic cells.

The term "expression vectors" as used herein refers to DNA sequences that are required for the transcription of cloned copies of recombinant DNA sequences or genes and the translation of their mRNAs in an appropriate host. Such vectors can be used to express eukaryotic genes in a variety of hosts such as bacteria, blue-green algae, yeast cells, insect cells, plant cells and animal cells. Specifically designed vectors allow the shuttling of DNA between bacteria-yeast, bacteria-plant or bacteria-animal cells. An appropriately constructed expression vector should contain: an origin of replication for autonomous replication in host cells, selective markers, a limited number of useful restriction enzyme sites, a high copy number, and strong promoters. A promoter is defined as a DNA sequence that directs RNA polymerase to bind to DNA and to initiate RNA synthesis. A strong promoter is one which causes mRNAs to be initiated at high frequency. Expression vectors may include, but are not limited to, cloning vectors, modified cloning vectors, specifically designed plasmids or viruses.

The term "cloning vector" as used herein refers to a DNA molecule, usually a small plasmid or bacteriophage DNA capable of self- replication in a host organism, and used to introduce a fragment of foreign DNA into a host cell. The foreign DNA combined with the vector DNA constitutes a recombinant DNA molecule which is derived from recombinant technology. Cloning vectors may include plasmids, bacteriophages, viruses and cosmids.

The recombinant expression vector in accordance with the invention may be prepared by inserting the nucleotide sequence of the GABAA Y3 subunit into a suitable precursor expression vector (hereinafter referred to as the "precursor vector") using conventional recombinant DNA methodology known from the art. The precursor vector may be obtained commercially, or constructed by standard techniques from known expression vectors. The precursor vector suitably contains a selection marker, typically an antibiotic resistance gene, such as the neomycin or ampicillin resistance gene. The precursor vector preferably contains a neomycin resistance gene, adjacent the SV40 early splicing and polyadenylation region; an ampicillin resistance gene; and an origin of replication, e.g. pBR322 ori. The vector also preferably contains an inducible promoter, such as MMTV-LTR (inducible with dexamethasone) or metallothionin (inducible with zinc), so that transcription can be controlled in the cell line of this invention. This reduces or avoids any problem of toxicity in the cells because of the chloride channel intrinsic to the GABAA receptor.

One suitable precursor vector is pMAMneo, available from Clontech Laboratories Inc. (Lee et al, Nature, 1981, 294. 228; and Sardet et al, Cell, 1989, 56, 271). Alternatively the precursor vector pMSGneo can be constructed from the vectors pMSG and pSV2neo.

The recombinant expression vector of the present invention is then produced by cloning the GABAA receptor 73 subunit cDNA in .he above precursor vector. The receptor subunit cDNA is subcloned from the vector in which it is harboured, and Hgated into a _* estriction enzyme site, e.g. the HindHI site, in the polylinker of the precursor vector, for example pMAMneo or pMSGneo, by standard cloning methodology known from the art, and in particular by techniques analogous to those described herein. Before this subcloning, it is often advantageous, in order to improve expression, to modify the end of the 73 subunit cDNA with additional 5' untranslated sequences, for example by modifying the 5' end of the 73 subunit DNA by addition of 5' untranslated region sequences from the oq subunit DNA.

One suitable expression vector of the present invention is illustrated in Fig. 1 of the accompanying drawings, in which R represents the nucleotide sequence of the 73 subunit of the GABAA receptor, and the remainder of the expression vector depicted therein is derived from the precursor vector pMSGneo. According to a further aspect of the present invention, there is provided a stably co-transfected eukaryotic cell line capable of expressing a GABAA receptor, which receptor comprises at least one alpha, one beta and the 73 subunit. This is achieved by co-transfecting cells with three expression vectors, each harbouring cDNAs encoding for an α, β or 73 GABAA receptor subunit. In a further aspect, therefore, the present invention provides a process for the preparation of a eukaryotic cell line capable of expressing a GABAA receptor, which comprises stably co-transfecting a eukaryotic host cell with at least three expression vectors, one such vector harbouring the cDNA sequence encoding for an alpha, another such vector harbouring the cDNA sequence encoding for a beta, and a third such vector harbouring the cDNA sequence encoding for the 73 GABAA receptor subunit. The stable cell-line which is established expresses an 0Φ73 GABAA receptor. Each receptor thereby expressed, comprising a unique combination of α, β and 73 subunits, will be referred to hereinafter as a

GABAA receptor "subunit combination". Pharmacological and electrophysiological data confirm that the recombinant αβy3 receptor expressed by the cells of the present invention has the properties expected of a native GABAA receptor.

Expression of the GABAA receptor may be accomplished by a variety of different promoter-expression systems in a variety of different host cells. The eukaryotic host cells suitably include yeast, insect and mammalian cells. Preferably the eukaryotic cells which can provide the host for the expression of the receptor are mammalian cells. Suitable host cells include rodent fibroblast fines, for example mouse Ltk", Chinese hamster ovary (CHO) and baby hamster kidney (BHK); HeLa; and HEK293 cells. It is necessary to incorporate at least one α, one β and the 73 subunit into the cell line in order to produce the required receptor.

Within this limitation, the choice of receptor subunit combination is made according to the type of activity or selectivity which is being screened for. For example, benzodiazepines (designated BZ) represent one class of drugs which act upon the GABAA receptor. The presence of an αj subunit is specific for a class of benzodiazepines having the pharmacology designated BZj; whereas ct2 to 015 define diffe~"~!t pharmacological profiles, broadly designated as BZ2. The type ..- β subunit is not critical in defining the class of benzodiazepine, although a β subunit is required. The 73 subunit is also important in defining BZ selectivity. It is likely that differentiation between α subunit selectivity is conferred by the 73 subunit.

In order to employ this invention most effectively for screening purposes, it is preferable to build up a library of cell lines, each with a different combination of subunits. Typically a library of 5 or 6 cell line types is convenient for this purpose. Preferred subunit combinations include: ct2βi73 and 0^173, and in particular 0^373. These may be used with cell lines containing other subunit combinations such as oqβ_] 2; ^αlβ2Y2; «2βιγι; cⁱ2βi72;

^α4βlY2; αδβrø ^α6βlY2; ^{and α}lβlY2L- As stated above, for each cell line of the present invention, three such vectors will be necessary, one containing an α subunit, one containing a β subunit, and the third containing the 73 subunit.

Cells are then co-transfected with the desired combination of three expression vectors. There are several commonly used techniques for transfection of eukaryotic cells in vitro. Calcium phosphate precipitation of DNA is most commonly used (Bachetti et al, Proc. Natl. Acad. Sci. USA, 1977, 74, 1590-1594; Maitland et al, CeU, 1977, 14, 133-141), and represents a favoured technique in the context of the present invention. A small percentage of the host cells takes up the recombinant DNA. In a small percentage of those, the DNA will integrate into the host cell chromosome. Because the neomycin resistance gene will have been incorporated into these host cells, they can be selected by isolating the individual clones which will grow in the presence of neomycin. Each such clone is then tested to identify those which will produce the receptor. This is achieved by inducing the production, for example with dexamethasone, and then detecting the presence of receptor by means of radioligand binding. In a further aspect, the present invention provides protein preparations of GABAA receptor subunit combinations, especially human

GABAA receptor subunit combinations, comprising the human 73 GABAA receptor subunit derived from cultures of stably transfected eukaryotic cells. The invention also provides preparations of membranes containing subunit combinations of the GABAA receptor, especially human GABAA receptor subunit combinations, comprising the human 73 GABAA receptor subunit derived from cultures of stably transfected eukaryotic cells. In an especially preferred embodiment, the invention provides cell membranes containing a human GABAA receptor consisting of an C 73 subunit combination isolated from stably transfected mouse Ltk" fibroblast cells, most especially an 0^373 subunit combination.

The cell fine, and the membrane preparations therefrom, according to the present invention have utility in screening and design of drugs which act upon the GABAA receptor, for example benzodiazepines, barbiturates, β-carbolines and neurosteroids. The present invention accordingly provides the use of the cell fine described above, and membrane preparations derived therefrom, in screening for and designing medicaments which act upon the GABAA receptor. Of particular interest in this context are molecules capable of interacting selectively with GABAA receptors made up of varying subunit combinations. As will be readily apparent, the cell line in accordance with the present invention, and the membrane preparations derived therefrom, provide ideal systems for the study of structure, pharmacology and function of the various GABAA receptor subtypes.

The following non-limiting Examples illustrate the present invention.

EXAMPLE 1

ISOLATION AND SEQUENCING OF cDNAS ENCODING THE HUMAN GABA_A RECEPTOR 73 SUBUNIT

a) cDNA libraries cDNAs were cloned from human foetal brain cDNA libraries. All cDNA libraries were constructed in the lambdaZAP vector, and were purchased from Stratagene (San Diego, California). For screening, the cDNA libraries were plated according to the manufacturer's instructions, at 40,000 pfu per 137 mm plate. Filter lifts were taken using Hybond N filters (Amersham) according to the manufacturer's instructions.

b) Isolation of cDNA encoding human 73 subunit

A rat 73 cDNA probe was first generated by PCR using oligonucleotide primers derived from the rat 73 sequence (Knoflach et al,

FEBS Lett., 1991, 293, 191):

5ΑTTCAAGCTTACCATGGCTGCAAAGCTGCTGCTTCTCTGCCTGTTCT CGGG3' (bp 177-217, with 13 bases on the 5' end containing a Hind III restriction site) SEQ. ID. NO.: 1, and 5'GGAATTGTTTAACGTGATCATCACGGGTG3' (bp 1330-1358, antisense) SEQ. ID. NO.: 2. PCR was performed as described, for example, by Whiting et al in Proc. Natl. Acad. Sci. USA, 1990, 87, 9966, using rat brain cDNA as a template. A 1250bp PCR product was obtained which when digested with Hind III was cut into 2 pieces of 900bp and 350bp in size. The 900bp fragment was subcloned into the Hind III site of pBluescript SK-(Stratagene) and its identity confirmed by DNA sequencing using standard techniques and the Sequensase II enzyme (United States Biochemicals). A human foetal brain cDNA Hbrary was screened using 32p labelled rat 73 900bp DNA as described above. A single cDNA clone was obtained. Sequence analysis was performed, using an Appfied Biosystems 373 A DNA sequencer and dye terminator chemistry according to the manufacturers' instructions. This cDNA lacked both the 5' and 3' ends of the coding region. These were subsequently obtained by anchored PCR. For the 3' end, a sense oHgonucleotide derived from sequence near the 3' end of the truncated cDNA clone

(δ'CCAGATTCCTCAAGATGATTCCTGAGCGAATAAGS', incorporating an EcoRI site) SEQ. ID. NO.: 3 was used in conjunction with an oHgonucleotide "anchor" primer derived from the T7 primer sequence of the pBluescript vector

(5ΑGCGCGCGTAATACGACTCACTATAGGGCGAA3') SEQ. ID. NO.: 4 in a PCR reaction with human foetal brain cDNA Hbrary as template. A 500bp PCR product was obtained and subcloned into EcoRI cut pBluescript SK-. Sequencing, as above, confirmed that it contained the 3' end of the human 73 coding region, together with 131bp of 3' untranslated region sequence. The missing 5' sequences of the 73 cDNA were obtained using human brain "5' RACE Ready cDNA", obtained from CLONTECH (part no. 7302-1), using the antisense primers 5'GCTTTTTATCATATGCTCTTAGCAAC3' SEQ. ID. NO.: 5 and 5'CAAGACCCACATATGGTTTGATGGAGA3' SEQ. ID. NO.: 6, derived from the very 5' end of the truncated 73 cDNA clone. The anchored PCR was performed according to manufacturers' instructions, and a 200bp PCR product obtained which was subcloned into the p-CR-Script vector (Stratagene), again according to the manufacturers' instructions. DNA sequencing confirmed that the 200bp PCR product contained the missing 5' coding region of the human 73 cDNA, together with 25bp of 5' untranslated region.

The complete nucleotide sequence of the cDNA encoding the human 73 subunit, together with the deduced amino acid sequence corresponding thereto is shown in Fig. 2 of the accompanying drawings SEQ. ID. NO.: 7.

EXAMPLE 2

PREPARATION OF STABLY TRANSFECTED CELLS EXPRESSING 0^373 SUBUNIT COMBINATION OF THE HUMAN

GABA_A RECEPTOR

Human 065 (see International patent specification no. WO

92/22652), β3 (Wagstaff et al, Genomics, 1991, U, 1071) and 73 cDNAs were subcloned into the eukaryotic expression vector pMSGneo (the preparation of which is described in WO 92/22652) using standard techniques (cf. Maniatis et al, in Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, New York, 2nd Edition, 1989) and a stable ceH fine expressing human 0^373 GABA-A receptor estabHshed according to the methodology described in Example 1 of WO 92/22652. EXAMPLE 3 CHARACTERISATION OF STABLY TRANSFECTED CELLS EXPRESSING <x₅β₃73 SUBUNIT COMBINATION OF THE HUMAN GABAA RECEPTOR

Expression of recombinant 0^373 human GABAA receptors is demonstrated by radiological binding. Transfected cells which had been induced by culture in dexamethasone containing medium for 3-5 days (according to methodology described in Example 2 of WO 92/22652) were harvested and ceU membranes prepared (again according to methodology described in Example 2 of WO 92/22652). Saturation binding curves (Figure 3) were obtained by incubating ceU membranes with various concentrations of ^H Ro 15- 1788 (obtained from New England Nuclear, Du Pont (U.K.) Ltd., Stevenage), with non-specific binding measured in the presence of lOμM flunitrazepam (obtained from Sigma Chemical

Company, Poole, UK). All binding assays were performed in tripHcate in an assay volume of 0.5ml, with an incubation time of 90min at 4°C.

Incubations were terminated by filtration through GF/B filters (Brandel, Gathersberg, MD) on a Tomtech ceU harvester, foUowed by three washes in ice-cold assay buffer. After drying, filter-retained radioactivity was measured by Hquid scintillation counting.

A ceU Hne prepared as described in Example 2 expressed approximately 80fmol [3H]Rol5-1788 binding sites/mg protein foUowing a 5-day induction of receptor expression. The expression of human 0:5, β3 and 73 mRNA transcripts was confirmed by isolation of mRNA, cDNA synthesis and PCR using subunit specific oHgonucleotide primers in a conventional manner. Scatchard analysis of saturation binding curves for

[8H]Rol5-1788 was performed for membrane preparations from two cell Hnes expressing the 0^373 subunit combination according to the present invention, giving the foUowing KD values (mean ± SEM): 0.32±0.06nM and 0.63±0.11nM.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

APPLICANT:

(A) NAME: Merck Sharp & Dohme Limited

(B) STREET: TerHngs Park

(C) CITY: Harlow

(D) STATE: Essex (E) COUNTRY: England

(F) POSTAL CODE (ZIP): CM20 2QR

(n) TITLE OF INVENTION: Nucleic Acids

(iii) NUMBER OF SEQUENCES: 8

(iv) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: PatentIn Release #1.0, Version #1.25 (EPO)

(2) INFORMATION FOR SEQ ID NO: 1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 51 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single (D) TOPOLOGY: Hnear (n) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

ATTCAAGCTT ACCATGGCTG CAAAGCTGCT GCTTCTCTGC CTGTTCTCGG G 51

(2) INFORMATION FOR SEQ ID NO: 2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 29 base pairs

(B) TYPE: nucleic acid

(C) ST ANDEDNESS: single

(D) TOPOLOGY: Hnear

fti) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:

GGAATTGTTT AACGTGATCA TCACGGGTG 29

(2) INFORMATION FOR SEQ ID NO: 3:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 34 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: Hnear

(n) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

CCAGATTCCT CAAGATGATT CCTGAGCGAA TAAG 34

(2) INFORMATION FOR SEQ ID NO: 4:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: Hnear

(u) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:

AGCGCGCGTA ATACGACTCA CTATAGGGCG AA 32

(2) INFORMATION FOR SEQ ID NO: 5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 26 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: single

(D) TOPOLOGY: Hnear

(n) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:

GCTTTTTATC ATATGCTCTT AGCAAC 26 (2) INFORMATION FOR SEQ ID NO: 6:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: Hnear

(ϋ) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:

CAAGACCCAC ATATGGTTTG ATGGAGA 27

(2) INFORMATION FOR SEQ ID NO: 7:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1565 base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: Hnear

tii) MOLECULE TYPE: cDNA

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 33..1436

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: TGAATTCGTG AGATGGCGAG CTCCACGGCA CC ATG GCC CCG AAG CTG CTG CTC 53

Met Ala Pro Lys Leu Leu Leu 1 5

CTC CTC TGC CTG TTC TCG GGC TTG CAC GCG CGG TCC AGA AAG GTG GAA 101 Leu Leu Cys Leu Phe Ser Gly Leu His Ala Arg Ser Arg Lys Val Glu 10 15 20

GAG GAT GAA TAT GAA GAT TCA TCA TCA AAC CAA AAG TGG GTC TTG GCT K9 Glu Asp Glu Tyr Glu Asp Ser Ser Ser Asn Gin Lys Trp Val Leu Ala 25 30 35

CCA AAA TCC CAA GAC ACC GAC GTG ACT CTT ATT CTC AAC AAG TTG CTA 197 Pro Lys Ser Gin Asp Thr Asp Val Thr Leu He Leu Asn Lys Leu Leu 40 45 50 55

AGA GAG TAT GAT AAA AAG CTG AGG CCA GAT ATT GGA ATA AAA CCG ACC 245 Arg Glu Tyr Asp Lys Lys Leu Arg Pro Asp He Gly He Lys Pro Thr 60 65 70

GTA ATT GAC GTT GAC ATT TAT GTT AAC AGC ATT GGT CCT GTG TCA TCA 293 Val He Asp Val Asp He Tyr Val Asn Ser He Gly Pro Val Ser Ser 75 80 85

ATA AAC ATG GAA TAC CAA ATT GAC ATA TTT TTT GCT CAG ACC TGG ACA 341 He Asn Met Glu Tyr Gin He Asp He Phe Phe Ala Gin Thr Trp Thr 90 95 100

GAT AGT CGC CTT CGA TTC AAC AGC ACA ATG AAA ATT CTT ACT CTG AAC 389 Asp Ser Arg Leu Arg Phe Asn Ser Thr Met Lys He Leu Thr Leu Asn 105 110 115

AGC AAC ATG GTG GGG TTA ATC TGG ATC CCA GAC ACC ATC TTC CGC AAT 437 Ser Asn Met Val Gly Leu He Trp He Pro Asp Thr He Phe Arg Asn 120 125 130 135

TCT AAA ACC GCA GAG GCT CAC TGG ATC ACC ACA CCC AAT CAG CTC CTC 485 Ser Lys Thr Ala Glu Ala His Trp He Thr Thr Pro Asn Gin Leu Leu 140 145 150

CGG ATT TGG AAT GAC GGG AAA ATC CTT TAC ACT TTG AGG CTC ACC ATC 533 Arg He Trp Asn Asp Gly Lys He Leu Tyr Thr Leu Arg Leu Thr He 155 160 165 AAT GCT GAG TGC CAG CTG CAG CTG CAC AAC TTC CCC ATG GAC GAA CAC 581 Asn Ala Glu Cys Gin Leu Gin Leu His Asn Phe Pro Met Asp Glu His 170 175 180

TCC TGC CCG CTG ATT TTC TCC AGC TAT GGC TAT CCC AAA GAA GAA ATG 629 Ser Cys Pro Leu He Phe Ser Ser Tyr Gly Tyr Pro Lys Glu Glu Met 185 190 195

ATT TAT AGA TGG AGA AAA AAT TCA GTG GAG GCA GCT GAC CAG AAA TCA 677 He Tyr Arg Trp Arg Lys Asn Ser Val Glu Ala Ala Asp Gin Lys Ser

200 205 210 215

TGG CGG CTT TAT CAG TTT GAC TTC ATG GGC CTC AGA AAC ACC ACA GAA 725 Trp Arg Leu Tyr Gin Phe Asp Phe Met Gly Leu Arg Asn Thr Thr Glu 220 225 230

ATC GTG ACA ACG TCT GCA GGT GAT TAT GTT GTC ATG ACT ATA TAT TTT 773 He Val Thr Thr Ser Ala Gly Asp Tyr Val Val Met Thr He Tyr Phe 235 240 245

GAA TTG AGT AGA AGA ATG GGA TAC TTC ACC ATT CAG ACA TAC ATT CCC 821 Glu Leu Ser Arg Arg Met Gly Tyr Phe Thr He Gin Thr Tyr He Pro 250 255 260

TGT ATA CTG ACT GTG GTT TTA TCC TGG GTG TCA TTT TGG ATC AAA AAA 869 Cys He Leu Thr Val Val Leu Ser Trp Val Ser Phe Trp He Lys Lys 265 270 275

GAT GCT ACG CCA GCA AGA ACA GCA TTA GGC ATC ACC ACG GTG CTG ACC 917 Asp Ala Thr Pro Ala Arg Thr Ala Leu Gly He Thr Thr Val Leu Thr

280 285 290 295

ATG ACC ACC CTG AGC ACC ATC GCC AGG AAG TCC TTG CCA CGC GTG TCC 965 Met Thr Thr Leu Ser Thr He Ala Arg Lys Ser Leu Pro Arg Val Ser 300 305 310

TAC GTG ACC GCC ATG GAC CTT TTT GTG ACT GTG TGC TTC CTG TTT GTC 1013 Tyr Val Thr Ala Met Asp Leu Phe Val Thr Val Cys Phe Leu Phe Val 315 320 325

TTC GCC GCG CTG ATG GAG TAT GCC ACC CTC AAC TAC TAT TCC AGC TGT 1061 Phe Ala Ala Leu Met Glu Tyr Ala Thr Leu Asn Tyr Tyr Ser Ser Cys 330 335 340 AGA AAA CCA ACC ACC ACG AAA AAG ACA ACA TCG TTA CTA CAT CCA GAT 1109 Arg Lys Pro Thr Thr Thr Lys Lys Thr Thr Ser Leu Leu His Pro Asp 345 350 355

TCC TCA AGA TGG ATT CCT GAG CGA ATA AGC CTA CAA GCC CCT TCC AAC 1157 Ser Ser Arg Trp He Pro Glu Arg He Ser Leu Gin Ala Pro Ser Asn 360 365 370 375

TAT TCC CTC CTG GAC ATG AGG CCA CCA CCA CCT GCG ATG ATC ACT TTA 1205 Tyr Ser Leu Leu Asp Met Arg Pro Pro Pro Pro Ala Met He Thr Leu 380 385 390

AAC AAT TCC GTT TAC TGG CAG GAA TTT GAA GAT ACC TGT GTC TAT GAG 1253 Asn Asn Ser Val Tyr Trp Gin Glu Phe Glu Asp Thr Cys Val Tyr Glu 395 400 405

TGT CTG GAT GGC AAA GAC TGT CAG AGC TTC TTC TGC TGC TAT GAA GAA 1301 Cys Leu Asp Gly Lys Asp Cys Gin Ser Phe Phe Cys Cys Tyr Glu Glu 410 415 420

TGT AAA TCA GGA TCC TGG AGG AAA GGG CGT ATT CAC ATA GAC ATC TTG 1349 Cys Lys Ser Gly Ser Trp Arg Lys Gly Arg He His He Asp He Leu 425 430 435

GAG CTG GAC TCG TAC TCC CGG GTC TTT TTC CCC ACG TCC TTC CTG CTC 1397 Glu Leu Asp Ser Tyr Ser Arg Val Phe Phe Pro Thr Ser Phe Leu Leu 440 445 450 455

TTT AAC CTG GTC TAC TGG GTT GGA TAC CTG TAT CTC TAAGTGTTGC 1443 Phe Asn Leu Val Tyr Trp Val Gly Tyr Leu Tyr Leu 460 465

TCAGAGTGAA GAGTGAAGAG CATTTGGTAC ACACTTGACC TTCTGTCGTC CCCAGACCAG 1503

TAGTGACCAA TCGGGAGTAG CAAGGAAGGA CACTGCCCAG TGTATCTTGT TATAAATGAC 1563

CG 1565

(2) INFORMATION FOR SEQ ID NO: 8:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 467 amino acids (B) TYPE: amino acid (D) TOPOLOGY: Hnear

tii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:

Met Ala Pro Lys Leu Leu Leu Leu Leu Cys Leu Phe Ser Gly Leu His 1 5 10 15

Ala Arg Ser Arg Lys Val Glu Glu Asp Glu Tyr Glu Asp Ser Ser Ser 20 25 30

Asn Gin Lys Trp Val Leu Ala Pro Lys Ser Gin Asp Thr Asp Val Thr 35 40 45

Leu He Leu Asn Lys Leu Leu Arg Glu Tyr Asp Lys Lys Leu Arg Pro

50 55 60

Asp He Gly He Lys Pro Thr Val He Asp Val Asp He Tyr Val Asn

65 70 75 80

Ser He Gly Pro Val Ser Ser He Asn Met Glu Tyr Gin He Asp He 85 90 95

Phe Phe Ala Gin Thr Trp Thr Asp Ser Arg Leu Arg Phe Asn Ser Thr 100 105 110

Met Lys He Leu Thr Leu Asn Ser Asn Met Val Gly Leu He Trp He 115 120 125

Pro Asp Thr He Phe Arg Asn Ser Lys Thr Ala Glu Ala His Trp He 130 135 140

Thr Thr Pro Asn Gin Leu Leu Arg He Trp Asn Asp Gly Lys He Leu

145 150 155 160

Tyr Thr Leu Arg Leu Thr He Asn Ala Glu Cys Gin Leu Gin Leu His 165 170 175

Asn Phe Pro Met Asp Glu His Ser Cys Pro Leu He Phe Ser Ser Tyr 180 185 190 Gly Tyr Pro Lys Glu Glu Met He Tyr Arg Trp Arg Lys Asn Ser Val 195 200 205

Glu Ala Ala Asp Gin Lys Ser Trp Arg Leu Tyr Gin Phe Asp Phe Met 210 215 220

Gly Leu Arg Asn Thr Thr Glu He Val Thr Thr Ser Ala Gly Asp Tyr 225 230 235 240

Val Val Met Thr He Tyr Phe Glu Leu Ser Arg Arg Met Gly Tyr Phe 245 250 255

Thr He Gin Thr Tyr He Pro Cys He Leu Thr Val Val Leu Ser Trp 260 265 270

Val Ser Phe Trp He Lys Lys Asp Ala Thr Pro Ala Arg Thr Ala Leu 275 280 285

Gly He Thr Thr Val Leu Thr Met Thr Thr Leu Ser Thr He Ala Arg 290 295 300

Lys Ser Leu Pro Arg Val Ser Tyr Val Thr Ala Met Asp Leu Phe Val 305 310 315 320

Thr Val Cys Phe Leu Phe Val Phe Ala Ala Leu Met Glu Tyr Ala Thr 325 330 335

Leu Asn Tyr Tyr Ser Ser Cys Arg Lys Pro Thr Thr Thr Lys Lys Thr

340 345 350

Thr Ser Leu Leu His Pro Asp Ser Ser Arg Trp He Pro Glu Arg He 355 360 365

Ser Leu Gin Ala Pro Ser Asn Tyr Ser Leu Leu Asp Met Arg Pro Pro 370 375 380

Pro Pro Ala Met He Thr Leu Asn Asn Ser Val Tyr Trp Gin Glu Phe 385 390 395 400

Glu Asp Thr Cys Val Tyr Glu Cys Leu Asp Gly Lys Asp Cys Gin Ser

405 410 415

Phe Phe Cys Cys Tyr Glu Glu Cys Lys Ser Gly Ser Trp Arg Lys Gly 420 425 430 Arg He His He Asp He Leu Glu Leu Asp Ser Tyr Ser Arg Val Phe 435 440 445

Phe Pro Thr Ser Phe Leu Leu Phe Asn Leu Val Tyr Trp Val Gly Tyr 450 455 460

Leu Tyr Leu 465

Claims

CLAIMS:

1. A stably co-transfected eukaryotic ceU Hne capable of expressing a human GABAA receptor, which receptor comprises at least one alpha receptor subunit, at least one beta receptor subunit and the gamma-3 receptor subunit.

2. A ceU Hne as claimed in claim 1 wherein the ceU Hne is a rodent fibroblast ceU line.

3. A process for the preparation of a eukaryotic ceU Hne capable of expressing a human GABAA receptor, which comprises stably co- transfecting a rodent fibroblast host ceU with at least three expression vectors, one such vector harbouring the human cDNA sequence encoding an alpha receptor subunit, another such vector harbouring the human cDNA sequence encoding a beta receptor subunit, and a third such vector harbouring the human cDNA sequence encoding the gamma-3 GABAA receptor subunit.

4. A process as claimed in claim 3 wherein the eukaryotic ceU

Hne is a rodent fibroblast ceU Hne.

5. A DNA molecule encoding the 73 subunit of the human GABAA receptor comprising aU or a portion of the sequence depicted in Figure 2 herein SEQ. ID. NO.: 7.

6. A recombinant expression vector comprising the nucleotide sequence of the human 73 GABAA receptor subunit together with additional sequences capable of directing the synthesis of the said human 73 GABAA receptor subunit in cultures of stably co-transfected eukaryotic cells.

7. A protein preparation of human GABAA receptor subunit combinations comprising the human 73 GABAA receptor subunit derived from a culture of stably co-transfected eukaryotic ceUs.

8. A membrane preparation containing GABAA receptor subunit combinations comprising the human 73 GABAA receptor subunit derived from a culture of stably co-transfected eukaryotic ceUs.

9. A preparation as claimed in claim 7 wherein the subunit combination derived is the 0^373 subunit combination of the human

GABAA receptor.

10. A preparation as claimed in claim 8 wherein the subunit combination derived is the 0^373 subunit combination of the human

GABAA receptor.

11. The use of the ceU Hne as claimed in claim 1, and membrane preparations derived therefrom, in screening for and designing medicaments which act upon the human GABAA receptor.