CA2188258A1 - Human gamma 3 gaba-a receptor subunit and stably co-transfected cell lines - Google Patents

Abstract

The present invention relates to the cloning of a novel cDNA sequence encoding the .gamma.3 receptor subunit of the human GABAA receptor; to stably cotransfected eukaryotic cell lines capable of expressing a human GABAA receptor, which receptor comprises at least one .alpha. receptor subunit, at least one .beta. receptor subunit and the .gamma.3 receptor subunit; and to the use of such cell lines in screening for and designing medicaments which act upon the human GABAA receptor.

Description

wogs/29234 r~

2 1 88258 Human gamma 3 GA~A-A receptor subunit and stably ~c-transfected cell l~nes . .
This invention concerns t: loning of a novel cDNA
5 sequence encoding a particular subuni. ~he hulnan GABAA receptor. In addition, the invention relates to a stable cell line capable f ~
said cDNA and to the use of the cell line in a screening technique for the design and ~1u~ .,l of subtype-specific P ~
Gamma-amino butyric acid (GABA) is a major inhibitory 10 n~ . in the central nervous system. It mediates fast synaptic inhihit.i--n by opening the chloride channF-l intrinsic to the GABAA
receptor. This receptor ~ ; `F.~ a ~I~ltimP~ri~. protein of m~ r size 230-270 kDa with specific binding sites for a variety of dru~s including b~..,.u~ 7~ .c, ks~ c and ~-carbolines, in additi . to sites for the agonist ligand GABA (for reviews see StPphp~ncnn~ Biochem. J., 1988, 249.
21; Olsen and Tobin, Faseb J., 1990, _, 14~9; and Sieghart, Tren~s in PharmQcol. Sci., 1989, lQ, 407).
MnlF~C~ r biûlogical studies tipmnnetr~tp~ that the receptor is composed of several distinct types of subunit, which are divided into four classes (a, ~, ~, and ~) based on their sequence ~imil~ritiP.c To date, six types of a (.~I`hnfiPl(i et al., N~tture (Lo7t~70n), 1987, 328, 221; Levitan et al., Nature ~London), 1988, ~, 76; Ymer et al., EMB0 J., 1989, ~, 1665;
Pritchett & Seeberg, J. Neurochem., 1990, 54, 802; Luddens et al., Nature (I,ondon), 1990, 346, 648; and Rhrpqtrh ~ticl~y et al., Neuron, 1989, 3, 745), three types of ~ (Ymer et al., EMBO J., 1989, 8, 1665), two types of y (Ymer et al., EMB0 J., 1990, ~, 32G1; and Shivers et al., Neuro7l, 1989, 3, 327) and one ~ subunit (Shivers et al., Neuron, 1989, 3, 327) have been i~lPntifiPA
The .liffPrPntl~l rlic~rihlltlr~n of many of the subunits has been ~ by in situ hyhri~liq~tinn (Sequier et al., Proc. Natl, wossns234 21~8258 P~' 9'~

Acad. Sci. USA, 1988, ~5, 7815; Malherbe et al., J. Neurosci., 1990, 10~
2330; and Shivers et al., Neuron, 1989, ~ 327) and this has pPrmitt~d it to be speculated which subunits, by their co-lnr~lic~t~nn could thPr,rpti/~lly . .
exist in the same receptor complex.
Various cnmhin ~h ~m c of subunits have been co~ r~ l pd into cells to identify synthetic rnnnhin~tinn.c of subunits whose rh~rnl~rrl~gy parallels that of bona fide GABAA receptors in uiuo ~Pritchett et al., Science, 1989, 245. 1389; Malherbe et al., J. Neurosci., 1990, 10, 2330; Pritchett and Seeberg, J. Neurochem., 1990, 54, 1802; and Luddens et al., Nature (Zondo1~), 1990, ~, 648). This approach has revealed that, in addition to an a and ,~ subunit, either Yl or Y2 (Pritchett et al., Nature (London,~, 1989, 338, 582; Ymer et al., EMB0 J., 1990, 9, 32~il; and Malherbe et al., J. Neurosci., 1990, 1~, 2330) or y3 ~Herb et al., Proc. Natl. Acad. Sci. ~JSA, 1992, 89, 1433; Knoflach et al., ~EBS Lett., 1991, ~, 191; and Wilson-Shaw et al., ~EBS Lett., 1991, 284. 211) is also generally required to confer b~, . 7 ~ i . . P se~siiivi~y, and that the bPn7.n~ 7Prinr rh~rm~rnln~y of the expressed receptor is largely dependent on the identity of the a and y subunits present. Receptors rnnts~ininE a o subunit (i.e. a,~o) do not appear to bind bPn7n~ 7prinpc (Shivers et al., Neuron, 1989, 3, 327). Cnmhin~t~nc of subunits have been identified which exhibit the ph slrm ~rl-lgir~l profile of a BZ 1 type receptor (al~1y2) and a BZ2 type receptor (a2~1y2 or a3ply2, Pritchett et al., Nature (London), 1989, ~, 582), as well as two GABAA receptors with a novel ph~rm~rnlngy, as,~2~2 (eritchett and Seeberg, J. Neurochem., 1990, 54, 1802) and a6~2~2 (Luddens et al., Nature (London), 1990, ~i, 648).
Although the ph~r~ rnlngy of these expressed receptors appears similar to that of those i~lPntifie~ in brain tissue by rs~-linli~nd binding, it has nnnPthPlPcR not been shown that these receptor subunit rnmhin~tinnc exist in viuo.

_ ~ 218~258 `
A r~!mhin ~ tinn of subunits rnmrri cin E the human y3 GABAA
receptor subunit has not hitherto been possible due to the non-availability of the human y3 cDNA. T_is has consequently limited the use of cell lines in screening for subtype-specific m~lir~mPnt~, it being impossible to study 5 the ph~rm~rnlngir~l profile of subunit rnTnhinsltinn~ rn nrriqine the y3 subunit.
We have now ascertained the cDNA sequence of the y3 subunit of the human GABAA receptor. This nucleotide sequence, together with the deduced amino acid sequence corresponding thereto, is 10 depicted in SEQ.ID.NO.7 of the accompanying Sequence Listing.
The present invention accordingly provides, in a first aspect, a DNA molecule encoding the y3 subunit of the human GABAA receptor comprising all or a portion of the sequence depicted in Figure 2, or a modified human sequence.
The sequencing of the novel cDNA molecule in accordance with the invention can conveniently be carried out by the standard procedure described in accompanying Example 1; or may be Ar~nrnrlichrd by alternative molecular cloning techniques which are well known in the art, such as those described by Maniatis et al. in Molecular Cloning, A
20 I,aboratory Manual, Cold Spring ~arbor Press, New York, 2nd edition, 1989.
In another aspect, the invention provides a reromhin~nt expression vector comprising the nucleotide sequence of the GABAA
receptor y3 subunit together with ~ itinn~l sequences capable of 25 directing the synthesis of the said GABAA receptor y3 subunit in cultures of stably co-tr~n ~fe~te :1 eukaryotic cells.
The term "expression vectors" as used herein refers to DNA
sequences that are required for the transcription of cloned copies of rrrnmhin~nt DNA sequences or genes and the tr:ln~l:3tlnn of their mRNAs AMENCF.D S~EET
.. . , .... . .. ... _ .. .. .. _ woss/2s234 ~ 1 88258 ,~ . s. ~
in an i-~ ,uru~liaL~ host. Such vectors can be used to express eukaryotic genes in a variety of hosts such as bacteria, blue-green algae, yeast ce~ls, insect cells, plant cells and animal cells. Specifically designed vectors allow the shuttling of DNA between bacteria-yeast, bacteria-plant or 5 bacteria-animal cells. An appropriately cv s~ru~Led t~l'.,Ul~ - vector should contain: an origin of replication for ~ - c ~ aLiuu in host cells, selective markers, a limited number of useful rPe~rt~r~n enzyme sites, a high copy number, and strong promoters. A promoter is defined as a DNA sequence that directs RNA polymerase to bind to DNA and to 10 initiate RNA synthesis. A strong promoter is one vhich causes mRNAs to be initiated at high frequency. Expression vectors may include, but are not limited to, cloning vectors, modified cloning vectors, specifically designed plasmids or viruses.
The term "cloning vector" as used herein refers to a DNA
15 molecule, usually a smaU plasmid or b~rtnrirplt~ DNA capable of se~f-replication in a host nr~niem, and used to introduce a fragment of foreign DNA into a host celL The foreign DNA combined with the vector DNA
rr,ncfitlltPc a rernmhin~nt DNA molecule which is derived from rPcnmhin slnt technology. Cloning vectors may include plasmids, 20 bacteriophages, viruses and cosmids.
The rPrnmhinslnt ~:~,Ult:~S;ull vector in a~u~da~ with the invention may be prepared by inserting the nucleotide sequence of the GABAA ~3 subunit into a suitable precursor expression vector ~hereinafter referred to as the ",Ull,~ Ul vector") using conventional rprnmh;n~nt~ DNA
25 mPtho~nlngy known from the art. The precursor vector may be obtained cnmmPrri~lly, or constructed by standard techniques from known expression vectors. The precursor vector suitably contains a selection marker, typically an antibiotic resistance gene, such as the neomycin or simpirillin l~,~ e gene. The precursor vector preferably contains a 30 neomycin l~s~ldu~,e gene, adjacent the SV40 early splicing and Tl271 2 ~ 2~8 polyadenylation region; an ampicillin resistance gene; and an origin of r~li~t1nn, e.g. pBR322 ori. The vector also preferably contains an inducible promoter, such as MMTV-LTR (inducible with (1~Y~lm~tllA.con~) or metallothionin (inducible with zinc), so that transcription can be 5 controlled in the cell line of this invention. This reduces or avoids any problem of toxicity in the cells because of the chloride channel intrinsic to the GABAA receptor.
One suitable precursor vector is pMAMneo, available from Clontech Laboratories Inc. (Lee et al., N~ture, 1981, 294. 228; and Sardet et al., Cell, 1989, 56, 271). Alternatively the precursor vector pMSGneo can be constructed from the vectors pMSG and pSV2neo.
The r~ om~in~nt expression vector of the present invention i9 then produced by cloning the GABAA receptor 1'3 subunit cDNA into the above precursor vector. The receptor subunit cDNA is subcloned from the 15 vector in which it is harboured, and ligated into a restriction enzyme site, e.g. the Hindm site, in the polylinker of the precursor vector, for example pMAMneo or pMSGneo, by standard cloning methodology known from the art, and in particular by techniques analogous to those described herein.
Before this subcloning, it is often advantageous, in order to improve 20 expression, to modify the end of the ~3 subunit cDNA with ~ititm~l 5 untranslated sequences, for example by modifying the 5' end of the ~3 subunit DNA by addition of 5~ lln~.r~n~l~t.oll region sequences from the a subunit DNA.
AMENI'ED SHEET

woss/2s234 2' 3~rj8 ~.,. s According to a further aspect of the present invention, there is provided a stably CO-I, J. .~ d eukaryotic cell Iine capable of PYrrPCCin ~ a GABAA receptor, which receptor ~ c at least one alpha, one beta and the y3 subunit.
This is achieved by co-tr~n cfPctln ~ cells with three e~JL
vectors, each ~ e cDNAs encoding for an a, ,~ or y3 GABAA
receptor subunit. In a further aspect, therefore, the present invention provides a process for the preparation of a eukaryotic cell Line capable of expressing a GABAA receptor, which ~o~rricPc stably co-tr~n cfPctin E a eukaryotic host cell with at least three expression vectors, one such vector h s~rhollrin ~ the cDNA sequence encoding for an alpha, another such vector harbouring the cDNA sequence encoding for a beta, and a third such vector harbouring the cDNA sequence encoding for the y3 GABAA receptor subunit. The stable cell-line which is Psf~hlichP(l expresses an a~y3 GABAA receptor. Each receptor thereby P~rPCCP~ a unique rnmhin ~tinn of , ~ and y3 subunits, wi~l be referred to hereinafter as a GABAAreceptor"subunit c~lmhin~tinn'~, Ph ~rm~r~ and electrophysiological data conf~nn that the rP~mhin~nt a~y3 receptor expressed by the cells of the present invention has the properties expected of a native GABAA receptor.
Expression of the GABAA receptor may be ~cc~-mplichPd by a variety of di~ferent promoter-~ systems in a v riety of different host cells. The eukaryotic host cells suitably include yeast, insect and mslmm~ n cells. Pr~erably the eukaryotic cells which can provide the host for the ~ of the receptor are m~mms~ n cells. Suitable host cells include rodent fibroblast lines, for example mouse Ltk-, Chinese hamster ovary (CH0) and baby hamster kidney (BHK); HeLa; and HEK293 cells. It is necessary to incorporate at least one a, one ,~ and the wo g5ng234 ~ 1 8 ~ ~ 5 ~
y3 subunit into the cell line in order to produce the required receptor.
Within this linnit~ti~n, the choice of receptor subunit cnnnhin~tinn is made according to the t,ype of activity or 3el~_Lvi~y which is being screened for.
For example, bpn7n~ 7prinpq ((lP4;~ d BZ) represent one class of 5 drugs which act upon the GABAA receptor. The presence of an al subunit is specific for a class of 1~ P.4 having the rh~rn~ y (lP.Ci~n ~tPd BZl; whereas 2 to as define different ph~rm ~rnln~jrsll profiles, broadly ~lPCiF~tPd as BZ2. The type of ~ subunit is not critical in defining the class of bn~ J~l; s ~l); ~P, although a ~ subunit is required.
10 The y3 subunit is also innptlrt~nt in defining BZ scle_Lvi~y. It is lil~ely that .lil~ tiu . between a subunit s~le~,~ivi~,y is conferred by the y3 subunit.
In order to employ this invention most ~ ly for screening purposes, it is llrPfPr~hl^ to build up a library of cell lines, each 15 with a different rmnhin~ti~n of subunits. Typically a library of 5 or 6 cell line types is convenient for this purpose. Preferred subunit rnmhin~tinnc include: a2,~1y3 and a3~1y3, and in particular as~3y3. These may be used with cell lines cnnt:3inin~ other subunit rnmhin~tinn~ such as all31y2;
al,B2y2; a2~1yl; a2,~1y2; a3~1Y2; ~4~1Y2; a5~1Y2; a6~1Y2; and all3ly2L
As stated above, for each cell line of the present invention, three such vectors will be necessary, one ~rnnt~ininE an a subunit, one r~nt:lininF a ~ subunit, and the third rnnt~ininF the ~3 subunit.
Cells are then co-tr~ncfP~tPd with the desired cnmhin~tinn of three expression vectors. There are several commonly used techniques for tr~n cfpcti nn of eukaryotic cells in vitro. Calcium phosphate ~ n of DNA is most commonly used (Bachetti et al., Proc. N~tl. Acad . Sci.
USA, 1977, 74, 1590-1594; Maitland et ~1., Cell, 1977, 14, 133-141), and represents a favoured tPrhniqllP in the context of the present invention.

wo ss/2s234 2 ~ 8 8 2 5 8 A small ~ la~ of the host cells takes up the rPrnmhin~nt DNA. In a small percentage of those, the DNA will integrate into the host cell chromosome. Because the neomycin . ~ gene will have been i .. ~.. ,. I ~d into these host ce s, they can be selected by isolating the 5 individual clones which will grow in the presence of neomycin. Each suc'n clone is then tested to identify those which will produce the receptor. This is achieved by inducing the production, for example with llPY~mPthslennp and then detecting the presence of receptor by means of r~flinliF~n~
binding.
In a further aspect, the present invention provides protein prep~r~tinn e of GABAA receptor subunit rnmhin sl* nn e especially human GABAA receptor subunit rnmhin~tinnc, comprising the human y3 GABAA
receptor subunit derived from cultures of stably ll aul;~L~ d eukaryotic cells. The invention also provides rrPr~r~tinn A of mPmhr~n Pq n ~ E
15 subunit cnmhin~*nnc of the GABAA receptor, especially human GABAA
receptor subunit rnmhin:ltinne ~ e the human y3 GABAA receptor subunit derived from cultures of stably tr~nqfPct~d eukaryotic cells. In an especiaUy preferred Pmho~imPnt, the invent;on provides cell mPmhrs~nPA
rnnt:linine a human GABAA receptor ~...u.i~l;..e of an a~y3 subunit 20 rnmhin~tinn isolated from stably ~ r~ mouse Ltk- fibroblast cells, most especially an as~3y3 subunit r~nhin~tinn The cell line, and the mPmhr~nP preparations therefrom, according to the present invention have utility in screening and design of drugs which act upon the GABAA receptor, for example b~ ",.l ;~ ,~l.; . .PA, 25 ba~ u~a~t:s, ,B-carbolines and neurosteroids The present invention s~rrnrAin ely provides the use of the cell line described above, and m~mhr~nP pr~pPr~tinne derived therefrom, in screening for and designing mPtlir~mrntA which act upon the GABAA receptor. Of particular interest in this context are molecules capable of interacting selectively with ~ woss/2s234 ~ ~ 882~;8 r ~
GABAA receptors made up of varying subunit f~nmhin ~ti rn q As will be readily apparent, the cell line in ~ .1u ~ f- with the present invention, and the mPmhr~nP prPr~r~tinns derived thPrPfrnm provide ideal systems for the study of structure, ph~r~ ~ ,,y and function of the various 5 GABAA receptor subtypes.
The following non-limiting FY~mI'lPC illustrate the present invention.
EXAMPLE I
ISOLATION AND SEQUENCING OF cDNAS ENCODING THE
HUMAN GABAA RECEPTOR y3 SUBUNIT
a) cDNA libraries cDNAs were cloned from human foetal brain cDNA libraries.
All cDNA libraries were cu~ u~l~d in the lambdaZAP vector, and were purchased from Stratagene (San Diego, C~lifnrni~). For screening, the cDNA libraries were plated according to the ~ u~ ,. r~ instructions, at 40,000 pfu per 137 mm plate. Filter lifts .~ere taken using Hybond N
filters ~AmPrch~m) according to the m~nllf~rrl-rer's ~ u.,l.iu..s.
b) Isolation of cDNA encodin~ human ~3 subunit, A rat y3 cDNA probe was first ~n~r~t~d by PCR using 25 nli~nnllnlPoti~o primers derived from the rat y3 sequence f~Knoflach et fll, FEBS Lett., 1991, 293,191):
5'ATTCAAGCTTACCATGGCTGCAAAGCTGCTGCTTCTCTGCCTGTTCT
CGGG3'(bp 177-217,with 13basesonthe5'endf lluil~ aHind m restriction Cite) SEQ. ID. NO.: 1, and - ~=~
Wog5129234 2 ~ ~8258 ]~,IJ~ 1 5'GGAATTGTTTAACGTGATCATCACGGGTG3' (bp 1330-1358, antisense) SEQ. ID. NO.: 2. PCR ~vas performed as described, for example, by Whiting et al in Proc Natl. Acad. Sc~. USA, 1990, ~, 9966, using rat ,.
brain cDNA as a template. A 1250bp PCR product was obtained which when digested with Hind m was cut into 2 pieces of 900bp and 350bp in size. The 900bp fragment was subcloned into the Hind m site of pRlll~srrillt SK-(str~t~nf~) and its identity cnn~rm~d by DNA
~q..~ using standard terhnigll~c and t_e ~ u~ II enzyme (United States R~rl..-...;. ,~lc).
A human foetal brain cDNA Iibrary was screened using 32p labelled rat y3 900bp DNA as described above. A single cDNA clone was obtained. Sequence analysis was p~rfnrmf~r~, using an Applied Biosystems 373A DNA se4uG..~G~ and dye l. . ~ chemistry according to the ~z"~..r~ 2' iUal~lu-~..iOl12. This cDNAlackedboth the 5' and 3' ends of 15 the coding region. These were sllhseqll~ntly obtained by anchored PCR.
For the 3' end, a sense nli~ -rl~ derivedfrom sequence near the 3' end of the truncated cDNA clone (5'CCAGATTCCTCAAGATGATTCCTGAGCGAATAAG3', incorporating an EcoRI site) SEQ. ID. NO.: 3 was used in conjunction with an 20 oligonucleotide "anchor" primer derived from the T7 primer sequence of the pRll~crri~t vector (5'AGCGCGCGTAATACGACTCACTATAGGGCGAA3') SEQ. ID. NO.: 4 in a PCR reaction with human foetal brain cDNA library as template. A
500bp PCR product was obtained and cllhrlnnrtl into EcoRl cut 25 pF~ r-~rnl)t SK-. Sequencing, as above, rr.,nfirm~d that it contained the 3' end of the human y3 coding region, together with 13 lbp of 3~ llntr~ncl~tRd region sequence. The missing 5' ~e4..~.l~s of the y3 cDNA were obtained using human brain "5' RACE Ready cDNA", obtained from CLONTECH -(part no. 7302-1), using the antisense primers 5~GCTTTTTATCATATGCTCTTAGCAAC3' SEQ. ID. NO: 5 and , . . . _ . .... .. , = .

T1271 ~ 2~
.

5'CAAGACCCACATATGG~GATGGAGA3' SEQ. ID. NO.: 6, derived from the very 5' end of the truncated r3 cDNA clone. The anchored PCR
was performed according to manufacturers' instructions, and a 200bp PCR
product obtained which was subcloned into the p-CR-Script vector (Stratagene),againaccordingtothem~ (" ~ r~ instructions. DNA
sequencing confirm~d that the 200bp PCR product contained the missing 5' coding region of the human y3 cDNA, together with 25bp of 5' ntr~n.c1s3t.~d region.
The complete nucleotide sequence of the cDNA encoding the human r3 subunit, together with the deduced amino acid sequence corresponding thereto is shown in SEQ. ID. NO.: 7.
EXAMPLE ~
PREPARATION OF STABLY TRANSFECTED CELLS
EXPRESSING a6133r3 SUBUNIT COMBINATION OF THE ~UMAN
GABAA RECEPTOR
Human as (see Tntf~rn~ti~nsll patent sp~ ifi-~tl~n no. WO
92/22~52), ,B3 (Wagstaff et al, Genomics, lg91, 11, 1071) and y3 cDNAs were subcloned into the eukaryotic ~p~ iiUIl vector pMSGneo (the preparation of which is described in WO 92/22(~52) using standard techniques (cf. Maniatis et al., in Molecular Clo~ing, A l,aboratory Manual, Cold Spring Harbor Press, New York, 2nd Edition, 1989) and a 25 stable cell line expressing human as~3y3 GABA-A receptor ~c~hlich~d according to the methodology described in Example l of WO 92/22652.
A~ !~.3 ~IEE, wo 9sl2s~34 2 l 8 8 2 5 8 ClIARACT~RT~ATTON OF STABLY TRANSFECTED CELLS
EXPRESSING as~3y3 SUBUNIT COMBINATION OF TiIE HUMAN

Expression of r~acr~hin ~nt s,~3Y3 hurnan GABAA receptors is ~ ' ' ' by r~linln~ir~l binding. Tr~ncfartPd cells which had been induced by culture in ~a~nl ~th ~c~ma crnt~ininE medium for 3-5 days (according to math n~l -' r ~y described in Example 2 of WO 92l22652) were harvested and cell mamhr~n Pc prepared (again according to m~th r ~nl rgy described in Example 2 of WO 92/22652). ~t..rAti.~n binding curves (Figure 3) were obtained by inrllh~tinF cell mannhr~n~c with various .~.. l ~ ~I:.. c of 3H Rol5-1788 (obtained from New England Nuclear, Du15 Pont (U.K.) Ltd., Stevenage), with non-specific binding measured in the presence of 10~1M n....;~ .. (obtained from Sigma Chemical Company, Poole, UE~). All binding assays were p~ 1 in triplicate in an assay volume of 0.5ml, with an inCllh~tirn time of 90min at 4C.
Tnrllh~tinnq were iarmin~tPd by filtration through GF/B filters ~randel, 20 Gathersberg, MD) on a Tomtech cell harvester, followed by three washes in ice-cold assay buffer. After drying, filter-retained radioactivity was measured by liquid srintill~tinn counting.
A ce~l line prepared as described in Example 2 expressed approximately 80fmol [3H]Rol5-1788 binding sites/mg protein following a 25 5-day induction of receptor ''~ 4' '`" The ~,UleS~u.~ of human as, ~3 and y3 mRNA transcripts was rrnfirnn~ by isolation of mRNA, cDNA
synthesis and PCR using subunit specific oligonucleotide primers in a conventional manner.

W0 9~/29234 j Scatchard anRlysis of S~tl~rRti-m binding curves for [3HlRol5-1788 was p~ d for mPmhr~R~n~ pr~pRrRtirn~ from two cell lines ~ g the as,B3y3 subunit f'A~nhinRtii n according to the present invention, giving the following KD values (mean i SEM~: 0.32iO.06nM and 5 O.G3iO.llnM.

woss/2s234 2 1 8 ~258 ,~

SEQUENCE LISTING
(1) GENERAL INFORMATION:
6 (i) APPLICANT:
(A) NAME: Merck Sharp & Dohrae Limited ~B) STREET: T~ings Park (C) CITY: Harlow (D) STATE: Essex (E) COUNTRY: England (F~ POSTAL CODE (ZIP): CM20 2QR
(ii) TmE OF I~tENTION: Nucleic Acids (iii) NUMBER OF SEQUENCES: 8 (iv) COMPUTER RT.~AnAT~T.T1~ FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC rnmr;l~ihlp (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Versior~ #1.25 (EPO) (2) INFORMATTON ~OR SEQ ID NO: 1:

(i) SEQUENCE CHA~ACTERISTICS:
(A) LENGTH: ~1 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: sir gle a)) TOPGLOGY: linear Vl/O 95/29234 ~ 1 8 8 2 ~ ~ r~

(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
ATTC,.AGCTT ACC~TGGCTG CMAGCTGCT GCTTCTCTGC CTGTTCTCGG C 51 (2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARAl;l~ llCS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: 3inear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DES5RIPTION: SEQ ID NO: 2:
~CMTTGTTT AACGTGATCA TCACGGGTG 29 (2) INFORMATION FOR SEQ ID NO: 3:
(i) SEQUENCE CHARA( ~ CS:
(A) LENGTH: 34 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (I)) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

woss/2s234 21 8 8 2 5 8 P~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

(2) INFOR~IATION FOR SEQ ID NO: ~:
(i) SEQUENCE C~A :l~;~lSllCS:
(A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:
AGCCCGCGTA ATACCACTC~ CTATAGGGCG M 32 20 (2) INFORMATION FOR SEQ ID NO: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 base pairs ~) TYPE: nucleic acid 26 (C) STRANDEDNESS: single (D) TOPGLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:~

wo gs/29234 2 1 8 8 2 5 8 r~~
.

-~ (2) INFORMATION FOR SEQ ID NO: 6:
(i) SEQUENCE CHARA(;~ lCS:
(A) LENGTH: 27 base pairs ~) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUEN5E DESCRIPTION: SEQ ID NO: 6:
C~ACACCCAC ATATCGTTTG ATCCACA 27 (2) INFOP~MATION FOR SEQ ID NO: 7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1565 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(ix) FEATURE:
- (A) NAMEIKEY: CDS
(B) LOCATION: 33..143G
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:

=
WO 9929D4 2 1 ~ 8 2 ~ 8 Met Al~ Pro Lys Leu Leu Leu LeU Leu Cy Leu Ph~ ser Gly L~u His Al- Arg 8er Ars Ly~ V~ CIU

CAC GAT GM TAT G~A GAT TU TCA TU MC CAA AAG TGC GTC TTC CCT 149 0 Clu Asp Clu Tyr GIU Asp Ser ser S~r Asn Gln Lys Trp Val LeU Aln CCA MM TCC CAA G~C ACC GAC CTC ACT CtT ATT CTC MC AAC TTC CTA 197 Pro Lys s~r Cln Asp Thr Asp V l Thr Leu lle Leu Asn Lys LeU Leu Arg Glu Tyr Asp Lys Lys LeU Arg Pro Asp lle Gly lle Lys Pro Thr GTA ATT GAC GTT GAC ATT TAT GTT MC AGC ATT GGT CCT GTG TCA Ta 293 V~l lle Asp Val Asp lle Tyr Val ~sn Ser lle Gly Pro Vol Ser ser lle Asn Me~ Glu Tyr Gln lle Asp lle Phe Phe Ala G~n Thr Trp Thr Asp Ser Aro Leu Arg Ph~ Asn S~r Thr M~t Lys l~e L~u Thr Leu Asn ser Asn Met Va~ G~y Leu l~e Trp l~e Pro Asp Thr l~e Phe Arg Asn lZ0 125 130 135 ser Lys Thr Ala G~u Al~ H~s Trp lle Thr Thr Pro Asn Gln Leu Leu Arg lle Trp Asn Asp Gly Lys lle Leu Tyr Thr Leu Arg Leu Thr lle . . .

~ WO 9~Q9234 2 1 8 ~ 2 5 8 P~

A~n Al- Glu Cy~ Gln Leu G~n Leu Hi~ Asn Phe Pro Met Asp Glu Nis 170 1h 180 5TCc TGC CCG CTG ATT TTC TCC AGC TAT CGC TAT CCC MM C~A CM ATG 629 Ser Cys Pro Leu l~e Ph~ Ser Ser Tyr Gly Tyr Pro Lys Glu Glu Met 0lle Tyr Arg Trp Arg Ly~ Asn Ser Vnl Glu Ala Al- Asp Cln Ly Ser Trp Arg Leu Tyr Gln Phe Asp Ph~ M~t Gly Leu Arg A~n Thr Thr Glu ATC GTG ACA ACG TCT GCA GGT GAT TAT GTT GTC ATG ACT ATA TAT TTT m lle Val Thr Thr Ser ~1- Gly Asp Tyr V-l V-l Met Thr 11- Tyr Ph~

GAA TTG AGT AGA AGA ATG GGA TAC TTC ACC ATT CAG AC~ TAC ATT CCC 821 Glu Leu S~r Arg Arg Met Gly Tyr Phe Thr l~e Gln Thr Tyr lle Pro 25TGT ATA CTG ACT GTG CTT TTA TCC TGG GTG TU TTT TGG ATC AAA A~A 869 Cy~ ~e Leu Thr Yal V~l Leu ser Trp Val Ser Phe Trp lle Ly5 Lys GAT GCT ACG CCA GCA AGA ACA GCA TTA GGC ATC ACC A~G GTG CTG ACC 917 30Asp Al- Thr Pro Al- Arg Thr Al~ Leu Gly lle Thr ~ - V~l Leu Thr Met Thr Thr Leu Ser Thr lle Alfl Arg Lys Ser Leu Pro Arg V-l Ser 35 ~oo 305 310 Tyr V-l Thr Ala Met Asp Leu Phe Val Thr Val Cys Phe Leu Phe Val Phe Al- Ala Leu Met GIU Tyr AL- Thr Leu Asn Tyr Tyr Ser Ser Cys wossns234 2 ~ 8 ~258 r~

AGA AAA CCA ACC ACC ACG AAA MG ACA ACA TCC TTA CTA CAT CCA CAT t109 Aro ~ys Pro Thr Thr Thr Lys Lyi Thr Thr S~r Leu Leu hi~ Pro Asp Ser S-r Arg Trp lle Pro Glu Ar~ lle S~r Leu C~n Al~ Pro ser Asn TAT TCC CTC CTC GAC ATC AGG CQ~ CCA CCA CCT CCG ATG ATC ACT TTA 1205 0 Tyr s~r Leu Leu Asp Het Ars Pro Pro Pro Pro Ala Met lle Thr Leu 3aO 3a5 390 MC MT TCC CTT TAC TCC CAC GAA TTT GAA GAT ACC TGT GTC TAT GAG ~253 A~n Asn S~r Va~ Tyr Trp Cln Clu Phe Clu Asp Thr Cys V~ Tyr CIU

TCT CTG GAT GCC AAA GAC TCT CAC ACC TTC TT~ TCC TGC TAT GAA CAA 1301 Cyc Leu Asp Gly Ly~ Asp Cyi Gln Ser Ph~ Phe Cys Cyr. Tyr GIU Glu TGT A~A TCA GGA TCC TCC ACC AAA CCC CCT ATT CAC ATA GAC ATC TTC 1349 Cy~ Lys Ser Gly Ser Trp Ars LYs G~y Ars lle Uis lle Asp lle Leu Clu Leu ASp Ser Tyr ser Arc V~l~ Phe Phe Pro Thr Ser Phe Leu Leu Ph~ Asn Leu Vl~ Tyr Trp Val G~y Tyr Leu Tyr Leu TCAGAGTGAA GAGTGMGAG CATTTGGTAC ACACTTGACC TTCTGTCGTC CCCAGACC~G 1503 (2) INFOR~ATION FOR SEQ ID NO: 8: .
(i) SEQUENCE CHARA~ lCS:
(A) LE~GTH: 467 amino aci~s wo 95~2~234 2 ~ 8 8 2 ~ 8 r~

~) TYPE: an~ino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ m NO: 8:
Met Ala Pro Lys Leu Leu Leu Leu Leu Cys L~u Phe Ser Sly Leu Hi~

Ala Arg Ser Arg Lys VAI Glu Glu Asp Glu Tyr G~u Asp Ser Ser Ser Asn Gln Lys Trp V~l Leu Al- Pro Lys Ser Gln Asp Thr Asp V~l Thr L~u lle Leu Asn Lys Leu Leu Ars Glu Tyr Asp Lys Lys Leu Arg Pro Asp 1~ Gly l~e Lys Pro Thr Val lle Asp Val ~sp lle Tyr Val Asn ser lle Cly Pro Vl~l 5~r Ser lle Asn Met Olu Tyr Cln ILe Asp 11 Phe Phe Al~ Gln Thr Trp Thr Asp Ser Arg Leu Arg Phe Asn Ser Thr Mee Lys lle Leu Thr Leu Asn Ser Asri Met V~l C~y Leu lle Trp lle Pro Asp Thr lle Phe Arg Asn ser Lys Thr Al~ Clu Ala His Trp lle Thr Thr Pro Asn Cln Leu Leu Ars 1 le Trp Asn Asp Gly Lys I le Leu 145 tS0 155 160 Tyr Thr Leu Arg Leu Thr lle Asn Al~ Clu Cys Cln Leu Cln Leu His Asn Phe Pro Met Asp Clu His Ser Cys Pro Leu lle Phe Ser Ser Tyr W0 95/29234 2 1 8 8 2 5 8 ~ . ~ 1 ~

Gly Tyr Pro Ly~ C~u Clu Met lle Tyr Arg Trp Arg Ly~ A~n Ser Val Glu Al- Al- Asp Gln Ly~ Ser Trp Arg Leu Tyr Gln Ph~ Asp Phe Ret 2~0 215 220 Gly Leu Arg A~n Thr Thr Glu 11~ Val Thr Thr Ser AIA Gly Asp Tyr 0 Val V~l Met Thr lle Tyr Phe Glu L~U Ser Arg Arg Met Gly Tyr Phe Thr lle Gln Thr Tyr lle Pro Cys 11~ Leu Thr V l V-l Leu Ser Trp Val Ser Phe Trp lle Ly~ Lys A~p Ala Thr Pro Al- Arg Thr Al- Leu Cly lle Thr Thr Vol Leu Thr Met Thr Thr Leu ser Thr lle Alo Ar~

Lys Ser Leu Pro Arg V-l Ser Tyr V~l Thr Al- Met Asp L~u Phe Val 305 310 ~tS 320 Thr V l Cys Phe Leu Phe V-l Phe Al- Alo Leu Met Glu Tyr Al- Thr Leu Asn Tyr Tyr Ser Ser Cys Arg Lys Pro Thr Thr Thr Lys Lys Thr Thr Ser Leu Leu Ni~ Pro A~p Ser Ser Arg Trp lle Pro Glu Arg lle Ser Leu Cln Al- Pro ser A~n Tyr Ser Leu Leu Asp Met Arg Pro Pro Pro Pro A~a Met lle Thr Leu A~n Asn Scr Y-l Tyr Trp Gln Glu Phe 0 GIU Asp Thr Cy~ Val Tyr Glu Cy~ Leu Asp Gly Ly~ Asp Cys Gln Ser 405 4~0 415 he Phe CYs Cys Tyr Glu Glu Cys Lys Ser Gly Ser Trp Arg Lys Giy ~ W0 95129234 2 1 ~ 8 2 5 8 -Ar9 lle ~i- Ile ~sp lle Leu Glu Leu Asp Ser Tyr Ser Ar~ V~l Phe Phe Prr, Thr Ser Phe Leu Leu Phe Asn Leu V~ Tyr Trp Y~Z~ Gly Iyr 450 455 ~,60 Leu Tyr Leu

Claims (11)

CLAIMS:

1. A stably co-transfected eukaryotic cell line capable of expressing a human GABAA receptor, which receptor comprises at least one alpha receptor subunit, at least one beta receptor subunit and the gamma-3 receptor subunit depicted in SEQ.ID.NO.8.

2. A cell line as claimed in claim 1 wherein the cell line is a rodent fibroblast cell line.

3. A process for the preparation of a eukaryotic cell line capable of expressing a human GABAA receptor, which comprises stably co-transfecting a rodent fibroblast host cell with at least three expression vectors, one such vector harbouring the human cDNA sequence encoding an alpha receptor subunit, another such vector harbouring the human cDNA sequence encoding a beta receptor subunit, and a third such vector harbouring the human cDNA sequence depicted in SEQ.ID.NO.7 encoding the gamma-3 GABAA receptor subunit.

4. A process as claimed in claim 3 wherein the eukaryotic cell line is a rodent fibroblast cell line.

5. A DNA molecule encoding the .gamma.3 subunit of the human GABAA receptor comprising the sequence depicted in SEQ.ID.NO.:7 or a modified human sequence.

6. A recombinant expression vector comprising the nucleotide sequence of the human .gamma.3 GABAA receptor subunit depicted in SEQ.ID.NO.7 together with additional sequences capable of directing the synthesis of the said human .gamma.3 GABAA receptor subunit in cultures of stably co-transfected eukaryotic cells.

7. A protein preparation of human GABAA receptor subunit combinations comprising the human .gamma.3 GABAA receptor subunit derived from a culture of stably co-transfected eukaryotic cells.

8. A membrane preparation containing GABAA receptor subunit combinations comprising the human .gamma.3 GABAA receptor subunit derived from a culture of stably co-transfected eukaryotic cells.

9. A preparation as claimed in claim 7 wherein the subunit combination derived is the .alpha.5.beta.3.gamma.3 subunit combination of the human GABAA receptor.

10. A preparation as claimed in claim 8 wherein the subunit combination derived is the .alpha.5.beta.3.gamma.3 subunit combination of the human GABAA receptor.

11. The use of the cell line as claimed in claim 1, and membrane preparations derived therefrom, in screening for and designing medicaments which act upon the human GABAA receptor.