JPH10500007A - Human γ lower 3 GABA lower A receptor subunit and stably co-transfected cell line - Google Patents

Abstract

(57) Abstract: The invention includes a cloning of a novel cDNA sequence encoding the gamma ₃ receptor subunit of human GABA _A receptor, at least one of the α receptor subunit, at least one β receptor subunit, and gamma ₃ may human GABA _a receptor comprising receptor subunits were expressed, the eukaryotic cell line co-transfected stably, drugs that act on the human GABA _a receptor to screening and design The use of cell lines as described above.

Description

DETAILED DESCRIPTION OF THE INVENTION           Stably co-transfected cell lines   The present invention relates to human GABA_ANovel cDs encoding specific subunits of the receptor It concerns cloning of NA sequences. The present invention can further express the above cDNA. Screening for the design and development of stable cell lines and subtype-specific drugs It also relates to the use of said cell lines in the imaging technology.   γ-Aminobutyric acid (GABA) is the major inhibitory neurotransmitter present in the central nervous system Substance. This substance is GABA_AIntrinsic in the receptor Mediates rapid synaptic depression by opening chloride channels. GABA_A The receptor is a benzodiazepine in addition to a site for the agonist ligand GABA. Binding for Various Drugs Including Barbiturates and β-Carboline Multimer protein having a site and having a molecular size of 230 to 270 kDa Quality (Stephenson, Biochem. J. 249, pp. . 21, 1988; Olsen and Tobin, Faseb J .; 4, p. 1469, 1990; and Sieghar t, Trends in Pharmacol. Sci. 10, p. 4 07, 1989).   Molecular biology studies have shown that the receptor has several different types of subunits. And their subunits are identified based on their sequence similarity. Into two classes (α, β, γ and δ). To date, six types of α sub-units [Schofield et al., Nature (London) 328, p. . 221, 1987; Levitan et al., Nature (London) 335, p. 76, 1988; Ymer et al., EMBO J. Clin. 8, p . 1665, 1989; Pritchett and Seeberg, J. Mol. Neurochem. 54, p. 802, 1990; Luddens et al. , Nature (London) 346, p. 648, 1990; And Khrestchatisky et al., Neuron 3, p. 745, 1 989] and three β subunits (Ymer et al., EMBO J. 8, p. 1). 665, 1989), and two types of gamma subunits (Ymer et al., EMBO J. Clin.   9, p. 3261, 1990; and Shivers et al., Neuron. 3, p. 327, 1989), and one δ subunit (Shivers et al., Neuron 3, p. 327, 1989).   The characteristic distribution of many subunits is useful for in situ hybridization. Thus, it has been elucidated (Sequier et al., Proc. Natl. Aca. d. Sci. USA 85, p. 7815, 1988; Malherb e. Neurosci. 10, p. 2330, 1990; And Shivers et al., Neuron 3, p. 327, 1989) This means that either subunit has its co-localization (co-localization). ) Makes it possible to speculate whether they could theoretically be present in the same receptor complex I do.   Co-transfect subunits of various combinations into cells, Its pharmacological properties are in vivo authentic GABA_ASame as receptor Identification of synthetic subunit combinations has been performed [Pri tchett et al., Science 245, p. 1389, 1989; N alherbe et al. Neurosci. 10, p. 2330, 19 9 0; Pritchett and Seeberg, J .; Neurochem. 54, p. 1802, 1990; and Ludens et al., Nature. (London) 346, p. 648, 1990]. With this approach In addition to α and β subunits, γ₁if Or γ_Two[Pritchett et al., Nature (London) 338, p. 582, 1989; Ymer et al., EMBOJ. 9, p. 3261 , 1990; and Malherbe et al. Neurosci. 10 , P. 2330, 1990] or γ_Three(Herb et al., Proc. Nat. l. Acad. Sci. USA 89, p. 1433, 1992; Knoflach et al., FEBS Lett. 293, p. 191, 19 91; and Wilson-Shaw et al., FEBS Lett. 284, p. 211, 1991) are also usually required, and the expressed receptor vs. benzodiazepi Pharmacological properties may depend primarily on the equivalence of existing α and γ subunits. found. The receptor with the δ subunit (ie, αβδ) is a benzodiazepine Are not considered to be combined (S Hivers et al., Neuron 3, 327, 1989). BZ₁Type acceptance Body (α₁β₁γ_Two) And BZ_TwoType receptor [α_Twoβ₁γ_TwoOr α_Threeβ₁γ_TwoPritc; Hett et al., Nature (London) 338, p. 582, 19 89], and novel pharmacological properties GABAs with_AReceptor α_Fiveβ_Twoγ_Two(Pritchett and Seebe rg, J.M. Neurochem. 54, p. 1802, 1990) And α₆β_Twoγ_Two[Luddens et al., Nature (London) 346,   p. 648, 1990]. Pharmacological properties of these expressed receptors Mimics the pharmacological properties of receptors identified in brain tissue by radioligand binding Although these receptor subunit combinations are considered in vivo It has not yet been shown to exist in vo.   Human γ_Three  GABA_ACombination of subunits including receptor subunits Has been human γ_Three  Not possible because no cDNA was available. Therefore, the use of cell lines to screen for subtype-specific drugs Is limited and γ_ThreeSubunit including subunit It was not possible to study the pharmacological properties of tocombination.   The present inventors have finally found that human GABA_AReceptor γ_ThreeConfirm subunit cDNA sequence I accepted. This nucleotide sequence is referred to as the deduced amino acid sequence corresponding to the sequence. Both are shown in FIG. 2 of the accompanying drawings.   Accordingly, the present invention provides, in the first aspect, all or one of the sequences shown in FIG. Human GABA comprising part or modified human sequence_AReceptor γ_ThreeSubunit A DNA molecule encoding   Sequencing of the novel cDNA molecules according to the present invention is accomplished by standard procedures described below in Example 1. Or Maniatis et al., "Molecular C loning: A Laboratory Manual, "2nd ed ition, Cold Spring Harbor Press, New   Other molecular classes well known to those skilled in the art, as described in York, 1989. It can also be implemented by a cloning technique.   In another aspect, the present invention provides a GABA_AReceptor γ_ThreeSubunit nucleotide Stable simultaneous transfer of sequences GABA in culture of isolated eukaryotic cells_AReceptor γ_ThreeSubunit synthesis And a recombinant expression vector comprising an additional sequence capable of directing   As used herein, the term "expression vector" refers to a recombinant in an appropriate host. Transcription of a cloned copy of a DNA sequence or gene and translation of its mRNA Means the DNA sequence required for Vectors such as those described above harbor eukaryotic genes. Various hosts such as fungi, cyanobacteria, yeast cells, insect cells, plant cells and animal cells And can be used for expression. Specially designed vectors include bacteria-yeast, bacteria -It allows the shuttling of DNA between plant or bacterial-animal cells. Suitable The constructed expression vector is an origin of replication for autonomous replication in host cells. , Selectable markers, limited number of useful restriction enzyme sites, high copy number, You should have a motor. The promoter tells RNA polymerase Are defined as DNA sequences that bind to and initiate RNA synthesis. Strong promo A promoter is a promoter that frequently initiates transcription into mRNA. You. Expression vectors include cloning vectors, modified cloning vectors, A separately designed plastic A sumid or virus may be included without limitation.   As used herein, the term “cloning vector” refers to a foreign cell into a host cell. A DNA molecule capable of self-replication in a host organism used for introducing a DNA fragment Means that the DNA molecule is usually a small plasmid or bacteriophage DNA It is. Foreign DNA, combined with vector DNA, can be Constitute the resulting recombinant DNA molecule. The cloning vector contains Sumids, bacteriophages, viruses and cosmids can be included.   The recombinant expression vector according to the present invention is GABA._A  γ_ThreeSubunit Nucleus Otide sequence into an appropriate expression vector precursor (hereinafter referred to as "vector precursor"), Prepared by insertion using conventional recombinant DNA techniques known to those skilled in the art. obtain. Vector precursors are commercially available or can be standardized from known expression vectors. It can be constructed by conventional technology. Vector precursor is a selectable marker, typically neo An antibiotic resistance gene such as a mycin or ampicillin resistance gene I do. Preferably, the vector precursor is SV40 initial splicing and polyadenylation. Next to Nylation area Contiguous neomycin resistance gene; ampicillin resistance gene; and origin of replication , For example, pBR322 orj. The vector precursor is preferably of the invention MMTV-LTR (dexamethasazo) so that transcription can be controlled in Inducible promoters such as metallothionein (inducible with zinc) It also has a tar. Thereby, GABA_AIntrinsic chloride channel in the receptor Thus, the problem of toxicity occurring in the cells is reduced or avoided.   One example of a suitable vector precursor is Clontech Laboratorie. s, Inc. There is pMAMneo available from (Lee et al., Nature e 294, p. 228, 1981; and Sardet et al., Cell 5 6, p. 271, 1989). Alternatively, in other cases, the vectors pMSG and And pSV2neo to construct the vector precursor pMSGneo.   GABA in the above vector precursor_AReceptor γ_ThreeSubunit cDNA Thus, the recombinant expression vector of the present invention is prepared. Receptor sub Subclone the cDNA from the vector containing the unit cDNA And transform this into a vector precursor such as pMAMneo or pMSGneo. A restriction enzyme site in the relinker, such as a HindIII site, is known to those skilled in the art. Ligation is performed using standard cloning techniques, particularly techniques similar to those described herein. Before this subcloning, γ_ThreeSub-uni Modifying the ends of the human cDNA by adding a 5 'untranslated sequence, for example, γ_Three The 5 'end of the subunit DNA is α₁5 'untranslated region obtained from subunit DNA It is often advantageous to modify by adding a region sequence.   One suitable expression vector of the present invention is shown in FIG. 1 of the accompanying drawings. R in the figure is GA BA_AReceptor γ_ThreeSubunit nucleotide sequence, the expression vector shown The rest of the-is derived from the vector precursor pMSGneo.   The invention provides, according to yet another aspect, at least one α-subunit, one β subunit, and γ_ThreeGABA including subunit_ACapable of expressing the receptor, Also provided are stably co-transfected eukaryotic cell lines.   The cell lines are α, β and γ_Three  GABA_AC encoding the receptor subunit Three types of DNA each holding DNA Obtained by co-transfecting cells with an expression vector. Therefore The present invention provides, in yet another aspect, GABA_AEukaryotic cell line capable of expressing the receptor Also provided is a method for preparing a eukaryotic host cell comprising at least three expression vectors. One of said vectors, including co-transfection stably with a vector. Is α GABA_ACarrying the cDNA sequence encoding the receptor subunit, The vector is β GABA_AContains cDNA sequence encoding receptor subunit And the third vector is γ_Three  GABA_ACDNA encoding the receptor subunit Holds an array. The established stable cell line is αβγ_Three  GABA_AExpressed receptor Let Α, β and γ expressed in such cell lines_ThreeFeatures of subunit Individual receptors consisting of certain combinations are referred to as GABA_AReceptor "Subuni This is referred to as a "set combination". From pharmacological and electrophysiological data, Recombinant αβγ expressed in cells of the invention_ThreeThe receptor is natural GABA_AReceptor It is confirmed that the compound has various properties considered to have.   GABA_AReceptor expression is dependent on the expression of various promoters in various host cells It can be realized by the system. Eukaryotic host Vesicles include yeast, insect and mammalian cells as appropriate. Preferably, the receptor Eukaryotic cells that can provide a host for expression are mammalian cells. Suitable host cells Include rodent fibroblasts such as mouse Ltk^-, Chinese hamster ovary ( CHO) and baby hamster kidney (BHK); HeLa; and HEK2 93 cells are included. In order to produce the desired receptor, at least one α Subunit, one β subunit, and γ_ThreeSubunits into the cell line There must be. Receptor subunit combinations within this limit The choice is made according to the type of activity or selectivity to be leaned. For example, Nzodiazepines (denoted as BZ) are GABA_AA group of drugs that act on receptors You. α₁Existence of subunit is BZ₁A class of benzos with pharmacological properties called Specific for diazepines, while α_Two~ Α_FiveIs widely used in BZ_TwoCalled Define different pharmacological properties. Species of β-subunit in benzodiazepine classification rules The class is not important, but the β subunit is required. The definition of BZ selectivity is γ_ThreeSa Buunit is also important. Difference between α subunit selectivity is γ_ThreeTo subunit Considered to be granted by Can be   To use the present invention most effectively for screening, Forming a library of cell lines with subunit combinations preferable. Typically, a library of 5 or 6 cell lines is It is suitable. Preferred subunit combinations are α_Twoβ₁γ_ThreeAnd α_Threeβ₁ γ_Three, And especially α_Fiveβ_Threeγ_ThreeIs included. These are α₁β₁γ_Two, Α₁β_Twoγ_Two, Α_Two β₁γ₁, Α_Twoβ₁γ_Two, Α_Threeβ₁γ_Two, Α_Fourβ₁γ_Two, Α_Fiveβ₁γ_Two, Α₆β₁γ_TwoAnd α₁β₁ γ_2LAnd other cell lines having other subunit combinations.   As mentioned above, for any of the cell lines of the invention, one vector is αα Subunit, another vector has a β subunit and a third vector Is γ_ThreeThree types of vectors having subunits are required.   Once the desired combination of the three expression vectors has been obtained, the vector Co-transfect the cells with a thermometer. Transform eukaryotic cells in vitro There are several techniques commonly used for effecting. Phosphate cal of DNA Cium precipitation is the most commonly used (Bac Hetti et al., Proc. Natl. Acad. Sci. USA 74 Pp. 1590-1594, 1977; Maitland et al., Cell.   14, pp. 133-141, 1977), this technique is also favorable for the present invention. Good.   A low percentage of host cells take up the recombinant DNA. Low ratio of those host cells Wherein the DNA is integrated into the host cell chromosome. To such host cells Grows in the presence of neomycin, since the neomycin resistance gene has been introduced. The host cells can be selected by isolating individual clones. Then, on Each clone as described above is tested to identify those that produce the receptor. this Identification can be achieved, for example, by inducing production with dexamethasone, and then determining the presence of It is performed by detecting by gand binding.   In yet another aspect, the present invention provides a GABA_AReceptor subunit combination Human gamma, particularly from cultures of stably transfected eukaryotic cells_Three   GABA_AHuman GABA containing receptor subunit_AReceptor subunit combination A nation protein preparation is provided. The present invention also provides GABA_AReceptor subunit combinations, especially stable Human γ from cultures of transfected eukaryotic cells_Three  GABA_AReceptor Human GABA containing subunit_AContains receptor subunit combination Also provided are membrane preparations. In one particularly preferred embodiment, the present invention Transfected mouse Ltk fibroblasts^-Αβγ isolated from cells_ThreeSabyu Knit combination, especially α_Fiveβ_Threeγ_ThreeSub-unit combination Human GABA_AA cell membrane containing the receptor is provided.   Cell lines according to the invention and membrane preparations derived from said cell lines are_AActs on receptors Drugs such as benzodiazepines, barbiturates, β-carboline and Useful for screening and designing transsteroids It is. The present invention therefore relates to the cell lines and membrane preparations derived from said cell lines as described above. ABA_AProvided is a use for screening and designing a drug acting on a receptor. Of particular importance in this regard are the various subunit combinations GABA_AA molecule that can selectively interact with a receptor. Very obvious Wax, according to the present invention Cell lines and membrane preparations derived therefrom have various GABA_AReceptor subtype Provides an ideal system for studying structure, pharmacological properties and function.   The present invention is further described by the following non-limiting examples.Example 1 Isolation and sequencing of NA a)cDNA library   CDNA was cloned from a human fetal brain cDNA library. All cDNA The library was constructed in a λZAP vector and Stratagene (S an Diego, California). Screenini For the cDNA library, plate the 137 mm plate according to the manufacturer's instructions. Plates were plated at 40,000 pfu per cell. Hybond N filter ( Amersham) was used according to the manufacturer's instructions to remove the filter lift.   First, rat γ_ThreeSequences (Knoflach et al., FEBS Lett. 2 93, p. 191, 1991) Oligonucleotide primers derived from 5'ATTCAAGCTTACCATGGCTGCAAAGCTGCTGCTT CTCTGCCTGTTCTCGGGG 3 '(base pairs 177 to 217; 5' end 13 contains a HindIII restriction site; SEQ ID NO: 1), and 5 'GGAA TTGTTTAACGTGATCCATCACGGGTG3 '(base pair 1330 to 1358; antisense; SEQ ID NO: 2) Rat γ by PCR using_Three  A cDNA probe was generated. PCR is Using rat brain cDNA as a template, for example, Whiting et al., Proc.   Natl. Acad. Sci. USA 87, p. 9966, 1990 Performed as described. A 1250 bp PCR product was obtained, which was Upon digestion with indIII, it was cut into two pieces of 900 bp and 350 bp in size. The 900 bp fragment was converted to pBluescript SK (-) (Stratagene ) Were subcloned into the HindIII site and their equivalence determined by standard techniques and S equinase II enzyme (United States Biochemical) als) was confirmed by DNA sequencing.   Human fetal brain cDNA library³²Rat γ as described above labeled with P_Three  90 Screening was performed using 0 bp DNA. A single cDNA clone was obtained. Applied Biosystems 373A DNA Sequencer and Color Dye terminator chemicals should be supplied according to the manufacturer's instructions. Sequence analysis was performed using the cage. This cDNA is the 5 'end of the coding region And both the 3 'end. These are anchored P Obtained later by CR. In the case of the 3 'end, near the 3' end of the truncated cDNA clone Sense oligonucleotide derived from the adjacent sequence 5'CCAGATTCCTCAAGATGATCTCTGAGCGGAATAAG 3 '(including EcoRI site; SEQ ID NO: 3) Is an oligonucleotide derived from the T7 primer sequence of the pBluescript vector. Leotide “anchor” primer 5'AGCGCGCGTAATACGACTCACTATAGGGCGAA3 ' (SEQ ID NO: 4) Along with the PCR reaction using a human fetal brain cDNA library as a template Was. 500 bp PCR product obtained This was introduced into pBluescript SK (-) cut with EcoRI. It was cloned. By sequencing as described above, the product is human γ_Three It should have the 3 'end of the coding region together with 131 bp of 3' untranslated region sequence. And confirmed. γ_Three  The missing 5 'sequence of the cDNA was imported from CLONTECH. The human brain "5 'RACE Ready cDNA" (part number 7302) -1) and truncated γ_Three  derived from the 5 'end of the cDNA clone itself Antisense primer 5'GCTTTTATCATATGCCTCTTAGCAAC3 '(SEQ ID NO: 5 ),as well as 5 'CAAGACCCACATATGGTTTGATGGAGA3' (SEQ ID NO: 6) Was obtained using Perform anchored PCR as per manufacturer's p-PCR product was obtained, again according to the manufacturer's instructions, p-CR-Scri. Subcloned into pt vector (Stratagene). DNA sequencing By convention, the 200 bp PCR product_Three  The missing 5 'cDNA Coding region together with a 25 bp 5 'untranslated region.   Human γ_ThreeThe complete nucleotide sequence of the cDNA encoding the subunit; The deduced amino acid sequence corresponding to the sequence is shown in FIG. 2 of the accompanying drawings and SEQ ID NO: 7.Example 2 Preparation of stably transfected cells expressing cations   Human α_Five  cDNA (see WO 92/22652), human β_Three   cDNA (Wagstaff et al., Genomics 11, p. 1071). 1991) and human γ_Three  The cDNA is prepared using standard techniques (Maniatis et al.). , "Molecuar ar Cloning: Abortion Man. ual, "2nd Edition, Cold Spring Harbo rPress, New York, 1989). PMSGneo (the preparation of this vector is disclosed in Subcloned into human α_Fiveβ_Threeγ_Three  GABA_AExpress the receptor Stable cell lines were prepared according to the method described in Example 1 of the above-mentioned International Patent Application Publication. Established.Example 3 Characterization of stably transfected cells that express cations   Recombinant human α_Fiveβ_Threeγ_Three  GABA_AThe expression of the receptor is radioactive (radiolog) ical). (The above-mentioned International Patent Application Publication No. 92/22652) 3-5 days in medium containing dexamethasone) (according to the method described in Example 2 of The transfected cells induced by the culture during Cell membranes were prepared (by the method described in Example 2 of the published application). Like cell membrane Various concentrations of [^ThreeH] Ro15-1788 [New England Nucle ar, DuPont (UK) Ltd. , Obtained from Stevenage] Saturation binding curves (FIG. 3) were obtained by incubation and 10 μM full Nitrazepam (Sigma Chemical Company, Poole) , Obtained from UK). Any binding assay The assay volume was 0.5 ml, and the incubation time was 90 minutes at 4 ° C. Was repeated three times. End of incubation At the end of the test, the GF / B filter (Brande 1, Gathersberg, MD) and then with ice-cold assay buffer. Was washed three times. After drying, the radioactivity retained by the filter is It was determined by counting the number of cells.   The cell line prepared as described in Example 2 was used for 5 days after induction of receptor expression, Approximately 80 fmol [^ThreeH] Expresses Ro15-1788 binding site I let it. As usual, mRNA isolation, cDNA synthesis, and subunit-specific PCR using various oligonucleotide primers_Five, Β_ThreeAnd γ_Three   The expression of the mRNA transcript was confirmed.   Α according to the invention_Fiveβ_Threeγ_ThreeTwo subunits that express subunit combinations For membrane preparations derived from the vesicle system,^ThreeH] Saturation of Ro15-1788 When the Scatchard analysis of the combined curve was performed, 0.32 ± 0.06 nM and 0.63 ± 0.11 nM K_DValues (mean ± SEM) were obtained.

[Procedure of Amendment] Article 184-8 of the Patent Act [Submission date] March 27, 1996 [Correction contents]   Human γ_Three  GABA_ACombination of subunits including receptor subunits Has been human γ_Three  Not possible because no cDNA was available. Therefore, the use of cell lines to screen for subtype-specific drugs Is limited and γ_ThreePharmacological properties of subunit combinations including subunits It was impossible to study.   The present inventors have finally found that human GABA_AReceptor γ_ThreeConfirm subunit cDNA sequence I accepted. This nucleotide sequence is referred to as the deduced amino acid sequence corresponding to the sequence. Both are shown in SEQ ID NO: 7 in the attached sequence listing.   Accordingly, the present invention provides, in the first aspect, all or one of the sequences shown in FIG. Human GABA comprising part or modified human sequence_AReceptor γ_ThreeSubunit A DNA molecule encoding   Sequencing of the novel cDNA molecules according to the present invention is accomplished by standard procedures described below in Example 1. Or Maniatis et al., "Molecular C loning: A Laboratory Manual, "2nd ed ition, Cold Spring Ha rbor Press, New York, 1989, It can be performed by other molecular cloning techniques well known to those skilled in the art.   In another aspect, the present invention provides a GABA_AReceptor γ_ThreeSubunit nucleotide The GAB in culture of stably co-transfected eukaryotic cells A_AReceptor γ_ThreeRecombinant expression with additional sequences that can direct subunit synthesis Provide the vector.   As used herein, the term "expression vector" refers to a recombinant in an appropriate host. Transcription of a cloned copy of a DNA sequence or gene and translation of its mRNA Means the DNA sequence required for Neomycin resistance adjacent to SV40 early splicing and polyadenylation region Sex gene; ampicillin resistance gene; and origin of replication, eg, pBR322   ori. The vector precursor is preferably transcribed in the cell line of the invention. MMTV-LTR (inducible with dexamethasone) and meta It also has an inducible promoter, such as rothioneine (inducible with zinc). in addition Therefore, GABA_ADue to the internal chloride channel in the receptor, The resulting toxicity problems are reduced or avoided.   One example of a suitable vector precursor is Clontech Laboratorie. s, Inc. There is pMAMneo available from (Lee et al., Nature e 294, p. 228, 1981; and Sardet et al., Cell 5 6, p. 271, 1989). Alternatively, in other cases, the vectors pMSG and And pSV2neo to construct the vector precursor pMSGneo.   GABA in the above vector precursor_AReceptor γ_ThreeSubunit cDNA Thus, the recombinant expression vector of the present invention is prepared. Receptor sub Unit c The cDNA is subcloned from a vector carrying the DNA, and Restriction enzymes in polylinkers of precursors such as pMAMneo or pMSGneo Standard cloning, known to those skilled in the art, at an elementary site, such as a HindIII site The method may be coupled in a manner similar to that described herein, in particular, the techniques described herein. This subcloning Before the expression, to achieve more preferable expression, γ_ThreeTerminate the subunit cDNA Modifying by the addition of a 5 'untranslated sequence, for example, γ_ThreeSubunit of DNA 5 'end is α₁By adding the 5 'untranslated region sequence obtained from the subunit DNA Modifications are often advantageous. 5 'CAAGACCCACATATGGTTTGATGGAGA3' (SEQ ID NO: 6) Was obtained using Perform anchored PCR as per manufacturer's p-PCR product was obtained, again according to the manufacturer's instructions, p-CR-Scri. Subcloned into pt vector (Stratagene). DNA sequencing By convention, the 200 bp PCR product_Three  The missing 5 'cDNA Coding region together with a 25 bp 5 'untranslated region.   Human γ_ThreeThe complete nucleotide sequence of the cDNA encoding the subunit; The corresponding amino acid sequence is shown in SEQ ID NO: 7.Example 2 Preparation of stably transfected cells expressing cations   Human α_Five  cDNA (see WO 92/22652), human β_Three   cDNA (Wagstaff et al., Genomics 11, p. 1071,   1991) and human γ_Three  The cDNA is prepared using standard techniques (Maniat). is, et al., “Molecular Cloning: A Laboratory”   Manual, "2nd Edition, Cold Spring H arbor Press, New York, 1989). Biological expression vector pMSGneo (the preparation of this vector is described in Subcloned into human alpha_Fiveβ_Threeγ_Three  GABA_AThe receptor A stable cell line to be expressed is described in Example 1 of the above-mentioned International Patent Application Publication. Established according to law.The scope of the claims 1. Human GABA_AStably co-transfected, capable of expressing the receptor A eukaryotic cell line, wherein the receptor comprises at least one α-receptor subunit; At least one β receptor subunit and the γ shown in SEQ ID NO: 8_ThreeReceptor sub Cell lines containing units. 2. The cell line according to claim 1, which is a rodent fibroblast cell line. 3. Human GABA_AA method for preparing a eukaryotic cell line capable of expressing a receptor, comprising: Stably cotransfect rodent fibroblast host cells with at least three expression vectors And one of the vectors comprises an α receptor subunit. Another vector contains the human cDNA sequence, and another vector encodes the β receptor subunit. The third vector contains the human cDNA sequence_Three  GABA_AReceptor Method for carrying the human cDNA sequence shown in SEQ ID NO: 7 that encodes buunit . 4. 4. The method according to claim 3, wherein the eukaryotic cell line is a rodent fibroblast cell line. Method. 5. SEQ ID NO: 7 or the modified human sequence Including, human GABA_AReceptor γ_ThreeA DNA molecule that encodes a subunit. 6. Human γ shown in SEQ ID NO: 7_Three  GABA_AReceptor subunit nucleotides The sequence is transformed into the human γ in a culture of stably co-transfected eukaryotic cells._Three   GABA_ARecombination involving additional sequences that can direct the synthesis of receptor subunits Expression vector. 7. Human gamma from a culture of stably co-transfected eukaryotic cells_Three  G ABA_AHuman GABA containing receptor subunit_AReceptor subunit combination Protein preparation consisting of 8. Human gamma from a culture of stably co-transfected eukaryotic cells_Three  G ABA_AGABA containing receptor subunit_AReceptor subunit combination A membrane preparation containing 9. Subunit combination from culture is human GABA_AReceptor α_Fiveβ_Three γ_Three8. The method according to claim 7, wherein the combination is a subunit combination. Product. 10. Subunit combination from culture is human GABA_AReceptor α_Fiveβ_Three γ_ThreeSubunit combination 9. The preparation according to claim 8, wherein the preparation is 11. Human GABA of the cell line according to claim 1 and a membrane preparation derived from said cell line._A Screening and design of drugs acting on receptors.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁶ Identification code Agency reference number FI (C12N 5/10 C12R 1:91) (C12P 21/02 C12R 1:91)

Claims (1)

[Claims] 1. Human GABA_AStably co-transfected, capable of expressing the receptor A eukaryotic cell line, wherein the receptor comprises at least one α-receptor subunit; At least one β receptor subunit, and γ_ThreeCells containing receptor subunits system. 2. The cell line according to claim 1, which is a rodent fibroblast cell line. 3. Human GABA_AA method for preparing a eukaryotic cell line capable of expressing a receptor, comprising: Stably cotransfect rodent fibroblast host cells with at least three expression vectors And one of the vectors comprises an α receptor subunit. Another vector contains the human cDNA sequence, and another vector encodes the β receptor subunit. The third vector contains the human cDNA sequence_Three  GABA_AReceptor A method for retaining a human cDNA sequence encoding buunit. 4. 4. The method according to claim 3, wherein the eukaryotic cell line is a rodent fibroblast cell line. Method. 5. Human GABA containing all or a part of the sequence shown in SEQ ID NO: 7 in FIG._A Receptor γ_ThreeCode subunit A DNA molecule. 6. Human γ_Three  GABA_AStable simultaneous nucleotide sequence of receptor subunit The human γ in culture of transfected eukaryotic cells_Three  GABA_AReceptor A recombinant expression vector comprising an additional sequence capable of directing subunit synthesis. 7. Human γ from a culture of stably co-transfected eukaryotic cells_Three   GABA_AHuman GABA containing receptor subunit_AReceptor subunit combination A protein preparation comprising 8. Human γ from a culture of stably co-transfected eukaryotic cells_Three   GABA_AGABA containing receptor subunit_AReceptor subunit combination A membrane preparation containing a solution. 9. Subunit combination from culture is human GABA_AReceptor α_Fiveβ_Three γ_Three8. The method according to claim 7, wherein the combination is a subunit combination. Product. 10. Subunit combination from culture is human GABA_AReceptor α_Fiveβ_Three γ_Three9. The combination according to claim 8, wherein the combination is a subunit combination. Product. 11. Human GABA of the cell line according to claim 1 and a membrane preparation derived from said cell line._A Screening and design of drugs acting on receptors.