GB2291647A - Stable cell line expressing human NMDA R2B receptor submit - Google Patents

Abstract

The present invention relates to a stably co-transfected eukaryotic cell line capable of expressing a human N-methyl-D-aspartate (NMDA) receptor, which receptor comprises at least one human R1 subunit isoform, the human R2B subunit, and optionally one other human R2 subunit.

Description

STABLE CELL LINE EXPRESSING HUMAN NMDA R2B RECEPTOR SUBUNIT The present invention concerns a cell line, and in particular relates to a stable cell line capable of expressing a human N-methyl-Daspartate (NMDA) receptor. The invention also relates to complementary DNAs (cDNAs) encoding a novel human NMDA receptor subunit, and concerns in particular the nucleotide and deduced amino acid sequences of the human NMDA R2B receptor subunit.

The NMDA receptor is the major excitatory amino acid receptor that mediates glutamate transmission in the central nervous system. This receptor has been implicated in neuronal modulation, including long term potentiation in the hippocampus (Collingridge and Singer, TIPS, 1990, 11, 290). It is consequently believed to play a key role in memory acquisition and learning.

The integral channel of the NMDA receptor allows Ca2+ to permeate as well as Na+ and K+, and presents at least seven pharmacologically distinct sites. These include a glutamate binding site, a glycine binding site, a polyamine site, a dizocilpine binding site, a voltage dependent Mg2+ site, a Zn2+ binding site (Wong and Kemp, Ann.

Rev. Pharmacol. Toxicol., 1991, 31, 401) and an ifenprodil binding site (Carter et al., J. Pharmacol. Exp. Ther., 1988, 247, 1222).

The development of potent and selective NMDA receptor antagonists which penetrate into the brain has received considerable attention of late as an attractive strategy for treating and/or preventing conditions which are believed to arise from over-stimulation of neurotransmitter release by excitatory amino acids.Such conditions notably include neurodegenerative disorders arising as a consequence of such pathological conditions as stroke, hypoglycaemia, cerebral palsy, transient cerebral ischaemic attack, cerebral ischaemia during cardiac pulmonary surgery or cardiac arrest, perinatal asphyxia, epilepsy, Huntington's chorea, Alzheimer's disease, Amyotrophic Lateral Sclerosis, Parkinson's disease, Olivo-ponto-cerebellar atrophy, anoxia such as from drowning, spinal cord and head injury, and poisoning by exogenous and endogenous NMDA receptor agonists and neurotoxins, including environmental neurotoxins NMDA receptor antagonists may also be useful as anticonvulsant and antiemetic agents, as well as being of value in the prevention or reduction of dependence on dependence-inducing agents such as narcotics.

NMDA receptor antagonists have recently been shown to possess analgesic (see, for example, Dickenson and Aydar, Neuroscience Lett., 1991, 121, 263; Murray et al., Pain, 1991, 44, 179; and Woolf and Thompson, Pain, 1991, 44, 293) and anxiolytic (see, for example, US-5145866; and Kehne et al., Eur. J. Pharmacol., 1991, 193, 283) effects, and such compounds may accordingly be useful in the management of pain, depression and anxiety.

Compounds possessing functional antagonist properties for the NMDA receptor complex are stated in WO-A-91/19493 to be effective in the treatment of mood disorders, including major depression, bipolar disorder, dysthymia and seasonal affective disorder (cf. also Trullas and Skolnick, Eur. J. Pharmacol., 1990, 185, 1). Such compounds may consequently be of benefit in the treatment and/or prevention of those disorders.

The association of NMDA receptor antagonists with regulation of the dopaminergic system has recently been reported (see, for example, Werling et al., J. Pharmacol. Exp. Ther., 1990, 255, 40; Graham et al., Life Sciences, 1990, 47, PL-41; Hutson et al., Br. J. Pharmacol., 1991, 103, 2037; and Turski et al., Nature (London), 1991, 349, 414). This suggests that such compounds may thus be of assistance in the prevention and/or treatment of disorders of the dopaminergic system such as schizophrenia and Parkinson's disease.

It has also been reported recently (see Lauritzen et al., Journal of Cerebral Blood Flow and Metabolism, 1991, vol. 11, suppl. 2, Abstract XV-4) that NMDA receptor antagonists block cortical spreading depression (CSD), which may thus be of clinical importance since CSD is a possible mechanism of migraine. The class of substituted 2-amino-4- phosphonomethylalk-3-ene carboxylic acids and esters described in EP-A0420806, which are stated to be selective NMDA antagonists, are alleged thereby to be of potential utility in the treatment of inter alia migraine.

Excitatory amino acid receptor antagonists, including inter alia antagonists of NMDA receptors, are alleged in EP-A-0432994 to be of use in suppressing emesis.

Recent reports in the literature have also suggested a link between the neurotoxicity of certain viruses and the deleterious effects of these viruses on an organism caused by the potentiation of neurotransmission via excitatory amino acid receptors. Antagonists of NMDA receptors may therefore be effective in controlling the manifestations of neuroviral diseases such as measles, rabies, tetanus (cf.

Bagetta et al., Br. J. Pharmacol., 1990, 101, 776) and AIDS (cf. Lipton et al., Society for Neuroscience Abstracts, 1990, 16, 128.11).

NMDA antagonists have, Moreover, been shown to have an effect on the neuroendocrine system (see, for example, van den Pol et al., Science, 1990, 250, 1276; and Urbanski, Endocrinology, 1990, 127, 2223), and such compounds may therefore also be effective in the control of seasonal breeding in mammals.

A cDNA, encoding a subunit of the rat NMDA receptor and designated NMDA R1, has been cloned by expression cloning (Moriyoshi et al., Nature (London), 1991, 354, 31). When expressed in Xenopus oocytes, this cDNA exhibits the electrophysiological and pharmacological properties expected of an authentic NMDA receptor, although the levels of expression are extremely low. More recently, the existence of several discrete isoforms of the rat NMDA R1 receptor subunit, generated by alternative RNA splicing, has been reported (Sugihara et al., BBRC, 1992, 185, 826).Using both low stringency hybridization and polymerase chain reaction methodologies, four additional rodent NMDA receptor subunit cDNAs have been cloned: s1 or NMDA R2A; s2 or NMDA R2B; s3 or NMDA R2C; and s4 or NMDA R2D (see Monyer et al., Science, 1992, 256, 1217; Kutsuwada et al., Nature (London), 1992, 358, 36; Ikeda et al., FEBS Lett., 1992, 313, 34; and Ishii et al., J. Biol. Chem., 1993, 268, 2836).

Co-expression in Xenopus oocytes or transiently transfected cells of the NMDA R1 subunit, with any one of the R2A, R2B, R2C or R2D subunits referred to above, gives rise to a more robust NMDA receptor than that constituted by the NMDA R1 subunit alone (Monyer et al., Science, 1992, 256, 1217). Moreover, these four resulting putative NMDA receptors (R1/R2A; R1/R2B; R1/R2C; and R1/R2D) are observed to be pharmacologically and electrophysiologically distinguishable. These data support the hypothesis that a family of NMDA receptor subtypes with distinct pharmacological profiles may exist in the brain through combination of different subunits. However, since the systems described both involve transient expression, they are consequently unsuitable for screening purposes. The preferred means of expression from the point of view of drug screening is stable expression.

WO-A-94/11501 describes and claims a stably co-transfected eukaryotic cell line capable of expressing a human or animal NMDA receptor, in particular a human NMDA receptor, which receptor comprises at least one R1 subunit isoform, or at least one R1 subunit isoform and one or two R2 subunits; the resulting cell line is stated to be useful in designing and developing NMDA receptor subtype-specific medicaments.

Also described in WO-A-94/11501 is the molecular cloning of novel cDNA sequences encoding the human NMDA R2A receptor subunit and various isoforms of the human NMDA R1 receptor subunit.

We have now obtained by molecular cloning a novel cDNA sequence which encodes the human NMDA R2B receptor subunit.

Any of a variety of procedures may be used to molecularly clone human NMDA receptor cDNA. These methods include, but are not limited to, direct functional expression of the human NMDA receptor cDNAs following the construction of a human NMDA receptor containing cDNA library in an appropriate expression vector system. Another method is to screen a human NMDA receptor containing cDNA library constructed in a bacteriophage or plasmid shuttle vector with a labelled oligonucleotide probe designed from the amino acid sequence of the purified NMDA receptor protein or from the DNA sequence of known NMDA receptor cDNAs. The preferred method consists of screening a human NMDA receptor containing cDNA library constructed in a bacteriophage or plasmid shuttle vector with a 32P-labelled cDNA oligonucleotide-primed fragment of rodent NMDA receptor subunit cDNA.

The preferred human cDNA library is a commercially available human foetal brain cDNA library.

It is readily apparent to those skilled in the art that other types of libraries, as well as libraries constructed from other brain regions, may be useful for isolating DNA encoding the human NMDA receptor.

Other types of libraries include, but are not limited to, cDNA libraries derived from other tissues, cells or cell lines other than human foetal brain cells, and genomic DNA libraries.

Preparation of cDNA libraries can be performed by standard techniques well known in the art. Well known cDNA library construction techniques can be found, for example, in Maniatis, T., Fritsch, E.F., Sambrook, J., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Press, New York, 2nd edition, 1989).

It is also readily apparent to those skilled in the art that DNA encoding the human NMDA receptor may also be isolated from a suitable genomic DNA library.

Construction of genomic DNA libraries can be performed by standard techniques well known in the art. Well known genomic DNA library construction techiques can be found in Maniatis et al., supra.

Using the preferred method, cDNA clones encoding the human NMDA R2B receptor subunit were isolated by cDNA library screening. 32P-radiolabelled fragments of rodent NMDA receptor subunit cDNAs served as probes for the isolation of human NMDA R2B receptor subunit cDNA from a commercially available cDNA library derived from human foetal brain tissue.

For the molecular cloning of cDNA encoding the human NMDA R2B subunit, several hybridising clones were detected using the rodent NMDA receptor R2B subunit cDNA probes A and B as described in accompanying Example 1. None of the cDNAs obtained from a human foetal brain cDNA library encoded the complete human NMDA R2B deduced amino acid sequence. For this reason, a full-length cDNA was constructed from overlapping truncated cDNAs, as described in accompanying Example 2.

The complete nucleotide and deduced amino acid sequences of the cDNA encoding the human NMDA R2B receptor subunit are shown in Figure 1. The cDNA is 4939 bases long. Thetopen reading frame is between bases 143 and 4594. Bases 1-142 are 5' untranslated sequence, and bases 4595-4939 are 3' untranslated sequence. The deduced amino acid sequence is 1484 residues long and has 23 differences from the published rat NMDA R2B sequence (Monyer et al., Science, 1992, 256, 1217).

The cloned human NMDA R2B receptor subunit cDNA obtained through the methods described above may be recombinantly expressed by molecular cloning into an expression vector containing a suitable promoter and other appropriate transcription regulatory elements, and then transferring the expression vector into prokaryotic or eukaryotic host cells to produce a recombinant NMDA receptor.

Techniques for such manipulations are fully described in Maniatis et al., supra, and are well known in the art.

DNA encoding the NMDA R2B receptor subunit cloned into an expression vector may then be transferred to a recombinant host cell for expression. Recombinant host cells may be prokaryotic or eukaryotic, including but not limited to bacteria, yeast, mammalian cells (including but not limited to cell lines of human, bovine, porcine, monkey and rodent origin), and insect cells (including but not limited to drosophila derived cell lines).Cell lines derived from mammalian species which may be suitable and which are commercially available include, but are not limited to, L-M (ATCC CCL 1), HEK293 (ATCC CCL 1555), CV-1 (ATCC CCL 70), COS-1 (ATCC CRL 1650), COS-7 (ATCC CRL 1651), CHO-K1 (ATCC CCL 61), 3T3 (ATCC CCL 92), NIH/3T3 (ATCC CRL 1658), HeLa (ATCC CCL 2), C1271 (ATCC CRL 1616), BS-C-1 (ATCC CCL 26) and MRC-5 (ATCC CCL 171).

The expression vector may be introduced into host cells via any one of a number of techniques including but not limited to transformation, transfection, protoplast fusion, and electroporation. The expression vector-containing cells are clonally propagated and individually analyzed to determine whether they produce NMDA receptor protein. Identification of NMDA receptor expressing host cell clones may be done by several means, including but not limited to immunological reactivity with anti-NMDA receptor antibodies, and the presence of host cell-associated NMDA receptor activity.

Expression of NMDA receptor DNA may also be performed using in vitro produced synthetic mRNA. Synthetic mRNA can be efficiently translated in various cell-free systems, including but not limited to wheat germ extracts and reticulocyte extracts, as well as efficiently translated in cell based systems, including but not limited to microinjection into frog oocytes.

To determine the NMDA receptor cDNA sequence(s) that yield(s) optimal levels of binding activity and/or NMDA receptor protein, NMDA receptor cDNA molecules including but not limited to the following can be constructed: the full-length open reading frame of the human NMDA receptor cDNA depicted in Figure 1 and constructs containing portions of the cDNA encoding biologically active human NMDA receptor protein. All constructs can be designed to contain none, all, or portions of the 5' and 3' untranslated region of human NMDA receptor cDNA. NMDA receptor activity and levels of protein expression can be determined following the introduction, both singly and in combination, of these constructs into appropriate host cells.Following determination of the NMDA receptor cDNA cassette which yields optimal expression, this cDNA construct may be transferred to a variety of expression host cells, including but not limited to mammalian cells, baculovirus-infected insect cells, E. coli, and the yeast S. cerevisiae.

Expression of the human NMDA receptor in a recombinant host cell affords NMDA receptor protein in active form. Several purification procedures are available and suitable for use. Recombinant NMDA receptor may suitably be purified from cell lysates and extracts, or from conditioned culture medium, by various combinations of, or individual application of, salt fractionation, ion exchange chromatography, size exclusion chromatography, hydroxylapatite adsorption chromatography and hydrophobic interaction chromatography.

In addition, recombinant human NMDA receptor can be separated from other cellular proteins by use of an immuno-affinity column made with monoclonal or polyclonal antibodies specific for the NMDA receptor, or polypeptide fragments thereof. The preparation and purification of monoclonal or polyclonal antibodies specific for the NMDA receptor or polypeptide fragments thereof can be accomplished by conventional techniques well known in the art. Typical procedures include those described, for example, by Maniatis et al., in Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, New York, 2nd edition, 1989, Chapter 18.

The present invention is concerned with the production of permanently transfected cells containing a human NMDA receptor constituted by at least one human R1 subunit isoform, the human R2B subunit, and optionally one other human R2 subunit.

Accordingly, the present invention provides a stably cotransfected eukaryotic cell line capable of expressing a human NMDA receptor, which receptor comprises at least one human R1 subunit isoform, the human R2B subunit, and optionally one other human R2 subunit.

Suitable human R2 subunits, one of which may optionally be present in addition to the human R2B subunit in the human NMDA receptor expressed by the cell line according to the invention, include the human R2A, R2C and R2D subunits.

The cell line according to the present invention has been achieved by co-transfecting cells with expression vectors, each harbouring cDNAs coding for at least one human R1 subunit isoform, for the human R2B subunit, and optionally for one other human R2 subunit. In a further aspect, therefore, the present invention provides a process for the preparation of a eukaryotic cell line capable of expressing a human NMDA receptor, which comprises stably co-transfecting a eukaryotic host cell with a plurality of expression vectors, at least one such vector harbouring the cDNA sequence coding for a human NMDA R1 receptor subunit isoform (referred to in the art as the "key subunit"), another such vector harbouring the cDNA sequence coding for the human R2B subunit, and optionally one other such vector harbouring the cDNA sequence coding for another human NMDA R2 receptor subunit. The stable cell line which is established expresses a human R1+R2 NMDA receptor.

Each receptor thereby expressed, comprising a unique combination of at least one human R1 subunit isoform, the human R2B subunit, and optionally one other human R2 subunit, will be referred to hereinafter as an NMDA receptor "subunit combination". Pharmacological and electrophysiological data confirm that the recombinant human NMDA receptors expressed by the cells of the present invention have the properties expected of a native NMDA receptor.

As indicated above, expression of the NMDA receptor may be accomplished by a variety of different promoter-expression systems in a variety of different host cells. The eukaryotic host cells suitably include yeast, insect and mammalian cells. Preferably the eukaryotic cells which can provide the host for the expression of the receptor are mammalian cells. Suitable host cells include rodent fibroblast lines, for example mouse L(tk)-, Chinese hamster ovary (CHO) and baby hamster kidney (BHK); HeLa; and HEK293 cells. It is necessary to incorporate at least one human RI subunit isoform, the human R2B subunit, and optionally one other human R2 subunit, into the cell line in order to produce the required receptor. Within this limitation, the choice of receptor subunit combination is made according to the type of activity or selectivity which is being screened for.

In order to employ this invention most effectively for screening purposes, it is preferable to build up a library of cell lines, each with a different combination of subunits. Typically a library of 4 cell line types is convenient for this purpose. Preferred subunit combinations include: R1+R2B, R1+R2A+R2B, R1+R2B+R2C and R1+R2B+R2D.The nomenclature 'R1' signifies any one of the seven reported isoforms of the NMDA R1 subunit (Sugihara et al., BBRC, 1990, 185, 826): Rla, Rlb, Rlc, Rld, Rle, Rlf and Rlg. Where isoforms of the human NMDA receptor R2 subunits exist, it is to be understood that all such isoforms are included within the scope of the present invention.

Particular subunit combinations include Rla+R2B and Rla+R2A+R2B.

In a particular embodiment, the present invention provides a stably co-transfected eukaryotic cell line capable of expressing a human NMDA receptor comprising the Rla+R2B subunit combination.

In a further embodiment, the present invention provides a stably co-transfected eukaryotic cell line capable of expressing a human NMDA receptor comprising the Rla+R2A+R2B subunit combination.

As indicated above, the cDNAs for the receptor subunits can be obtained from known sources, and are generally obtained as specific nucleotide sequences harboured by a standard cloning vector such as those described, for example, by Maniatis et al., supra. The nucleotide sequences coding for the Rla, Rld and Rle isoforms of the R1 subunit, and that coding for the R2A subunit, of the human NMDA receptor are described and claimed in WO-A-94/11501.

In another aspect, the invention provides a recombinant expression vector comprising the nucleotide sequence of the human NMDA R2B receptor subunit together with additional sequences capable of directing the synthesis of the said NMDA receptor subunit in cultures of stably co-transfected eukaryotic cells.

The term "expression vectors" as used herein refers to DNA sequences that are required for the transcription of cloned copies of recombinant DNA sequences or genes and the translation of their mRNAs in an appropriate host. Such vectors can be used to express eukaryotic genes in a variety of hosts such as bacteria, blue-green algae, yeast cells, insect cells, plant cells and animal cells. Specifically designed vectors allow the shuttling of DNA between bacteria-yeast, bacteria-plant or bacteria-animal cells. An appropriately constructed expression vector should contain an origin of replication for autonomous replication in host cells; selectable markers; a limited number of useful restriction enzyme sites; a potential for high copy number; and strong promoters. A promoter is defined as a DNA sequence that directs RNA polymerase to bind to DNA and to initiate RNA synthesis.A strong promoter is one which causes mRNAs to be initiated at high frequency. Expression vectors may include, but are not limited to, cloning vectors, modified cloning vectors, specifically designed plasmids or viruses.

The term "cloning vector" as used herein refers to a DNA molecule, usually a small plasmid or bacteriophage DNA capable of selfreplication in a host organism, and used to introduce a fragment of foreign DNA into a host cell. The foreign DNA combined with the vector DNA constitutes a recombinant DNA molecule which is derived from recombinant technology. Cloning vectors may include plasmids, bacteriophages, viruses and cosmids.

A variety of mammalian expression vectors may be used to express recombinant NMDA receptor in mammalian cells. Commercially available mammalian expression vectors which may be suitable for recombinant NMDA receptor expression include, but are not limited to, pCDNAneo (Invitrogen), pCDNAI-Amp (Invitrogen), pCDM8 (Invitrogen), pMSGneo (Proc. Natl. Acad. Sci. USA, 1992, 89, 6378), pMClneo (Stratagene), pXT1 (Stratagene), pSG5 (Stratagene), EBO-pSV2-neo (ATCC 37593), pBPV-1(8-2) (ATCC 37110), pdBPV-MMTneo(342-12) (ATCC 37224), pRSVgpt (ATCC 37199), pRSVneo (ATCC 37198), pSV2dhfr (ATCC 37146), pUCTag (ATCC 37460), and gZD35 (ATCC 37565).

The recombinant expression vector in accordance with the invention may be prepared by inserting the nucleotide sequence of the human NMDA R2B subunit into a suitable precursor expression vector (hereinafter referred to as the "precursor vector") using conventional recombinant DNA methodology known from the art. The precursor vector may be obtained commercially, or constructed by standard techniques from known expression vectors. The precursor vector suitably contains a selection marker, typically an antibiotic resistance gene, such as the neomycin or ampicillin resistance gene. The precursor vector preferably contains a neomycin resistance gene, adjacent the SV40 early splicing and polyadenylation region; an ampicillin resistance gene; and an origin of replication, e.g. pBR322 ori.The vector also preferably contains an inducible promoter, such as MMTV-LTR (inducible with dexamethasone) or metallothionin (inducible with zinc), so that transcription can be controlled in the cell line of this invention. This reduces or avoids any problem of toxicity in the cells because of the ion channel intrinsic to the NMDA receptor.

One suitable precursor vector is pMAMneo, available from Clontech Laboratories Inc. (Lee et al., Nature, 1981, 294, 228; and Sardet et al., Cell, 1989, 56, 271). Alternatively the precursor vector pMSGneo can be constructed from the vectors pMSG and pSV2neo as described in Example 2, step (a) herein.

The recombinant expression vector of the present invention is then produced by cloning the NMDA receptor subunit cDNA into the above precursor vector. The required receptor subunit cDNA is subcloned from the vector in which it is harboured, and ligated into a restriction enzyme site in the polylinker of the precursor vector, for example pMAMneo or pMSGneo, by standard cloning methodology known from the art, and in particular by techniques analogous to those described in Example 2, step (b) herein.

One suitable expression vector of the present invention is illustrated in Figure 2 of the accompanying drawings, in which R represents the nucleotide sequence of the R2B subunit of the human NMDA receptor, and the remainder of the expression vector depicted therein is derived from the precursor vector pMSGneo and constructed as described in accompanying Example 2, steps (a) and (b).

For each cell line of the present invention, a plurality of such vectors will be necessary. At least one such vector will contain the cDNA sequence coding for a human R1 subunit isoform. Another such vector will contain the cDNA sequence coding for the human R2B subunit.

Optionally, one other such vector containing the cDNA sequence coding for another human R2 subunit may also be utilised.

Cells are then co-transfected with the desired combination of expression vectors, typically two or three expression vectors. There are several commonly used techniques for transfection of eukaryotic cells in vitro. Calcium phosphate precipitation of DNA is most commonly used (Bachetti et al., Proc. Natl. Acad. Sci. USA, 1977, 74, 1590-1594; Maitland et al., Cell, 1977, 14, 133-141), and represents a favoured technique in the context of the present invention.

A small percentage of the host cells takes up the recombinant DNA. In a small percentage of those, the DNA will integrate into the host cell chromosome. Because the neomycin resistance gene will have been incorporated into these host cells, they can be selected by isolating the individual clones which will grow in the presence of neomycin. Each such clone is then tested to identify those which will produce the receptor. This is achieved by inducing the production, for example with dexamethasone, and then detecting the presence of receptor by means of radioligand binding.

In order to prevent cell death induced by the expression of the recombinant human NMDA receptors, it has been found advisable to incorporate a substance capable of acting as a non-competitive NMDA receptor antagonist at an appropriate concentration into the culture medium. A particular non-competitive NMDA receptor antagonist is ketamine. Moreover, in order to enhance the efficiency of recombinant expression, a three-day induction period at 41 C has been found advantageous.

In a further aspect, the present invention provides protein preparations of human NMDA receptor subunit combinations, comprising at least one human R1 subunit isoform, the human R2B subunit, and optionally one other human R2 subunit, derived from cultures of stably transfected eukaryotic cells. The invention also provides preparations of membranes containing subunit combinations of the human NMDA receptor, comprising at least one human R1 subunit isoform, the human R2B subunit, and optionally one other human R2 subunit, derived from cultures of stably transfected eukaryotic cells.In particular, the protein preparations and membrane preparations according to the invention will suitably contain the R1+R2B, R1+R2A+R2B, R1+R2B+R2C or R1+R2B+R2D subunit combinations of the human NMDA receptor, wherein the nomenclature 'R1' signifies any one of the several isoforms of the R1 subunit as described above. Preferred subunit combinations include Rla+R2B and Rla+R2A+R2B. In one especially preferred embodiment, the invention provides cell membranes containing a human NMDA receptor consisting of the Rla+R2B subunit combination isolated from stably transfected mouse L(tk)- fibroblast cells. In another especially preferred embodiment, the invention provides cell membranes containing a human NMDA receptor consisting of the Rla+R2A+R2B subunit combination isolated from stably transfected mouse L(tk)- fibroblast cells.

The cell line, and the membrane preparations therefrom, according to the present invention have utility in screening and design of drugs which act upon the NMDA receptor. The present invention accordingly provides the use of the cell line described above, of membrane preparations derived therefrom, and of the cloned human NMDA receptor subunit as described herein, in screening for and designing medicaments which interact selectively with the NMDA receptor. Of particular interest in this context are molecules capable of interacting selectively with NMDA receptors made up of varying subunit combinations. As will be readily apparent, the cell line in accordance with the present invention, and the membrane preparations derived therefrom, provide ideal systems for the study of structure, pharmacology and function of the various NMDA receptor subtypes.

This invention provides an antisense oligonucleotide having a sequence capable of binding specifically with any sequences of an mRNA molecule which encodes the human NMDA R2B receptor subunit, so as to prevent translation of the mRNA molecule. The antisense oligonucleotide may have a sequence capable of binding specifically with any sequences of the cDNA molecule whose sequence is shown in, for example, Figure 1. A particular example of an antisense oligonucleotide is an antisense oligonucleotide comprising chemical analogues of nucleotides.

This invention provides a transgenic nonhuman mammal expressing DNA encoding the human NMDA R2B receptor subunit. This invention also provides a transgenic nonhuman mammal, so mutated as to be incapable of normal receptor activity, and not expressing the native NMDA R2B receptor subunit, which mammal is nonetheless capable of expressing DNA encoding the human NMDA R2B receptor subunit. This invention further provides a transgenic nonhuman mammal whose genome comprises antisense DNA complementary to DNA encoding the native NMDA R2B receptor subunit, so placed as to be transcribed into antisense mRNA which is complementary to mRNA encoding the receptor subunit and which hybridizes to mRNA encoding the receptor subunit thereby reducing its translation.The DNA may additionally comprise an inducible promoter or additionally comprise tissue specific regulatory elements, so that expression can be induced, or restricted to specific cell types. Examples of DNA are DNA or cDNA molecules having a coding sequence substantially the same as the coding sequence shown in, for example, Figure 1. An example of a transgenic animal is a transgenic mouse. Examples of tissue specificity-determining regions are the metallothionein promoter (Low et al., Science, 1986, 231, 1002-1004) and the L7 promoter (Oberdick et al., Science, 1990, 248, 223-226).

The following non-limiting Examples illustrate the present invention.

EXAMPLE 1 Isolation of cDNAs encoding the human NMDA R2B subunit Oligonucleotide primers derived from the published rat NMDA R2B cDNA sequence (Monyer et al., Science, 1992, 256, 1217; Ishii et al., J. Biol. Chem., 1993, 268, 2836) were used in the polymerase chain reaction (PCR) to generate two cDNA probes: (i) Primers for probe A (encoding residues Leu 910-Val 1193) were 5 'ACATGGGAATTCCTGTCTGGAGTAAACGGCT3' and 5'CCCAAGAAGCTTGCACCCCGCCTACCACTC3'. The first (sense) oligonucleotide had an EcoRI restriction enzyme site incorporated into it, while the second (antisense) oligonucleotide had a HindIII restriction enzyme site incorporated. PCR using rat brain cDNA as template was performed using standard techniques (e.g. Whiting et al., Proc. Natl.

Acad. Sci. U.S.A., 1990, 87, 9966-9970) to yield a PCR product of 860 bases in length which was subcloned into pBluescript Sk- (Stratagene).

(ii) Primers for probe B (encoding residues Val 558-Leu 824), derived by aligning the four rat R2A-D subunits and determining the consensus sequences, were 5'CGGGATCCGT(GC)TGGGTGATGATGTT(TC)GT(GC)ATG3' and 5 'C GAATTCAT(GA)TAGAA(TC)AC (GAC) CC(CT) GC CAT(GA)TT(GA)TC3'.

The first (sense) primer had a BamHI restriction enzyme site incorporated on the 5' end, while the second (antisense) primer had an EcoRI restriction enzyme site. PCR using human brain cDNA as template was performed using standard techniques (e.g. Whiting et al., Proc. Natl.

Acad. Sci. U.S.A., 1990, 87, 9966-9970) to yield a PCR product of 800bp which was subcloned into pBluescript Sk- (Stratagene).

Both probes were verified by DNA sequencing on an Applied BioSystems 373A sequencer, using dye labelled primer or dye labelled terminator chemistry, according to the manufacturer's instructions.

A human foetal brain cDNA library in XZAP (Stratagene) was screened with probe A under moderate stringency (420C in 5 x SSPE, 5 x Denhardt's solution, 100 Fg/ml salmon sperm DNA, 0.1% sodium dodecyl sulphate, 30% formamide, for 18 hours; wash in 1 x SSPE, 55"C) and probe B under high stringency (420C in 5 x SSPE, 5 x Denhardt's solution, 100 Rg/ml salmon sperm DNA, 0.1% sodium dodecyl sulphate, 50% formamide, for 18 hours; wash in 0.3 x SSPE, 65"C), using standard techniques (e.g. Maniatis et al., in Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, New York, 2nd edition, 1989). A number of overlapping cDNA clones were isolated, which were shown by restriction mapping and partial sequencing to contain the complete coding region of the R2B subunit.A full length human R2B cDNA was generated by assembling 3 overlapping cDNAs (using convenient restriction enzyme sites) using standard molecular biology techniques. The full length R2B cDNA was sequenced completely on both strands using Taq dideoxy terminator cycle sequencing (Applied BioSystems) and an Applied BioSystems 373A sequencer. The complete nucleotide and deduced amino acid sequence is shown in Figure 1. The numbering shown for the deduced amino acid sequence assumes a 27 amino acid putative signal peptide, cleaved off in the mature protein. Four putative transmembrane domains (TM 1-4) are also indicated.

EXAMPLE 2 Preparation of Rla+R2B transfected cells and Rla+R2A+R2B transfected cells a) Construction of eukarvotic expression vector nMSGneo The approx. 2500 base pair HindIII-EcoRI fragment of the vector pMSG (purchased from Pharmacia Biosystems Limited, Milton Keynes, United Kingdom), containing the gpt structural gene and SV40 polyadenylation signals was replaced by the approx. 2800 base pair HindIII-EcoRI fragment of pSV2neo (Southern, P.J. and Berg, P.J., Molecular and Applied Genetics, 1982, 1, 327-341) containing the neomycin resistance gene Neor and SV40 polyadenylation signals. The EcoRI and HindIII sites were then removed by restriction digesting, blunt ending with klenow polymerase, and religating.EcoRI and HindIII cloning sites were then inserted at the XhoI and SmaI sites of the polylinker by conventional techniques using EcoRI and Hindill linkers.

b) Cloning of subunit cDNAs into pMSC;neo Human Rla and R2A cDNA were cloned as described in Examples 1 and 2 respectively of WO-A-94/11501. Human R2B cDNA was cloned as described in Example 1 above. Human Rla cDNA was subcloned from pBluescript Sk- (Stratagene, San Diego, CA, USA) by digestion with SalI and EcoRI and ligation into the SalI and EcoRI sites of pMSGneo. Human R2A cDNA was subcloned from pBluescript Sk- by restriction digestion with NheI and XhoI and ligation into the NheI and XhoI sites of pMSGneo. Human R2B cDNA was subcloned from pBluescript Sk- by restriction digestion with XbaI and EcoRV and ligation into the XbaI and EcoRV sites of pMSGneo.

c) Co-transfection of mouse L(tk)- cells L(tk)- cells were obtained from the Salk Institute for Biological Studies, San Diego, California. Cells were grown at 370C, 5-8% CO2, in Modified Eagles Medium containing penicillin, streptomycin and 10% foetal calf serum. The expression vector harbouring the NMDA receptor subunit DNAs for co-transfection was prepared by a standard protocol (Chen, C. and Okayama, H., BioTechniques, 1988, 6, 632-638).

For co-transfection, L(tk)- cells were plated in dishes (approx. 2 x 105 cells/dish) and grown overnight. The transfection was performed by calcium phosphate precipitation using a kit (purchased from 5 Prime e 3 Prime Products, Westchester, Pennsylvania). Co-transfection was performed according to manufacturers' instructions, using 5 Rg of each subunit DNA construct per 10 cm dish of cells. After 2 days in culture the cells were divided 1:8 into culture medium containing 1 mg/ml neomycin [Geneticin (obtainable from Gibco BRL, Paisley, Scotland, United Kingdom)]. After a further week the concentration was increased to 1.5 mg/ml, and then 2 mg/ml 1 week after that. Resistant clones of cells were isolated and subcloned using cloning cylinders.Subclones were analysed using radioligand binding: subclones were grown in 10 cm culture dishes, and when confluent changed into culture medium containing 1 ,uM dexamethasone (obtainable from Sigma Chemical Company, Poole, Dorset, United Kingdom). In order to prevent cell death induced by the expression of the recombinant Rla+R2B and Rla+R2A+R2B receptors, 5 mM ketamine was added into the culture medium in addition to the dexamethasone. Ketamine is a substance known to act as a noncompetitive antagonist at the NMDA receptor (MacDonald et al., J.

Neurophysiol., 1987, 58, 251-266). A 3-day induction period at 410C is advisable in order to improve the efficiency of recombinant expression. 35 days later the cells were harvested, membranes prepared and used for radioligand binding (see Example 3, step (a) below), using the channel blocker [3H]-dizocilpine (obtained from New England Nuclear, Du Pont Ltd., Stevenage, United Kingdom) for the characterisation of the recombinant Rla+R2B and Rla+R2A+R2B receptors.

The recombinant Rla+R2B and Rla+R2A+R2B receptor clones expressing the highest amount of [3H]-dizocilpine binding were subcloned from a single cell by limiting dilution. The two resultant clonal populations of these cells are referred to hereinbelow as populations A and B respectively.

EXAMPLE 3 Characterization of Rla+R2B transfected cells and Rla+R2A+R2B transfected cells a) Radioliand binding The nature of the recombinant Rla+R2B and Rla+R2A+R2B NMDA receptors prepared as described in Example 2 was addressed by demonstrating binding of the channel blocker [3H]-dizocilpine. For radioligand binding assays, cells which had been induced by culture at 41"C in dexamethasone and ketamine containing medium for 3-5 days were scraped off into 5 mM Tris-Acetate, pH 7.0 at 40C (buffer 1) and pelleted (20,000rpm, Sorvall RC5C centrifuge). The cell pellet was resuspended in buffer 1, homogenised using an Ultra-Turrax homogeniser and then pelleted as above.This was repeated once more, and the cells then resuspended in 5 mM Tris-Acetate, pH 7.4 at 250C (buffer 2) at a protein concentration of 1 mg/ml. Radioligand binding was performed in 0.5 ml final volume buffer 2, containing 2 nM of [3H]-dizocilpine and 100 ,eg of protein. After 2 hours at 25"C in the presence of 30 RM glycine and 30 ,eM L-glutamate the membranes were washed with buffer 1 and bound radioactivity determined by scintillation counting. The recombinant Rla+R2B receptors bound [3H]-dizocilpine at levels up to 1533 fmols/mg protein. The recombinant Rla+R2A+R2B receptors bound [3H]-dizocilpine at levels up to 1336 fmols/mg protein.No binding was seen to untransfected L(tk)- cells, confirming that the [3H]-dizocilpine was binding to recombinant Rla+R2B and Rla+R2A+R2B NMDA receptors.

Non-specific binding was determined in a parallel incubation containing 100 ,uM dizocilpine.

b) Electrophvsiologr The nature of the NMDA receptor expressed by population A cells has been extensively characterised by electrophysiological techniques, using whole cell patch clamp. Only cells induced by culture in the presence of dexamethasone showed responses to NMDA.

Concentration response curves to glutamate in a saturating concentration of glycine (10 gave a log EC5o of 6.60, and a Hill coefficient of 1.6.

These electrophysiological data confirm that the recombinant Rla+R2B NMDA receptor expressed by population A cells has the properties expected of a bona fide NMDA receptor.

c) Northern blot analvsis In order to demonstrate the effectiveness of the transcription oft1, R2A and R2B subunits in cell populations A and B, NMDA receptor subunit RNAs expressed in both populations were analysed. RNA extraction and Northern blot analysis were performed as described in Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, New York, 2nd edition, 1989. Hybridization of Northern blots was performed with randomly primed 32P-labelled probes prepared from the inerts of human Rla, R2A and R2B cDNAs. Hybridization was performed at high stringency in 5 x SSPE/50% formamide at 420C (1 x SSPE is 0.18 M NaClilO mol sodium phosphate, pH 7.4/1 mM EDTA).

Filters were washed at 65"C in 0.3 x SSPE and exposed to Kodak XAR film. All Northern blot analyses confirmed the presence of NMDA Rla and R2B subunit mRNAs in population A cells and NMDA Rla, R2A and R2B subunit mRNAs in population B cells.

Claims (14)

CLAIMS:

1. A stably co-transfected eukaryotic cell line capable of expressing a human NMDA receptor, which receptor comprises at least one human R1 subunit isoform, the human R2B subunit, and optionally one other human R2 subunit.

2. A cell line as claimed in claim 1 wherein the human R2 subunit which is optionally present in addition to the human R2B subunit is the human R2A, R2C or R2D subunit.

3. A stably co-transfected eukaryotic cell line capable of expressing a human NMDA receptor comprising the Rla+R2B subunit combination.

4. A stably co-transfected eukaryotic cell line capable of expressing a human NMDA receptor comprising the Rla+R2A+R2B subunit combination.

5. A cell line as claimed in claim 1 wherein the human NMDA receptor is expressed in rodent fibroblast cells.

6. A cell line as claimed in claim 5 wherein the human NMDA receptor is expressed in mouse L(tk)- cells.

7. A process for the preparation of a eukaryotic cell line capable of expressing a human NMDA receptor, which comprises stably co-transfecting a eukaryotic host cell with a plurality of expression vectors, at least one such vector harbouring the cDNA sequence coding for a human NMDA R1 receptor subunit isoform, another such vector harbouring the cDNA sequence coding for the human NMDA R2B receptor subunit, and optionally one other such vector harbouring the cDNA sequence coding for another human NMDA R2 receptor subunit.

8. A process as claimed in claim 7 wherein the eukaryotic host cell employed is a rodent fibroblast cell.

9. A process as claimed in claim 8 wherein the eukaryotic host cell employed is a mouse L(tk)- cell.

10. A protein preparation of human NMDA receptor subunit combinations derived from a culture of the stably co-transfected eukaryotic cells as claimed in claim 1.

11. A membrane preparation containing subunit combinations of the human NMDA receptor derived from a culture of the stably co-transfected eukaryotic cells as claimed in claim 1.

12. A preparation as claimed in claim 10 containing a human NMDA receptor comprising the human Rla+R2B or Rla+R2A+R2B subunit combination isolated from stably co-transfected mouse L(tk)- fibroblast cells.

13. A preparation as claimed in claim 11 containing a human NMDA receptor comprising the human Rla+R2B or Rla+R2A+R2B subunit combination isolated from stably co-transfected mouse L(tk)- fibroblast cells.

14. The use of the cell line as claimed in claim 1, and protein and membrane preparations derived therefrom, in screening for and designing medicaments which act upon the human NMDA receptor.