WO1995006718A2 - Procede de suppression de la reponse auto-immune - Google Patents

Procede de suppression de la reponse auto-immune Download PDF

Info

Publication number
WO1995006718A2
WO1995006718A2 PCT/US1994/009860 US9409860W WO9506718A2 WO 1995006718 A2 WO1995006718 A2 WO 1995006718A2 US 9409860 W US9409860 W US 9409860W WO 9506718 A2 WO9506718 A2 WO 9506718A2
Authority
WO
WIPO (PCT)
Prior art keywords
cells
vector construct
recombinant vector
protein
recombinant
Prior art date
Application number
PCT/US1994/009860
Other languages
English (en)
Other versions
WO1995006718A3 (fr
Inventor
Douglas J. Jolly
Michael J. Irwin
John F. Warner
Thomas W. Dubensky, Jr.
Carlos E. Ibanez
Original Assignee
Viagene, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Viagene, Inc. filed Critical Viagene, Inc.
Priority to AU78699/94A priority Critical patent/AU7869994A/en
Priority to JP7508256A priority patent/JPH09503655A/ja
Priority to EP94929752A priority patent/EP0716692A1/fr
Publication of WO1995006718A2 publication Critical patent/WO1995006718A2/fr
Publication of WO1995006718A3 publication Critical patent/WO1995006718A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/70539—MHC-molecules, e.g. HLA-molecules
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates generally to the field of autoimmunity, and more specifically, to methods of suppressing T-cell recognition of host tissues.
  • Autoimmunity refers to the reaction of the immune system against the body's own tissues, and is characterized by either the production of antibodies or immune effector T-cells that react with host tissue.
  • diseases attributed to autoimmunity include multiple sclerosis (MS), rheumatoid arthritis, diabetes and uveitis.
  • MS is a neurological disorder characterized by recurrent incidence of axon demyelination in the optic nerve, brain, and spinal cord. Although it affects approximately one million people worldwide, the incidence is higher in populations living above the 37th parallel. This progressive disease may be linked to a defect in the immune system which may cause the self-destruction of myelin sheaths in both the central and peripheral nervous systems.
  • MS patients are genetically susceptible to the onset of this disease following infection by a virus containing amino acid sequences similar to normal myelin.
  • MS human leukocyte antigen
  • HLA-DR2 human leukocyte antigen
  • Rheumatoid arthritis is an autoimmune disease characterized by chronic systemic inflammation specifically affecting synovial membranes of the joints. Viral infection in a genetically susceptible individual leads to either a cross re: ⁇ tion between antiviral antibodies and joint tissue antigen, or deviation of lymphocyte function by incorporation of viral DNA into the cell genome.
  • the pathology of the disease includes chronic synovitis and pannus formation. Synovitis refers to the excessive inflammation of the synovial membranes surrounding the joints, thereby causing severe pain, while pannus eventually results in fibroid alkalosis by eroding cartilage, bone, ligaments, and tendons.
  • the prevalence of rheumatoid arthritis in the general population is l%-2%, with female patients outnumbering males 3:1. In general, the age at onset ranges from 20-40 years, although this disease may begin at any age.
  • Nonsteroidal anti-inflammatory drugs include aspirin, ibuprofen, fenoprofen, naproxen, tolmetin, flurbiprofen, sulindac, meclofenamate sodium, piroxicam, diclofenac, and ketoprofen.
  • these drugs induce gastric ulceration, perforation, or aggravating inflammatory bowel disease, and in some cases result in renal toxicity.
  • the anti-malaria drug Plaquenil (hydroxy ⁇ hloroquine sulfate), is used in patients with mild cases of rheumatoid arthritis because uf its low toxicity as compared to nonsteroidal anti-inflammatory drugs. However, only 25% of those treated respond to this drug and in some cases only after 3-6 months of therapy. Side effects include pigmentary retinitis, neuropathologies, and myopathologies of both skeletal and cardiac muscle In some patients, gold salts have been shown to retard bone erosions associated with rheumatoid arthritis. Thirty-two percent of these patients experience toxic side effects similar to heavy metal poisoning.
  • Corticosteroids are generally used for their immediate anti-inflammatory effect without altering the natural progression of rheumatoid arthritis. Unfortunately, they mask the underlying disease, and therefore increase the tendency of the patient and physician to neglect general supportive treatment, physical therapy and orthopedic measures. Methotrexate is given to patients with severe rheumatoid arthritis who fail to respond to nonsteroidal anti-inflammatory drugs and gold salts. This drug produces beneficial effects within two to four weeks as compared to gold salts which take two to six months.
  • associated disadvantages include gastric irritation, stomatitis, pneumonitis, fibrosis, and cirrhosis. Therefore, liver biopsies are performed periodically to monitor treated individuals.
  • Azathioprine like methotrexate, is effective for the treatment of severe rheumatoid arthritis. However, its use is restricted because of the potential for severe toxicity, including leukopenia, thrombocytopenia, and immunosuppression complicated by opportunistic infection. Penicillamine is also effective for treating severe rheumatoid arthritis.
  • IDDM insulin-dependent diabetes mellitus
  • NIDDM non-insulin-dependent diabetes mellitus
  • HLA-DR3 and HLA- DR4 are present in 95% of patients as compared to 45%-50% in controls.
  • antigen HLA-DQw3.2 is present in DR4 patients with IDDM, while the protective gene HLA-DQ3.1 is found predominantly in DR4 controls.
  • Anti-insulin and circulating islet cell antibodies have been detected in 85% of patients in the first few weeks following the onset of diabetes. Considering these immune characteristics, IDDM is believed to result from an infectious or toxic environmental insult to pancreatic B cells of individuals whose immune system is genetically predisposed to develop an autoimmune response against altered pancreatic B cell antigens.
  • Factors that effect B cell function include damage caused by viruses such as mumps or coxsackie B4 virus, toxic chemical agents or cytotoxins, and antibodies released from sensitized immunocytes. Sustained hyperglycemia causes osmotic diuresis, resulting in increased urination. This lowered plasma volume produces dizziness and weakness that is further exacerbated by potassium loss and catabolism of muscle protein. Acute stages of ketoacidosis exacerbates the dehydration and hyperosmolarity by producing anorexia, nausea and vomiting. This condition interferes with oral fluid replacement and as serum osmolarity increases, the patient experiences impaired consciousness eventually progressing to coma.
  • Type II diabetes occurs predominantly in adults. NIDDM is not associated with HLA markers, is non-ketotic, lacks islet cell antibodies, and does not require insulin therapy to sustain life. Although the cause of this form of diabetes is unclear, an unknown primary genetic factor is implicated which is aggravated by enhancers of insulin resistance such as aging and abdominal visceral obesity. Genetic influences have been further supported by epidemiological data showing that when one monozygotic twin over forty years of age develops diabetes, the second will develop the disease within the same year.
  • Uveitis is an intraocular inflammatory disease present in the anterior or posterior segment of the eye or equally distributed between the two. It is categorized as acute or chronic and granulomatous or nongranulomatous.
  • Anterior uveitis is characterized by inflammatory cells within the aqueous humor. In granulomatous anterior uveitis, large precipitates and iris nodules cause blurred vision and inflammation. Diseases producing granulomatous anterior uveitis include sarcoidosis, tuberculosis, syphilis, toxoplasmosis, Vogt-Koyanagi-Harada syndrome and sympathetic ophthalmia.
  • non-granulomatous anterior uveitis the precipitates are smaller and lack iris nodules. This causes unilateral pain, redness, photophobia and loss of vision.
  • severe non-granulomatous anterior uveitis fibrin is present within the anterior chamber.
  • Systemic disorders associated with acute non-granulomatous anterior uveitis are the HLA-B27-related conditions sacroilitis, ankyloing spondylitis, Reiter's syndrome, psoriasis, ulcerative colitis and Chron's disease.
  • Other infections that may cause non- granulomatous anterior uvieitis are herpes simplex and herpes zoster.
  • posterior uveitis there are cells in the vitreous humor and inflammatory lesions in the retina or choroid. Visual loss may be due to vitreous haze, opacities, inflammatory lesions involving the macula, macular edema, retinal vein occlusion or associated optic neuropathy. Autoimmune retinal vasculitis and pars planitis are conditions that produce posterior uveitis. There are limited treatments for uveitis. Anterior uveitis may be treated with topical corticosteroids, while posterior uveitis requires systemic corticosteroid therapy. Posterior uveitis may also be treated through systemic immunosuppression with azathioprine or cyclosporine. However, high dosage use can result in hepatotoxicity and nephrotoxicity. Other side effects include renal dysfunction, tremor, hirsutism, hypertension and gum hyperplasia.
  • the present invention provides methods for inhibiting MHC antigen presentation in order to suppress T-cell recognition of host tissues.
  • methods for suppressing the autoimmune response within an animal comprising transforming tissue cells of an animal with a recombinant vector construct that expresses a protein or an active portion of a protein capable of inhibiting MHC antigen presentation, such that an autoimmune response against the cells is suppressed.
  • the recombinant vector construct directs the expression of a protein capable of binding ⁇ 2-microglobulin, such as H301.
  • the recombinant vector construct directs the expression of a protein capable of binding the MHC class I heavy chain molecule intracellularly, such as E3/19K.
  • a method for suppressing an autoimmune response within an animal comprising transforming tissue cells of an animal with a recombinant vector construct that transcribes an antisense message capable of inhibiting MHC antigen presentation, such that an autoimmune response against the cells is suppressed.
  • the recombinant vector construct transcribes an antisense message which binds a conserved region of MHC class I heavy chain transcripts, ⁇ 2-microglobulin transcript. :>r the PSF1 transporter protein transcript.
  • a method for suppressing an autoimmune response within an animal comprising transforming tissue cells of an animal with a recombinant vector construct that transcribes a ribozyme capable of inhibiting MHC antigen presentation, such that an autoimmune response against the cells is suppressed.
  • the recombinant vector construct transcribes a ribozyme that cleaves a conserved region of MHC class I heavy chain transcripts, ⁇ 2-microglobu-.n transcript, or the PSF1 transporter protein transcript.
  • a method for suppressing an autoimmune response within an animal comprising transforming tissue cells of an animal with a multivalent recombinant vector construct that expresses a protein or active portion of a protein capable of inhibiting MHC antigen presentation, and an antisense message or ribozyme capable of inhibiting MHC antigen presentation, such that an autoimmune response against the cells is suppressed.
  • the multivalent recombinant vector construct directs the expression of an antisense message and a ribozyme capable of inhibiting MHC antigen presentation, such that an autoimmune response to the cells is suppressed.
  • the multivalent recombinant vector construct directs the expression of two or more proteins or active portions of proteins, two or more antisense messages, or two or more ribozymes capable of inhibiting MHC antigen presentation, such that an autoimmune response to the cells is suppressed.
  • the multivalent recombinant vector construct expresses or transcribes at least two of the following in any combination: a protein or active portion of the proteins E3/19K or H301, an antisense message that binds the transcript of a conserved region of MHC class I heavy chains, ⁇ 2-microglobulin or PSFl transporter protein, or a ribozyme that cleaves the transcript of a conserved region of the MHC class I heavy chains, ⁇ 2-microglobulin or PSFl transporter protein.
  • the recombinant vector construct is a recombinant viral vector construct.
  • the recombinant vector construct is a recombinant retroviral vector construct.
  • the recombinant vector construct is carried by a virus selected from the group consisting of togaviridae, picornaviridae, poxviridae, adenoviridae, parvoviridae, herpesviridae, paramyxoviridae and coronaviridae.
  • suitable tissue cells of an animal include myelin nerve sheath cells, synovial membrane cells, pancreatic islet cells, hepatocytes and keratocytes.
  • the animal cells are transformed in vivo by direct injection of a recombinant vector construct.
  • Autoimmune response refers to a condition characterized by a specific humoral or cell-mediated immune response against constituents of the body's own tissue.
  • suppression of the autoimmune response refers to interference with MHC antigen presentation, such that an immune response is diminished or prevented.
  • Transforming tissue cells refers to the transduction or transfection of tissue cells by any of a variety of means recognized by those skilled in the art, such that the transformed tissue cell expresses additional polynucleotides as compared to a tissue cell prior to the transforming event.
  • Recombinant vector construct refers to an assembly which is capable of expressing sequences or genes of interest.
  • the vector construct must include promoter elements and may include a signal that directs polyadenylation.
  • the vector construct preferably includes a sequence which, when transcribed, is operably linked to the sequences or genes of interest and acts as a translation initiation sequence.
  • the vector construct includes a selectable marker such as neomycin, thymidine kinase, hygromycin, phleomycin, histidinol, or dihydrofolate reductase (DHFR), as well as one or more restriction sites and a translation termination sequence.
  • DHFR dihydrofolate reductase
  • the vector construct if used to make a retroviral particle, the vector construct must include a retroviral packaging signal and TRs appropriate to the retrovirus used, provided these are not already present.
  • the vector construct can also be used in combination with other viral vectors or inserted physically into cells or tissues as described below.
  • the vector construct includes a sequence that encodes a protein or active portion of the protein, antisense message or ribozyme. Such sequences are designed to inhibit MHC antigen presentation, in order to suppress an autoimmune response of class I restricted T-cells against transformed tissues cells.
  • the recombinant vector constructs described herein are prepared by selecting a plasmid with a strong promoter, and appropriate restriction sites for insertion of DNA sequences of interest downstream from the promoter.
  • the vector construct may have a gene encoding antibiotic resistance for selection as well as termination and polyadenylation signals. Additional elements may include enhancers and introns with functional splice donor and acceptor sites.
  • multivalent recombinant vector constructs may require two promoters when two proteins are being expressed, because one promoter may not ensure adequate levels of gene expression of the second gene.
  • a second promoter may not be necessary.
  • an internal ribosome binding site (IRBS) or herpes simplex virus thymidine kinase (HSVTK) promoter is placed in conjunction with the second gene of interest in order to boost the levels of gene expression of the second gene.
  • the upstream untranslated region of the immunoglobulin heavy chain binding protein has been shown to s j port the internal engagement of a bicistronic message (Jacejak et°al., Nature 353:90. 1991).
  • This sequence is small, approximately 300 base pairs, and may readily be incorporated into a vector in order to express multiple genes from a multi-cistronic message whose cistrons begin with this sequence.
  • the recombinant vector construct is carried by a virus
  • such constructs are prepared by inserting sequences of a virus containing the promoter, splicing, and polyadenylation signals into plasmids containing the desired gene of interest using methods well known in the art.
  • the recombinant viral vector containing the gene of interest can replicate to high copy number after transduction into the target tissue cells.
  • the recombinant vector construct is carried by a retrovirus.
  • Retroviruses are RNA viruses with a single positive strand genome which in general, are nonlytic. Upon infection, the retrovirus reverse transcribes its RNA into DNA, forming a provirus which is inserted into the host cell genome.
  • Preparation of retroviral constructs for use in the present invention is described in greater detail in an application entitled "Recombinant Retroviruses" (U.S.S.N. 07/586,603, filed September 21, 1990) herein incorporated by reference.
  • the retroviral genome can be divided conceptually into two parts.
  • the "trans-acting" portion consists of the region coding for viral structural proteins, including the group specific antigen (gag) gene for synthesis of the core coat proteins; the pol gene for the synthesis of the reverse transcriptase and integrase enzymes; and the envelope (env) gene for the synthesis of envelope glycoproteins.
  • the "cis-acting" portion consists of regions of the genome that is finally packaged into the viral particle. These regions include the packaging signal, long terminal repeats (LTR) with promoters and polyadenylation sites, and two start sites for DNA replication.
  • LTR long terminal repeats
  • the internal or "trans-acting" part of the cloned provirus is replaced by the gene of interest to create a "vector construct".
  • the vector construct When the vector construct is placed into a cell where viral packaging proteins are present (see U.S.S.N. 07/800,921), the transcribed RNA will be packaged as a viral particle which , in turn, will bud off from the cell. These particles are used to transduce tissue cells, allowing the vector construct to integrate into the cell genome. Although the vector construct express its gene product, the virus carrying it is replication defective because the trans-acting portion of the viral genome is absent.
  • Various assays may be utilized in order to detect the presence of any replication competent infectious retrovirus.
  • One preferred assay is the extended S + L" assay described in Example 9.
  • Preferred retroviral vectors are murine leukemia amphotropic or xenotropic or VsVg pseudotype vectors (see WO 92/14829; incorporated herein by reference).
  • Recombinant vector constructs may also be developed and utilized with a variety of viral carriers including, for example, poliovirus (Evans et al., Nature 339:385, 1989, and Sabin et al., J. of Biol. Standardization 1:115, 1973) (ATCC VR-58) rhinovirus (Arnold et al., J. Cell. Biochem. L401, 1990) (ATCC VR-1110); pox viruses such as canary pox virus or vaccinia virus (Fisher-Hoch et al., PNAS 86:317, 1989 Flexner et al., Ann. N.Y. Acad. Sci. 569:86.
  • poliovirus Evans et al., Nature 339:385, 1989, and Sabin et al., J. of Biol. Standardization 1:115, 1973
  • ATCC VR-58 rhinovirus
  • pox viruses such as canary pox virus or vaccinia virus
  • Flexner et al. Ann. N
  • ATCC VR-797 adenovirus (Berkner, et, al., Biotechniques 6:616, 1988, and Rosenfeld et al., Science 252:431, 1991) (ATCC VR-1); parvovirus such as adeno-associated virus (Samulski et al., J. Vir. 63:3822, 1989, and Mendelson et al., Virology 166: 154, 1988) (ATCC VR-645); herpes simplex virus (Kit et al., Adv. Exp. Med. Biol.
  • a vector construct may be administered to a warm-blooded animal in order to transform tissue cells through a variety of routes, including in vivo by direct injection. More specifically, naked DNA or a recombinant vector construct containing a sequence that codes for a protein or active portion of a protein, an antisense message or ribozyme sequence capable of inhibiting MHC antigen presentation, can be directly injec 'ed into the interstitial space of tissues including muscle, brain, liver, skin, synovial membrane cells, pancreatic islet cells, and keratocytes (see WO 90/11092).
  • vector constructs include transfection by various physical methods, such as lipofection (Feigner et al., PNAS 84:7413, 1989); microprojectile bombardment (Williams et al., PNAS 88:2726, 1991); liposomes (Wang et al., PNAS 84-7851, 1987); calcium phosphate (Dubensky et al., PNAS 81:7529, 1984); DNA ligand complexes (Wu et al., J. of Biol. Chem. 264:16985, 1989; Cotten et al., PNAS 89:6094, 1992).
  • the vector construct may be carried by a virus such as vaccinia, Sindbis, or corona.
  • a virus such as vaccinia, Sindbis, or corona.
  • methods for administering a vector construct via a retroviral vector by direct injection are described in greater detail in an application entitled "Recombinant Retroviruses" (U.S.S.N. 07/586,603) herein incorporated by reference.
  • the present invention provides methods and compositions suitable for inhibiting MHC antigen presentation in order to suppress the autoimmune response of the host.
  • CTL are specifically activated by the display of peptides in the context of self MHC molecules along with accessory molecules such as CD8, inexcellular adhesion molecule -1 (ICAM-1), ICAM-2, (Singer, Science 255: 1671, 1992; RAO, Crit.Rev.Immunol. 10: 495, 1991 leukocyte functional antigen- 1 (LFA-1) (Altmann et al., Nature 338:521, 1989), the B7/BB1 molecule (Freeman et al., J. Immunol. 143: 2714. 1989 . LFA-3, or other cell adhesion molecules. Antigenic peptide presentation in association with MHC class I molecules leads to CTL activation.
  • IAM-1 inexcellular adhesion molecule -1
  • ICAM-2 ICAM-2
  • T-cells capable of expressing products expected to inhibit MHC antigen presentation block activation of T-cells, such as CD8 + CTL, and therefore suppress the autoimmune response.
  • a standard CTL assay is used to detect this response, as described in detail in Example 13.
  • Components of the antigen presentation pathway include the 45Kd MHC class I heavy chain, ⁇ 2-microglobulin, processing enzymes such as proteases, accessory molecules, chaparones and transporter proteins such as PSFl.
  • vector constructs which direct the expression of a protein or active portion of a protein capable of inhibiting MHC antigen presentation.
  • an "active portion" of a protein is that fragment of the protein which must be retained for biological activity. Such fragments or active domains can be readily identified by systematically removing nucleotide sequences from the protein sequence, transforming target cells with the resulting recombinant vector construct, and determining MHC class I presentation on the surface of cells using FACS analysis or other immunological assays, such as a CTL assay. These fragments are particularly useful when the size of the sequence encoding the entire protein exceeds the capacity of the viral carrier.
  • the active domain of the MHC antigen presentation inhibitor protein can be enzymatically digested and the active portion purified by biochemical methods.
  • a monoclonal antibody that blocks the active portion of the protein can be used to isolate and purify the active portion of the cleaved protein.
  • the recombinant vector construct directs the expression of a protein or active portion of a protein that binds to newly synthesized MHC class I molecules intracellularly. This binding prevents migration of the MHC class I molecule from the endoplasmic reticulum, resulting in the inhibition of terminal glycosylation. T.
  • E3 encodes a 19kD glycoprotein, E3/19K, transcribed from the E3 region of the adenovirus 2 genome.
  • E3/19K a 19kD glycoprotein, E3/19K, transcribed from the E3 region of the adenovirus 2 genome.
  • an animal is injected directly with a recombinant vector construct containing the E3/19K sequence, which upon expression produces the E3/19K protein.
  • the E3/19K protein inhibits the surface expression of an MHC class I surface molecules, and the cells transformed by the vector construct evade an immune response.
  • the construction of a representative recombinant vector construct in this regard is presented in Example 7.
  • the recombinant vector construct directs the expression of a protein or an active portion of a protein capable of binding ⁇ 2-microglobulin.
  • Transport of MHC class I molecules to the cell surface for antk presentation requires association with ⁇ 2-microglobulin.
  • proteins that bin ⁇ ⁇ 2-microglobulin and inhibit its association with MHC class I indirectly inhibit MHC class I antigen presentation.
  • Suitable proteins include the H301 gene product. Briefly, the H301 gene, obtained from the human cytomegalovirus (CMV) encodes a glycoprotein with sequence homology to the ⁇ 2-microglobulin binding site on the heavy chain of the MHC class I molecule (Browne et al., Nature 347:770. 1990). H301 binds to ⁇ 2-microglobulin, preventing the maturation of MHC class I molecules, and renders transformed cells unrecognizable by cytotoxic T-cells, thus evading MHC class I restricted immune surveillance.
  • CMV human cytomegalovirus
  • proteins that function to inhibit or down- regulate MHC class I antigen presentation may also be identified and utilized within the context of the present invention.
  • a recombinant vector construct that expresses a protein or an active portion thereof suspected of being capable of inhibiting MHC class I antigen presentation is transformed into a tester cell line, such as BC.
  • the tester cell lines with and without the sequence encoding the candidate protein are compared to stimulators and/or targets in the CTL assay. A decrease in cell lysis corresponding to the transformed tester cell indicates that the candidate protein is capable of inhibiting MHC presentation.
  • An alternative method to determine down-regulation of MHC class I surface expression is by FACS analysis. More specifically, cell lines are transformed with a recombinant vector construct encoding the candidate protein. After drug selection and expansion, the cells are analyzed by FACS for MHC class I expression and compared to that of non-transformed cells. A decrease in cell surface expression of MHC class I indicates that the candidate protein is capable of inhibiting MHC presentation (see, for instance, Example 12).
  • methods are provided for suppressing an autoimmune response within an animal by transforming tissue cells of an animal with a recombinant vector construct which transcribes an antisense message capable of inhibiting MHC class I antigen presentation.
  • Antisense RNA sequences function as regulators of gene expression by hybridizing to complementary mRNA sequences and arresting translation (Mizuno et al., PNAS 81: 1966, 1984; Heywood et al., Nucleic Acids Res. 14:6771, 1986).
  • Antisense molecules comprising the entire sequence of the target transcript or any part thereof can be synthesized (Ferretti et al., PNAS 83:599, 1986), placed into vector constructs, and effectively introduced into cells to inhibit gene expression ( Izant et al., Cell 36: 1007, 1984).
  • asRNA antisense RNA
  • the recombinant vector construct transcribes an antisense message capable of binding a conserved region of the MHC class I transcript, thereby inhibiting cell surface expression and MHC class I antigen presentation.
  • conserved regions through computer- assisted comparison of sequences representing different classes of MHC genes (for example, HLA A, B and C), available within DNA sequence databanks (e.g., Genbank).
  • conserved sequences are identified through computer-assisted alignment for homology of the nucleotide sequences.
  • the conserved region is a sequence having less than 50% mismatch, preferably less than 20% mismatch, per 100 base pairs between MHC class I genotypes.
  • the recombinant vector construct transcribes an antisense message responsible for binding to ⁇ 2- microglobulin transcript. This binding prevents translation of the ⁇ 2-microglobulin protein and thereby inhibits proper assembly of the MHC class I molecule complex necessary for cell surface expression.
  • the nucleotide sequence for ⁇ 2-microglobulin is cloned into a vector construct in the reverse orientation. The proper antisense orientation may be determined by restriction enzyme analysis.
  • the recombinant vector construct transcribes an antisense message responsible for binding PSFl transcript, a peptide transporter protein. Since this protein is necessary for the efficient assembly of MHC class I molecules, an antisense to PSFl transcript blocks the transport of proces «°d antigenic peptide fragments to the endoplasmic reticulum (ER) prior to association , i the ⁇ 2-microglobulin and MHC class I molecular complex.
  • the nucleotide sequence for PSFl is prepared and inserted in reverse orientation into the vector construct and determined by restriction enzyme analysis.
  • sequences of other proteins involved in antigen presentation may also be identified, and used to design a recombinant vector construct capable of transcribing an antisense message that inhibits MHC antigen presentation. More specifically, the nucleotide sequence of the gene encoding the protein is examined, and the identified sequence is used to synthesize an appropriate antisense message. It is preferable to use a sequence complimentary to a portion upstream or close to the start sequence of the target message. This allows the antisense sequence to bind to the mRNA preventing translation of a significant portion of the protein. Examples of such molecules are ICAM-1, ICAM-2, LFA-1, LFA-3, and B7/BB1. Down-regulation of MHC class I expression or antigen presentation may be assayed by FACS analysis or CTL assay, respectively, as described in Examples 13 and 15 or other means as described above for proteins capable of inhibiting MHC class I presentation.
  • a method for suppressing an autoimmune response within an animal by transducing selected cells of the animal with a recombinant vector construct which transcribes a ribozyme responsible for the enzymatic cleavage of a component involved in MHC antigen preservation.
  • ribozymes are RNA molecules with enzymatic activity used to digest other RNA molecules. They consist of short RNA molecules possessing highly conserved sequence- specific cleavage domains flanked by regions which allow accurate positioning of the enzyme relative to the potential cleavage site in the desired target molecule. They provide highly flexible tools in inhibiting the expression and activation of specific genes (Haseloff et al., Nature 334:585, 1988).
  • Custom ribozymes can be designed, provided that the transcribed sequences of the gene are known. Specifically, a ribozyme may be designed by first choosing the particular target RNA sequence and attaching complimentary sequences to the beginning and end of the ribozyme coding sequence. This ribozyme producing gene unit can then be inserted into a recombinant vector construct and used to transform tissue cells. Upon expression, the target gene is neutralized by complimentary binding and cleavage, guaranteeing permanent inactivation. In addition, because of their enzymatic activity, ribozymes are capable of destroying more than one target.
  • vector constructs containing specific ribozymes are used to cleave the transcript of a conserved region of the MHC class I heavy chain molecule in order to inhibit antigen presentation.
  • the recombinant vector construct transcribes a ribozyme responsible for the enzymatic cleavage of the ⁇ 2-microglobulin transcript.
  • a ribozyme with flanking regions complimentary to a sequence of the ⁇ 2 -microglobulin message cleaves the transcript, thereby preventing protein translation and proper assembly of the MHC class I molecule complex. This inhibits transport of the MHC class I complex to the cell surface, thereby preventing antigen presentation.
  • the recombinant vector construct transcribes a ribozyme responsible for the enzymatic cleavage of the PSFl transcript, thereby suppressing cell surface expression of MHC class I molecules and preventing antigen presentation. More specifically, a ribozyme designed with flanking regions complimentary to a sequence of the PSFl message cleaves the transcript and inhibits transport of peptides to the ER, thereby preventing assembly of the MHC class I complex and antigen presentation.
  • sequences of other proteins involved in the antigen presentation pathway may be identified and used to design a recombinant vector construct capable of transcribing a ribozyme that inhibits MHC antigen presentation.
  • Down-regulation of MHC class I expression or antigen presentation may be assayed by FACS analysis or CTL assay as described in more detail in Examples 13 and 15 or other means as described above for proteins and antisense messages capable of inhibiting MHC class I presentation.
  • multivalent recombinant vector constructs are provided. Briefly, the efficiency of suppressing an autoimmune response can be enhanced by transforming cells with a multivalent recombinant vector construct. Upon expression, the gene products increase the degree of interference with MHC antigen presentation by attacking a single component via two different routes, or through two different components via the same or different route.
  • the construction of multivalent recombinant vector constructs may require two promoters because one promoter may not ensure adequate levels of gene expression of the second gene.
  • a second promoter such as an internal ribozyme binding site (IRBS) promoter, or herpes simplex virus thymidine kinase (HSVTK) promoter placed in conjunction with the second gene of interest boosts the levels of gene expression of the second gene.
  • IRBS internal ribozyme binding site
  • HVTK herpes simplex virus thymidine kinase
  • the vector construct expresses or transcribes at least two of the following components in any combination: (a) a protein or active portion of the proteins E3/19K or H301; (b) an antisense message that binds the transcript of a conserved region of the MHC class I heavy chain, ⁇ 2-microglobulin or PSFl transporter protein; and (c) a ribozyme that cleaves the transcript of the proteins listed in (b) above.
  • multivalent recombinant vector constructs are provided which express two proteins or active portions of proteins as described herein, two antisense messages, or two ribozymes. Within related embodiments, a number of specific combinations may be utilized to form a multivalent recombinant vector construct.
  • a multivalent recombinant vector construct may consist of a gene expressing E3/19K or H301 in combination with the antisense message or ribozyme sequence for a conserved region of the MHC class I heavy chain, ⁇ 2-microglobulin, or PSFl transporter protein.
  • compositions comprising one of the above described recombinant vector constructs or a recombinant virus carrying the vector construct, such as a retrovirus, poliovirus, rhinovirus, vaccinia virus, influenza virus, adenovirus, adeno-associated virus, herpes simplex virus, measles virus, coronavirus or Sindbis virus, in combination with a pharmaceutically acceptable carrier or diluent.
  • the composition may be prepared either as a liquid solution, or as a solid form (e.g., lyophilized) which is resuspended in a solution prior to administration.
  • the composition may be prepared with suitable carriers or diluents for either injection, oral, nasal or rectal administration or other means appropriate tc the carrier.
  • the recombinant virus carrying the vector construct is purified to a concentration ranging from 0.25% to 25%, and preferably about 5% to 20% before formulation. Subsequently, after preparation of the composition, the recombinant virus carrying the vector construct will constitute about 10 ng to 1 ⁇ g of material per dose, with about 10 times this amount of material present as copurified contaminants.
  • the composition is prepared in 0.1-1.0 ml of aqueous solution formulated as described below.
  • Pharmaceutically acceptable carriers or diluents are those which are nontoxic to recipients at the dosages and concentrations employed.
  • carriers or diluents for injectable solutions include water, isotonic solutions which are preferably buffered at a physiological pH (such as phosphate-buffered saline or Tris-buffered saline) and containing one or more of mannitol, lactose, trehalose, dextrose, glycerol and ethanol, as well as polypeptides or proteins such as human serum albumin (HSA).
  • a physiological pH such as phosphate-buffered saline or Tris-buffered saline
  • mannitol lactose
  • trehalose dextrose
  • glycerol glycerol
  • HSA human serum albumin
  • the recombinant virus carrying the vector construct since the recombinant virus carrying the vector construct represents approximately 10 ng to 1 ⁇ g of material, it may be less than 1% of the total high molecular weight material, and less than 1/100,000 of the total material (including water). This composition is generally stable at -70°C for at least six months. It will be evident that substantially equivalent dosages of the recombinant vector construct may be prepared. In this regard, the vector construct will constitute 100 ng to 100 ug of material per dose, with about 10 times this amount of material present as copurified contaminants.
  • the composition may be administered through a variety of routes (as discussed above), including intravenous (i.v.), subcutaneous (s.c), or intramuscular (i. .) injection.
  • routes including intravenous (i.v.), subcutaneous (s.c), or intramuscular (i. .) injection.
  • the mode of administration will be influenced by the specific therapeutic application.
  • the individual doses normally used are 10 6 to 10 10 c.f.u. (e.g., colony forming units of neomycin resistance titered on HT1080 cells).
  • These compositions are administered at one- to four-week intervals for three or four doses (at least initially). Subsequent booster shots may be given as one or two doses after 6-12 months, and thereafter annually.
  • the N2R5 construct is mutated by site-directed in vitro r ut agenesis to change the ATG start codon to ATT preventing gag expression.
  • This m-.'-:. ⁇ enized fragment is 200 base pairs (bp) in length and flanked by Pst I restriction sues.
  • the Pst I-Pst I mutated fragment is purified from the SK + plasmid and inserted into the Pst I site of N2 MoMLV 5' LTR in plasmid pUC31 to replace the non-mutated 200 bp fragment.
  • the plasmid pUC31 is derived from pUC19 (Stratagene, San Diego, CA) in which additional restriction sites Xho I, Bgl II, BssH II and Nco I are inserted between the EcoR I and Sac I sites of the polylinker. This construct is called pUC3 l/N2R5g M .
  • the Cla I-Cla I dominant selectable marker gene fragment from pAFVXM retroviral vector (Kriegler et al., Cell 38:483, 1984, St. Louis et al., PNAS 85:3150. 1988), comprising a SV40 early promoter driving expression of the neomy i phosphotransferase gene, is cloned into plasmid SK + .
  • a 1.3 Kb Cla I-BstB I gene fragment is purified from the SK + plasmid.
  • An alternative selectable marker, phleomycin resistance may be used to make the retroviral backbone KT-3C, for use in transforming genes to cells that are already neomycin resistant.
  • the plasmid pUT507 (Mulsant et al., Som.Cell and Mol Gen 14:243. 1988) is digested with Nde I and the ends blunted with Vlenow polymerase I. The sample is then further digested with Hpa I, Cla linhers ligated to the mix of fragments and the sample further digested with Cla I.
  • the excess Cla I linkers are removed by Cla I digestion and the 1.2 Kb Cla I fragment carrying the RSV LTR and the phleomycin resistance gene isolated by agarose gel electrophoresis followed by purification using Gene Clean (Bio 101, San Diego, CA). This fragment is used in place of the 1.3Kb Cla I - Bs+B I neomycin resistance fragment to give the backbone KT-3C.
  • a further modification of the selectable marker cassette is to simply use the Clal- Cla I SV2 Neo fragment from PAFVXM. Antisense or Ribozyme sequences can be inserted into the HWC II S/TE in the 3 -untranslated region of the NEO gene. This vector is designated KT3D.
  • the expression vector is constructed by a three part ligation in which the Xho I-
  • Hind III fragment are inserted into the Xho I-Hind III site of pUC31/N2R5g M plasmid.
  • the 1.3 Kb Cla I-BstB I Neo r gene, or 1.2 Kb Clal PHLEOMYCIN, fragment is then inserted into the Cla I site of this plasmid in the sense orientation.
  • adenovirus isolation and purification of adenovirus is described by Green et al., Methods in Enzvmology 58: 425, 1979. Specifically, five liters of Hela cells (3-6 x 10 5 cells/ml) are infected with 100-500 plaque forming units (pfii) per ml of adenovirus type
  • Ad2 Ad2 virions
  • Ad2 Ad2 virions
  • Ad2 Ad2 virions
  • Ad2 Ad2 virions
  • the cells are placed on ice, harvested by centrifligation at 23 Og for 20 minutes at 4°C, and resuspended in Tris-HCl buffer (pH 8.1).
  • the pellets are mechanically disrupted by sonication and homogenized in trichlorotrifluoroethane prior to centrifligation at l,000g for 10 min.
  • the upper aqueous layer is removed and layered over 10 mis of CsCl (1.43 g/cm 3 ) and centrifuged in a SW27 rotor for 1 hour at 20,000 rpm.
  • the opalescent viral band is removed and adjusted to 1.34 g/cm 3 with CsCl and further centrifuged in a Ti 50 rotor for 16-20 hours at 30,000 rpm.
  • the visible viral band in the middle of the gradient is removed and stored at 4°C until purification of adenoviral DNA.
  • the adenovirus band is incubated with protease for 1 hour at 37°C to digest proteins. After centrifligation at 7,800g for 10 minutes at 4°C, the particles are solubilized in 5% sodium dodecyl sulfate (SDS) at room temperature for 30 minutes before being extracted with equal volume of phenol. The upper aqueous phase is removed, re-extracted with phenol, extracted three times with ether, and dialyzed in Tris buffer for 24 hours. The viral Ad2 DNA is precipitated in ethanol, washed in ethanol, and resuspended in Tris-EDTA buffer, pH 8.1. Approximately 0.5 mg of viral Ad2 DNA is isolated from virus produced in 1.0 liter of cells.
  • SDS sodium dodecyl sulfate
  • the viral Ad2 DNA is digested with EcoR I (New England Biolabs, Beverly, MA) and separated by electrophoresis on a 1% agarose gel.
  • EcoR I New England Biolabs, Beverly, MA
  • the resulting 2.7 Kb Ad2 EcoR I D fragments, located in the Ad2 coordinate region 75.9 to 83.4, containing the E3/19K gene are eluted by electrophoresis, phenol extracted, ethanol precipitated, and dissolved in Tris-EDTA (pH 8.1).
  • the E3/19K gene is cloned into the EcoR I sit? of PUC1813.
  • PUC1813 is prepared as essentially described by Kay et al., Nucleic Acids Research 11:2778, 1987 and Gray et al., PNAS 80:5842, 1983).
  • the E3/19K is retrieved by EcoR I digestion and the isolated fragment is cloned into the EcoR I site of phosphatase-treated pSP73 plasmid, (Promega, Madison, WI). This cons' uct is designated SP-E3/19K.
  • the orientation of the SP-E3/19K cDNA is verified by using appropriate restriction enzyme digestion and DNA sequencing.
  • the 5' end of the cDNA is adjacent to the Xho I site of the pSP73 polylinker and the 3' end adjacent to the Cla I site.
  • the Xho I-Cla I fragment containing the E3/19K cDNA in either sense or antisense orientation is retrieved from the SP-E3/19K construct and cloned into the Xho I-Cla I site of the KT-3B retroviral backbone. This construct is designated KT-3B/E3/19K.
  • the Ad2 DNA E3/19K gene including the amino terminal signal sequence, followed by the intraluminal domain and carboxy terminal cytoplasmic tail which allow the E3/19K protein to embed itself in the endoplasmic reticulum (ER), is located between viral nucleotides 28,812 and 29,288. Isolation of the Ad2 E3/19K gene from the viral genomic DNA is accomplished by PCR amplification, with the primer pair shown below:
  • the forward primer corresponds to the Ad2 nucleotide sequences 28,812 to 28,835.
  • the reverse primer corresponds to the Ad2 nucleotide sequences 29,241 to 29,213. (Sequence ID No. )
  • both primers contain a five nucleotide "buffer sequence" at their 5' ends for efficient enzyme digestion of the PCT amplicon products.
  • This sequence in the forward primer is followed by the Xho I recognition site and by the Cla I recognition site in the reverse primer.
  • the E3/19K gene is flanked by Xho I and Cla I recognition sites.
  • Amplification of the E3/19K gene from Ad2 DNA is accomplished with the following PCR cycle protocol:
  • the E3/19K gene from the SK-E3/19K construct is removed and isolated by 1% agarose/TBE gel electrophoresis as described in
  • Example 2Bi The Xho I-Cla I E3/19K fragment is then ligated into the KT-3B retroviral backbone.
  • This construct is designated KT-3B/E3/19K .
  • It is amplified by transforming DH5 ⁇ bacterial strain with the KT-3B/E3/19K construct. Specifically, the bacteria is transformed with 1-1000 ng of ligation reaction mixture DNA. The transformed bacterial cells are plated on LB plates containing ampicillin. The plates are incubated overnight at 37°C, bacterial colonies are selected and DNA is prepared from them. The DNA is digested with Xho I and Cla I.
  • the expected endonuclease restriction cleavage fragment sizes for plasmids containing the E3/19K gene are 780 and 1300 bp.
  • nucleotide sequence of each fragment is determine by the dideoxy method using the single-stranded M13mpl8 and M13mpl9 recombinant phage DNA as templates and selected synthetic oligonucleotides as primers. This confirms the identity and structural integrity of the gene.
  • the E3/1 K gene is ligated into the KT-3B or KT-3C vector as previously described in Example 2Bii.
  • the cDNA clone of the MHC class I allele CW3 (Zemmour et al., Tissue Antigens 39:249, 1992) is used as a template in a PCR reaction for the amplification of specific sequences to be inserted into the untranslated region of the neomycin resistance gene of the KT-3C backbone vector, .
  • the MHC class I allele CW1 cDNA is amplified between nucleotide sequence 147 to 1,075 using the following primer pairs:
  • the forward primer corresponds to MHC CW3 cDNA nucleotide sequence 147 to 166:
  • the reverse primer corresponds to MHC CW3 cDNA nucleotide sequence 1,075 to 1,056:
  • both primers contain a five nucleotide "buffer sequence" at their 5' ends for efficient enzyme digestion of the PCR amplicon products.
  • the buffer sequence is followed by the Hinc II recognition sequence in both primers.
  • Generation of the MHC amplicon with the primers shown above is accomplished using the PCR protocol described in section 2B This protocol is modified by using Vent polymerase (New England Biolabs, Beverly, MA) and further modified to include 1 minute extension times instead of 3.5 minutes. The Vent polymerase generates amplicons with blunt ends.
  • the forward and reverse primers may contain only the MHC CW3 complementary sequences.
  • the MHC CW3 cDNA 950 bp amplicon product is purified with Gene Clean (Biol 01, San Diego, CA) and digested with Hinc II.
  • the digested fragment, 938 bp is isolated by 1% agarose/TBE gel electrophoresis and purified with Gene Clean.
  • the MHC CW3 cDNA 938 bp fragment is inserted in the 3' untranslated region of the neomycin resistance gene in the antisense orientation.
  • the Hinc II recognition sequence at nucleotide sequence number 676 of the pBluescript II SK + (pSK + ) (Stratagene, San Diego, CA) plasmid is removed by digestion with Hinc II and Kpn I.
  • the Kpn I 3' end is blunted with T4 DNA polymerase and the blunt ends are ligated.
  • This plasmid is designated as pSKdlHII.
  • the 1.3 Kb Cla I- Cla I dominant selectable marker gene fragment from pAFVXM retroviral vector is cloned into the Cla I site of pSKdlH ⁇ .
  • This plasmid is designated as pSKdlHII/SVneo.
  • the MHC CW3 cDNA 938 bp fragment is inserted in an ar . sense orientation into the Hinc II site of pSKdlHII/SVneo, located in the 3' untranslated region of the neomycin resistance gene.
  • High level MHC CW3 antisense RNA expression is accomplished by insertion of this sequence downstream of the Ad2 VARNA 1 promoter.
  • the Ad2 VARNA promoter-MHC antisense cDNA is assembled as a RNA polymerase III (pol III) expression cassette then inserted into the KT-3C backbone.
  • pol III expression cassette the Ad2 VARNA 1 promoter is followed by the antisense ⁇ MHC cDNA, which in turn is followed by the pol III consensus termination signal.
  • the double stranded -30/+70 Ad2 VARNA 1 promoter is chemically synthesized (Railey et al., Mol. Cell. Biol. 8: 1147, 1988) and includes Xho I and Bgl II sites at the 5' and 3', respectively.
  • VARNA 1 promoter forward strand (Sequence ID No. ) 5'-3': CGAGTCTAGACCGTGCAAAAGGAGAGCCTGTAAGCGGGCACTCTTCC
  • the VARNA 1 promoter reverse strand (Sequence ID No. )
  • the forward primer corresponds to nucleotide sequence 653 to 680:
  • the reverse primer corresponds to nucleotide sequence 854 to 827:
  • both primers contain a five nucleotide "buffer sequence" at their 5' ends for efficient enzyme digestion of the PCR amplicon products.
  • the buffer sequence is followed by the Avr II recognition sequence in the forward primer and by the Bgl II recognition sequence in the reverse primer, which allows insertion in an antisense orientation, relative to the Ad2 VARNA 1 promoter in the pol III expression cassette.
  • Generation of the MHC amplicon with the primers discussed above is accomplished with the PCR protocol described in Example 2Bi modified to include 0.5 minute extension times instead of 3.5 minutes.
  • the MHC CW3 cDNA 223 bp amplicon product is purified with Gene Clean (Bio 101, San Diego, CA), then digested with Avrll and Bglll, and isolated by 2% NuSeive-1% agarose/TBE gel electrophoresis. The 211 bp band is then excised from the gel and the DNA purified with Gene Clean.
  • the double stranded pol III consensus termination sequence is chemically synthesized (Geiduschek et al., Annu. Rev. Biochem. 57:873, 1988) and includes Avr II and Cla I sites at the 5' and 3' ends, respectively.
  • the pol III termination sequence forward primer (Sequence ID No. )
  • the pol m termination sequence reverse primer (Sequence ID No. )
  • the pol III expression cassette for antisense ⁇ MHC class I allele CW3 is assembled in a four way ligation in which the Xho I-Bgl II Ad2 VARNA 1 promoter fragment, the Bgl II-Avr II ⁇ MHC CW3 fragment, and the Avr II-Cla I transcription termination fragment, are cloned into pSKII + between the Xho I and Cla I sites.
  • This construct is designated pSK/VARNA ⁇ xMHC.
  • KT3B/SVneo/VARNA/otMHC is accomplished in a two step ligation.
  • the first step is a three way ligation in which the Xho I-Cla I VARNA/ocMHC fragment and the 1.0 Kb MoMLV 3' LTR Cla I-Hind III fragment from N2R3", are inserted between the Xho I and Hind III sites of pUC31/N2R5g plasmid as described in Example 1.
  • This construct is designated KT3B VARNA/ ⁇ MHC.
  • the second ligation step the 1.3 Kb Cla I-BstB I SVneo fragment into the Cla I site of KT3B/VARNA ⁇ MHC.
  • This construct is designated KT3B/SVneo/VARNA ⁇ MHC.
  • a hairpin ribozyme with target specificity for the MHC class I allele is inserted into the KT3B/SVneo vector.
  • the ribozyme is expressed at high levels from the Ad2 VARNA 1 promoter.
  • the MHC hairpin ribozyme (HRBZ) is inserted into the pol III pSK VARNA otMHC expression cassette described in Example 3.
  • the HRBZ and the MHC class I allele CW3 have the homologous sequence shown below: (Sequence ID No. )
  • the HRBZ is designed to cleave after the A residue in the AGTC hairpin substrate motif contained in the target sequence. Following cleavage, the HRBZ is recycled and able to hybridize to, and cleave, other MHC class I RNA molecule.
  • Double stranded HRBZ as defined previously (Hampel et al., Nucleic Acids Research 18:299, 1990), containing a four base "tetraloop" 3 and an extended helix 4, with specificity for the MHC class I homologous sequence shown above, is chemically synthesized and includes Bgl II and Avr II sites at the 5' and 3' ends, respectively.
  • the MHC HRBZ sense strand (Sequence ID No. )
  • the MHC HRBZ antisense strand (Sequence ID No. )
  • the pol III expression cassette for the MHC HRBZ is assembled by ligation of the chemically synthesized double stranded MHC class I specific HRBZ with Bgl II and Avr II cohesive ends into Bgl II and Avr II digested and CIAP treated pSK/VARNA ⁇ MHC, in which the ⁇ MHC sequence has been gel purified away from the expression vector.
  • This plasmid is designated pSK VARNA MHCHRBZ and contains the Ad2 VARNA 1 promoter followed by the MHC HRBZ, which in turn is followed by the pol III consensus termination sequence.
  • the pol III expression components is flanked by Xho I and Cla I recognition sites.
  • KT3B/SVneo/VARNA/MHCHRBZ Construction of KT3B/SVneo/VARNA/MHCHRBZ is accomplished in a two ste ligation.
  • the first step is a three way ligation in which the Xho I-Cla I VARNA/MHCHRB fragment and the 1.0 Kb MoMLV 3' LTR Cla I-Hind III fragment from N2R3-, are inserte between the Xho I and Hind III sites of pUC31/N2R5g M plasmid described in Example 1.
  • This construct is designated KT3B/VARNA MHCHRBZ.
  • the 1.3 Kb Cl I-BstB I SVneo fragment is ligated into the Cla I site of KT3B/VARNA MHCHRBZ.
  • Thi construct is designated KT3B/SVneo/VARNA MHCHRBZ.
  • the PSFl cDNA is amplified between nucleotide sequence 91 to 1,124 using the following primer pairs:
  • the forward primer corresponds to nucleotide sequence 91 to 111 :
  • the reverse primer corresponds to nucleotide sequence 1,124 to 1,105:
  • both primers contain a five nucleotide "buffer sequence" at their 5' ends for efficient enzyme digestion of the PCR amplicon products.
  • the buffer sequence is followed by the Hinc II recognition sequence in both primers.
  • Generation of the PSFl amplicon with the primers discussed above is accomplished with the PCR protocol described in Example 2Bi. This protocol is modified by using Vent polymerase (New England Biolabs, Beverly, MA) and further modified to include 1 minute extension times instead of 3.5 minutes. The Vent polymerase generates amplicons with blunt ends.
  • High level PSFl antisense expression is accomplished by insertion of this sequence downstream of the Ad2 VARNA 1 promoter.
  • the Ad2 VARNA promoter- PSF1 antisense cDNA is first assembled as a pol III expression cassette then inserted into the KT-3B backbone. In this pol III expression cassette, the Ad2 VARNAl promoter is followed by the antisense PSFl cDNA, which in turn is followed by the pol in consensus termination signal.
  • the nucleotide sequence 91 to 309 of the PSFl cDNA are amplified in a PCR reaction using the following primer pair:
  • the forward primer corresponds to nucleotide sequence 91 to 111: (Sequence ID No. )
  • the reverse primer corresponds to nucleotide sequence 309 to 288:
  • both primers contain a five nucleotide "buffer sequence" at their 5' ends for efficient enzyme digestion of the PCR amplicon products.
  • the buffer sequence is followed by the Avr II recognition sequence in the forwc'd primer and by the Bgl II recognition sequence in the reverse primer, which allows insertion in an antisense orientation, relative to the Ad2 VARNAl promoter in the RNA polymerase III expression cassette.
  • Generation of the PSFl amplicon with the primers described above is accomplished with the PCR protocol described in Example 2Bi modified to include 0.5 minutes extension times instead of 3.5 minutes.
  • the MHC CW3 cDNA 240 bp amplicon product is purified with Gene Clean
  • KT3B/SVneo/VARNA/ocPSFl is accomplished in two step ligation.
  • the first step is a three-way ligation in which the Xho I-Cla I VARNA/ ⁇ PSFl fragment and the 1.0 Kb MoMLV 3' LTR Cla I-Hind III fragment from N2R3", are inserted between the Xho I and Hind III sites of pUC31/N2R5g plasmid as described ir Example 1.
  • This construct is designated as KT3B/VARNA/ ⁇ PSFl.
  • the second ligation step the 1.3 kb Cla I-BstB I SVneo fragment is ligated into the Cla I site of KT3B/VARNA/ ⁇ PSF 1.
  • This construct is designated KT3B/S Vneo/VARNA/ ⁇ PSFl .
  • a hairpin ribozyme with target specificity for the PSFl RNA is inserted into the KT3B/SVne ⁇ vector.
  • the ribozyme is expressed at high levels from the Ad2 VARNAl promoter.
  • the PSFl hairpin ribozyme (HRBZ) is inserted into the pol III pSK/VARNA/ ⁇ MHC expression cassette described in Example 3.
  • the PSFl HRBZ-pol III expression cassette is then inserted into the KT3B/SVneo backbone vector.
  • the HRBZ and the PSFl RNA have the homologous sequence shown below:
  • the HRBZ is designed to cleave after the T residue in the TGTC hairpin substrate motif contained in the target sequence. Following cleavage, the HRBZ is recycled and able to hybridize to, and cleave, other PSFl RNA molecule.
  • Double stranded HRBZ as defined previously (Hampel et al., Nucleic Acids Research 18:299, 1990), containing a four base "tetraloop" 3 and an extended helix 4, with specificity for the PSFl homologous sequence shown above, is chemically synthesized and includes Bgl II and Avr II sites at the 5' and 3' ends, respectively.
  • the PSFl HRBZ, sense strand (Sequence ID No. )
  • the PSFl HRBZ, antisense strand (Sequence ID No. )
  • the pol HI expression cassette for the PSFl HRBZ is assembled by ligation of the chemically synthesized double stranded PSFl specific HRBZ with Bgl II and Avr II cohesive ends into Bgl II and Avr II digested and CIAP treated pSK/VARNA ocMHC, in which the ocMHC sequence has been gel purified away from the pol III expression vector.
  • This plasmid is designated pSK/VARNA PSFlHRBZ and contains the Ad2 VARNAl promoter followed by the PSFl HRBZ, which in turn is followed by the pol III consensus termination sequence.
  • the pol III expression component is flanked by Xho I and Cla I recognition sites.
  • KT3B/SVneo/VARNA PSFlHRBZ Construction of KT3B/SVneo/VARNA MHCHRBZ is accomplished in a two step ligation.
  • the first step is a three way ligation in which the Xho I-Cla I VARNA/PSFIHRBZ fragment and the 1.0 Kb MoMLV 3' LTR Cla I-Hind III fragment from N2R3", are inserted between the Xho I and Hind III sites of pUC31/N2R5g M plasmid as described in Example 1.
  • This construct is designated KT3B/VARNA/PSF1HRBZ.
  • the second ligation step the 1.3 Kb Cla I-BstB I SVneo fragment is ligated into the Cla I site of KT3B/VARNA/PSF1HRBZ. This construct is designated
  • a variation of the retroviral vector KT3B-E3/19K can also be constructed containing both the E3/19K sequences and anti-sense sequences specific for a conserved region between the three class I MHC alleles A2, CW3 and B27, Example 2 and 3.
  • This vector known as KT3B-E3/19K/ ⁇ MHC, is designed to incorporate the MHC class I anti-sense sequences at the 3' end of the E3/19K sequence which would be expressed as a chimeric molecule.
  • the retroviral vector, KT3B-E3/19K/ ⁇ MHC can be constructed by ligating a Cla I digested PCR amplified product containing the MHC anti-sense sequences into the Cla I site of the KT3B-E3/19K vector. More specifically, the cDNA clone of the MHC class I allele CW3 (Zemmour et al., Tissue Antigens 39:249, 1992) is amplified by PCR between nucleotides 653 and 854 using the following primer pair:
  • the forward primer of ocMHC is:
  • the reverse primer of ⁇ MHC is:
  • the primer pairs are flanked by Cla I restriction enzyme sites in order to insert an amplified Cla I digested product into the partially pre-digested KT-3B-E3/19K vector in the anti-sense orientation.
  • Cla I fragment By placing the Cla I fragment in reverse orientation the vector will express the negative anti-sense strand upon transcription.
  • 293 2-3 cells (a cell line derived from 293 cells ATCC No. CRL 1573, WO 92/05266) 5 x 10 5 cells are seeded at approximately 50% confluence on a 6 cm tissue culture dish. The following day, the media is replaced with 4 ml fresh media 4 hours prior to transfection.
  • a standard calcium phosphate-DNA coprecipitation is performed by mixing 10.0 ⁇ g of KT-3B-E3/19K plasmid and 10.0 ⁇ g MLP G plasmid with a 2M CaC-2 solution, adding a lx Hepes buffered saline solution, pH 6.9, and incubating for 15 minutes at room temperature.
  • the calcium phosphate-DNA coprecipitate is transferred to the 293 2-3 cells, which are then incubated overnight at 37°C, 5% CO2. The following morning, the cells are rinsed three times in lx PBS, pH 7.0. Fresh media is added to the cells, followed by overnight incubation at 37°C, 10% CO2. The following day, the media is collected off the cells and passed through a 0.45 ⁇ filter. This supernatant is used to transduce packaging and tumor cell lines. Transient vector supernatant for other vectors are generated in a similar fashion.
  • DA cells an amphotropic cell line derived from D-17 cells ATCC No. 183, WO 92/052666
  • DA cells are seeded at 5 x 10 5 cells/10 cm dish.
  • phleomycin is added to these cells and a drug resistant pool is generated over a period of a week.
  • This pool of cells is dilution cloned to yield a single cell per well of 96 well plates. Twenty-four clones are expanded to 24 well plates, then to 6 well plates, at which time cell supernatants are collected for titering.
  • DA clones are selected for vector production and called DA-E3/19K.
  • Vector supernatants are collected from 10cm confluent plates of DA-E3/19K clones cultured in normal media containing polybrene or protamine sulfate. Alternatively, vector supernatant can be harvested from bioreactors or roller bottles, processed and purified further before use.
  • selection of stably transduced clones must be performed by dilution cloning the DA transduced cells one to two days after transducing the cells with 293 2-3 generated supernatant.
  • the dilution clones are then screened for the p r esence of E3/19K expression by using reverse transcription of messenger RNA, followed by amplification of the cDNA message by the polymerase chain reaction, a procedure known as the RT-PCR.
  • a commercial kit is available through Invitrogen Corp. (San Diego, CA).
  • RT-PCR should be performed on clones which have been propagated for at least 10 days and approximately 50 to 100 clones will need to be screened in order to find a reasonable number of stably transformed clones.
  • specific primers will be required for each message to be amplified. Primers designed to amplify a 401 bp product for E3/19K message screening are as follows:
  • the extended S + L ⁇ assay determines whether replication competent, infectious virus is present in the supernatant of the cell line of interest.
  • the assay is based on the empirical observation that infectious retroviruses generate foci on the indicator cell line MiCli (ATCC CCL 64.1).
  • the MiCl] cell line is derived from the MvlLu mink cell line (ATCC CCL 64) by transduction with Murine Sarcoma Virus (MSV). It is a non- producer, non-transformed, revertant clone containing a murine sarcoma provirus that forms sarcoma (S + ) indicating the presence of the MSV genome but does not cause leukemia (L”) indicating the absence of replication competent virus.
  • MvlLu cells are seeded at 1 x 10 5 cells per well (one well per sample to be tested) of a 6 well plate in 2 ml DMEM, 10% FBS and 8 ⁇ g/ml polybrene. MvlLu cells are plated in the same manner for positive and negative controls on separate 6 well plates. The cells are incubated overnight at 37°C, 10% CO2.
  • 1.0 ml of test supernatant is added to the MvlLu cells.
  • the negative control plates are incubated with 1.0 ml of media.
  • the positive control consists of three dilutions (200 focus forming units (ffu), 20 ffli and 2 ffu each in 1.0 ml media) of MA virus (Miller et al., Molec. and Cell. Biol. 5:431, 1985) which is added to the cells in the positive control wells. The cells are incubated overnight. On day 3, the media is aspirated and 3.0 ml of fresh DMEM and 10% FBS is added to the cells.
  • the cells are allowed to grow to confluency and are split 1:10 on day 6 and day 10, amplifying any replication competent retrovirus.
  • the media on the MvlLu cells is aspirated and 2.0 ml DMEM and 10% FBS is added to the cells.
  • the MiCli cells are seeded at 1 x 10 5 cells per well in 2.0 ml DMEM, 10% FBS and 8 ⁇ g/ml polybrene.
  • the supernatant from the MvlLu cells is transferred to the corresponding well of the MiCli cells and incubated overnight at 37°C, 10% CO2.
  • the media is aspirated and 3.0 ml of fresh DMEM and 10% FBS is added to the cells.
  • the cells are examined for focus formation (appearing as clustered, refractile cells that overgrow the monolayer and remain attached) on the monolayer of cells.
  • the test article is determined to be contaminated with replication competent retrovirus if foci appear on the MiCl] cells.
  • HT 1080 ATCC No. CCL 121
  • Hela ATCC No. CCL 2
  • BC10ME Patek et al., Cell. Immuno. 72:113, 1982, ATCC No. TIB 85
  • BCenv BC10ME expressing HIV-1 IIIBenv (Warner et al., AIDS Res, and Human Retroviruses 7:645. 1991, L33 obtained from Gunther Oennert, University of Southern California), and L33env.
  • 1.0 ml of filtered supernatant from the DA E3/19K pool is added to each of the cell culture plates.
  • phleomycin is added to the media of all cell cultures.
  • the E3/19K in the KT-3C backbone phleomycin resistant
  • Transient supernatants for 293 2-3 or from DA derived lines can be used.”
  • the cultures are maintained until selection is complete and sufficient cell numbers are generated to test for gene expression.
  • the transduced cell lines are designated HT 1080-E3/19K, Hela- E3/19K, BC10ME-E3/19K, L33-E3/19K and L33env-E3/.9K respectively.
  • EBV transformed cell lines are transduced by co-cultivation with the irradiated producer cell line, DA-E3/19K.
  • irradiated (10,000 rads) producer line cells are plated at 5 x 10*5 cells /6 cm dish in growth media containing 4 ⁇ g/ml polybrene. After the cells have been allowed to attach for 2-24 hours, 10 ⁇ suspension cells are added. After 2-3 days, the suspension cells are removed, pelleted by centrifligation, resuspended in growth media containing 1 mg/ml phleomycin , and seeded in 10 wells of a round bottom 96 well plate. The cultures were expanded to 24 well plates, then to T-25 flasks.
  • Radio-immuno precipitation assay (RIPA) lysates are made from selected cultures for analysis of E3/19K expression.
  • RIPA lysates are prepared from confluent plates of cells. Specifically, the media is first aspirated off the cells. Depending upon the size of the culture plate containing the cells, a volume of 100 to 500 ⁇ l ice cold RIPA lysis buffer (10 mM Tris, pH 7.4; 1% Nonidet P40 (Calbiochem, San Diego, CA); 0.1% SDS; 150 mM NaCl) is added to the cells. Cells are removed from plates using a micropipet and the mixture is transferred to a microfuge tube.
  • RIPA lysates are prepared from confluent plates of cells. Specifically, the media is first aspirated off the cells. Depending upon the size of the culture plate containing the cells, a volume of 100 to 500 ⁇ l ice cold RIPA lysis buffer (10 mM Tris, pH 7.4; 1% Nonidet P40 (Calbiochem
  • the tube is centrifuged for 5 minutes to precipitate cellular debris and the supernatant is transferred to another tube.
  • the supernatants are electrophoresed on a 10% SDS-PAGE gel and the protein bands are transferred to an Immobilon membrane in CAPS buffer (Aldrich, Milwaukee, WI) (10 mM CAPS, pH 11.0; 10% methanol) at 10 to 60 volts for 2 to 18 hours.
  • the membrane is transferred from the CAPS buffer to 5% Blotto (5% nonfat dry milk; 50 mM Tris, pH 7.4; 150 mM NaCl; 0.02% sodium azide, and 0.05% Tween 20) and probed with a mouse monoclonal antibody to E3/19K (Severinsson et al., J. Cell Biol. 101:540. 1985).
  • Antibody binding to the membrane is detected by the use of 125 I- Protein A.
  • Cell lines transduced with the E3/19K-vector are examined for MHC class I molecule expression by FACS analysis. Non-transduced cells are also analyzed for MHC class I molecule expression and compared with E3/19K transduced cells to determine the effect of transduction on MHC class I molecule expression.
  • Murine cell lines L33-E3/19K, L33env-E3/19K, L33, L33env, BC10ME, BCenv, and BCenv-E3/19K, are tested for expression of the H-2D d molecule on the cell surface.
  • Cells grown to subconfluent density are removed from culture dishes by treatment with Versene and washed two times with cold (4°C) PBS plus 1% BSA and 0.02% Na-azide (wash buffer) by centrifligation at 200g. Two million cells are placed in microfuge tubes and pelleted by centrifligation, 200g, and the supernatant is removed.
  • Cell pellets are resuspended with the H-2D d -s ⁇ ecific Mab 34-2-12s (50 ⁇ l of a 1:100 dilution of purified antibody, ATCC No. HB 87) and incubated for 30 min at 4°C with occasional mixing.
  • Antibody labeled cells are washed two times with 1 ml of wash buffer (4°C) centrifuged and the supernatant is removed.
  • Cells are resuspended with a biotinylated goat anti-mouse kappa light chain Mab (Amersham, Arlington Heights, EL) (50 ⁇ l, of a 1:100 dilution of purified antibody) and incubated for 30 min at 4°C.
  • Balb/c mice are injected with 10 7 irradiated (10,000 rads) BCenv cells. After 7 days the spleens are harvested, dispersed into single cell suspension and 3 x 10 6 splenocytes/ml are cultured in vitro with 6 x 10 4 cells/ml irradiated BCenv or BCenv- E3/19K cells for 7 days at 37°C in T-25 flasks.
  • Culture medium consists of RPMI 1640; 5% fetal bovine serum, heat-inactivated (FBS); 1 mM pyruvate; 50 ⁇ g/ml gentamicin and 10 " M 2-mercaptoethanol.
  • Effector cells are harvested 7 days later and tested using various effecto ⁇ target cell ratios in 96 well microtiter plates in a standard 4- 6 hour assay.
  • the assay employs Na CrO -labeled, 100 ⁇ Ci, 1 hour at 37°C, (Amersham, Arlington Heights, Illinois) target cells (BC, BCenv, Warner, et al., Aids Res, and Human Retroviruses 7: 645, 1991 or BCenv E3/19K) at 1.0 x 10 4 cells/well with the final total volume per well of 200 ⁇ l. Following incubation, 100 ⁇ l of culture medium is removed and analyzed in a WALLAC gamma spectrometer (Gaithersburg, MD.).
  • Spontaneous release is determined as CPM from targets plus medium and maximum release (MR) is determined as counts per minute (CPM) from targets plus 1M HC1. Percent target cell lysis is calculated as: [(effector cell + target CPM) - (SR)]/[(MR) - (SR)] x 100. Spontaneous release values of targets are typically 10%- 30% of the MR. Tumor cells that have been transduced with the gene of interest (ribozyme, E3/19K, antisense, etc.) are used as stimulator and/or target cells in this assay to demonstrate the reduction of HIV-specific CTL induction and detection as compared to the non-transduced line which is the positive control.
  • ribozyme ribozyme, E3/19K, antisense, etc.
  • the L33env cell is being employed as a model for gene therapy treated transformed cells. Gene therapy treated cells produce a foreign protein making them possible targets for clearance by CTL. It has been demonstrated that Balb/c mice injected with live L33 tumor cells will develop a solid tumor identifiable by caliper measurement within three weeks post-exposure. However, Balb/c mice injected with live L33env transformed tumor cells (L33 cells transduced and selected for expression of the HTV-l ⁇ iB envelope protein) recognize HTV env in the context of H-2D d and reject the tumor cells with no apparent tumor up to 15 weeks later (Warner et al., AIDS Res. and Human Retroviruses 7:645, 1991).
  • Transformation of L33env cells with the E3/19K vector decreases cell surface expression of MHC class I molecules allowing these cells to evade immune surveillance and thereby establish a tumor.
  • Development of an L33env tumor indicates that cell surface expression of MHC class I molecules has been decreased by cotransducing cells with the El 9 gene. This impedes optimal immune system clearance mechanisms.
  • Three tumor cell lines L33, L33env, and E3/19K-L33env are grown in DMEM containing 10% FBS. The tumor cells are gently rinsed with cold (4°C) PBS and treated with versene to remove them from the plate. After aspirating cells from plates, single cell suspensions are added to sterile plastic tubes.
  • mice 4-6 weeks old are injected subcutaneous with 10 6 live tumor cells (0.1 ml) and assessed for tumor formation and tumor clearance. Different mice are injected with different tumor cell lines. Mice injected with L33 cells are positive control animals for tumor formation while those injected with L33env are negative controls and should reject the tumor cells because of the env specific CTL response. The group of mice injected with E3/19K-transformed, L33env cells are monitored to show the effect that E3/19K expression in L33env cells has on the murine immune response to these tumor cells.
  • Cell lines transduced with the E3/19K vector are examined for class I molecule expression by FACS analysis.
  • Non-transduced cells are analyzed for class I molecule expression to compare with E3/19K transduced cells and determine the effect that transduction has on class I molecule expression.
  • the cells Prior to removing the supernatant, the cells are resuspended with a biotinylated rat anti-mouse kappa light chain Mab (50 ⁇ l, of a 1:100 dilution of purified antibody) and incubated for 30 min at 4°C. Cells are washed, resuspended with 50 ⁇ l of avidin conjugated FITC, and incubated for 30 min at 4°C. The cells are washed once more, and resuspended in 1 ml of wash buffer, and held on ice prior to analysis on a FACStar Analyzer. The mean fluorescence intensity of transduced cells is compared with that of non-transduced cells to determine the effect E3/19K protein has on surface MHC class I molecule expression.
  • Human CTL lines propagated from donor blood samples using autologous EBV transformed cells as stimulators have been shown to be HLA-A2 restricted and specific for EBV proteins. These CTL lines, are propagated with autologous EBV transformed cells and can lyse JY target cells (HLA-A2 + and EBV transformed). A chromium release assay can be performed with these CTL lines and JY target cells that have been transformed with the E3/19K gene or nontransduced. The EJ/19K transformed JY target cell are used to demonstrate decreased recognition and lysis of this cell when compared to nontransformed JY target cells. These results indicate that cell transformation with agents that decrease MHC class I surface expression also ---ecreases MHC class I restricted cell mediated immune responses in an in vitro human c 1 model system.
  • I x 10 6 irradiated (10,000 rad) JY cells are cultured with 1 x 10 7
  • the culture medium consists of RPMI 1640 supplemented with 5% heat inactivated fetal bovine serum preselected for
  • Spontaneous release is determined as counts per minute (CPM) CPM from targets plus medium and maximum release (MR) is determined as from targets plus 1M HC1. Percent target cell lysis is calculated as: [(effector cell + target CPM) - (SR)]/[(MR) - (SR)] x 100. Spontaneous release values of targets are typically 10%-30% of the MR. Tumor cells that have been transduced with the gene of interest (ribozyme, E3/19K, antisense, etc.) are used as stimulator and/or target cells in this assay to demonstrate the reduction of EBV-specific CTL induction and detection as compared to the non-transduced line which is the positive control.
  • the number of transformed cells used to infuse back into the patient per infusion is projected to be at a minimum of l ⁇ 7 - lO-* cells per patient per injection.
  • the site of the infusion may be directly into the patient's synovial membrane or i.v., into the peripheral hood stream.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Zoology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Cellules tissulaires d'un animal transformées à l'aide d'un vecteur de recombinaison qui (a) exprime une protéine ou une partie active de ladite protéine, (b) transcrit un message non codant ou (c) transcrit un ribozyme capable d'inhiber la présentation d'antigènes du complexe majeur d'histocompatiblité (MHC), destinées à être utilisées pour supprimer une réponse auto-immune. Dans un aspect associé, lesdites cellules sont transformées avec au moins deux protéines, deux messages non codants ou deux ribozymes ou des combinaisons de ceux-ci.
PCT/US1994/009860 1993-09-03 1994-09-02 Procede de suppression de la reponse auto-immune WO1995006718A2 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
AU78699/94A AU7869994A (en) 1993-09-03 1994-09-02 Methods of suppressing autoimmune response
JP7508256A JPH09503655A (ja) 1993-09-03 1994-09-02 自己免疫応答の抑制方法
EP94929752A EP0716692A1 (fr) 1993-09-03 1994-09-02 Procede de suppression de la reponse auto-immune

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US11698393A 1993-09-03 1993-09-03
US08/116,983 1993-09-03

Publications (2)

Publication Number Publication Date
WO1995006718A2 true WO1995006718A2 (fr) 1995-03-09
WO1995006718A3 WO1995006718A3 (fr) 1995-04-06

Family

ID=22370406

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1994/009860 WO1995006718A2 (fr) 1993-09-03 1994-09-02 Procede de suppression de la reponse auto-immune

Country Status (5)

Country Link
EP (1) EP0716692A1 (fr)
JP (1) JPH09503655A (fr)
AU (1) AU7869994A (fr)
CA (1) CA2158932A1 (fr)
WO (1) WO1995006718A2 (fr)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5624803A (en) * 1993-10-14 1997-04-29 The Regents Of The University Of California In vivo oligonucleotide generator, and methods of testing the binding affinity of triplex forming oligonucleotides derived therefrom
US6376661B1 (en) * 1997-12-04 2002-04-23 Isis Pharmaceuticals, Inc. Human RNase H and compositions and uses thereof
WO2003051309A2 (fr) * 2001-12-17 2003-06-26 Isis Pharmaceuticals, Inc. Modulation antisens de l'expression du transporteur abc mhc 1
US6692910B2 (en) 1997-07-28 2004-02-17 The University Of Connecticut Inhibition of a target messenger RNA with a modified U1 small nuclear RNA
WO2004080378A3 (fr) * 2003-03-04 2005-04-21 Univ Nice Sophia Antipolis Methodes et outils pour le criblage d’arn actifs in cellulo
US6884785B2 (en) * 1999-06-17 2005-04-26 The Scripps Research Institute Compositions and methods for the treatment or prevention of autoimmune diabetes
WO2005108572A1 (fr) * 2004-05-06 2005-11-17 Medizinische Hochschule Hannover Composes et procedes d'immunosuppression
US8236771B2 (en) * 2004-05-18 2012-08-07 National Institute Of Transplantation Foundation Vectors and methods for long-term immune evasion to prolong transplant viability

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991002805A2 (fr) * 1989-08-18 1991-03-07 Viagene, Inc. Retrovirus de recombinaison apportant des constructions de vecteur a des cellules cibles
WO1992007071A1 (fr) * 1990-10-19 1992-04-30 The Board Of Trustees Of The University Of Illinois Methodes et applications relatives a des elements suppresseurs genetiques efficaces
WO1993002690A1 (fr) * 1991-08-02 1993-02-18 The General Hospital Corporation Diagnostic et traitement de maladies auto-immunes
WO1993014769A1 (fr) * 1992-01-31 1993-08-05 The Regents Of The University Of California Procede de production de cellules donneuses universelles
EP0601585A2 (fr) * 1992-12-09 1994-06-15 Enzo Therapeutics, Inc. Acide nucléique pour l'inhibition ou la régulation des fonctions d'un gène de la réponse immunitaire, méthode employant le-dit acide nucléique et système immuno-compatible contenant le-dit acide nucléique

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991002805A2 (fr) * 1989-08-18 1991-03-07 Viagene, Inc. Retrovirus de recombinaison apportant des constructions de vecteur a des cellules cibles
WO1992007071A1 (fr) * 1990-10-19 1992-04-30 The Board Of Trustees Of The University Of Illinois Methodes et applications relatives a des elements suppresseurs genetiques efficaces
WO1993002690A1 (fr) * 1991-08-02 1993-02-18 The General Hospital Corporation Diagnostic et traitement de maladies auto-immunes
WO1993014769A1 (fr) * 1992-01-31 1993-08-05 The Regents Of The University Of California Procede de production de cellules donneuses universelles
EP0601585A2 (fr) * 1992-12-09 1994-06-15 Enzo Therapeutics, Inc. Acide nucléique pour l'inhibition ou la régulation des fonctions d'un gène de la réponse immunitaire, méthode employant le-dit acide nucléique et système immuno-compatible contenant le-dit acide nucléique

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
NATURE, vol.347, no.6295, 25 October 1990, LONDON, GB pages 770 - 772 H. BROWNE ET AL. 'A complex between the MHC class I homologue encoded by human cytomegalovirus and beta2 microglobulin.' cited in the application *
PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE USA, vol.84, no.5, March 1987, WASHINGTON DC, USA pages 1356 - 1360 H-G. BURGERT ET AL. '"E3/19K" protein of adenovirus type 2 inhibits lysis of cytolytic T lymphocytes by blocking cell-surface expression of histocompatibility class I antigens.' *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5624803A (en) * 1993-10-14 1997-04-29 The Regents Of The University Of California In vivo oligonucleotide generator, and methods of testing the binding affinity of triplex forming oligonucleotides derived therefrom
US6692910B2 (en) 1997-07-28 2004-02-17 The University Of Connecticut Inhibition of a target messenger RNA with a modified U1 small nuclear RNA
US6376661B1 (en) * 1997-12-04 2002-04-23 Isis Pharmaceuticals, Inc. Human RNase H and compositions and uses thereof
US6884785B2 (en) * 1999-06-17 2005-04-26 The Scripps Research Institute Compositions and methods for the treatment or prevention of autoimmune diabetes
WO2003051309A2 (fr) * 2001-12-17 2003-06-26 Isis Pharmaceuticals, Inc. Modulation antisens de l'expression du transporteur abc mhc 1
WO2003051309A3 (fr) * 2001-12-17 2004-04-15 Isis Pharmaceuticals Inc Modulation antisens de l'expression du transporteur abc mhc 1
WO2004080378A3 (fr) * 2003-03-04 2005-04-21 Univ Nice Sophia Antipolis Methodes et outils pour le criblage d’arn actifs in cellulo
WO2005108572A1 (fr) * 2004-05-06 2005-11-17 Medizinische Hochschule Hannover Composes et procedes d'immunosuppression
US8236771B2 (en) * 2004-05-18 2012-08-07 National Institute Of Transplantation Foundation Vectors and methods for long-term immune evasion to prolong transplant viability

Also Published As

Publication number Publication date
JPH09503655A (ja) 1997-04-15
EP0716692A1 (fr) 1996-06-19
CA2158932A1 (fr) 1995-03-09
WO1995006718A3 (fr) 1995-04-06
AU7869994A (en) 1995-03-22

Similar Documents

Publication Publication Date Title
JP2859252B2 (ja) 感染および過剰増殖障害の為の組換え療法
JP2752788B2 (ja) 感染および過剰増殖障害の為の組換え療法
Williams et al. Retrovirus-mediated transfer of human adenosine deaminase gene sequences into cells in culture and into murine hematopoietic cells in vivo.
DE69829857T2 (de) Hypoxie-regulierte gene
JPH09509324A (ja) 増殖阻止ホメオボックス遺伝子
JPH06335392A (ja) Ｈｉｖ阻害性アンチセンスおよび他のヌクレオチド配列を含有する発現構成体、レトロウイルスのベクターおよびそれを含有する組換えレトロウイルス
US6323019B1 (en) Design of novel highly efficient HIV based packaging systems for gene therapy
EP0716692A1 (fr) Procede de suppression de la reponse auto-immune
US5650306A (en) Recombinant nucleic acids for inhibiting HIV gene expression
JPH06505401A (ja) ウイルス、特に病原性レトロウイルスによって誘発される疾病の予防または治療のための形質転換された細胞
EP0716710B1 (fr) Procedes de suppression de la reponse immunitaire par therapie genique
US5414076A (en) DNA encoding gibbon ape leukemia virus receptor
JPH09508267A (ja) 自然抵抗性結合マクロファージタンパク質およびその使用法
IL130160A (en) Expression vector for blocking hiv entry into a cell and compositions comprising cells transduced with such vector
WO1997005254A1 (fr) Adn complementaire de cytidine deaminase utilise comme marqueur positif pouvant etre selectionne pour le transfert de gene, la therapie genique et la synthese de proteine
WO1999003999A1 (fr) Procedes et compositions servant a inhiber la reaction proinflammatoire
AU7681394A (en) Methods of suppressing graft rejection
US20030091546A1 (en) Methods of suppressing immune response by gene therapy
US20030008356A1 (en) Novel polypeptide, a cDNA encoding the same, and use of it
KR20210110234A (ko) Apoe4 rna 특이적 트랜스-스플라이싱 리보자임 및 이의 용도
WO2023081749A1 (fr) Compositions et méthodes de traitement d'une déficience du récepteur de l'interleukine 7
US6063374A (en) Recombinant HIV and modified packaging cells and method for using
US20040038247A1 (en) Nucleic acid constructs including a novel t-cell active promoters, and pharmaceutical compositions and methods utilizing same for regulating t-cell mediated immune response
Takatoku et al. HEMATOPOIETIC STEM CELL GENE TRANSFER: ONCO RETROVIRUS VECTORS
Heusch Preclinical development of ribozyme gene therapy for primate lentiviruses

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AU CA JP

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

AK Designated states

Kind code of ref document: A3

Designated state(s): AU CA JP

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2158932

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1994929752

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1994929752

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1994929752

Country of ref document: EP