WO1999003999A1 - Procedes et compositions servant a inhiber la reaction proinflammatoire - Google Patents

Procedes et compositions servant a inhiber la reaction proinflammatoire Download PDF

Info

Publication number
WO1999003999A1
WO1999003999A1 PCT/US1998/014771 US9814771W WO9903999A1 WO 1999003999 A1 WO1999003999 A1 WO 1999003999A1 US 9814771 W US9814771 W US 9814771W WO 9903999 A1 WO9903999 A1 WO 9903999A1
Authority
WO
WIPO (PCT)
Prior art keywords
fasl
agent
cell mixture
tgf
cells
Prior art date
Application number
PCT/US1998/014771
Other languages
English (en)
Inventor
Gary J. Nabel
Jian-Jun Chen
Original Assignee
The Regents Of The University Of Michigan
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Regents Of The University Of Michigan filed Critical The Regents Of The University Of Michigan
Priority to AU84087/98A priority Critical patent/AU8408798A/en
Publication of WO1999003999A1 publication Critical patent/WO1999003999A1/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5047—Cells of the immune system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/12—Cyclic peptides, e.g. bacitracins; Polymyxins; Gramicidins S, C; Tyrocidins A, B or C
    • A61K38/13—Cyclosporins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A61K38/1841—Transforming growth factor [TGF]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70575—NGF/TNF-superfamily, e.g. CD70, CD95L, CD153, CD154
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70578—NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2510/00—Detection of programmed cell death, i.e. apoptosis

Definitions

  • the CD95 or Fas antigen is a cell surface receptor which transduces apoptotic signals into cells. Itoh, N. et al. (1991) Cell 66:233.
  • the physiological ligand of Fas, Fas- ligand (FasL) is a type 2 membrane protein which can transduce this signal upon cell contact (Suda, T. et al. (1993) Cell 75:1169) or in a soluble form. Nagata, S. and Goldstein, P. (1995) Science 267:1449.
  • Fas-FasL The primary function of the Fas-FasL system is thought to be the maintenance of homeostasis in the immune system by the clonal deletion of autoreactive lymphocytes in peripheral lymphoid tissues and the elimination of expanded lymphocyte populations. Nagata, S. and Goldstein, P. (1995) Science 267:1449; Brunner, T. et al. (1995) Nature 373:441; Dhein, J. et al. (1995) Nature 373:438; and Ju, S. et al. (1995) Nature 373:444. FasL expression in normal tissue is restricted to T lymphocytes, macrophages, the cornea, the iris, ciliary bodies, the retina and Sertoli cells (Wong-Staal, F.
  • FasL has therefore been proposed as a gene product which may be useful in the setting of cell or organ transplantation, as evidenced by its ability to delay the rejection of allogeneic cells (Lau, M.
  • FasL FasL
  • Science 273:109 Science 273:109.
  • FasL FasL
  • the ability of FasL to prolong foreign tissue engraftment is complicated and contraindicated by the proinflammatory effects of FasL (Arai, H. et al. (1997) Nat. Med. 3:843).
  • Syngeneic tumor cells which express FasL are also rapidly rejected by inflammatory cells in vivo
  • an effective amount of FasL is coadministered with the immunosuppressive agent.
  • the cell mixture comprises neutrophil cells. The method can be practiced in vitro, ex vivo or in vivo.
  • the immunosuppressive agent can be any agent which inhibits the immunostimulatory function of FasL.
  • Such agents include, but are not limited to, anti-sense molecules that inhibit endogenous FasL expression, soluble Fas receptors or variants thereof, ribozymes that inhibit the endogeneous expression of FasL, drugs that inhibit FasL signalling, agents that induce the endogenous expression of TGF- ⁇ , such as cyclosporin or thrombospondin 1 , polynucleotides coding for an immunosuppressive agent such as TGF- ⁇ , or TGF- ⁇ protein or polypeptide.
  • agents, molecules and compositions can be administered alone or in combination with a carrier, e.g., a pharmaceutically acceptable carrier.
  • a method for identifying agents which modulate FasL stimulation of a proinflammatory response by:
  • Figures 1A to 1C shows neutrophil-mediated destruction of CD95 + CT26 but not FasL " , CT26 cells in vitro.
  • Figure 1 A shows neutrophil dose-dependent killing of FasL + CT26 cells.
  • Figure IB shows neutrophil effector-mediated killing.
  • Figure 1C shows cytolysis mediated by neutrophils from syngeneic animals.
  • Figures 2A and 2B show FasL interaction is required for neutrophil cytolytic function.
  • Figure 2A shows blockade of neutrophil cytotoxicity by Fas-Fc fusion protein, prepared as described below and in Brunner, T. (1995) Nature 373:441.
  • CT26-FasL target cells were labeled with 5, Cr and mixed with neutrophils at an effector-to-target ratio of 50: 1.
  • Increasing amounts of mouse Fas-Fc protein, control human Ig or anti-Fas3 antibody were added to the medium to neutralize the killing.
  • Figure 2B shows induction of bystander neutrophil cytotoxicity against CT26-neo by CT26-FasL cells.
  • CT26-neo target cells were labeled with 51 Cr and mixed with neutrophils at an E/T ratio of 100: 1 in the presence of the indicated numbers of unlabeled CT26-FasL cells. Equal numbers of unlabeled CT26-neo cells were used as a negative control.
  • Figures 3A to 3E show inhibitory effects of recombinant TGF- ⁇ on neutrophil- mediated cytotoxicity and its role in the aqueous humor.
  • Figure 3 A shows inhibition of neutrophil cytolysis by TGF- ⁇ 1.
  • Neutrophils were incubated with CT26-FasL cells at an E/T ratio of 100: 1.
  • Increasing amounts of human TGF- ⁇ l (R&D Systems), human IL-10 (Genzyme) and GM-CSF (Immunex) were added to the culture and chromium releases assays were performed as in Figure 2.
  • Figure 3B shows lack of inhibition of FasL-mediated apoptosis by TGF- ⁇ l in Jurkat cells.
  • CT26-FasL were incubated with 51 Cr-labeled Jurkat cells (lxlOVwell) at a ratio of 10:1.
  • Human TGF- ⁇ l (20 ng/ml) was added to the medium, and Fas-Fc fusion protein was used as a positive control. Cytotoxicity was measured by 51 Cr release after 4 hours of co-incubation. The data represent mean ⁇ - SD from three assays.
  • Figure 3C shows inhibition of neutrophil-mediated cytolysis of CT26-FasL cells by preincubation of neutrophils with TGF- ⁇ l .
  • Neutrophils were preincubated with TGF- ⁇ l (20 ng/ml) or GM-CSF (20 ng/ml) for the indicated period and washed with 10 ml of medium three times. The percentage of inhibition was calculated relative to neutrophils preincubated with medium, TGF- ⁇ l, or GM-CSF for the same period of time.
  • the data represent mean ⁇ SD from three assays.
  • Figure 3D shows inhibitory effects of aqueous humor on neutrophil-mediated lysis of CT26-FasL cells.
  • the indicated percentages of bovine aqueous humor or heat inactivated bovine aqueous humor (volume/volume) were added to the assay described in
  • FIG 3E shows reversal of inhibitory effects of aqueous humor by neutralizing soluble TGF- ⁇ receptor protein.
  • Mouse neutrophils were incubated with radiolabeled CT- 26-FasL at a ratio of 50:1 and 40 ⁇ l of bovine aqueous human were added to the assay.
  • the indicated concentrations of soluble human TGF- ⁇ l receptor (TGF- ⁇ SRII/Fc, purchased from R&D Systems, Minneapolis, MN) or c '.ntrol human immunoglobulin were added to the assay as shown in Figure lC.
  • Figure 4A provides the polynucleotide and predicted amino acid sequence of rat FasL (SEQ ID NOS: 1 and 2, respectively). The numbers above and below each line refer to the nucleotide position and amino acid positions, respectively. The putative transmembrane domain is underlined and four potential N-linked glycosylation sites (N-X- S/T) are indicated by asterisks.
  • Figure 4B (SEQ ID NOS: 3 and 4) provides the nucleotide and amino acid sequence of soluble Fas receptor as provided in WO 95/13701 , which also describes methods for recombinantly producing and purifying the soluble Fas receptor.
  • Figure 5 provides the polynucleotide and amino acid sequence of human FasL
  • the human FasL protein comprises an N-terminal cytoplasmic domain (amino acids 1-80), a transmembrane region (amino acids 81-105), and an extracellular domain (amino acids 106-281).
  • the extracellular domain contains the receptor binding region.
  • Soluble FasL polypeptides comprise all or part of the extracellular domain of a Fa ⁇ L protein, but lack the transmembrane region that would cause retention of the polypeptide on a cell membrane.
  • a heterologous signal peptide can be fused to the N-terminus such that the soluble FasL is secreted upon expression.
  • Soluble FasL can also include part of the transmembrane region or part of the cytoplasmic domain or other sequences, provided that the soluble FasL is capable of being secreted.
  • Figure 6 provides the amino acid sequences of several proteins having FasL activity for use in the methods of this invention as provided below (SEQ ID NOS: 7 to 10).
  • SEQ ID NOS: 7 to 10 See Figure 2(b) of Nagata, S. et al. (1995) Science 267: 1449.) Shown is the nucleotide and amino acid sequence of mutant FasL [mFasL(gld)] and wild type FasL (mFasL).
  • the arrow indicates the position of the mutation in FasL of ld mice.
  • Amino acid sequences of the corresponding region of the other members of the TNF family (TNF, LT- ⁇ , CD40L, CD27L and CD30L) are also shown. The amino acids of favored substitutions in more than four members are boxed.
  • Figure 7 provides the polynucleotide sequence coding for TGF- ⁇ .
  • Figures 8 A and 8B show abrogation of FasL neutrophil cytolysis by p38 MAPK pharmacologic inhibitors, and p38 MAPK activation by FasL is inhibited by TGF- ⁇ .
  • Figure 9A shows the effects of p38 MAPK inhibitors on FasL-stimulated neutrophil cytotoxicity. Neutrophils were incubated with CT26-FasL cells at an E/T ratio of 50:1. Increasing amounts of commercialy available p38 MAPK inhibitors, SB203580
  • Chromium release assays were prepared as in Figure 2.
  • Figure 2B shows activation and modulation of p38 MAPK in neutrophils by FasL and inhibition by TGF- ⁇ .
  • enzymatic r ctivity of p38 MAPK was determined by phosphorylation of ATF2 substrate. Neutrophils were treated as described above. Cellular p38 MAPK activity was determined by phosphorylation of ATF2 by immunoprecipitated p38 according to manufacturer's instructions (New England Biolabs, Inc.). To verify that the change in the level of phosphorylated p38 MAPK and kinase activity did not result from variable amounts of protein, the total amount of p38 MAPK was examined by Western blotting using p38 kinase antibody according to manufacturer's instructions (New England Biolabs, Inc.).
  • a cell includes a plurality of cells, including mixtures.
  • proteins proteins
  • peptides and “polypeptides” are used interchangeably and are intended to include molecules containing amino acids linearly coupled through peptide bonds.
  • the amino acids can be in the L or D form so long as the biological activity of the polypeptide is maintained.
  • the protein can be altered so as to be secreted from the cell for recombinant production and purification.
  • proteins which are post-translationally modified by reactions that include glycosylation, acetylation and phosphorylation.
  • polypeptides also include analogs, alleles and allelic variants which can contain amino acid derivatives or non-amino acid moieties that do not affect the biological or functional activity of the protein as compared to wild-type or naturally occurring protein.
  • amino acid refers both to the naturally occurring amino acids and their derivatives, such as TyrMe and PheCl, as well as other moieties characterized by the presence of both an available carboxyl group and an amine group.
  • Non-amino acid moieties which can be contained in such polypeptides include, for example, amino acid mimicking structures. Mimicking structures are those structures which exhibit substantially the same spatial arrangement of functional groups as amino acids but do not necessarily have both the ⁇ -amino and ⁇ -carboxyl groups characteristic of amino acids.
  • Mimicking structures are those structures which exhibit substantially the same spatial arrangement of functional groups as amino acids but do not necessarily have both the ⁇ -amino and ⁇ -carboxyl groups characteristic of amino acids.
  • Meins are proteins or polypeptides which have minor changes in amino acid sequence caused, for example, site-specific mutagenesis or other manipulations; by errors in transcription or translation; or which are prepared synthetically by rational design.
  • peptide bond or “peptide linkage” refers to an amide linkage between a carboxyl group of one amino acid and the ⁇ -amino group of another amino acid.
  • hydrophobic is interded to include those amino acids, amino acid derivatives, amino acid mimics and chemical moieties which are non-polar. Hydrophobic amino acids include Phe, Val, Trp, He and Leu.
  • positively charged amino acid refers to those amino acids, amino acid derivatives, amino acid mimics and chemical moieties which are positively charged. Positively charged amino acids include, for example, Lys, Arg and His.
  • “Native" polypeptides, proteins, or nucleic acid molecules refer to those recovered from a source occurring in nature or "wild-type".
  • composition is intended to mean a combination of active agent and another compound or composition, inert (for example, a detectable agent or label) or active, such as an adjuvant.
  • pharmaceutical composition is intended to include the combination of an active agent with a carrier, inert or active, making the composition suitable for diagnostic or therapeutic use in vitro, in vivo or ex vivo.
  • the term "pharmaceutically acceptable carrier” encompasses any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, and emulsions, such as an oil/water or water/oil emulsion, and various types of wetting agents.
  • the compositions also can include stabilizers and preservatives.
  • stabilizers and adjuvants see Martin, REMINGTON'S PHARM. SCI., 15* Ed. (Mack Publ. Co., Easton (1975)).
  • polynucleotide means single and double stranded DNA, cDNA, genome-derived DNA, and RNA, as well as the positive and negative strand of the nucleic acid that are complements of each other, including anti-sense RNA.
  • a "nucleic acid molecule” is a term used interchangeably with “polynucleotide” and each refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides, or analogs thereof. It also includes known types of modifications, for example labels which are known in the art (e.g., Sambrook, et al.
  • methylation substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl carbamate, etc.), those containing pendant moieties, such as for example, proteins (including , e.g., nuclease, toxins, antibodies, signal peptides, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g., metals, radioactive metals, boron, oxidative metals, etc.), those containing alkylators, those with modified linkages (e.g., alpha anomeric polynucleotide, etc.), as well as unmodified forms of the polynucleotide.
  • internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl carbamate, etc.), those containing pendant moie
  • the polynucleotide can be chemically or biochemically modified or contain non-natural or derivatized nucleotide bases.
  • the nucleotides may be complementary to the mRNA encoding the polypeptides. These complementary nucleotides include, but are not limited to, nucleotides capable of forming triple helices and antisense nucleotides.
  • Recombinant polynucleotides comprising sequences otherwise not naturally occurring are also provided by this invention, as are alterations of wild type polypeptide sequences, including but not limited to, those due to deletion, insertion, substitution of one or more nucleotides or by fusion to other polynucleotide sequences.
  • a polynucleotide is said to "encode" a polypeptide if, in its native state or when manipulated by methods well-known to those skilled in the art, it can be transcribed and/or translated to produce a polypeptide or mature protein.
  • the term polynucleotide shall include, in addition to coding sequences, processing sequences and other sequences that do not code for amino acids of the mature protein.
  • the anti-sense strand of such a polynucleotide is also said to encode the sequence.
  • polynucleotide or DNA refers to a polynucleotide that is made by the combination of two otherwise separated segments of sequence accomplished by the artificial manipulation of isolated segments of DNA by genetic engineering techniques or by chemical synthesis. In so doing one may join together DNA segments of desired functions to generate a desired combination of functions.
  • an "analog" of DNA, RNA or a polynucleotide refers to a macromolecule resembling naturally occurring polynucleotides in form and/or function (particularly in the ability to engage in sequence-specific hydrogen bonding to base pairs on a complementary polynucleotide sequence) but which differs from DNA or RNA in, for example, the possession of an unusual or non-natural base or an altered backbone. See for example,
  • a "gene” is a hereditary unit that, in the classical sense, occupies a specific position (locus) within the genome or chromosome; a unit that has one or more specific effects upon the phenotype of the organism; a unit that can mutate to various allelic forms; a unit that recombines with other such units.
  • a "probe” is any biochemical labeled with radioactive isotopes or tagged in other ways for ease in identification. A probe is used to identify or isolate a gene, a gene product, or a protein.
  • probes include, but are not limited to, a radioactive mRNA hybridizing with a single strand of its DNA gene, a DNA or cDNA hybridizing with its complementary region in a chromosome, or a monoclonal antibody combining with a specific protein.
  • Hybridization refers to hybridization reactions can be performed under conditions of different "stringency”. Conditions that increase the stringency of a hybridization reaction are widely known and published in the art: see, for example, Sambrook, et al. (1989) supra . Examples of relevant conditions include (in order of increasing stringency): incubation temperatures of 25 ° C, 37 ° C, 50 ° C, and 68 ° C; buffer concentrations of 10 x SSC, 6 x SSC,
  • stringency In general, a low stringency hybridization reaction is carried out at about 40 °C in 10 x SSC or a solution of equivalent ionic strength/temperature. A moderate stringency hybridization is typically performed at about 50 °C in 6 x SSC, and a high stringency hybridization reaction is generally performed at about 60 °C in 1 x SSC.
  • a “stable duplex" of polynucleotides, or a “stable complex” formed between any two or more components in a biochemical reaction refers to a duplex or complex that is sufficiently long-lasting to persist between the formation of the duplex or complex, and its subsequent detection.
  • duplex or complex must be able to withstand whatever conditions exist or are introduced between the moment of formation and the moment of detection, these conditions being a function of the assay or reaction which is being performed.
  • Intervening conditions which may optionally be present and which may dislodge a duplex or complex include washing, heating, adding additional solutes or solvents to the reaction mixture (such as denaturants), and competing with additional reacting species.
  • Stable duplexes or complexes may be irreversible or reversible, but must meet the other requirements of this definition.
  • a transient complex may form in a reaction mixture, but it does not constitute a stable complex if it dissociates spontaneously or as a result of a newly imposed condition or manipulation introduced before detection.
  • a double-stranded polynucleotide can be "complementary" to another polynucleotide, if a stable duplex can form between one of the strands of the first polynucleotide and the second.
  • a complementary sequence predicted from the sequence of a single stranded polynucleotide is the optimum sequence of standard nucleotides expected to form hydrogen bonding with the single-stranded polynucleotide according to generally accepted base-pairing rules.
  • a “sense” strand and an “antisense” strand when used in the same context refer to single-stranded polynucleotides which are complementary to each other. They may be opposing strands of a double-stranded polynucleotide, or one strand may be predicted from the other according to generally accepted base-pairing rules. Unless otherwise specified or implied, the assignment of one or the other strand as “sense” or “antisense” is arbitrary.
  • a linear sequence of nucleotides is “identical” to another linear sequence, if the order of nucleotides in each sequence is the same, and occurs without substitution, deletion, or material substitution.
  • RNA and a DNA polynucleotide have identical sequences when the sequence for the RNA reflects the order of nitrogenous bases in the polyribonucleotide, the sequence for the DNA reflects the order of nitrogenous bases in the polydeoxyribonucleotide, and the two sequences satisfy the other requirements of this definition.
  • the two sequences are identical if at least one of the alternative forms of the degenerate oligonucleotide is identical to the sequence with which it is being compared.
  • AY AAA is identical to AT AAA, if AY AAA is a mixture of AT AAA and AC AAA.
  • the sequences are identical if one strand of the first polynucleotide is identical with one strand of the second polynucleotide.
  • a polynucleotide probe is described as identical to its target, it is understood that it is the complementary strand of the target that participates in the hybridization reaction between the probe and the target.
  • a linear sequence of nucleotides is "essentially identical” or the "equivalent” to another linear sequence, if both sequences are capable of hybridizing to form duplexes with the same complementary polynucleotide. It should be understood, although not always explicitly stated that when Applicants refer to a specific polynucleotide, its equivalents are also intended. Sequences that hybridize under conditions of high stringency are more preferred. It is understood that hybridization reactions can accommodate insertions, deletions, and substitutions in the nucleotide sequence. Thus, linear sequences of nucleotides can be essentially identical even if some of the nucleotide residues do not precisely correspond or align. Sequences that correspond or align more closely to the invention disclosed herein are comparably more preferred. Generally, a polynucleotide region of about
  • 25 residues is essentially identical to another region, if the sequences are at least about 80% identical; more preferably, they are at least about 90%) identical; more preferably, they are at least about 95% identical; still more preferably, the sequences are 100% identical.
  • a polynucleotide region of 40 residues or more will be essentially identical to another region, after alignment of homologous portions if the sequences are at least about 75% identical; more preferably, they are at least about 80%> identical; more preferably, they are at least about 85% identical; even more preferably, they are at least about 90% identical; still more preferably, the sequences are 100% identical.
  • a sequence that preserves the functionality of the polynucleotide with which it is being compared is particularly preferred. Functionality can be determined by different parameters. For example, if the polynucleotide is to be used in reactions that involve hybridizing with another polynucleotide, then preferred sequences are those which hybridize to the same target under similar conditions. In general, the T m of a DNA duplex decreases by about 10°C for every 1% decrease in sequence identity for duplexes of 200 or more residues; or by about 50 °C for duplexes of less than 40 residues, depending on the position of the mismatched residues (see, e.g., Meinkoth et al.).
  • Essentially identical or equivalent sequences of about 100 residues will generally form a stable duplex with each other's respective complementary sequence at about 20 ° C less than T m ; preferably, they will form a stable duplex at about 15 ° C less; more preferably, they will form a stable duplex at about 10 °C less; even more preferably, they will form a stable duplex at about 5 ° C less; still more preferably, they will form a stable duplex at about T m .
  • preferred sequences are those which encode identical or essentially identical polypeptides.
  • nucleotide differences which cause a conservative amino acid substitution are preferred over those which cause a non-conservative substitution
  • nucleotide differences which do not alter the amino acid sequence are more preferred, while identical nucleotides are even more preferred.
  • Insertions or deletions in the polynucleotide that result in insertions or deletions in the polypeptide are preferred over those that result in the down-stream coding region being rendered out of phase; polynucleotide sequences comprising no insertions or deletions are even more preferred.
  • the relative importance of hybridization properties and the encoded polypeptide sequence of a polynucleotide depends on the application of the invention.
  • a polynucleotide has the same characteristics or is the equivalent of another polynucleotide if both are capable of forming a stable duplex with a particular third polynucleotide under similar conditions of maximal stringency.
  • the polynucleotides also encode essentially identical polypeptides.
  • Constant residues of a polynucleotide sequence are those residues which occur unaltered in the same position of two or more related sequences being compared. Residues that are relatively conserved are those that are conserved amongst more related sequences than residues appearing elsewhere in the sequences. "Related" polynucleotides are polynucleotides that share a significant proportion of identical residues.
  • a "degenerate" oligonucleotide sequence is a designed sequence derived from at least two related originating polynucleotide sequences as follows: the residues that are conserved in the originating sequences are preserved in the degenerate sequence, while residues that are not conserved in the originating sequences may be provided as several alternatives in the degenerate sequence.
  • the degenerate sequence AYASA may be designed from originating sequences AT ACA and ACAGA, where Y is C or T and S is C or G. Y and S are examples of "ambiguous" residues.
  • a degenerate segment is a segment of a polynucleotide containing a degenerate sequence.
  • a synthetic oligonucleotide comprising a degenerate sequence is actually a mixture of closely related oligonucleotides sharing an identical sequence, except at the ambiguous positions.
  • Such an oligonucleotide is usually synthesized as a mixture of all possible combinations of nucleotides at the ambiguous positions.
  • Each of the oligonucleotides in the mixture is referred to as an "alternative form".
  • a polynucleotide "fragment” or “insert” as used herein generally represents a sub-region of the full-length form, but the entire full-length polynucleotide may also be included.
  • RNA corresponds to the gene from which it is transcribed.
  • cDNA corresponds to the RNA from which it has been produced, such as by a reverse transcription reaction, or by chemical synthesis of a DNA based upon knowledge of the RNA sequence.
  • cDNA also corresponds to the gene that encodes the RNA.
  • Polynucleotides also "correspond" to each other if they serve a similar function, such as encoding a related polypeptide, in different species, strains or variants that are being compared.
  • a "probe” when used in the context of polynucleotide manipulation refers to an oligonucleotide which is provided as a reagent to detect a target potentially present in a sample of interest by hybridizing with the target.
  • a probe will comprise a label or a means by which a label can be attached, either before or subsequent to the hybridization reaction.
  • Suitable labels include, but are not limited to radioisotopes, fluorochromes, chemiluminescent compounds, dyes, and proteins, including enzymes.
  • a “primer” is an oligonucleotide, generally with .1 free 3' -OH group, that binds to a target potentially present in a sample of interest by hybridizing with the target, and thereafter promotes polymerization of a polynucleotide complementary to the target.
  • amplification processes of producing replicate copies of the same polynucleotide, such as PCR or gene cloning, are collectively referred to herein as "amplification” or “replication".
  • amplification processes of producing replicate copies of the same polynucleotide, such as PCR or gene cloning, are collectively referred to herein as "amplification” or “replication”.
  • single or double-stranded DNA may be replicated to form another DNA with the same sequence.
  • RNA may be replicated, for example, by an RNA-directed RNA polymerase, or by reverse-transcribing the DNA and then performing a PCR. In the latter case, the amplified copy of the RNA is a DNA with the identical sequence.
  • PCR polymerase chain reaction
  • PCR is a reaction in which replicate copies are made of a target polynucleotide using one or more primers, and a catalyst of polymerization, such as a reverse transcriptase or a DNA polymerase, and particularly a thermally stable polymerase enzyme.
  • a PCR involves reiteratively forming three steps: "annealing”, in which the temperature is adjusted such that oligonucletide primers are permitted to form a duplex with the polynucleotide to be amplified; “elongating”, in which the temperature is adjusted such that oligonucleotides that have formed a duplex are elongated with a DNA polymerase, using the polynucleotide to which are formed the duplex as a template; and “melting”, in which the temperature is adjusted such that the polynucleotide and elongated oligonucleotides dissociate. The cycle is then repeated until the desired amount of amplified polynucleotide is obtained.
  • annealing in which the temperature is adjusted such that oligonucletide primers are permitted to form a duplex with the polynucleotide to be amplified
  • elongating in which the temperature is adjusted such that oligonucleotides that have formed
  • operatively linked means that the DNA molecule is positioned relative to the necessary regulation sequences, e.g., a promoter or enhancer, such that a promoter will direct transcription of RNA off the DNA molecule in a stable or transient manner.
  • Regulatory elements include, but are not limited to promoter regions, enhancer regions, repressor binding regions, transcription initiation sites, ribosome binding sites, translation initiation sites, protein encoding regions, introns and exons, and termination sites for transcription and translation.
  • a "subject,” “individual” or “patient” is used interchangeably herein, which refers to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets.
  • a “control” is an alternative subject or sample used in an experiment for comparison purpose. A control can be "positive” or "negative”.
  • a positive control a subject or a sample from a subject, carrying such alteration and exhibiting syndromes characteristic of that disease
  • a negative control a subject or a sample from a subject lacking the altered expression and clinical syndrome of that disease
  • a “gene delivery vehicle” is defined as any molecule that can carry inserted polynucleotides into a host cell.
  • Examples of gene delivery vehicles are liposomes, viruses, such as baculovirus, adenovirus and retrovirus, bacteriophage, cosmid, plasmid, fungal vectors and other recombination vehicles typically used in the art which have been described for expression in a variety of eukaryotic and prokaryotic hosts, and may be used for gene therapy as well as for simple protein expression.
  • a "viral vector” is defined as a recombinantly produced virus or viral particle that comprises a polynucleotide to be delivered into a host cell, either in vivo, ex vivo or in vitro.
  • viral vectors include retroviral vectors, adenovirus vectors, adeno- associated virus vectors and the like.
  • a vector construct refers to the polynucleotide comprising the retroviral genome or part thereof, and a therapeutic gene.
  • retroviral mediated gene transfer or “retroviral transduction” carries the same meaning and refers to the process by which a gene or polynucleotide sequences are stably transferred into the host cell by virtue of the virus entering the cell and integrating its genome into the host cell genome.
  • the virus can enter the host cell via its normal mechanism of infection or be modified such that it binds to a different host cell surface receptor or ligand to enter the cell.
  • retroviral vector refers to a viral particle capable of introducing exogenous nucleic acid into a cell through a viral or viral-like entry mechanism.
  • Retroviruses carry their genetic information in :ne form of RNA; however, once the virus infects a cell, the RNA is reverse-transcribed into the DNA form which integrates into the genomic DNA of the infected cell.
  • the integrated DNA form is called a provirus.
  • a vector construct refers to the polynucleotide comprising the viral genome or part thereof, and a therapeutic gene.
  • Ads adenoviruses
  • Ads are a relatively well characterized, homogenous group of viruses, including over 50 serotypes.
  • Ads are easy to grow and do not require integration into the host cell genome.
  • Recombinant Ad-derived vectors particularly those that reduce the potential for recombination and generation of wild-type virus, have also been constructed, (see, WO 95/00655; WO 95/11984). Wild-type AAV has high infectivity and specificity integrating into the host cells genome. (Hermonat and Muzyczka (1984) PNAS USA 81:6466; and Lebkowski et al. (1988) Mol. Cell. Biol. 8:3988).
  • Vectors that contain both a promoter and a cloning site into which a polynucleotide can be operatively linked are well known in the art. Such vectors are capable of transcribing RNA in vitro or in vivo, and are commercially available from sources such as Stratagene (La Jolla, CA) and Promega Biotech (Madison, Wl). In order to optimize expression and/or in vitro transcription, it may be necessary to remove, add or alter 5' and/or 3' untranslated portions of the clones to eliminate extra, potential inappropriate alternative translation initiation codons or other sequences that may interfere with or reduce expression, either at the level of transcription or translation. Alternatively, consensus ribosome binding sites can be inserted immediately 5' of the start codon to enhance expression. Gene delivery vehicles also include several non-viral vectors, including
  • nucleic acid or proteins of this invention can be conjugated to antibodies or binding fragments thereof which bind cell surface antigens.
  • Polynucleotides are inserted into vector genomes using methods well known in the art. For example, insert and vector DNA can be contacted, under suitable conditions, with a restriction enzyme to create complementary ends on each molecule that can pair with each other and be joined together with a ligase.
  • synthetic nucleic acid linkers can be ligated to the termini of restricted polynucleotide. These synthetic linkers contain nucleic acid sequences that correspond to a particular restriction site in the vector
  • an oligonucleotide containing a termination codon and an appropriate restriction site can be ligated for insertion into a vector containing, for example, some or all of the following: a selectable marker gene, such as the neomycin gene for selection of stable or transient transfectants in mammalian cells; enhancer/promoter sequences from the immediate early gene of human CMV for high levels of transcription; transcription termination and RNA processing signals from SV40 for mRNA stability; SV40 polyoma origins of replication and ColEl for proper episomal replication; versatile multiple cloning sites; and T7 and SP6 RNA promoters for in vitro transcription of sense and antisense RNA.
  • a selectable marker gene such as the neomycin gene for selection of stable or transient transfectants in mammalian cells
  • enhancer/promoter sequences from the immediate early gene of human CMV for high levels of transcription
  • transcription termination and RNA processing signals from SV40 for mRNA stability transcription termination and RNA processing
  • “Host cell” is intended to include any individual cell or cell culture which can be or have been recipients for vectors or the incorporation of exogenous polynucleotides, polypeptides and/or proteins. It also is intended to include progeny of a single cell, and the progeny may not necessarily be completely identical (in morphology or in genomic or total DNA complement) to the original parent cell due to natural, accidental, or deliberate mutation.
  • the cells may be procaryotic or eucaryotic, and include but are not limited to bacterial cells, yeast cells, plant cells, insect cells, animal cells, and mammalian cells, e.g., murine, rat, simian or human.
  • expression refers to the process by which polynucleotides are transcribed into mRNA and translated into peptides, polypeptides, or proteins. If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA, if an appropriate eucaryotic host is selected. Regulatory elements required for expression include promoter sequences to bind RNA polymerase and transcription initiation sequences for ribosome binding.
  • a bacterial expression vector includes a promoter such as the lac promoter and for transcription initiation the Shine- Dalgarno sequence and the start codon AUG (Sambrook, et al. (1989) supra).
  • an eucaryotic expression vector includes a heterologous or homologous promoter for RNA polymerase II, a downstream polyadenylation signal, the start codon AUG, and a termination codon for detachment of the ribosome.
  • Such vectors can be obtained commercially or assembled by the sequences described in methods well known in the art, for example, the methods described below for constructing vectors in general.
  • purified or isolated shall mean not in the native or endogenous environment. In one embodiment, it shall mean removed from constituents normally associated with the nucleic acid, vector, cell, protein or polypeptide, in its native or naturally occurring environment.
  • polynucleotides and/or proteins may be used in purified form when in the naturally occurring form. However, the polynucleotides and/or proteins need not be utilized in the "isolated” or “purified” state when present in an unnatural form, e.g., produced from a bacterial cell.
  • Solid phase support is not limited to a specific type of support. Rather a large number of supports are available and are known to one of ordinary skill in the art. Solid phase supports include silica gels, resins, derivatized plastic films, glass beads, cotton, plastic beads, alumina gels. A suitable solid phase support may be selected on the basis of desired end use and suitability for various synthetic protocols.
  • solid phase support may refer to resins such as polystyrene (e.g., PAM-resin obtained from Bachem Inc., Peninsula Laboratories, etc.), POLYHIPE ® resin (obtained from Aminotech, Canada), polyamide resin (obtained from Peninsula Laboratories), polystyrene resin grafted with polyethylene glycol (TentaGel ® , Rapp Polymere, Tubingen, Germany) or polydimethylacrylamide resin (obtained from polystyrene (e.g., PAM-resin obtained from Bachem Inc., Peninsula Laboratories, etc.), POLYHIPE ® resin (obtained from Aminotech, Canada), polyamide resin (obtained from Peninsula Laboratories), polystyrene resin grafted with polyethylene glycol (TentaGel ® , Rapp Polymere, Tubingen, Germany) or polydimethylacrylamide resin (obtained from
  • solid phase support refers to polydimethylacrylamide resin.
  • an “antibody” is an immunoglobulin molecule capable of binding an antigen.
  • the term encompasses not only intact immunoglobulin molecules, but also anti-idiotypic antibodies, mutants, fragments, fusion proteins, humanized proteins and modifications of the immunoglobulin molecule that comprise an antigen recognition site of the required specificity.
  • an “antibody complex” is the combination of antibody (as defined above) and its binding partner or ligand.
  • An "antisense” copy of a particular polynucleotide refers to a complementary sequence that is capable of hydrogen bonding to the polynucleotide and can therefor, be capable of modulating expression of the polynucleotide. These may be DNA, RNA or analogs thereof, including analogs having altered backbones, as described above.
  • the polynucleotide to which the antisense copy binds may be in singe-stranded form or in double-stranded form.
  • This invention provides a method for inhibiting a proinflammatory response in a suitable cell mixture, the method comprising administrating to the mixture an effective amount of an immunosuppressive agent which suppresses the proinflammatory activity of FasL.
  • the immunosuppressive agent can be any agent which inhibits the immunostimulatory function of FasL.
  • agents include, but are not limited to, antisense molecules that inhibit endogenous FasL expression, soluble Fas receptors or variants thereof, ribozymes that inhibit the endogeneous expression of FasL, drugs that inhibit FasL signalling, agents that induce the endogenous expression of TGF- ⁇ , such as cyclosporin or thrombospondin 1, (see Crawford, S.E. et al. (1998) Cell 93(7): 1159), polynucleotides coding for an immunosuppressive agent such as TGF- ⁇ , or TGF- ⁇ protein or polypeptide.
  • agents, molecules and compositions can be administered alone or in combination with a carrier, e.g., a pharmaceutically acceptable carrier.
  • the method can be practiced in vitro, ex vivo or in vivo.
  • proinflammatory response shall mean an inflammatory response mediated by the Fas-FasL system, or a response which includes both cellular and humoral immunity , or in which an inflammatory response is mediated by neutrophils or cells of granulocytic or monocytic origin.
  • the term "administration" shall mean providing to cells in vitro or ex vivo, an effective amount of FasL and/or the immunosuppressive agent. It also shall mean providing to cells in a subject in vivo an effective amount of FasL and/or the immunosuppressive agent. It also includes administering to cells in vitro, ex vivo or in a subject in vivo, an agent which inhibits the endogenous production of an effective amount of FasL and/or the production of an effective amount of the immunosuppressive agent by the cells in vitro, ex vivo or in vivo.
  • the cell mixture comprises neutrophils as exemplified in vitro and in vivo, below.
  • the cell mixture comprises cells lacking FasL.
  • the method is practiced by administration of a polynucleotide coding for FasL or soluble FasL.
  • the term "FasL” is intended to include, but not be limited to the polynucleotide comprising the open reading frame of the FasL polynucleotide shown in Figures 4A and 5 and those polynucleotides coding for polypeptides and proteins having FasL biological activity.
  • the method can be practiced by administering a polynucleotide coding for and expressing FasL or soluble FasL.
  • FasL is intended to include, but not be limited to the polynucleotide comprising the open reading frame of the FasL polynucleotide provided in WO 98/03648, WO 97/33617, WO 95/18819, WO 95/13293; their complements; polynucleotides that hybridize to these sequences or their complements under stringent hybridization conditions; or those which are greater than 75%, more preferably greater than 85% and most preferably, greater than 90% homologous as determined by a sequence allignment program such BLAST and using the default search parameters with a cutoff of a high score of 50 or above, 100 or above, or more preferably, 150 or above (see http://www.ncbi.nlm.nih.gov/BLAST/blast_ help.html).
  • One of skill in the art can determine if a putative equivalent has the requisite biological activity by assaying the polynucleotide in the methods provided below. Although biological activity greater than the FasL polynucleotide provided herein is preferred, polynucleotides coding for polypeptides having less potent biological activity are useful as controls in the assays provided herein.
  • the term also is intended to include polynucleotides which correspond to the sequence shown in Figure 5, its complement, essentially identical polynucleotides or equivalent polynucleotides.
  • the term “FasL” further includes the polynucleotides coding for ligand proteins of the TNF/nerve growth factor receptor family as shown in Figure 6 (SEQ ID NOS: 7 to 10), which includes two TNF receptors (type I, ⁇ or 55kD; type II, ⁇ or 75 kD), the low-affinity nerve growth factor receptor (CD40, CD27, CD30 and OX40), biologically equivalent mutants, analogs and variants thereof. It further includes polynucleotides coding for polypeptides having the sequence shown in SEQ ID NOS. 6 to
  • polynucleotide sequences that encodes biologically equivalent proteins such as amino acids as shown in Figures 4 to 0, modified by having conservative amino acid substitutions.
  • the term also includes a polynucleotide coding for soluble FasL, the polynucleotide and amino acid sequence of which is shown in Figure 5 (SEQ ID NO: 5 and 6) and disclosed in WO 95/13701 and their complements; as well as polynucleotides that hybridize to these sequences, or their complements under stringent hybridization conditions or those polynucleotides which are greater than 75%>, more preferably greater than 85% and most preferably, greater than 90% homologous as determined by a sequence allignment program such as BLAST and using the default search parameters with a cutoff of a high score of 50 or above, 100 or above, or more preferably 150 or above (see http://www.ncbi.nlm.nih.gov/BLAST/blast_ help.html).
  • polynucleotides which correspond to the sequence shown in Figure 5, its complement, an essentially identical polynucleotide or an equivalent polynucleotide. It further includes a polynucleotide sequences that encodes biologically equivalent proteins such as amino acids as shown in Figure 5 and modified by having conservative amino acid substitutions. It further includes polynucleotides coding for polypeptides having the sequence shown in SEQ ID NO 6 or disclosed in WO 95/13701 , biologically equivalent mutants, analogs and variants thereof. One of skill in the art can determine if a putative equivalent has the requisite biological activity by assaying the polynucleotide in the methods provided below.
  • polynucleotide coding for polypeptides having less potent biological activity are useful as controls in the assays provided herein.
  • compositions provides a separate embodiment of the invention, which may be practiced separately or in combination with each other or another, yet undetermined composition
  • This invention further includes the polynucleotides coding for FasL and soluble FasL as defined herein operatively linked to regulatory sequences required for transcription and/or translation of the polynucleotide in a host cell.
  • the polynucleotides and regulatory sequences are administered in a gene delivery vehicle such as a liposome, a viral vector, or a plasmid.
  • the host cell containing the FasL polynucleotide and soluble FasL polynucleotide also is provided by this invention.
  • the host cell may be a procaryotic cell, such a bacterial cell or a eucaryotic cell such as an insect cell, a plant cell or an animal cell, such as a mammalian cell.
  • a procaryotic cell such as a bacterial cell or a eucaryotic cell such as an insect cell, a plant cell or an animal cell, such as a mammalian cell.
  • the cell culture is useful for the recombinant production of FasL and soluble FasL polypeptide or protein. Isolated, recombinantly produced FasL and soluble FasL polypeptide or protein are further provided by this invention.
  • FasL also includes FasL protein and soluble FasL polypeptide, the amino acid sequences of which are provided in Figures 4 through 6, as well as analogs, muteins and variants thereof having comparable biological activity to wild-type FasL.
  • the analogs, muteins and variants thereof can be assayed in the screening method described below to determine if they have the required biological activity.
  • the method also requires the administration of an effective amount of an immunosuppressive agent.
  • an immunosuppressive agent is to include any agent which counteracts the proinflammatory response mediated by the sole administration of FasL.
  • the agent is a cytokine, such as TGF- ⁇ , the nucleotide for which is provided in Figure 7 and U.S. Patent Nos. 4,886,747; 5,168,051 ; 5,284,763; and 5,482,851.
  • the TGF- ⁇ is any one of TGF- ⁇ 1-5.
  • it includes a cytokine, e.g., an interferon or a growth factor.
  • FasL polynucleotide is an antisense FasL polynucleotide or ribozyme which inhibits expression of endogeneous FasL, Fas soluble receptor protein or polynucleotide,or a drug that inhibits Fas signalling.
  • it is an agent or compound which promotes the endogenous production of the immunosuppressive agent such as cyclosporin or thrombospondin 1 , or stimulates its signal translation pathway.
  • a further embodiment includes any combination of agents that stimulate Fas signalling and TGF- ⁇ signalling concurrently.
  • TGF- ⁇ polynucleotide is to include polynucleotides which correspond to the sequence shown in Figure 7 or U.S. Patent Nos.
  • One of skill in the art can determine if a putative equivalent has the requisite biological activity by assaying the polynucleotide in the methods provided below. Although biological activity greater than the TGF- ⁇ polynucleotide provided herein is preferred, polynucleotide coding for polypeptides having less potent biological activity are useful as controls in the assays provided herein.
  • compositions that encodes biologically equivalent proteins such as amino acids as shown in U.S. Patent Nos. 4,886,747; 5,168,051 ; 5,284,763; and 5,482,851 and those having conservative amino acid substitutions.
  • Each of the above noted compositions provides a separate embodiment of the invention, which may be practiced separately or in combination with each other or another, yet undetermined composition.
  • This invention further includes the polynucleotides coding for the immunosuppressive agent such as TGF- ⁇ as defined herein operatively linked to regulatory sequences for transcription and/or translation of the nucleic acid in a host cell.
  • the polynucleotide and regulatory sequences are administered in gene delivery vehicle such as a liposome, a viral vector, or a plasmid.
  • the host cell containing the immunosuppressive polynucleotide also is provided by this invention.
  • the host cell may be a procaryotic cell, such a bacterial cell or a eucaryotic cell such as an insect cell, a plant cell or an animal cell, such as a mammalian cell. When the host cells are maintained in culture, the cell culture is useful for the recombinant production of immunosuppressive polypeptide or protein. Isolated, recombinantly produced TGF- ⁇ polypeptide or protein are further provided by this invention.
  • immunosuppressive agent also includes TGF- ⁇ protein and polypeptide, the amino acid sequences of which are provided in U.S. Patent Nos.
  • TGF- ⁇ l protein also is commercially available from R&D Systems, Minneapolis, MN. This invention further provides a method to inhibit the proinflammatory response mediated by FasL comprising administering to a cell mixture an effective amount of TGF- ⁇ l -5, analogs, mutants and variants thereof.
  • this invention also provides a method for treating an undesired FasL- mediated proinflammatory response. This includes, but is not limited to conditions such as graft versus host disease, an autoimmune disease, such as systemic lupus erythrematosus, rheumatoid arthritis, and psoriasis.
  • the method requires administering to the subject an effective amount an immunosuppressive agent, under conditions favorable for the treatment of the an undesired FasL-mediated proinflammatory response.
  • an effective amount of FasL also is administered.
  • this method comprises administration of an agent that stimulates endogenous production of an effective amoount of FasL and/or an immunosuppressive agent in a subject.
  • the method comprises administration of an agent such as cyclosporin A, that stimulates the endogenous production of an immunosuppressive agent, e.g., TGF- ⁇ , in a subject.
  • the invention is practiced with an agent that stimulates the Fas-signal transduction pathway and/or inhibits the relevant elements of the TGF- ⁇ signal transduction pathway, e.g., those agents that inhibit p38 MAP kinase in neutrophils (See Figures 8A and 8B, above).
  • FasL polynucleotide and/or immunosuppressive agent When the FasL polynucleotide and/or immunosuppressive agent is administered to the cells in vitro, any suitable gene transfer method is intended. Such methods include, but are not limited to by electroporation, transformation or transfection procedures. Sambrook et al. (1989) supra. Alternatively, the gene is inserted into an appropriate expression vector by methods well known in the art and as described below. FasL and the immunosuppressive agent can be administered in separate gene delivery vehicles or combined into one gene delivery vehicle. In one aspect, polynucleotides encoding one or more of the embodiments of FasL and/or immunosuppressive agent can be delivered to the subject using a gene delivery vehicle. The methods of this invention are intended to encompass any method of gene transfer into the subject.
  • delivery mechanisms include, but are not limited to viral mediated gene transfer, liposome mediated transfer, transformation, transfection and transduction, e.g., viral mediated gene transfer such as the use of vectors based on DNA viruses such as adenovirus, adeno-associated virus and herpes virus, as well as retroviral based vectors.
  • Vectors Useful in Genetic Modifications are accomplished by introducing a vector containing a polynucleotide as described herein.
  • a variety of different gene transfer vectors, including viral as well as non-viral systems can be used.
  • Viral vectors useful in the genetic modifications of this invention include, but are not limited to adenovirus, adeno-associated virus vectors, retroviral vectors and adeno-retroviral chimeric vectors.
  • Adenovirus and adeno-associated virus vectors useful in the genetic modifications of this invention may be produced according to methods already taught in the art. (see, e.g., Karlsson, et al. (1986) EMBO J. 5:2377; Carter (1992) Current Opinion in
  • Virology 163:614 are missing essential early genes from the adenoviral genome (usually E1A/E1B), and are therefore unable to replicate unless grown in permissive cell lines that provide the missing gene products in trans.
  • a transgene of interest can be cloned and expressed in cells infected with the replication deficient adenovirus.
  • adenovirus-based gene transfer does not result in integration of the transgene into the host genome (less than 0.1% adenovirus-mediated transfections result in transgene incorporation into host DNA), and therefore is not stable, adenoviral vectors can be propagated in high titer and transfect non-replicating cells.
  • Human 293 cells which are human embryonic kidney cells transformed with adenovirus E1A/E1B genes, typify useful permissive cell lines and are commercially available from the ATCC. However, other cell lines which allow replication-deficient adenoviral vectors to propagate therein can be used, including HeLa cells.
  • adenovirus vectors and other viral vectors which could be used in the methods of the present invention include the following: Horwitz, M.S., Adenoviridae and Their Replication, in Fields, B. et al. (eds.) VIROLOGY, Vol. 2, Raven Press New York, pp. 1679- 1721 , 1990); Graham, F. et al. pp. 109- 128 in METHODS IN
  • adenovirus plasmids are also available from commercial sources, including, e.g., Microbix Biosystems of Toronto, Ontario (see, e.g., Microbix Product Information Sheet: Plasmids for Adenovirus Vector Construction,
  • Retroviral vectors useful in the methods of this invention are produced recombinantly by procedures already taught in the art.
  • WO 94/29438 describes the construction of retroviral packaging plasr ds and packaging cell lines.
  • the retroviral vectors useful in the methods of this invention are capable of infecting the cells described herein.
  • the techniques used to construct vectors, and transfix and infect cells are widely practiced in the art.
  • Examples of retroviral vectors are those derived from murine, avian or primate retroviruses.
  • Retroviral vectors based on the Moloney murine leukemia virus (MoMLV) are the most commonly used because of the availability of retroviral variants that efficiently infect human cells.
  • MoMLV Moloney murine leukemia virus
  • Suitable vectors include those based on the Gibbon Ape Leukemia Virus (GALV) or HIV.
  • GLV Gibbon Ape Leukemia Virus
  • HIV HIV
  • retroviral vector constructs derived from the Moloney murine leukemia virus (MoMLV) in most cases, the viral gag, pol and env sequences are removed from the virus, creating room for insertion of foreign DNA sequences. Genes encoded by the foreign DNA are usually expressed under the control of the strong viral promoter in the LTR. Such a construct can be packed into viral particles efficiently if the gag, pol and env functions are provided in trans by a packaging cell line.
  • the gag-pol and env proteins produced by the cell assemble with the vector RNA to produce infectious virions that are secreted into the culture medium.
  • the virus thus produced can infect and integrate into the DNA of the target cell, but does not produce infectious viral particles since it is lacking essential packaging sequences.
  • Most of the packaging cell lines currently in use have been transfected with separate plasmids, each containing one of the necessary coding sequences, so that multiple recombination events are necessary before a replication competent virus can be produced.
  • the packaging cell line harbors an integrated provirus.
  • the provirus has been crippled so that, although it produces all the proteins required to assemble infectious viruses, its own RNA cannot be packaged into virus. Instead, RNA produced from the recombinant virus is packaged.
  • the virus stock released from the packaging cells thus contains only recombinant virus.
  • the range of host cells that may be infected by a retrovirus or retroviral vector is determined by the viral envelope protein.
  • the recombinant virus can be used to infect virtually any other cell type recognized by the env protein provided by the packaging cell, resulting in the integration of the viral genome in the transduced cell and the stable production of the foreign gene product.
  • murine ecotropic env of MoMLV allows infection of rodent cells
  • amphotropic env allows infection of rodent, avian and some primate cells, including human cells.
  • Amphotropic packaging cell lines for use with MoMLV systems are known in the art and commercially available and include, but are not limited to, PA12 and PA317. Miller et al. (1985) Mol. Cell. Biol. 5:431 ; Miller et al. (1986) Mol. Cell. Biol. 6:2895; and Danos et al. (1988) Proc. Natl. Acad. Sci. USA
  • Xenotropic vector systems exist which also allow infection of human cells.
  • VSV-G vesicular stomatitis virus
  • the vectors will contain at least two heterologous genes or gene sequences: (i) the therapeutic gene to be transferred; and (ii) a ma ⁇ er gene that enables tracking of infected cells.
  • therapeutic gene can be an entire gene or only the functionally active fragment of the gene capable of compensating for the deficiency in the patient that arises from the defective endogenous gene.
  • Therapeutic gene also encompasses antisense oligonucleotides or genes useful for antisense suppression and ribozymes for ribozyme-mediated therapy.
  • a therapeutic gene may be one that neutralizes the immunosuppressive factor or counter its effects.
  • the method also can be practiced ex vivo using a modification of the method described in Lum et al. (1993) Bone Marrow Transplantation 12:565 or a modification of the method described in U.S. Patent No. 5,399,346.
  • a sample of cells such as bone marrow cells or MLC containing neoplastic cells can be removed from a subject or animal using methods well known to those of skill in the art.
  • An effective amount of FasL nucleic acid and/or immunosuppressive agent is added to the cells and the cells are cultured under conditions that favor internalization of the nucleic acid by the cells.
  • the transformed cells are then returned or reintroduced to the same subject or animal
  • Non-viral vectors such as plasmid vectors useful in the genetic modifications of this invention, can be produced according to methods taught in the art. References describing the construction of non-viral vectors include the following: Ledley, F.D. (1995)
  • More than one gene can be administered per vector or alternatively, more than one gene can be delivered using several compatible vectors.
  • the vector can include the regulatory and untranslated sequences.
  • the polynucleotides encoding the FasL, soluble FasL and/or the immunosuppressive agent will generally be of human origin although genes from other closely related species that exhibit high homology and biologically identical or equivalent function in humans may be used, if the gene product does not induce an adverse immune reaction in the recipient.
  • a reporter or marker gene can be included in the gene delivery vehicle to facilitate identification of those cells into which the vehicle is successfully incorporated (Kass-Eisler et al. (1994) Gene Therapy 1:395).
  • marker genes may prove especially helpful.
  • Screening markers or reporter genes are genes that encode a product that can readily be assayed. Non-limiting examples of screening markers include genes encoding for green fluorescent protein (GFP) or genes encoding for a modified fluorescent protein.
  • the marker gene included in the delivery vehicle is a selectable marker.
  • a "positive" selectable marker gene encodes a product that enables only the cells that carry the gene to survive and/or grow under certain conditions. For example, plant and animal cells that express the introduced neomycin resistance (Neo 1 ) gene are resistant to the compound G418. Cells that do not carry the Neo r gene marker are killed by G418.
  • Negative selectable marker genes encode a product that allows cells expressing that product to be selectively killed.
  • the conditionally activated cytotoxic agent may also be a selectable marker such as HSV-tk. Cells expressing this gene can be selectively killed using gancyclovir or acyclovir.
  • FasL proteins and polypeptides and immunosuppressive agents are obtainable by a number of processes well known to those of skill in the art, which include purification, chemical synthesis and recombinant methods. TGF- ⁇ and other immunosuppressive agents are commercially available.
  • Full length FasL protein can be purified from a FasL + cell or tissue lysate and TGF- ⁇ from tissues using the process described below or by methods such as immunoprecipitation with antibody, and standard techniques such as gel filtration, ion-exchange, reversed-phase, and affinity chromatography using a fusion protein as shown herein. For such methodology, see for example Cirr et al.
  • this invention also provides the processes for obtaining the proteins and polypeptides useful this invention as well as the products obtainable and obtained by these processes.
  • compositions containing the polypeptides and proteins for use in this invention including compositions comprising a pharmaceutically acceptable carrier, are further provided by this invention.
  • This invention further provides use of the polynucleotides and/or proteins disclosed herein for the manufacture of medicaments to inhibit a proinflammatory response.
  • the proteins and polypeptides also can be obtained by chemical synthesis using a commercially available automated peptide synthesizer such as those manufactured by Applied Biosystems, Inc./Perkin Elmer, Model 430A or 431 A, Foster City, CA and the amino acid sequences provided in Figures 4 through 6.
  • the synthesized protein or polypeptide can be precipitated and further purified, for example by high performance liquid chromatography (HPLC).
  • HPLC high performance liquid chromatography
  • this invention also provides a process for chemically synthesizing the proteins of this invention by providing the sequence of the protein and reagents, such as amino acids and enzymes and linking together the amino acids in the proper orientation and linear sequence.
  • the proteins and polypeptides can be obtained by well-known recombinant methods as described, for example, in Sambrook et al. (1989) supra, using the host cell and vector systems described and exemplified below.
  • This invention further provides a process for producing an immunosuppressive protein such as TGF- ⁇ and FasL protein, analog, mutein or fragment thereof, by growing a host cell containing a polynucleotide encoding the mammalian protein, the polynucleotide being operatively linked to a promoter of RNA transcription.
  • the host cell is grown under suitable conditions such that the polynucleotide is transcribed and translated into protein and purifying the protein so produced.
  • the potentially therapeutic agent identified by the method of this invention is an agent that is an agonist or antagonist of FasL stimulation of a proinflammatory response.
  • the method comprises (a) contacting a target cell mixture and a control cell mixture with FasL and an immunosuppressive agent; (bj contacting the target cell mixture with a candidate therapeutic agent; (c) assaying the target cell mixture for localized immune response; and (d) comparing the target cell mixture to the control cell mixture to determine if the agent modulates FasL stimulation of the proinflammatory response.
  • step (c) comprises assaying for modulation of a neutrophil mediated proinflammatory response or alternatively, assaying for modulation of a neutrophil mediated proinflammatory response, as indicated in the examples set forth below.
  • control cell mixture is admixed or contacted with an effective amount of FasL and an effective amount of an immunostimulatory agent subsequent to contacting the control cell mixture with the test agent.
  • control cell mixture is admixed or contacted with an effective amount of
  • an "agent” is intended to include, but not be limited to, a small organic molecule, a compound, a composition, a DNA molecule, an RNA molecule, a protein, a polypeptide, an antibody, an antibody fragment, an anti- idiotypic antibody or fragment or a fusion protein. It should be understood, although not always explicitly stated that the agent is used alone or in combination with another agent, having the same or different biological activity as the agents identified by the inventive screen. The agents and methods are also intended to b; combined with other therapies.
  • suitable cell cultures or tissue cultures are first provided.
  • the cell is a cultured cell or alternatively, the cells can be from a tissue biopsy.
  • the cells are cultured under conditions (temperature, growth or culture medium and gas (C0 2 )) and for an appropriate amount of time to attain exponential proliferation without density dependent constraints.
  • suitable cells may be cultured in microtiter plates and several agents may be assayed at the same time by noting phenotypic changes or cell death.
  • a positive and negative control sample should be run simultaneously with the test sample.
  • the positive control will receive the FasL polynucleotide or protein and/or the immunosuppressive polynucleotide or protein.
  • the negative control will not receive FasL polynucleotide or protein nor the immunosuppressive polynucleotide/protein nor the test agent.
  • the use of the negative control as compared to the test sample and the positive control allows one of skill in the art to compare the activity of the test agent versus the activity of the agent as against another agent having FasL and/or immunosuppressive activity. Each sammple must be assayed in the presence and absence of neutrophils to determine if the neutrophil-mediated response is inhibited. The identification of this activity allows one to find alternative therapies to the FasL polynucleotide or protein and/or other immunosuppressive agents.
  • the test agent is contacted with the cells under conditions which does not inhibit the proliferation or death of the cells.
  • the agent is a composition other than a DNA or RNA nucleic acid molecule
  • the suitable conditions may be directly adding the agent to the cell culture or added to culture medium.
  • an "effective" amount must be added which can be empirically determined.
  • the protein or polypeptide is administered to the cells, in vitro or in ' tvo, as described above.
  • the test cell is grown in small multi-well plates and is used to detect the biologic activity of test agents.
  • the successful candidate drug will promote (angonist) or block (antagonist) the immunosuppressive effect of an immunosuppressive agent such as TGF- ⁇ 1-5. If it the agent has no effect on the activity of the test cell sample but still stimulates the proinflammatory response, the agent is a candidate agent having FasL activity or immunostimulatory activity and is a possible substitute for FasL in the methods provided herein. Kits containing the agents and instructions necessary to perform the screen and in vitro are further provided by this invention
  • the agents identified herein as effective for their intended purpose can be administered to subjects or individuals susceptible to or at risk of developing a disease correlated to the presence of an unwanted immune FasL-mediated immune response such as autoimmune disease or graft versus host disease.
  • an unwanted immune FasL-mediated immune response such as autoimmune disease or graft versus host disease.
  • the agent When the agent is administered to a subject such as a mouse, a rat or a human patient, the agent can be added to a pharmaceutically acceptable carrier and systemically or topically administered to the subject.
  • a suitable cell sample is removed from the patient.
  • Therapeutic amounts can be empirically determined and will vary with the pathology being treated, the subject being treated and the efficacy and toxicity of the agent. When delivered to an animal, the method is useful to further confirm efficacy of the agent.
  • a reduction of FasL-mediated cytotoxicity against T lymphocytes by chromium release assay is one means by which to monitor the response.
  • a reduction of the proinflammatory response in vivo by noting the reduction in the severity of symptoms associated with a disease associated with this response such as graft versus host disease, an autoimmune disease, such as systemic lupus erythrematosus, rheumatoid arthritis, and psoriasis.
  • the method may be practiced in an appropriate experimental animal model.
  • rheumatoid arthritis For example, to determine their ability to treat rheumatoid arthritis, they may be assayed in collagen- or adjuvant-induced arthritis in rats. Reduction of disease severity in this model is measured by scales that respectively indicate degree of paralysis or joint swelling, as commonly used in the art. Survival after a defined time may also be an appropriate endpoint in certain animal models.
  • Ability to treat diabetes can be modeled in the non-obese diabetic (NOD) mouse or BB rat. Numerous animal models are available to test the treatment of these and other autoimmune diseases (see, European Patent 0304291 and references cited therein) or other inflammatory diseases (see, EP 94903357.5 and references cited therein).
  • Fas-Fc fusion protein was included in the cytotoxicity assay. Lysis of CT26-FasL cells was inhibited specifically by the Fas-Fc fusion protein but not by a negative control immunoglobulin (Figure 2A). Furthermore, bystander killing was observed when chromium-labeled CT26- neo were incubated together with unlabeled CT26-FasL cells ( Figure 2B), suggesting that lysis of CT26-FasL cells was not due to intrinsic susceptibility of CT26-FasL cells but instead to the ability of FasL to induce neutrophil cytotoxic effector function locally.
  • FasL Because CT26-FasL cells do not express Fas (Arai, H. et al. (1997) Proc. Natl. Acad. Sci USA 94:13862), it is likely that inhibition by Fas-Fc was mediated by engagement of the neutrophil Fas receptor by FasL, which apparently promotes cytotoxic function. Because a bystander effect was observed in the presence of FasL, this cytotoxic effect may be a consequence of neutrophil degranulation.
  • TGF- ⁇ l was found to effectively inhibit neutrophil- mediated lysis, in contrast to other relevant cytokines, for example, IL-10 and GM-CSF ( Figure 3A). This effect was not related to neutrophil cell death since cell viability was unchanged during the incubation period ( Figure 3, legend).
  • TGF- ⁇ l did not affect Fas expression or neutrophils or FasL expression or CT26-FasL cells. It also had no effect on the FasL-mediated lysis of Jurkat cells, a susceptible T-cell leukemia cell line ( Figure 3B). This latter finding demonstrates that TGF- ⁇ does not block apoptosis in Fas + cells.
  • FasL + cells evade destruction by neutrophils The mechanism by which FasL + cells evade destruction by neutrophils is central to an understanding of the generation of immune tolerance. While it has been postulated that FasL may provide immune protection, the results reported here suggest that additional local inhibitory factors likely regulate the inflammatory response.
  • the role of FasL in the maintenance of immune privilege in the eye (Griffith, T. et al. (1995) Science 270: 1 189) and testis (Bellgrau, D. et al. (1995) Nature 377:630) is well-recognized.
  • the correlation of corneal graft survival with FasL expression further supports this concept (Stuart, P.M. et al. (1997) J Clin. Invest.
  • FasL + cells interact with neutrophils to promote the activation of cytolytic function and this effect is normally counteracted by a second immunosuppressive agent, such as TGF- ⁇ .
  • TGF- ⁇ can also promote T cell survival in some instances, and its effect on innate immune responses mediated by neutrophils was previously unknown. It is interesting to note that TGF- ⁇ l does not block FasL-induced apoptosis of a T leukemia line at the same time that it inhibited neutrophil function (Figure 3B). Taken together, these findings suggest that FasL, in combination with TGF- ⁇ , both suppresses inflammatory effects and promotes lymphocyte clonal deletion.
  • Renca and CT26 were obtained from the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, VA 20110-2209, U.S.A., and grown in RPMI 1640 medium supplemented with 10%> fetal calf serum (FCS), L-glutamine, and antibiotics.
  • ATCC American Type Culture Collection
  • FCS fetal calf serum
  • L-glutamine L-glutamine
  • a mouse cDNA encoding FasL was synthesized from mouse spleen poly(A) RNA by reverse transcription (RT)-PCR using Superscript II reverse transcriptase (Gibco BRL,
  • CT26 cells were cultured in RPMI 1640 media (Gibco BRL) with 10% fetal calf serum (FCS). CT26 cells were transfected with linearized FasL/pVR1012 neo pLsmid by electroporation using Gene pulser (BioRad, Hercules, CA), and transfected cells were selected with 1 mg/ml of
  • CT26-FasL The CT26 cell line which expresses FasL stably (CT26-FasL) was generated as previously reported in Arai, H. et al. (1997), supra. Briefly, the mouse FasL cDNA was inserted into a mammalian expression vector which utilizes the CMV enhancer/promoter, bovine growth hormone poly-A signal, and neomycin resistant gene as a selection marker. CT26 cells were transfected with this plasmid by electroporation and were selected with 1 mg/ml of Geneticin (GIBCO BRL, Gaithersburg, MD). A clone which expressed FasL at high levels was isolated by limiting dilution. As a control, the CT26 clone transfected with the plasmid backbone (CT26-neo) was prepared in the same way.
  • Target cells (1 x 10 6 ) were stained with anti-Fas antibody (Pharmingen, San Diego,
  • Fas-Fc fusion protein To construct the Fas-Fc fusion protein, cDNAs encoding the mouse Fas extracellular domain and the human IgG Fc portion 29 were synthesized by RT-PCR Fas sense primer: AATTGTCGACCACCATGGTGTGGATCTG
  • GGCTGTCCTGCCTCTG antisense primer: AATTGGATCCTCGAGGCGA TTTCTGGGACTTTGTTTCCTGCAG; IgG Fc sense primer: AATTCTGCAG CTCGAGCCCAAATCTTGTGACAAAACTCACACA, antisense primer: AATTGGATCCTCTAGATCATTTACCCGGAGACAGGGAGAGGCTCTT) and were connected at the XHoI site on the primer.
  • the chimeric cDNA was inserted into pVR1012 neo backbone and transfected into 293 cells by the calcium-phosphate method. On day 7 post-transfection, the conditioned medium was collected, filtered and used in flow cytometric [fluorescence-activated cell sorting (FACS)] analysis.
  • FACS fluorescence-activated cell sorting
  • the 51 Cr- labeled target cells (lxlO 4 ) were mixed with human neutrophils (at the indicated effector/target ratios) in fibronectin-coated plates (Collaborative Biomedical Product, Bedford, MA 01730) in a total volume of 200 ⁇ l in 0.5% FCS.
  • the plates were centrifuged at 700 rpm for 3 minutes and incubated for 19 hours at 37°C in 5% C0 2 /95% air. After centrifugation at 1000 rpm for 5 minutes, the supernatants were collected with the harvesting frame (Squadron, Sterling, VA) and assayed for radioactivity.
  • FasL-mediated cytotoxicity against T lymphocytes was assayed as described in Bellgrau, D. et al. (1995) Nature 377:630.
  • Jurkat cells (lxlO 6 ) were incubated for 2 hours at 37°C with 70°Ci of 51 Cr sodium chromate (Amershani) in 100 ⁇ l of RPMI 1640 containing 10% FCS.
  • the 5, Cr labeled target cells (lxl 0 4 ) were mixed with CT26-FasL (lxlO 5 ) in a total volume of 200 ⁇ l for 4 hours and harvested as described above.
  • Figure IB shows neutrophil effector-mediated killing.
  • Human neutrophils were prepared as described below.
  • Human T lymphocytes, NK cells, and macrophages were depicted from the isolated neutrophils by an immunomagnetic separation method (as described in Horgan, K. and Shaw, S. (1998) Curr. Prot. Immu. 7:4) using anti-Fas3, anti- Fas65 and anti-Fas 115/c (Phamingen, Neomarkers).
  • the effector cells were mixed with FasL cells at a 50:1 ratio.
  • Figure 1C shows cytolysis mediated by neutrophils from syngeneic animals.
  • Mouse neutrophils were prepared as described below. Neutrophils were mixed with FasL cells at a 50: 1 ratio. Neutrophil-depleted mouse spleen cells were used as control. Neutrophils were depleted by using an anti-Ly6G (Pharmingen) as described in Figure IB, above.
  • Adenoviral vectors
  • Recombinant adenoviral vectors e.g., ADV-FasL as described herein, are preferred for the in vivo transfer of therapeutic polynucleotides. It can be prepared by homologous recombination between sub360 genomic DNA, an Ad5 derivative with a deletion in the E3 region, and a FasL expression plasmid, pAd-FasL. The pAd-FasL encodes the mouse
  • FasL cDNA under control of the cytomegaloviral enhancer/promoter and has a deletion in the El A and E1B region, impairing the ability of this virus to replicate and transform nonpermissive cells.
  • the presence of FasL cDNA and absence of the El in this viral genome was confirmed by Southern blot analysis.
  • the construction and propagation of ADV-FasL were performed in the FasL-resistant clone of 293 cells which was isolated by successive FasL transfections followed by limiting dilution.
  • This 293 clone exhibited low expression of Fas by FACS analysis and relative resistance to FasL-stimulation in [ 51 Cr] assays or by inclusion of a Caspase inhibitor, N-benzyloxycarbonyl Val-Ala-Asp- flouromethylketone (2-VAD-fmk) in the cell culture media.
  • the 293 cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FCS, L- glutamine and antibiotics.
  • DMEM Dulbecco's modified Eagle's medium
  • Cesium chloride-purified virus was dialyzed against PBS and diluted for storage in a 13% glycerol-PBS solution to yield a final concentration of lxlO 12 viral particles/ml. All stocks were sterilized by passage through a 0.45 ⁇ m filter and evaluated for the presence of replication-competent virus.
  • 0.9x10 2 particles corresponded to 1 plaque forming unit on 293 cells.
  • the cell suspension was underlain with cold Histopaque-1077 (Sigma) and centrifuged for 20 minutes at 1000 x g.
  • the preparation contained greater than 97% PMN as seen on a Wright stained blood film.
  • the mouse neutrophil-enriched PBL were obtained from Balb/c mice with modification, as described in Luo, Y. and Dorf, M.F. (1998) Curr. Prot. Immun. 3:20. Briefly, the PBL were treated twice with hypotonic distilled water for 30 s each time. The preparation contained approximately 90%> PMN as seen on a Wright stained blood film.
  • mice Female Balb/C, SOD, and SClD-beige mice were obtained from Charles River (Wilmington, MA) and Taconic
  • CT26-neo and CT26-FasL cells were inoculated subcutaneously in the flank. Tumor size was followed in two perpendicular dimensions using calipers.
  • 50 ⁇ l of viral solution (lxlO 12 particle/ml) was injected into the tumor with a 26-gauge hypodermic needle after the tumor mass was established ( ⁇ 0.5 cm).
  • the histology of the major organs liver, heart, lung, kidney, spleen, and thymus was examined by microscopic observation of hematoxylin and eosin stained slides by an experienced pathologist.
  • CT26-CD95L cells or CT26-neo cells (10 5 ) were injected into right anterior chambers or subcutaneously into the flank of syngeneic Balb/c mice as described above. Tumor growth was monitored by observation and palpitation daily for 3 weeks. All tumor growth at the anterior chamber appeared before day 8 after injection and was confirmed by microscopic observation of hematoxy. The results are summarized below.
  • Fresh-frozen tissues of CT26-FasL and CT26-neo tumor on day 2 were fixed with acetone.
  • the section was first incubated with anti-Ly-6G (GR-1) monoclonal antibody (RB6-8C5) (Pharmingen) or an istotype control rat IgG.
  • Biotinylated anti-rat IgG2b second antibody (Pharmingen) was added followed by the addition of preformed avidin biotinylated horseradish peroxidase complex.
  • the signal was visualized by incubation in peroxidase substrate.
  • the RB6-8C5 antibody reacts mainly with neutrophils and, to a lesser extent, with activated monocytes/macrophage as described in Julita, M.A. et al. (1988) Eur. J. Immunol. 18:1819.

Abstract

L'invention concerne un procédé servant à inhiber une réaction proinflammatoire dans un mélange approprié de cellules et consistant à administrer à ce mélange une quantité efficace d'un agent immunosuppresseur dont l'action inhibe l'activité proinflammatoire de FasL. Dans quelques modes de réalisation, on administre une quantité efficace de FasL conjointement avec l'agent immunosuppresseur. On peut mettre ce procédé en application in vitro, ex vivo ou in vivo. Elle concerne également un procédé servant à inhiber une réaction proinflammatoire provoquée par FasL chez un sujet, ce qui consiste à administrer à ce dernier une quantité efficace d'un agent immunosuppresseur inhibant de façon spécifique l'effet immunostimulateur de FasL. Cet agent immunosuppresseur peut être tout agent inhibant la fonction immunostimulatrice de Fas. Ces agents comprennent, sans y être limités, des molécules antisens inhibant l'expression endogène de FasL, des récepteurs solubles de Fas ou leurs variantes, des ribozymes inhibant l'expression endogène de FasL, des médicaments inhibant la signalisation de FasL, des agents induisant l'expression endogène de TGF-β, tels que cyclosporine ou thrombospondine 1, des polynucléotides codant pour un agent immunosuppresseur, tel que TGF-β, ou une protéine ou un polypeptide de TGF-β. Elle concerne, de plus, un procédé servant à identifier des agents modulant la stimulation par FasL d'une réaction proinflammatoire.
PCT/US1998/014771 1997-07-17 1998-07-16 Procedes et compositions servant a inhiber la reaction proinflammatoire WO1999003999A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU84087/98A AU8408798A (en) 1997-07-17 1998-07-16 Methods and compositions for inhibiting the proinflammatory response

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US5282997P 1997-07-17 1997-07-17
US60/052,829 1997-07-17

Publications (1)

Publication Number Publication Date
WO1999003999A1 true WO1999003999A1 (fr) 1999-01-28

Family

ID=21980170

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US1998/014770 WO1999003998A1 (fr) 1997-07-17 1998-07-16 Procedes et compositions servant a reduire une tumeur
PCT/US1998/014771 WO1999003999A1 (fr) 1997-07-17 1998-07-16 Procedes et compositions servant a inhiber la reaction proinflammatoire

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/US1998/014770 WO1999003998A1 (fr) 1997-07-17 1998-07-16 Procedes et compositions servant a reduire une tumeur

Country Status (2)

Country Link
AU (2) AU8492598A (fr)
WO (2) WO1999003998A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009124021A2 (fr) * 2008-03-31 2009-10-08 Lenticular Research Group, Llc Procédés et appareil pour prévenir, retarder ou améliorer un ou plusieurs symptômes de la presbytie

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MXPA03001812A (es) * 2000-08-29 2004-05-21 Bioniche Life Sciences Inc Modulacion de la expresion del sindrome de alcohol fetal y del ligando del sindrome de alcohol fetal..
WO2012142526A1 (fr) * 2011-04-14 2012-10-18 Modiano Jaime Utilisation de l'expression tumorale de fas pour déterminer la réponse à une thérapie anticancéreuse
WO2023034796A1 (fr) * 2021-08-31 2023-03-09 Yale University Régulateurs de tension cytosquelettique et compositions de combinaison de ligands fas et méthodes de traitement les utilisant

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990000900A1 (fr) * 1988-07-20 1990-02-08 Amgen Inc. Procede de traitement de troubles inflammatoires par reduction de l'activation phagocytaire
WO1994006476A1 (fr) * 1992-09-15 1994-03-31 Immunex Corporation Procede de traitement de l'inflammation dependante du facteur necrosant des tumeurs malignes (tnf) a l'aide d'antagonistes dudit tnf

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990000900A1 (fr) * 1988-07-20 1990-02-08 Amgen Inc. Procede de traitement de troubles inflammatoires par reduction de l'activation phagocytaire
WO1994006476A1 (fr) * 1992-09-15 1994-03-31 Immunex Corporation Procede de traitement de l'inflammation dependante du facteur necrosant des tumeurs malignes (tnf) a l'aide d'antagonistes dudit tnf

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ALLISON ET AL: "TRANSGENIC EXPRESSION OF CD95 LIGAND ON ISLET BETA CELLS INDUCES A GRANULOCYTIC INFILTRATION BUT DOES NOT CONFER IMMUNE PRIVILEGE UPON ISLET ALLOGRAFTS", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, USA, vol. 94, April 1997 (1997-04-01), pages 3943 - 3947, XP002086214 *
KANG ET AL: "FAS LIGAND EXPRESSION IN ISLETS OF LANGERHANS DOES NOT CONFER IMMUNE PRIVILEGE AND INSTEAD TARGETS THEM FOR RAPID DESTRUCTION", NATURE MEDICINE, vol. 3, no. 7, July 1997 (1997-07-01), pages 738 - 743, XP002086213 *
KANG S-M ET AL: "Rapid neutrophilic destruction of Fas ligand expressing cell lines in vivo reveals a novel proinflammatory function of Fas ligand.", SURGICAL FORUM 48 (0). 1997. 451-453. ISSN: 0071-8041, XP002084132 *
SEINO ET AL: "ANTITUMOR EFFECT OF LOCALLY PRODUCED CD95 LIGAND", NATURE MEDICINE, vol. 3, no. 2, February 1997 (1997-02-01), pages 165 - 170, XP002084129 *
SHIHAB ET AL: "CYCLOSPORINE NEPHROPATHY: PATHOPHYSIOLOGY AND CLINICAL IMPACT", SEMINARS IN NEPHROLOGY, vol. 16, no. 6, 1996, pages 536 - 547, XP002086215 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009124021A2 (fr) * 2008-03-31 2009-10-08 Lenticular Research Group, Llc Procédés et appareil pour prévenir, retarder ou améliorer un ou plusieurs symptômes de la presbytie
WO2009124021A3 (fr) * 2008-03-31 2010-01-07 Lenticular Research Group, Llc Procédés et appareil pour prévenir, retarder ou améliorer un ou plusieurs symptômes de la presbytie
US8991401B2 (en) 2008-03-31 2015-03-31 Lenticular Research Group, Llc Processes and apparatus for preventing, delaying or ameliorating one or more symptoms of presbyopia

Also Published As

Publication number Publication date
WO1999003998A1 (fr) 1999-01-28
AU8492598A (en) 1999-02-10
AU8408798A (en) 1999-02-10

Similar Documents

Publication Publication Date Title
US6174527B1 (en) Methods and compositions for gene therapy for the treatment of defects in lipoprotein metabolism
KR100834809B1 (ko) Ｂａｆｆ, 관련 차단제 및 면역 반응에서 ｂ 세포와면역글로불린을 촉진 및 억제하는데에 있어서 이들의 용도
RU2757058C2 (ru) Индуцируемые каспазы и способы использования
CN100558745C (zh) 同种排斥反应的特异性抑制
US8715645B2 (en) Viral vectors encoding apoptosis-inducing proteins and methods for making and using the same
UA66339C2 (uk) Зрізаний нейротрофічний фактор, що походить з лінії гліальних клітин (gdnf), молекула днк, яка кодує gdnf, вектор, що містить зазначену молекулу днк, клітина-хазяїн, спосіб виготовлення зрізаного gdnf, фармацевтична композиція та спосіб лікування
US20210260168A1 (en) Compositions and methods of fas inhibition
US20030045489A1 (en) Methods for modulating angiogenesis
WO2008024919A9 (fr) Antagonistes de l'interféron, anticorps contre ceux-ci et méthodes d'utilisation associées
EP2453019A1 (fr) Compositions de thérapie génique destinées à prévenir et/ou à traiter des maladies auto-immunes
WO2001034649A2 (fr) Compositions et methodes de traitement de maladies auto-immunes et des rejets de greffon
AU766984B2 (en) Trail: an inhibitor of autoimmune inflammation and cell cycle progression
ES2264697T3 (es) Variantes de cd154 y sus usos.
WO1999003999A1 (fr) Procedes et compositions servant a inhiber la reaction proinflammatoire
US20110195048A1 (en) Regulation of lymphocytes and uses therefor
CA2158932A1 (fr) Methodes de suppression de la reponse auto-immunitaire
US6835381B1 (en) Methods for modulating angiogenesis by using the anti-angiogenic angiotensin-7 and polynucleotides encoding therefor
JP2003513619A (ja) 自己免疫疾患および免疫病因を含む疾患を治療するための遺伝子導入ベクター
Peng et al. Construction of recombinant adeno-associated virus vector containing the rat preproinsulin II gene
JP2002512984A (ja) 内毒素血症の治療法
JP2003509472A (ja) Ｍ３ポリペプチドの治療的使用
Wang et al. Molecular cloning, expression and characterization of rhesus macaque Fas ligand cDNA
WO1997034473A9 (fr) Isoformes de craf1 (traf-3) et leurs utilisations
US20040235769A1 (en) Anti-tumor effects of prostage Carcinoma Tumor Antigen-1
Croxford Gene therapy for experimental allergic encephalomyelitis by delivery of inhibitory cytokines or cytokine inhibitors

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 09139530

Country of ref document: US

AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: KR

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA