WO1995006126A1 - Production of trehalose in plants - Google Patents

Production of trehalose in plants Download PDF

Info

Publication number
WO1995006126A1
WO1995006126A1 PCT/EP1993/002290 EP9302290W WO9506126A1 WO 1995006126 A1 WO1995006126 A1 WO 1995006126A1 EP 9302290 W EP9302290 W EP 9302290W WO 9506126 A1 WO9506126 A1 WO 9506126A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
trehalose
sequence
functional
host
Prior art date
Application number
PCT/EP1993/002290
Other languages
French (fr)
Inventor
Andreas Hoekema
Jan Pen
Mirjam Petronella Does
Peter J. M. Van Den Elzen
Original Assignee
Mogen International N.V.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Mogen International N.V. filed Critical Mogen International N.V.
Priority to PCT/EP1993/002290 priority Critical patent/WO1995006126A1/en
Priority to AU49533/93A priority patent/AU4953393A/en
Priority to SK1660-95A priority patent/SK166095A3/en
Priority to ES94923710T priority patent/ES2229222T3/en
Priority to KR1019950706055A priority patent/KR960703436A/en
Priority to JP50328695A priority patent/JP3645260B2/en
Priority to NZ269548A priority patent/NZ269548A/en
Priority to AU73846/94A priority patent/AU697997B2/en
Priority to EP94923710A priority patent/EP0711353B1/en
Priority to CA002166063A priority patent/CA2166063C/en
Priority to AT94923710T priority patent/ATE284446T1/en
Priority to CN94193026A priority patent/CN1131315C/en
Priority to PCT/EP1994/002167 priority patent/WO1995001446A1/en
Priority to HU9503723V priority patent/HU221124B1/en
Priority to CZ19953449A priority patent/CZ290830B6/en
Priority to DE69434173T priority patent/DE69434173T2/en
Priority to RO95-02295A priority patent/RO115650B1/en
Priority to UA95125515A priority patent/UA39958C2/en
Publication of WO1995006126A1 publication Critical patent/WO1995006126A1/en
Priority to PL94312303A priority patent/PL179629B1/en
Priority to NO955354A priority patent/NO955354L/en
Priority to FI956317A priority patent/FI956317A0/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L3/00—Preservation of foods or foodstuffs, in general, e.g. pasteurising, sterilising, specially adapted for foods or foodstuffs
    • A23L3/34—Preservation of foods or foodstuffs, in general, e.g. pasteurising, sterilising, specially adapted for foods or foodstuffs by treatment with chemicals
    • A23L3/3454—Preservation of foods or foodstuffs, in general, e.g. pasteurising, sterilising, specially adapted for foods or foodstuffs by treatment with chemicals in the form of liquids or solids
    • A23L3/3463—Organic compounds; Microorganisms; Enzymes
    • A23L3/3562—Sugars; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L3/00—Preservation of foods or foodstuffs, in general, e.g. pasteurising, sterilising, specially adapted for foods or foodstuffs
    • A23L3/40—Preservation of foods or foodstuffs, in general, e.g. pasteurising, sterilising, specially adapted for foods or foodstuffs by drying or kilning; Subsequent reconstitution
    • A23L3/42—Preservation of foods or foodstuffs, in general, e.g. pasteurising, sterilising, specially adapted for foods or foodstuffs by drying or kilning; Subsequent reconstitution with addition of chemicals before or during drying
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C12N9/1066—Sucrose phosphate synthase (2.4.1.14)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)

Definitions

  • This invention relates to the modification of plant
  • Said plants may be used to extract specific carbohydrate compounds, or alternatively, they may be processed as food, feed, or ingredients thereof, having improved properties due to the presence of said carbohydrate compounds, e.g. during
  • Trehalose is a general name given to D-glucosyl
  • D-glucosides which comprise disaccharides based on two ⁇ -, ⁇ , ⁇ - and ⁇ , ⁇ -linked glucose molecules.
  • ⁇ -trehalose 1-(O-a-D-glucopyranosyl)-1'-O- ⁇ -D-glucopyranose) is a widespread naturally occurring disaccharide.
  • Saccharomyces cerevisiae that can accumulate over 10% of dry weight as trehalose.
  • production is hampered by high trehalase activity causing rapid metabolization of trehalose.
  • the present invention provides for a method for the production of trehalose in a plant host due to the presence in said plant host of a plant expressible gene which
  • a plant expressible gene comprising in sequence:
  • RNA sequence which is at least partially complementary to an RNA sequence which encodes a sucrose phosphate synthase enzyme (SPS) naturally occuring in said plant host, and optionally
  • a plant expressible gene comprising in sequence:
  • ADP-glucose pyrophosphorylase enzyme naturally occuring in said plant host, and optionally
  • RNA sequence which encodes a sucrose phosphate synthase enzyme naturally occurring in said plant host, and optionally
  • RNA sequence which encodes an ADP-glucose pyrophosphorylase enzyme naturally occurring in said plant host, and optionally
  • the invention also extends to the plant expressible genes used in the process for making trehalose, as well as to the combinations of plant expressible genes, as well as to cloning plasmids, transformation vectors, microorganisms, an individual plant cells harboring plant expressible genes according to the invention.
  • the invention also provides a recombinant plant DNA genome which contains a plant expressible trehalose phosphate synthase gene that is not naturally present therein.
  • the invention also comprises a recombinant plant DNA genome which comprises a plant expressible trehalose phosphate gene that is not naturally present therein and in addition a plant expressible gene capable of inhibiting biosynthesis of an SPS activity, and/or a plant expressible gene capable of
  • the invention also provides a method for obtaining a plant capable of producing trehalose comprising the steps of,
  • the invention also comprises plants which produce
  • the invention further comprises plants having a
  • the invention also comprises plants having a recombinant DNA genome containing a plant expressible gene according to the invention and which plants produce trehalose.
  • the invention also comprises plants having a recombinant DNA genome according to the invention and which exhibit increased drought resistance.
  • the invention also extends to parts of plants according to the invention such as cells or protoplasts or cultures thereof, flowers, fruits, leaves, pollen, roots (including hairy root cultures), seeds, stalks, tubers (including so-called microtubers) and the like.
  • the invention also extends to a method of preserving plants or plant parts in the presence of trehalose comprising the steps of :
  • the invention further comprises the plants and plant parts which have been preserved by a method according to the invention.
  • the invention also includes a method for the production of trehalose comprising the steps of:
  • the invention further includes a method for the production of trehalose comprising the steps of:
  • the invention further provides an isolated nucleic acid sequence encoding a trehalose phosphate synthase activity.
  • a preferred isolated nucleic acid sequence is one obtained from E. coli, still more preferred is the isolated nucleic acid sequence represented in SEQIDNO: 2.
  • embodiment comprises a nucleic acid sequence that codes for an amino acid sequence as in SEQIDNO: 3.
  • FIG. 1 Schematic representation of parts of the sucrose and starch biosynthetic pathways in plant sink tissues.
  • the figure shows that carbohydrate produced in the leaf by photosynthesis is transported via the phloem tissue in the form of sucrose.
  • Upon entering the sink it is unloaded by a membrane bound invertase activity to yield the monosugars glucose and fructose.
  • these monosugars are converted to starch and/or sucrose as roughly shown here.
  • the glucose metabolites G6P and UDPG are believed to be used as the substrates for the TPS-enzyme engineered into the plant by introduction of the plant expressible otsA gene.
  • the figure shows how the amount of UDPG and G6P available as substrate is increased by reducing the levels of the enzymes SPS and AGPase. Their inhibition is marked with a cross.
  • FIG. 2 Schematic map of the EBL4clone 7F11 from Kohara et al. (1987), containing the otsBA operon from
  • Underscore maize SPS cDNA sequences used as oligonucleotides in the PCR amplification reaction.
  • FIG. 9 Schematic representation of pMOG579 used for constructing the helper plasmid without T- region in Agrobacterium strain MOG101.
  • Figure 10 Schematic representation of expression vector pMOG180.
  • FIG. 1 Also illustrated in figure 1 is an approach to improve substrate availability for TPS.
  • G6P glucose-6 phosphate
  • UDPG UDPG
  • an antisense SPS gene and a antisense APGase have been cloned under the control of the CaMV 35S promoter for expression in plant hosts. If introduced into a plant host containing a plant expressible TPS gene according to the invention, this will increase substrate availability for TPS and therefore trehalose synthesis.
  • other antisense genes may be used to block the synthesis of sucrose or starch, in order to improve substrate availability.
  • Angiospermae notably the Dicotyledoneae. comprising inter alia the Solanaceae as a representative family, and the
  • Monocotyledoneae comprising inter alia the Gramineae as a representative family.
  • Suitable host plants as defined in the context of the present invention include plants (as well as parts and cells of said plants) and their progeny which have been genetically modified using recombinant DNA
  • Crops with edible parts according to the invention include those which have flowers such as cauliflower (Brassica oleracea). artichoke (Cynara scolymus), fruits such as apple (Malus, e.g. domesticus), banana (Musa, e.g. acuminata), berries (such as the currant, Ribes, e.g. rubrum), cherries (such as the sweet cherry, Prunus . e.g.
  • avium cucumber (Cucumis, e.g. sativus), grape (Vitis, e.g. vinifera), lemon (Citrus limon), melon (Cucumis melo), nuts (such as the walnut, Juglans. e.g. regia; peanut, Arachis hypogeae).
  • lettuce (Lactuca, e.g. sativa), spinach (Spinacia e.g. oleraceae), tobacco (Nicotiana. e.g. tabacum). roots, such as arrowroot (Maranta, e.g.
  • arundinacea arundinacea
  • beet beet
  • carrot Digicus, e.g. carota
  • cassava Manihot, e.g. esculenta
  • Sweet potato Ipomoea batatas
  • seeds such as bean (Phaseolus. e.g. vulgaris), pea
  • the edible parts may be conserved by drying in the presence of enhanced trehalose levels produced therein due to the presence of a plant expressible trehalose phosphate synthase construct. It may be advantageous to produce enhanced levels of trehalose, by putting the DNA encoding the TPS activity under the control of an plant organ or tissue-specific promoter; the choice of which can readily be determined by those of skill in the art.
  • nucleic acid sequence represented in SEQIDNO: 2 in fact any open reading frame encoding a trehalose phosphate synthase activity according to the invention, may be altered without necessarily altering the amino acid sequence of the protein encoded thereby. This fact is caused by the degeneracy of the genetic code.
  • the open reading frame encoding the trehalose phosphate synthase activity may be adapted to codon usage in the host plant of choice.
  • isolated nucleic acid sequence represented by SEQIDNO: 2 may be used to identify trehalose phosphate synthase activities in other organisms and subsequently isolating them, by hybridising DNA from other sources with a DNA- or RNA fragment obtainable from the E. coli gene.
  • DNA sequences are screened by hybridising under stringent conditions (such as temperature and ionic strength of the hybridisation mixture. Whether or not
  • microorganisms e.g. bacteria, yeast, fungi
  • plants e.g., trehalose phosphate activity
  • isolated DNA sequences encoding trehalose phosphate activity from other sources may be used likewise in a method for producing trehalose
  • the invention also encompasses nucleic acid sequences which have been obtained by modifying the nucleic acid sequence represented in SEQIDNO: 2 by mutating one or more codons so that it results in amino acid changes in the encoded protein, as long as mutation of the amino acid sequence does not entirely abolish trehalose phosphate synthase activity.
  • any plant host is suitable in combination with any plant expressible trehalose phosphate synthase gene.
  • trehalose genes from other sources become available these can be used in a similar way to obtain a plant expressible trehalose phosphate synthase gene combination as described here.
  • pyrophosphorylase gene may be conducted in a number of ways the choice of which is not critical to the invention.
  • RNA inhibition is achieved through the so-called 'antisense approach'.
  • a DNA sequence is expressed which produces an RNA that is at least partially
  • RNA which encodes the enzymatic activity that is to be blocked e.g. AGP-ase or SPS, in the examples. It is preferred to use homologous antisense genes as these are more efficient than heterologous genes.
  • both dicotyledonous and monocotyledonous plants that are amenable for transformation can be modified by introducing a plant expressible gene according to the
  • Preferred plants according to the invention are those that are capable of converting trehalose-phosphate into trehalose, and which do contain no or little trehalose degrading activity. It will be understood that plants that lack the ability to convert the trehalose phosphate into trehalose are also included in the present invention. These plants may be further modified by introducing additional genes that encode phosphatases that are capable of the conversion of trehalose phosphate into trehalose. In principle also plants are envisaged that do contain trehalases, since these plants can be made suitable for the production of trehalose by inhibiting the activity of such enzymes, for instance by inhibiting expression of the genes encoding such enzymes using the antisense approach.
  • the method of introducing the plant expressible trehalose-phosphate gene into a recipient plant cell is not crucial, as long as the gene is stably incorporated into the genome of said plant cell.
  • various other techniques are available for the introduction of DNA into plant cells, such as transformation of protoplasts using the calcium/polyethylene glycol method, electroporation and microinjection or (coated) particle bombardment (Potrykus, 1990, Bio/Technol. 8, 535-542).
  • transformation systems involving vectors are widely available, such as viral vectors (e.g. from the Cauliflower Mosaic Virus (CaMV) and bacterial vectors (e.g. from the genus Agrobacterium) (Potrykus, 1990, Bio/Technol. 8, 535-542).
  • CaMV Cauliflower Mosaic Virus
  • bacterial vectors e.g. from the genus Agrobacterium
  • the protoplasts, cells or plant parts that have been transformed can be regenerated into whole plants, using methods known in the art (Horsch et al., 1985, Science 225 , 1229-1231).
  • hygroscopicus bar-gene which encodes phosphinothricin acetyltransferase (an enzyme which inactivates the herbicide phosphinothricin), into embryogenic cells of a maize
  • Agrobacterium strains European patent 159 418 B1; Gould J, Michael D, Hasegawa O, Ulian EC, Peterson G, Smith RH, (1991) Plant. Physiol. 95, 426-434).
  • plants that do exhibit trehalase activity are not excluded from being a suitable host plant for the production of trehalose, although it may be necessary to provide for inhibition of trehalase activity if this prevents the accumulation of trehalose altogether. Such inhibition can be achieved using the antisense approach well known in the art, and illustrated for other purposes in this
  • Suitable DNA sequences for control of expression of the plant expressible genes including marker genes, such as transcriptional initiation regions, enhancers, non-transcribed leaders and the like, may be derived from any gene that is expressed in a plant cell which, such as
  • Agrobacterium genes of plant viruses, as well as other eukaryotic genes that include a transcription initiation region that conforms to the consensus sequence for eukaryotic transcription initiation.
  • hybrid promoters combining functional portions of various promoters, or synthetic equivalents thereof.
  • inducible promoters, or promoters otherwise regulated in their expression pattern e.g. developmentally or cell-type specific, may be used to control expression of the plant expressible genes according to the invention as long as they are expressed in plant parts that contain substrate for TPS.
  • a marker gene linked to the plant expressible gene according to the invention to be transferred to a plant cell.
  • the choice of a suitable marker gene in plant transformation is well within the scope of the average skilled worker; some examples of routinely used marker genes are the neomycin phosphotransferase genes conferring resistance to kanamycin (EP-B 131 623), the Glutathion-S-transferase gene from rat liver conferring resistance to glutathione derived herbicides (EP-A 256 223), glutamine synthetase conferring upon
  • EPSPS EPSPS synthase
  • the marker gene and the gene of interest do not have to be linked, since co-transformation of unlinked genes (U.S.).
  • Patent 4,399,216 is also an efficient proces in plant transformation.
  • Preferred plant material for transformation especially for dicotyledonous crops are leaf-discs which can be readily transformed and have good regenerative capability (Horsch R.B. et al., (1985) Science 227, 1229-1231).
  • expressible antisense genes that are capable of effecting an increase of the availability of the substrate for trehalose phosphate synthase.
  • Specific examples of such genes are the plant expressible antisense genes for SPS from maize and potato and AGPase from potato.
  • the down regulation of carbohydrate modifying enzymes using the antisense approach is not limited by the specific examples. For instance
  • partially complementary plant expressible antisense genes can be used to inhibit expression of a target gene, as long as the plant expressible antisense gene produces a transcript that is sufficiently complementary with the transcript of the target gene and sufficiently long to inhibit expression said target gene.
  • the field of application of the invention lies both in agriculture and horticulture, for instance due to improved properties of the modified plants as such, as well as in any form of industry where trehalose is or will be applied.
  • Trehalose phosphate and trehalose can be used as such for instance in purified form or in admixtures, or in the form of a storage product in plant parts. Plant parts harboring
  • trehalose phosphate or trehalose may be used as such or processed without the need to add trehalose.
  • trehalose can be purified from the plants or plant parts producing it subsequently used in an industrial process.
  • trehalose can be employed by adding trehalose to foods before drying. Drying of foods is an important method of preservation in the industry.
  • Trehalose seems especially useful to conserve food products through conventional air-drying, and to allow for fast reconstitution upon addition of water of a high quality product (Roser et al, July 1991, Trends in Food Science and Technology, pp. 166-169).
  • the benefits include retention of natural flavors/fragrances, taste of fresh product, and nutritional value (proteins and vitamins). It has been shown that trehalose has the ability to stabilize proteins and membranes, and to form a chemically inert, stable glass. The low water activity of such thoroughly dried food products prevents chemical reactions, that could cause spoilage.
  • E.coli K-12 strain DH5 ⁇ is used for all examples.
  • MOGlOl is a non-oncogenic octopine type helper strain derived form LBA1010 (Koekman et al. (1982) Plasmid 7, 119) by substitution of the T-DNA by a spectinomycin resistance marker. Construction of Agrobacterium strain MOGlOl
  • the helper plasmid conferring the Agrobacterium tumefaciens virulence functions is derived from the octopine Ti-plasmid pTiB6.
  • MOG101 is an Agrobacterium tumefaciens strain carrying a non-oncogenic Ti-plasmid (Koekman et al. 1982, supra) from which the entire T-region is deleted and substituted by a bacterial Spectinomycin resistance marker from transposon Tn1831 (Hooykaas et al.. 1980 Plasmid A., 64-75).
  • the Ti-plasmid pTiB6 contains two adjacent T-regions, TL (T-left) and TR (T-right). To obtain a derivative lacking the TL- and TR-regions, we constructed intermediate vector pMOG579. Plasmid pMOG579 is a pBR322 derivative which
  • [C58-C9 (pTiB6) a cured C58 strain in which pTiB6 is introduced (Koekman et al. (1982), supra), by triparental mating from E.coli. using HB101 8pRK2013 as a helper.
  • Transconjugants are selected for resistance to Rifampicin (20 mg/1) and spectinomycin (250 mg/l).
  • a double recombination between pMOG579 and pTiB6 resulted in loss of carbenicillin resistance (the pBR322 marker) and deletion of the entire T-region.
  • spectinomycin resistant transconjugants replica plated onto carbenicillin (100 mg/1) 2 are found sensitive.
  • Southern analysis (not shown) showed that a double crossing over event had deleted the entire T-region. The resulting strain is called MOG101. This strain and its construction is analogous to strain GV2260 (Deblaere et al. 1985, Nucl. Acid Res. 13, 4777-4788).
  • helper strain for MOG101 is e.g. LBA4404; this strain can also suitably be used for introduction of a binary plasmid, such as pMOG799 and subsequent plant
  • the expression vector pMOG18O is a derivative of pMOG18 (EP 0 479 359 Al, Example 2b) wherein the gene coding for GUS is removed and other genes can be inserted between the AlMV RNA4 leader and 3' nos terminator as a BamHI fragment.
  • the EcoRI/NcoI fragment from pMOG18, containing the 35S promoter and AlMV RNA4 leader sequences is synthesized using PCR technology with the primer sets 5' GTTTCTACAGGACGGAGGATCCTGGAAGTATTTGAAAGA 3' and 5'
  • the binary vectors pMOG663-666 are mobilized in triparental matings with the E. coli strain HB101 containing plasmid PRK2013 (Ditta G., Stanfield, S., Corbin, D., and Helinski, D.R. et al. (I960) Proc. Natl. Acad. Sci. USA 77, 7347) into Agrobacterium tumefaciens strain MOG101 and used for
  • Potato Solanum tuberosum cv. Desiree
  • MOGlOl Agrobacterium tumefaciens strain MOGlOl containing the binary vector of interest as described (Hoekema A., Huisman, M.J., Molendijk, L., Van den Elzen, P.J.M., and Cornelissen, B.J.C. (1989) Bio/technology 7, 273).
  • the basic culture medium is MS30R30, consisting of MS-medium (Murashige, T., and Skoog, F. (1962) Physiol. Plan. 14, 473), supplemented with 30 g/L sucrose, R3 vitamins (Ooms et al.
  • Tubers of Solanum tuberosum cv. Desiree are peeled and surface sterilized for 20 minutes in 0.6% hypochlorite solution containing 0.1% Tween-20. The potatoes are washed thoroughly in large volumes of sterile water for at least 2 hours. Discs of approximately 2 mm thickness are sliced from cylinders of tuber tissue prepared with a corkbore. Discs are incubated for 20 minutes in a suspension consisting of the MS30R3 medium without ZR and IAA, containing 10 6 -10 7
  • the discs are subsequently blotted dry on sterile filter paper and transferred to solid MS30R3 medium with ZR and IAA. Discs are transferred to fresh medium with 100 mg/L cefotaxim and 50 mg/L vancomycin after 2 days. A week later, the discs are transferred again to the same medium, but this time with 100 mg/L kanamycin to select for transgenic shoots. After 4-8 weeks, shoots emerging from the discs are excised and placed onto rooting medium (MS30R3-medium without ZR and IAA, but with 100 mg/L cefotaxim and 100 mg/L kanamycin). The shoots are propagated axenically by meristem cuttings and transferred to soil after root development.
  • Trehalose is determined essentially as described by Hottiger et al. (Hottiger et al. (1987) J. Bact. 169, 5518) .
  • Potato tuber tissue is frozen in liquid nitrogen, powdered with pestle and mortar and subsequently extracted for 60 minutes at room temperature in app. 3 volumes of 500 mM
  • Trehalose is determined qualitatively by TLC.
  • the extracts are deionized (Merck, Ion exchanger V) and loaded onto Silica Gel 60 plates (Merck). After chromatography plates are developed with n-butanol-pyridine-water (15:3:2, v/v). Spots are visualized by spraying with 5 mg/ml vanillin in concentrated H 2 SO 4 and heating at 130°C.
  • Commercially available trehalose (Sigma) is used as a standard. Enzyme assays
  • non-transgenic tuber material of variety Desiree is used as control. Protein content in all samples is determined as described by Bradford (Bradford (1976) Anal. Biochem. 72, 248).
  • frozen potato tuber slices of app. 100 mg are homogenized in 100 ⁇ l 20 mM HEPES pH 7.4, centrifuged (Eppendorf, 5 minutes at maximum speed). The supernatant is used for activity assays.
  • TPS activity - TPS activity is determined essentially as described by Hottiger et al. (Hottiger T., Schmutz, P., and Wiemken, A. (1987) J. Bact. 169, 5518).
  • Tuber extract assay mixtures contained 50 mM tricine (K + ) pH 7.0, 10 mM glucose6-phosphate, 5mM UDP-glucose, 12.5 mM MgCl 2 , in a total volume of 0.4 ml. In controls glucose-6-phosphate is omitted. Assay mixtures are incubated at 37°C for 5-30 min. The reaction is stopped by addition of 0.2 ml ice-cold 1 N perchloric acid. After neutralization with 0.2 ml 1 N KOH, the samples are stored on ice for 10 minutes and subsequently centrifuged at 2,000 ⁇ g. UDP is determined in the
  • the assay mixture contained 140 mM tricine (K + ) pH 7.6, 2 mM phosphoenolpyruvate, 0.31 mM NADH, 20 U lactate dehydrogenase from rabbit muscle (Sigma Type XXXIX) in a total volume of 1.96 ml.
  • the reaction is started by addition of 20 U pyruvate kinase from rabbit muscle (Sigma Type III).
  • the decrease of the absorbance at 340 nm at 37°C is used to calculate the UDP concentration.
  • One unit of TPS activity is defined as nmol UDP formed per min at 37°C.
  • AGPase activity - AGPase activity is determined as described by M ⁇ ller-R ⁇ ber et al. (M ⁇ ller-R ⁇ ber B. , Sonnewald, U., and Willmitzer, L. (1992) EMBO J. 11, 1229). Production of glucose-1-phosphate from ADP-glucose is determined in a NAD- linked glucose-6-phosphate dehydrogenase system.
  • the reaction assay contained 80 mM HEPES pH 7.4, 10 mM MgCl 2 , 1 mM ADP-glucose, 0.6 mM NAD, 10 ⁇ M glucose-1, 6-diphosphate, 3 mM DTT, 0.02% bovine serum albumin, 1 U phosphoglucomutase from rabbit muscle (Sigma), 2.5 U NAD-linked glucose-6-phosphate dehydrogenase from Leuconostoc mesenteroides and tuber extract.
  • the reaction is initiated by addition of
  • a unit of AGPase activity is defined as nmol glucose-1-phosphate generated per min at 30°C.
  • SPS activity - SPS activity is determined essentially as described by Lunn & ApRees (Lunn and ApRees (1990) Phytochem. 29, 1057).
  • Assay mixtures contained 50 mM tricine (K + ) pH 7.0, 5 mM fructose-6-phosphate, 5mM UDP-glucose, 12.5 mM MgCl 2 , tuber extract, and water in a total volume of 0.4 ml. In controls fructose-6-phosphate is omitted.
  • Assay mixtures are incubated at 25°C for 5-30 min. The reaction is stopped by addition of 0.2 ml ice-cold 1 N perchloric acid.
  • the assay mixture contained 140 mM tricine (K + ) pH 7.6, 2 mM
  • E.coli trehalose phosphate synthase is encoded by the otsA gene located in the operon otsBA.
  • the location and the direction of transcription of this operon on the E.coli chromosome are precisely known (Kaassen I., Falkenberg, P., Styrvold, O.B., and Strom, A.R. (1992) J. Bact. 174, 889). It is located in the 41-42' region of the E.coli chromosome, and is confined on a 2.9 kb HindIII fragment on EMBL4 genomic clone designated 7F11 of the map by Kohara et al.
  • Cauliflower Mosaic Virus (CaMV) 35S promoter with double enhancer (Guilley H. , Dudley, R.K., Jonard, G., Balazs, E., and Richards, K.E. (1982) Cell 30, 763), the Alfalfa Mosaic Virus (AlMV) RNA4 leader sequence (Brederode et al. F.T., Koper-Zwarthoff, E.C., and Bol, J.F. (1960) Nucl. Acids Res. 8, 2213) and the nopaline synthase transcription terminator sequence from Agrobacterium
  • the expression cassette is cloned as an
  • Potato tuber discs are transformed with the binary vector pMOG663.
  • Transgenic shoots are selected on kanamycin.
  • a number of 20 independent transgenic shoots containing the plant expressible E.coli TPS-construct are analyzed for trehalose phosphate synthase (TPS) activity.
  • TPS trehalose phosphate synthase
  • Plants found to contain the enzyme are grown to mature plants.
  • Mature tubers of those transgenic potato plants, analyzed for trehalose, are found to contain elevated levels of trehalose in
  • Transgenic plant line 663.1 is propagated for further work.
  • oligonucleotides corresponding to the cDNA sequence of the small subunit of ADP-glucose pyrophosphorylase (AGPase) from potato tuber (EMBL data bank accession number X61186) are synthesized.
  • the sequences are as follows:
  • the oligonucleotides are designed to contain suitable restriction sites (BamHI and Ncol, underlined) at their termini to allow assembly in an expression cassette in an antisense orientation.
  • a fragment of about 1 kb is PCR amplified with these oligonucleotides using DNA isolated from a cDNA library from potato cv. Desiree prepared from 2 month old leaf tissue (Clontech) as a template. After sequencing it can be shown, that the fragment is identical with the AGPase sequence deposited in the EMBL data bank.
  • the fragment is cloned in pM0G18 linearized with BamHI and Ncol.
  • the 1.85 kb EcoRI/BamHI fragment is isolated (containing the CaMV 35S promoter, the AlMV RNA4 leader and the AGPase fragment in an antisense orientation) as well as the 0.25 kb BamHI/HindIII fragment containing the nos-terminator.
  • These two fragments are cloned in a three-way ligation with the binary vector pMOG22 linearized with EcoRI and HindIII.
  • the binary vector pMOG22 contains a plant expressible HPTII gene for hygromycin selection in transgenic plants (pMOG22 has been deposited at the Centraal Bureau voor Schimmelcultures on January 29, 1990 under accession number 101.90).
  • the resulting binary vector pMOG664 (see Figure 4) is used for potato transformation.
  • a set of oligonucleotides complementary to the sequence of the maize sucrose phosphate synthase (SPS) cDNA (Worrell A.C., Bruneau, J-M., Summerfelt, K., Boersig, M., and
  • oligonucleotides are used to PCR amplify a DNA fragment of 370 bp using DNA isolated from a potato cv. Desiree cDNA library prepared from 2 month old leaf tissue (Clontech) as a template. After sequencing of this fragment it can be shown that it is highly complementary to the SPS sequence of maize (see Figure 5, and Worrell et al. (1991) Plant Cell 3, 1121).
  • the PCR amplified fragment is made blunt-ended and cloned in pM0G18 linearized with Ncol and BamHI and made blunt-ended with Klenow polymerase.
  • the EcoRI/HindIII fragment is cloned into the binary vector pMOG22 linearized with EcoRI, in a three-way ligation using a synthetic adapter with the following
  • antisense SPS cassette is cloned in the binary, vector pMOG664 (containing the antisense AGPase cassette) linearized with EcoRI.
  • the resulting binary vector carrying the two anti-sense constructs is called pM0G666 (see Figure 7) .
  • Potato tuber discs of kanamycin resistant transgenic plant line 663.1, expressing TPS (example II) are transformed with the binary vector pMOG664, containing the antisense AGPase construct.
  • Transgenic shoots are selected on 10 mg/L hygromycin.
  • Transgenic shoots are recovered, and checked by PCR for the presence of both pMOG663 and pMOG664 sequences.
  • Transgenic plants containing the plant expressible E. coli TPS construct and the antisense AGPase construct are analyzed for TPS and AGPase activity.
  • transgenic tubers for AGPase activity shows reductions in activity levels in individual transgenic lines in comparison with non-transgenic controls.
  • Northern blotting shows that also mRNA levels for AGPase are reduced in the transgenic plants compared to those in non-transgenic control plants.
  • Trehalose levels in tubers of transgenic potato plants, found to exhibit TPS activity, and having reduced levels of AGPase, show an increase in comparison with the levels that can be found in tubers of transgenic plant line 663.1.
  • Potato tuber discs of transgenic plant line 663.1 expressing TPS are transformed with the binary vector pMOG665,
  • Transgenic shoots are selected on 10 mg/L hygromycin. Emerging shoots are checked by PCR for the presence of both pMOG663 and pMOG665
  • Transgenic shoots containing the plant expressible E. coli TPS construct and the antisense SPS construct are analyzed for TPS and SPS activity. Analysis of transgenic tubers for SPS activity shows
  • Potato tuber discs of transgenic plant line 663.1 expressing TPS are transformed with the binary vector pMOG666,
  • Transgenic shoots are selected on 10 mg/L hygromycin.
  • Emerging shoots are checked by PCR for the presence of the plant expressible E. coli TPS construct, and the antisense AGPase and SPS construct. Positive shoots are analyzed for TPS, AGPase and SPS activity.
  • transgenic tubers for AGPase and SPS activity shows reductions in the levels for both enzymes in individual transgenic lines in comparison with non-transgenic controls.
  • Northern blotting shows that also mRNA levels are reduced in the transgenic plants compared to those in non-transgenic control plants.
  • E.coli trehalose phosphate synthase TPS
  • E.coli trehalose phosphate synthase TPS
  • the location and the direction of transcription of this operon on the E.coli chromosome are known (Kaasen, I., Falkenberg, P., Styrvold, O.B., and Strom, A.R. (1992) J. Bact. 174. 889).
  • the otsA gene is located at 42 , and according to Kaasen et al.
  • the 2.9 kb HindIII insert from the resulting plasmid, designated pMOG674, is sequenced.
  • the sequence is found to contain part of the araH gene of the arabinose transport operon (Scripture, J.B., Voelker, C. , Miller, S., O' Donnell, R.T., Polgar, L., Rade, J., Horazdovsky, B.F., and Hogg, R.W. (1987) J. Mol. Biol. 197, 37), the otsB gene encoding TPP as localized by Kaasen et al. and part of the otsA gene encoding TPS.
  • the otsA is found not to be confined to the 2.9 kb HindIII fragment as described by Kaasen et al. To complete the sequence an overlapping BamHI/EcoRI fragment is isolated and partially sequenced. The complete TPS-encoding sequence of the otsA gene is shown in Figure 11 (SEQIDNO: 2) . The position of the otsA gene on clone 7F11, with the restriction enzyme sites used, is shown in Figure 12. An additional HindIII site not present on the map published by Kohara et al. is found on the 'left-hand' site of the 2.9 kb HindIII fragment.
  • 3' GGGGCCCCGTACGTTCGAACCTAG 5' (SEQIDNO: 11) is cloned in vector pMOG746 linearized with BamHI.
  • the vector with the oligonucleotide duplex in the desired orientation (checked by restriction enzyme digestion) is designated PMOG747.
  • the 2.9 kb HindIII fragment of plasmid pMOG674 is cloned in pMOG747 linearized with HindIII, resulting in vector pMOG748.
  • the app. 2.4 kb EcoRV/SstI and the app. 3.5 kb Sstl/Smal fragments of pMOG748 are isolated, ligated and transformed into IL.
  • the resulting plasmid is designated pMOG749.
  • the 5' end of the otsA gene is synthesized by PCR using the synthetic oligonucleotides TPS1 and TPS2 with PMOG749 as a template.
  • TPS1 5' GAGAAAATACCCGGGGTGATGAC 3' (SEQIDNO: 12)
  • TPS2 5" GATAATCGTGGATCCAGATAATGTC 3' (SEQIDNO: 13)
  • the 1 kb BamHI/HindIII fragment of pMOG749 is cloned together with the 0.4 kb Xmal/BamHI PCR fragment in pMOG747 linearized with Xmal and HindIII.
  • the synthetic oligonucleotide duplex TPS6/7 is cloned, encoding the three C-terminal amino acids of TPS.
  • the 0.25 kb HindIII/SstI fragment of plasmid pMOG749 is cloned, comprising the terminator from the Agrobacterium tumefaciens nopaline synthase (NOS) gene, resulting in plasmid pMOG798.
  • This plasmid contains the E. coli otsA gene in the correct orientation under control of the Cauliflower Mosaic Virus (CaMV) 35S promoter with double enhancer (Guilley et al.
  • CaMV Cauliflower Mosaic Virus
  • Trehalose production in potatoes transformed with pMOG799 Potato tuber discs are transformed with the binary vector pMOG799 using Agrobacterium tumefaciens. Transgenic shoots are selected on kanamycin. A number of 20 independent transgenic shoots are analyzed for trehalose phosphate synthase (TPS) activity. Plants found to contain the enzyme are grown to mature plants. Analyses of mature tubers of those transgenic potato plants show elevated levels of trehalose in comparison with non-transgenic control plants. Transgenic plant line MOG799.1 is propagated for further work.
  • TPS trehalose phosphate synthase
  • oligonucleotides corresponding to the cDNA sequence of the small subunit of ADP-glucose pyrophosphorylase (AGPaseB) from potato tuber cv. Desiree (Müller-Röber, B., Kossmann, J., Hannah, L.C., Willmitzer, L., and Sonnewald, U. (1990) Mol. Gen. Genet. 224, 136-146) are synthesized:
  • the oligonucleotides are designed to contain suitable restriction sites (BamHI and NcoI, underlined) at their termini to allow assembly in an expression cassette in an antisense orientation after digestion with these enzymes.
  • a fragment of about 1 kb is PCR amplified with these oligonucleotides using DNA isolated from a cDNA library from potato cv. Desiree prepared from 2 month old leaf tissue (Clontech) as a template. By sequencing it is shown, that the fragment is identical with the AGPase B sequence from potato cv. Desiree (M ⁇ ller-R ⁇ ber, B., Kossmann, J., Hannah, L.C., Willmitzer, L., and Sonnewald, U. (1990) Mol. Gen.
  • the binary vector pMOG22 contains a plant expressible HPTII gene for hygromycin selection in transgenic plants (pMOG22 has been deposited at the Centraal Bureau voor Schimmelcultures on January 29, 1990 under accession number 101.90).
  • the resulting binary vector pMOG664 (Fig. 4) is used for potato transformation.
  • a set of oligonucleotides complementary to the sequence of the maize sucrose phosphate synthase (SPS) cDNA (Worrell, A.C., Bruneau, J-M., Summerfalt, K., Boersig, M. , and Voelker, T.A. (1991) Plant Cell 3, 1121) is synthesized. Their sequences are as follows:
  • oligonucleotides are used to PCR amplify a DNA fragment of 370 bp using DNA isolated from a potato cv. Desiree cDNA library prepared from 2 month old leaf tissue (Clonte ⁇ h) as a template. By sequencing of this fragment it is shown, that it is homologous to the SPS sequence of maize (see Figure 4, and Worrell et al. (1991).
  • the PCR fragment is used to screen a lambda gt10 library of potato cv. Desiree cDNA library prepared from 2 month old leaf tissue (Clontech). The insert of one positively hybridizing clone is sequenced.
  • the sequence of the 654 bp DNA fragment is found to be 65% identical with the corresponding part of the maize SPS sequence (Starting at nucleotide number 349 in Figure 11 in Worrell et al. (1991).
  • the EcoRI insert of this clone is cloned in pMOG180 digested with BamHI, in a three-way ligation with the following synthetic oligonuclotide duplex.
  • the plasmid having the SPS fragment in the antisense orientation with respect to the CaMV 35S promoter, is designated pMOG787.
  • the EcoRI/HindIII fragment of plasmid pMOG787 is cloned in a three-way ligation with a synthetic linker:
  • the binary vector pMOG22 contains a plant expressible HPTII gene for hygromycin selection in transgenic plants (pMOG22 has been deposited at the Centraal Bureau voor Schimmelcultures on January 29, 1990 under accession number 101.90).
  • the resulting binary vector pMOG8Ol (Fig. 14) is used for potato transformation.
  • the EcoRI fragment of plasmid pMOG801, containing the antisense SPS expression cassette, is cloned in the binary vector pMOG664 (containing the antisense AGPase cassette), linearized with EcoRI.
  • the resulting binary vector is called pMOG802 (Fig 15).
  • Potato tuber discs of kanamycin resistant plant line MOG799.1, expressing TPS (Example IX) are transformed with the binary vector pMOG664, containing the antisense AGPase expression cassette.
  • Transgenic shoots, selected on 10 mg/L hygromycin, are analyzed for the presence of the TPS and antisense AGPase sequences by PCR.
  • Transgenic plants containing both are analyzed for TPS and AGPase activity.
  • transgenic tubers for AGPase activity By analysis of transgenic tubers for AGPase activity it is shown that, reductions in activity levels in individual transgenic lines in comparison with non-transgenic controls occur. By Northern blots it is shown, that mRNA levels for AGPase are reduced in the transgenic plants compared to those in non-transgenic control plants. Trehalose levels in tubers of transgenic potato plants, found to exhibit TPS activity, and having reduced levels of AGPase, show an increase in comparison with the levels found in tubers of transgenic plant line MOG799.1.
  • Potato tuber discs of kanamycin resistant plant line MOG799.1, expressing TPS (Example IX) are transformed with the binary vector pMOG8Ol, containing the antisense SPS expression cassette.
  • Transgenic shoots, selected on 10 mg/L hygromycin, are analyzed for the presence of the TPS and antisense SPS sequences by PCR.
  • Transgenic plants containing both are analyzed for TPS and SPS activity.
  • transgenic tubers for SPS activity By analysis of transgenic tubers for SPS activity it is shown that reductions in activity levels in individual transgenic lines in comparison with non-transgenic controls occur. By Northern blots it is shown, that mRNA levels for SPS are reduced in the transgenic plants compared to those in nontransgenic control plants. Trehalose levels in tubers of transgenic potato plants, found to exhibit TPS activity, and having reduced levels of SPS, show an increase in comparison with the levels found in tubers of transgenic plant line MOG799.1.
  • Potato tuber discs of kanamycin resistant plant line M0G799.1, expressing TPS (Example IX) are transformed with the binary vector pMOG802, containing the antisense SPS and AGPase expression cassettes.
  • Transgenic shoots, selected on 10 mg/L hygromycin, are analyzed for the presence of the TPS, antisense AGPase and antisense SPS sequences by PCR.
  • Transgenic plants containing all three constructs are analyzed for TPS, AGPase and SPS activity.
  • transgenic tubers for AGPase and SPS activity By analysis of transgenic tubers for AGPase and SPS activity it is shown, that reductions in the activity levels for both enzymes in individual transgenic lines in comparison with non-transgenic controls occur.
  • Northern blots it is shown that mRNA levels for AGPase and SPS are reduced in the transgenic plants compared to those in non-transgenic control plants.
  • Trehalose levels in tubers of transgenic potato plants, found to exhibit TPS activity, and having reduced levels of SPS show an increase in comparison with the levels found in tubers of transgenic plant line MOG799.1.
  • ORGANISM Escherichia coli
  • CAG ACA GAA AAC GAT CCT CTG GCG TTC CTG GAT TGT CTT TCT AAC CIG 627 Gln Thr Glu Asn Asp Arg Leu Ala Ehe Leu Asp Cys Leu Ser Asn Leu
  • GCC AAT CCG GGC GTT CTT GTT CTT TCG CAA TTT GCG GGA GCG GCA AAC 1203 Ala Asn Pro Gly Val Leu Val Leu Ser Gln Ehe Ala Gly Ala Ala Asn

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Nutrition Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The present invention provides for the production of trehalose in a plant host due to the presence in said plant host of a plant expressible gene which comprises in sequence: (a) a transcriptional initiation region that is functional in said plant host; (b) a DNA sequence encoding a trehalose phosphate synthase activity; and optionally, (c) a transcriptional termination sequence that is functional in said plant host.

Description

PRODUCTION OF TREHALOSE IN PLANTS
FIELD OF THE INVENTION
This invention relates to the modification of plant
carbohydrate metabolism using recombinant DNA techniques, recombinant DNA for use therein, as well as plants and parts of plants having a modified genetic constitution. Said plants may be used to extract specific carbohydrate compounds, or alternatively, they may be processed as food, feed, or ingredients thereof, having improved properties due to the presence of said carbohydrate compounds, e.g. during
processing.
STATE OF THE ART
Trehalose is a general name given to D-glucosyl
D-glucosides which comprise disaccharides based on two α-, α,β- and β,β-linked glucose molecules. Trehalose, and
especially α-trehalose 1-(O-a-D-glucopyranosyl)-1'-O-α-D-glucopyranose) is a widespread naturally occurring disaccharide.
The chemical synthesis of trehalose is difficult
(protecting groups required) and inefficient. Current natural sources of trehalose are mushrooms and the yeast
Saccharomyces cerevisiae, that can accumulate over 10% of dry weight as trehalose. However production is hampered by high trehalase activity causing rapid metabolization of trehalose.
Elbein A.D. (1974, Adv. Carbohydrate Chem. and Biochem. 30, 227-256) gives a review of the occurrence and metabolism of the disaccharide trehalose, particularly α,α-trehalose, in living organisms. In plants, the presence of trehalose has been reported in some lower plant species, as well as in a number of higher plant species belonging to the
spermatophvta; Echinops persicus. Carex brunescens; Faσus silvaticus. However, these results have never been firmly established by other authors (e.g. Kendall et al., 1990,
Phytochemistry 29, No. 8, 2525-2528). For instance, Kendall et al, supra, referring to the occurrence of trehalose in spermatophytes, stated that the presence thereof has only been firmly documented for caraway seed (Carum carvi). A report of the presence of trehalose in sunflower by Cegla et al., (1977, J. Am. Oil Chem. Soc. 54, 150 et seq. ) was questioned by Kandler et al., (in: The Biochemistry of Plants Vol. 3 Carbohydrates: Structure and Function; Preiss, J., ed., p.228. Academic Press) according to Kendall et al, 1990, supra. Reports of trehalose in beech (Fagus sylvaticus) and cabbage could not be verified by other authors (Kendall et al., 1990, supra, and references therein).
In spite of the apparent rarity of trehalose in higher plants, the presence of trehalose degrading activities was reported for a significant number of the investigated plant families. Stable high trehalase activity was found in three wheat lines, jack pine, and Selaginella lepidophylla. Stable, low trehalase activity was found in alfalfa, black Mexican sweet corn and white spruce. Labile, moderate activities were found in two different suspensions of canola, but these could probably not be ascribed to specific trehalase activity.
Barley, brome grass, soybean and black spruce were
reported to contain no trehalase activity at all (Kendall, 1990, supra).
In organisms capable of its production trehalose is
believed to be biosynthesized as the 6-phosphate, whereas the storage form is the free sugar. It is therefore believed, that organisms that produce and/or store trehalose contain a phosphatase capable of cleaving trehalose 6-phosphate.
(Elbein, 1974, supra). Little is known about the presence of specific trehalose phosphate phosphatases in higher plants.
SUMMARY OF THE INVENTION
The present invention provides for a method for the production of trehalose in a plant host due to the presence in said plant host of a plant expressible gene which
comprises in sequence:
(a) a transcriptional initiation region that is functional in said plant host,
(b) a DNA sequence encoding a trehalose phosphate synthase activity, and optionally
(c) a transcriptional termination sequence that is functional in said plant host.
Another embodiment of the invention comprises the
production of trehalose in a plant host due to the presence in said plant host of a plant expressible gene which comprises in sequence:
(a) a transcriptional initiation region that is functional in said plant host,
(b) a DNA sequence encoding a trehalose phosphate synthase activity, and optionally
(c) a transcriptional termination sequence that is functional in said plant host, and
a plant expressible gene comprising in sequence:
(a) a transcriptional initiation region that is functional in said plant host,
(b) a DNA sequence encoding an RNA sequence which is at least partially complementary to an RNA sequence which encodes a sucrose phosphate synthase enzyme (SPS) naturally occuring in said plant host, and optionally
(c) a transcriptional termination sequence that is functional in said plant host.
Yet another embodiment of the invention comprises the production of trehalose in a plant host due to the presence in said plant host of a plant expressible gene which
comprises in sequence:
(a) a transcriptional initiation region that is functional in said plant host,
(b) a DNA sequence encoding a trehalose phosphate synthase activity, and optionally
(c) a transcriptional termination sequence that is functional in said plant host, and
a plant expressible gene comprising in sequence:
(a) a transcriptional initiation region that is functional in said plant host,
(b) a DNA sequence encoding an RNA sequence which is at least partially complementary to an RNA sequence which encodes an
ADP-glucose pyrophosphorylase enzyme naturally occuring in said plant host, and optionally
(c) a transcriptional termination sequence that is functional in said plant host.
Yet another embodiment of the invention comprises the production of trehalose in a plant host due to the presence in said plant host of a plant expressible gene which
comprises in sequence: (a) a transcriptional initiation region that is functional in said plant host,
(b) a DNA sequence encoding a trehalose phosphate synthase activity, and optionally
(c) a transcriptional termination sequence that is functional in said plant host,
and a plant expressible gene comprising in sequence:
(a) a transcriptional initiation region that is functional in said plant host,
(b) a DNA sequence encoding an RNA sequence at least
partially complementary to an RNA sequence which encodes a sucrose phosphate synthase enzyme naturally occurring in said plant host, and optionally
(c) a transcriptional termination sequence that is functional in said plant host,
and a plant expressible gene comprising in sequence:
(a) a transcriptional initiation region that is functional in said plant host,
(b) a DNA sequence encoding an RNA sequence at least
partially complementary to an RNA sequence which encodes an ADP-glucose pyrophosphorylase enzyme naturally occurring in said plant host, and optionally
(c) a transcriptional termination sequence that is functional in said plant host.
The invention also extends to the plant expressible genes used in the process for making trehalose, as well as to the combinations of plant expressible genes, as well as to cloning plasmids, transformation vectors, microorganisms, an individual plant cells harboring plant expressible genes according to the invention.
The invention also provides a recombinant plant DNA genome which contains a plant expressible trehalose phosphate synthase gene that is not naturally present therein. The invention also comprises a recombinant plant DNA genome which comprises a plant expressible trehalose phosphate gene that is not naturally present therein and in addition a plant expressible gene capable of inhibiting biosynthesis of an SPS activity, and/or a plant expressible gene capable of
inhibiting biosynthesis of an AGPase activity. The invention also provides a method for obtaining a plant capable of producing trehalose comprising the steps of,
(1) introducing into a recipient plant cell a plant
expressible gene comprising in sequence:
(a) a transcriptional initiation region that is functional in said plant host,
(b) a DNA sequence encoding a trehalose phosphate synthase activity,
(c) a transcriptional termination sequence that is
functional in said plant host, and a plant expressible gene comprising in sequence:
(a) a transcriptional initiation region that is functional in said plant host,
(b) a DNA sequence encoding a selectable marker gene that is functional in said plant host, and optionally
(c) a transcriptional termination sequence that is
functional in said plant host,
(2) generating a plant from a transformed cell under
conditions that allow for selection for the presence of the selectable marker gene.
The invention also comprises plants which produce
(increased levels of) trehalose as a result of genetic modification.
The invention further comprises plants having a
recombinant DNA genome containing a plant expressible gene according to the invention.
The invention also comprises plants having a recombinant DNA genome containing a plant expressible gene according to the invention and which plants produce trehalose.
The invention also comprises plants having a recombinant DNA genome according to the invention and which exhibit increased drought resistance.
The invention also extends to parts of plants according to the invention such as cells or protoplasts or cultures thereof, flowers, fruits, leaves, pollen, roots (including hairy root cultures), seeds, stalks, tubers (including so-called microtubers) and the like.
The invention also extends to a method of preserving plants or plant parts in the presence of trehalose comprising the steps of :
(1) growing a plant according to the invention which produces trehalose,
(2) harvesting the plant or plant parts which contain
trehalose, and
(3) air drying the plants or plant parts or alternatively,
(4) freeze drying the plants or plant parts.
The invention further comprises the plants and plant parts which have been preserved by a method according to the invention.
The invention also includes a method for the production of trehalose comprising the steps of:
(1) growing a plant which by virtue of a recombinant plant DNA genome is capable of producing (increased levels of) trehalose,
(2) harvesting said plant or plant part,
(3) isolating the trehalose from the said plant or the said plant part.
The invention further includes a method for the production of trehalose comprising the steps of:
(1) growing in culture plant cells which by virtue of a recombinant plant DNA genome are capable of producing
(increased levels of) trehalose,
(2) isolating the trehalose from the said plant cell culture. The invention further provides an isolated nucleic acid sequence encoding a trehalose phosphate synthase activity. A preferred isolated nucleic acid sequence is one obtained from E. coli, still more preferred is the isolated nucleic acid sequence represented in SEQIDNO: 2. Another preferred
embodiment comprises a nucleic acid sequence that codes for an amino acid sequence as in SEQIDNO: 3.
The following figures further illustrate the invention.
DESCRIPTION OF THE FIGURES
Figure 1. Schematic representation of parts of the sucrose and starch biosynthetic pathways in plant sink tissues. The figure shows that carbohydrate produced in the leaf by photosynthesis is transported via the phloem tissue in the form of sucrose. Upon entering the sink it is unloaded by a membrane bound invertase activity to yield the monosugars glucose and fructose. By the action of a number of enzymatic steps these monosugars are converted to starch and/or sucrose as roughly shown here. The glucose metabolites G6P and UDPG are believed to be used as the substrates for the TPS-enzyme engineered into the plant by introduction of the plant expressible otsA gene. The figure shows how the amount of UDPG and G6P available as substrate is increased by reducing the levels of the enzymes SPS and AGPase. Their inhibition is marked with a cross.
Figure 2 Schematic map of the EBL4clone 7F11 from Kohara et al. (1987), containing the otsBA operon from
E. coli. The 18.8 kb insert has been shaded.
The restriction sites for the enzymes EcoRV and
HindiII used to clone the otsA gene are
indicated, as well as their distance in kb with respect to the left-hand site of the insert.
The otsA and B gene are indicated, the arrows shows the direction of transcription. (See Fig
11, extended map).
Figure 3 Schematic representation of binary vector
pMOG663.
Figure 4 Sequence of the cloned potato SPS cDNA.
Underscore: maize SPS cDNA sequences used as oligonucleotides in the PCR amplification reaction.
Figure 5. Schematic representation of binary vector
pMOG664.
Figure 6. Schematic representation of binary vector
PM0G665.
Figure 7. Schematic representation of binary vector
pMOG666.
Figure 8. Restriction map of part of pTiB6 showing two fragments cloned in pMOG579.
Figure 9, Schematic representation of pMOG579 used for constructing the helper plasmid without T- region in Agrobacterium strain MOG101.
Figure 10, Schematic representation of expression vector pMOG180.
Figure 11. Nucleic acid sequence of the otsA gene and
amino acid sequence of E. coli TPS.
Figure 12. Extended map of the EBL4clone 7F11 from Kohara et al. (1987), containing the otsBA operon from
E. coli. The location of the TPS open reading frame (ORF) is indicated. (*: HindIII sites not present in the map of Kohara et al., infra)
Figure 13. Schematic representation of binary vector
pMOG799.
Figure 14. Schematic representation of binary vector
PMOG801.
Figure 15. Schematic representation of binary vector
PMOG802.
DETAILED DESCRIPTION OF THE INVENTION
A preferred embodiment of the invention comprises a potato plant capable of producing trehalose in tubers due to the presence in said potato plant of a plant expressible gene which comprises in sequence:
(a) a transcriptional initiation region derived from the 35S RNA of CaMV flanked upstream by a double enhancer,
(b) a DNA sequence encoding trehalose phosphate synthase which is the coding region of the otsA gene located in the otsBA operon of E. coli.
(c) a transcriptional termination sequence derived from the nopaline synthase (nos) gene of Agrobacterium. Tubers of transgenic plants containing the plant expressible TPS gene produced trehalose, whereas control plants lacking this gene did not. Apparently, the trehalose phosphate which is produced by the transgenic tubers is converted into
trehalose. Apparently, it is not required to provide for a trehalose phosphate phosphatase activity since it seems present in potato.
Also illustrated in figure 1 is an approach to improve substrate availability for TPS. To this end two genes influencing the availability of glucose-6 phosphate (G6P) and UDPG, to whit an antisense SPS gene and a antisense APGase have been cloned under the control of the CaMV 35S promoter for expression in plant hosts. If introduced into a plant host containing a plant expressible TPS gene according to the invention, this will increase substrate availability for TPS and therefore trehalose synthesis. It will readily occur to someone skilled in the art that also other antisense genes may used to block the synthesis of sucrose or starch, in order to improve substrate availability.
Although the invention is described in detail for potato plants which express a plant expressible trehalose phosphate synthase gene from E. coli under the control of the CaMV 35S promoter as transcription initiation region, it will be clear to those of skill in the art that other spermatophytic plant hosts are equally suitable for the production of trehalose. Preferred plant hosts among the spermatophyta are the
Angiospermae. notably the Dicotyledoneae. comprising inter alia the Solanaceae as a representative family, and the
Monocotyledoneae. comprising inter alia the Gramineae as a representative family. Suitable host plants, as defined in the context of the present invention include plants (as well as parts and cells of said plants) and their progeny which have been genetically modified using recombinant DNA
techniques to cause or enhance production of trehalose interest in the desired plant or plant organ; these plants may be used directly (e.g. the plant species which produce edible parts) or after the trehalose is purified from said host (which be from edible as well as inedible plant hosts). Crops with edible parts according to the invention include those which have flowers such as cauliflower (Brassica oleracea). artichoke (Cynara scolymus), fruits such as apple (Malus, e.g. domesticus), banana (Musa, e.g. acuminata), berries (such as the currant, Ribes, e.g. rubrum), cherries (such as the sweet cherry, Prunus . e.g. avium), cucumber (Cucumis, e.g. sativus), grape (Vitis, e.g. vinifera), lemon (Citrus limon), melon (Cucumis melo), nuts (such as the walnut, Juglans. e.g. regia; peanut, Arachis hypogeae).
orange (Citrus, e.g. maxima), peach (Prunus. e.g. persica), pear (Pyra. e.g. communis), pepper (Solanum. e.g. capsicum), plum (Prunus. e.g. domestica), strawberry (Fragaria. e.g. moschata), tomato (Lycopersicon,, e.g. esculentum), leafs, such as alfalfa (Medicago. e.g. sativa), cabbages (such as Brassica oleracea). endive (Cichoreum. e.g. endivia), leek (Allium. e.g. porrum), lettuce (Lactuca, e.g. sativa), spinach (Spinacia e.g. oleraceae), tobacco (Nicotiana. e.g. tabacum). roots, such as arrowroot (Maranta, e.g.
arundinacea), beet (Beta, e.g. vulgaris), carrot (Daucus, e.g. carota), cassava (Manihot, e.g. esculenta), turnip
(Brassica. e.g. rapa), radish (Raphanus. e.g. sativus), yam (Dioscorea, e.g. esculenta) . sweet potato (Ipomoea batatas) and seeds, such as bean (Phaseolus. e.g. vulgaris), pea
(Pisum. e.g. sativum), soybean (Glycin, e.g. max), wheat (Triticum, e.g. aestivum), barley (Hordeum, e.g. vulgare), corn (Zea. e.g. mays), rice (Oryza, e.g. sativa), tubers, such as kohlrabi (Brassica. e.g. oleraceae), potato (Solanum. e.g. tuberosum), and the like. The edible parts may be conserved by drying in the presence of enhanced trehalose levels produced therein due to the presence of a plant expressible trehalose phosphate synthase construct. It may be advantageous to produce enhanced levels of trehalose, by putting the DNA encoding the TPS activity under the control of an plant organ or tissue-specific promoter; the choice of which can readily be determined by those of skill in the art.
Any trehalose phosphate gene under the control of
regulatory elements necessary for expression of DNA in plant cells, either specifically or constitutively, may be used, as long as it is capable of producing an active trehalose phosphate synthase activity. The nucleic acid sequence represented in SEQIDNO: 2, in fact any open reading frame encoding a trehalose phosphate synthase activity according to the invention, may be altered without necessarily altering the amino acid sequence of the protein encoded thereby. This fact is caused by the degeneracy of the genetic code. Thus the open reading frame encoding the trehalose phosphate synthase activity may be adapted to codon usage in the host plant of choice.
Also the isolated nucleic acid sequence represented by SEQIDNO: 2, may be used to identify trehalose phosphate synthase activities in other organisms and subsequently isolating them, by hybridising DNA from other sources with a DNA- or RNA fragment obtainable from the E. coli gene.
Preferably, such DNA sequences are screened by hybridising under stringent conditions (such as temperature and ionic strength of the hybridisation mixture. Whether or not
conditions are stringent also depends on the nature of the hybridisation, i.e. DNA:DNA, DNA:RNA, RNA:RNA, as well as the length of the shortest hybridising fragment. Those of skill in the art are readily capable of establishing a stringent hybridisation regime.
Sources for isolating trehalose phosphate synthase
activities include microorganisms (e.g. bacteria, yeast, fungi), plants, animals, and the like. Isolated DNA sequences encoding trehalose phosphate activity from other sources may be used likewise in a method for producing trehalose
according to the invention.
The invention also encompasses nucleic acid sequences which have been obtained by modifying the nucleic acid sequence represented in SEQIDNO: 2 by mutating one or more codons so that it results in amino acid changes in the encoded protein, as long as mutation of the amino acid sequence does not entirely abolish trehalose phosphate synthase activity.
In principle any plant host is suitable in combination with any plant expressible trehalose phosphate synthase gene. As trehalose genes from other sources become available these can be used in a similar way to obtain a plant expressible trehalose phosphate synthase gene combination as described here.
The inhibition of endogenous genes in order to enhance substrate availability for the trehalose phosphate synthase, as exemplified herein with the inhibition of endogenous sucrose phosphate synthase gene and the ADP-Glucose
pyrophosphorylase gene, may be conducted in a number of ways the choice of which is not critical to the invention.
Preferably gene inhibition is achieved through the so-called 'antisense approach'. Herein a DNA sequence is expressed which produces an RNA that is at least partially
complementary to the RNA which encodes the enzymatic activity that is to be blocked (e.g. AGP-ase or SPS, in the examples). It is preferred to use homologous antisense genes as these are more efficient than heterologous genes. The isolation of an antisense SPS gene from potato using a maize SPS-gene sequence as probe serves to illustrate the feasibility of this strategy. It is not meant to indicate that, for
practicing the invention the use of homologous antisense fragments is required. An alternative method to block the synthesis of undesired enzymatic activities is the
introduction into the genome of the plant host of an
additional copy of an endogenous gene present in the plant host. It is often observed that such an additional copy of a gene silences the endogenous gene: this effect is referred to in the literature as the co-suppressive effect, or co-suppression.
In principle both dicotyledonous and monocotyledonous plants that are amenable for transformation, can be modified by introducing a plant expressible gene according to the
invention into a recipient cell and growing a new plant that harbors and expresses the plant expressible gene. Preferred plants according to the invention are those that are capable of converting trehalose-phosphate into trehalose, and which do contain no or little trehalose degrading activity. It will be understood that plants that lack the ability to convert the trehalose phosphate into trehalose are also included in the present invention. These plants may be further modified by introducing additional genes that encode phosphatases that are capable of the conversion of trehalose phosphate into trehalose. In principle also plants are envisaged that do contain trehalases, since these plants can be made suitable for the production of trehalose by inhibiting the activity of such enzymes, for instance by inhibiting expression of the genes encoding such enzymes using the antisense approach.
The method of introducing the plant expressible trehalose-phosphate gene into a recipient plant cell is not crucial, as long as the gene is stably incorporated into the genome of said plant cell. In addition to the use of strains of the genus Agrobacterium various other techniques are available for the introduction of DNA into plant cells, such as transformation of protoplasts using the calcium/polyethylene glycol method, electroporation and microinjection or (coated) particle bombardment (Potrykus, 1990, Bio/Technol. 8, 535-542).
In addition to these so-called direct DNA transformation methods, transformation systems involving vectors are widely available, such as viral vectors (e.g. from the Cauliflower Mosaic Virus (CaMV) and bacterial vectors (e.g. from the genus Agrobacterium) (Potrykus, 1990, Bio/Technol. 8, 535-542). After selection and/or screening, the protoplasts, cells or plant parts that have been transformed can be regenerated into whole plants, using methods known in the art (Horsch et al., 1985, Science 225 , 1229-1231).
It has been shown that monocotyledonous plants are
amenable to transformation and that fertile transgenic plants can be regenerated from transformed cells. The development of reproducible tissue culture systems for these crops, together with the powerful methods for introduction of genetic
material into plant cells has facilitated transformation. Presently, preferred methods for transformation of monocots are microprojectile bombardment of explants or suspension cells, and direct DNA uptake, or electroporation (Shimamoto, et al. 1989, Nature 338, 274-276). Transgenic maize plants have been obtained by introducing the Streptomvces
hygroscopicus bar-gene, which encodes phosphinothricin acetyltransferase (an enzyme which inactivates the herbicide phosphinothricin), into embryogenic cells of a maize
suspension culture by microprojectile bombardment (Gordon-Kamm, 1990, Plant Cell, 2 , 603-618). The introduction of genetic material into aleurone protoplasts of other monocot crops such as wheat and barley has been reported (Lee, 1989, Plant Mol. Biol. 13, 21-30). Wheat plants have been
regenerated from embryogenic suspension culture by selecting only the aged compact and nodular embryogenic callus tissues for the establishment of the embryogenic suspension cultures (Vasil, 1990 Bio/Technol. 8, 429-434). The combination with transformation systems for these crops enables the
application of the present invention to monocots. These methods may also be applied for the transformation and regeneration of dicots. Monocotyledonous plants, including commercially important crops such as corn are amenable to DNA transfer by
Agrobacterium strains (European patent 159 418 B1; Gould J, Michael D, Hasegawa O, Ulian EC, Peterson G, Smith RH, (1991) Plant. Physiol. 95, 426-434).
As regards the choice of the host plant it is preferred to select plant species with little or no trehalose degrading activity. However, plants that do exhibit trehalase activity are not excluded from being a suitable host plant for the production of trehalose, although it may be necessary to provide for inhibition of trehalase activity if this prevents the accumulation of trehalose altogether. Such inhibition can be achieved using the antisense approach well known in the art, and illustrated for other purposes in this
specification.
It should also be understood that the invention is not limited to the use of the CaMV 35S promoter as transcription initiation region. Suitable DNA sequences for control of expression of the plant expressible genes, including marker genes, such as transcriptional initiation regions, enhancers, non-transcribed leaders and the like, may be derived from any gene that is expressed in a plant cell which, such as
endogenous plant genes, genes naturally expressed in plant cells such as those located on wild-type T-DNA of
Agrobacterium, genes of plant viruses, as well as other eukaryotic genes that include a transcription initiation region that conforms to the consensus sequence for eukaryotic transcription initiation. Also intended are hybrid promoters combining functional portions of various promoters, or synthetic equivalents thereof. Apart from constitutive promoters, inducible promoters, or promoters otherwise regulated in their expression pattern, e.g. developmentally or cell-type specific, may be used to control expression of the plant expressible genes according to the invention as long as they are expressed in plant parts that contain substrate for TPS.
To select or screen for transformed cells, it is preferred to include a marker gene linked to the plant expressible gene according to the invention to be transferred to a plant cell. The choice of a suitable marker gene in plant transformation is well within the scope of the average skilled worker; some examples of routinely used marker genes are the neomycin phosphotransferase genes conferring resistance to kanamycin (EP-B 131 623), the Glutathion-S-transferase gene from rat liver conferring resistance to glutathione derived herbicides (EP-A 256 223), glutamine synthetase conferring upon
overexpression resistance to glutamine synthetase inhibitors such as phosphinothricin (WO87/05327), the acetyl transferase gene from Streptomyces viridochromogenes conferring
resistance to the selective agent phosphinothricin (EP-A 275 957), the gene encoding a 5-enolshikimate-3-phosphate
synthase (EPSPS) conferring tolerance to N-phosphonomethylglycine, the bar gene conferring resistance against Bialaphos (e.g. WO91/02071) and the like. The actual choice of the marker is not crucial as long as it is
functional (i.e. selective) in combination with the plant cells of choice.
The marker gene and the gene of interest do not have to be linked, since co-transformation of unlinked genes (U.S.
Patent 4,399,216) is also an efficient proces in plant transformation.
Preferred plant material for transformation, especially for dicotyledonous crops are leaf-discs which can be readily transformed and have good regenerative capability (Horsch R.B. et al., (1985) Science 227, 1229-1231).
Whereas the production of trehalose can be achieved with the plant expressible trehalose phosphate synthase gene as the sole carbohydrate modifying gene, the invention is further illustrated with examples of additional plant
expressible antisense genes that are capable of effecting an increase of the availability of the substrate for trehalose phosphate synthase. Specific examples of such genes are the plant expressible antisense genes for SPS from maize and potato and AGPase from potato. The down regulation of carbohydrate modifying enzymes using the antisense approach is not limited by the specific examples. For instance
partially complementary plant expressible antisense genes can be used to inhibit expression of a target gene, as long as the plant expressible antisense gene produces a transcript that is sufficiently complementary with the transcript of the target gene and sufficiently long to inhibit expression said target gene.
It is immaterial to the invention how the presence of two or more genes in the same plant is effected. This can inter alia done be achieved by one of the following methods:
(a) transformation of the plant line with a multigene
construct containing more than one gene to be introduced, (b) co-transforming different constructs to the same plant line simultaneously,
(c) subsequent rounds of transformation of the same plant with the genes to be introduced,
(d) crossing two plants each of which contains a different gene to be introduced into the same plant.
The field of application of the invention lies both in agriculture and horticulture, for instance due to improved properties of the modified plants as such, as well as in any form of industry where trehalose is or will be applied.
Trehalose phosphate and trehalose can be used as such for instance in purified form or in admixtures, or in the form of a storage product in plant parts. Plant parts harboring
(increased levels of) trehalose phosphate or trehalose may be used as such or processed without the need to add trehalose.
Also trehalose can be purified from the plants or plant parts producing it subsequently used in an industrial process. In the food industries trehalose can be employed by adding trehalose to foods before drying. Drying of foods is an important method of preservation in the industry.
Trehalose seems especially useful to conserve food products through conventional air-drying, and to allow for fast reconstitution upon addition of water of a high quality product (Roser et al, July 1991, Trends in Food Science and Technology, pp. 166-169). The benefits include retention of natural flavors/fragrances, taste of fresh product, and nutritional value (proteins and vitamins). It has been shown that trehalose has the ability to stabilize proteins and membranes, and to form a chemically inert, stable glass. The low water activity of such thoroughly dried food products prevents chemical reactions, that could cause spoilage.
Field crops like corn, cassava, potato, sugar beet and sugarcane have since long been used as a natural source for bulk carbohydrate production (starches and sucrose). The production of trehalose in such crops, facilitated by genetic engineering of the trehalose-biosynthetic pathway into these plant species, would allow the exploitation of such
engineered crops for trehalose production.
All references cited in this specification are indicative of the level of skill in the arts to which the invention pertains. All publications, whether patents or otherwise, referred to previously or later in this specification are herein incorporated by reference as if each of them was individually incorporated by reference.
The Examples given below are just given for purposes of enablement and do not intend in any way to limit the scope of the invention.
EXPERIMENTAL DNA manipulations
All DNA procedures (DNA isolation from E.coli, restriction, ligation, transformation, etc.) are performed according to standard protocols (Sambrook et al. (1989) Molecular Cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, CSH, New York).
Strains
In all examples E.coli K-12 strain DH5α is used for
cloning. The Agrobacterium tumefaciens strain used for plant transformation experiments is MOGlOl which is a non-oncogenic octopine type helper strain derived form LBA1010 (Koekman et al. (1982) Plasmid 7, 119) by substitution of the T-DNA by a spectinomycin resistance marker. Construction of Agrobacterium strain MOGlOl
A binary vector system (Hoekema A., Hirsch, P.R.,
Hooykaas, P.J.J., and Schilperoort, R.A. (1983) Nature 303, 179) is used to transfer gene constructs into potato plants. The helper plasmid conferring the Agrobacterium tumefaciens virulence functions is derived from the octopine Ti-plasmid pTiB6. MOG101 is an Agrobacterium tumefaciens strain carrying a non-oncogenic Ti-plasmid (Koekman et al. 1982, supra) from which the entire T-region is deleted and substituted by a bacterial Spectinomycin resistance marker from transposon Tn1831 (Hooykaas et al.. 1980 Plasmid A., 64-75).
The Ti-plasmid pTiB6 contains two adjacent T-regions, TL (T-left) and TR (T-right). To obtain a derivative lacking the TL- and TR-regions, we constructed intermediate vector pMOG579. Plasmid pMOG579 is a pBR322 derivative which
contains 2 Ti-plasmid fragments homologous to the fragments located left and right outside the T-regions of pTiB6 (shaded in Figures 8 and 9). The 2 fragments are separated in pMOG579 by a 2.5 kb BamHI - HindIII fragment from transposon Tnl831 (Hooykaas et al., 1980 Plasmid 4, 64-75) carrying the
spectinomycin resistance marker (Figure 9). The plasmid is introduced into Agrobacterium tumefaciens strain LBA1010
[C58-C9 (pTiB6) = a cured C58 strain in which pTiB6 is introduced (Koekman et al. (1982), supra), by triparental mating from E.coli. using HB101 8pRK2013 as a helper.
Transconjugants are selected for resistance to Rifampicin (20 mg/1) and spectinomycin (250 mg/l). A double recombination between pMOG579 and pTiB6 resulted in loss of carbenicillin resistance (the pBR322 marker) and deletion of the entire T-region. Of 5000 spectinomycin resistant transconjugants replica plated onto carbenicillin (100 mg/1) 2 are found sensitive. Southern analysis (not shown) showed that a double crossing over event had deleted the entire T-region. The resulting strain is called MOG101. This strain and its construction is analogous to strain GV2260 (Deblaere et al. 1985, Nucl. Acid Res. 13, 4777-4788).
An alternative helper strain for MOG101 is e.g. LBA4404; this strain can also suitably be used for introduction of a binary plasmid, such as pMOG799 and subsequent plant
transformation. Other suitable helper strains are readily available.
Construction of the expression vector PMOG180
The expression vector pMOG18O is a derivative of pMOG18 (EP 0 479 359 Al, Example 2b) wherein the gene coding for GUS is removed and other genes can be inserted between the AlMV RNA4 leader and 3' nos terminator as a BamHI fragment.
For this purpose, the EcoRI/NcoI fragment from pMOG18, containing the 35S promoter and AlMV RNA4 leader sequences is synthesized using PCR technology with the primer sets 5' GTTTCTACAGGACGGAGGATCCTGGAAGTATTTGAAAGA 3' and 5'
CAGCTATGACCATGATTACG 3' thus mutating the NcoI site into a BamHI site. pMOG18 vector is then cut with EcoRI and BamHI after which the newly synthesized EcoRI/BamHI fragment can be ligated between these restriction sites. To circumvent PCR-induced random mutations in the promoter sequences, the
EcoRI/EcoRV fragment in the PCR synthesized EcoRI/BamHI
fragment is replaced by wildtype sequences from pMOG18. The short EcoRV/BamHI is checked for mutations by sequencing. The resulting expression vector is plasmid pMOG180 (Figure 10).
Triparental matings
The binary vectors pMOG663-666 are mobilized in triparental matings with the E. coli strain HB101 containing plasmid PRK2013 (Ditta G., Stanfield, S., Corbin, D., and Helinski, D.R. et al. (I960) Proc. Natl. Acad. Sci. USA 77, 7347) into Agrobacterium tumefaciens strain MOG101 and used for
transformation.
Transformation of potato
Potato (Solanum tuberosum cv. Desiree) is transformed with the Agrobacterium tumefaciens strain MOGlOl containing the binary vector of interest as described (Hoekema A., Huisman, M.J., Molendijk, L., Van den Elzen, P.J.M., and Cornelissen, B.J.C. (1989) Bio/technology 7, 273). The basic culture medium is MS30R30, consisting of MS-medium (Murashige, T., and Skoog, F. (1962) Physiol. Plan. 14, 473), supplemented with 30 g/L sucrose, R3 vitamins (Ooms et al. G., Burrell, M.M., Karp, A., Bevan, M., and Hille, J. (1987) Theor. Appl. Genet. 73, 744), 5 μM zeatin riboside (ZR), and 0.3 μM indole acetic acid (IAA). The media are solidified where necessary, with 0.7 g/L Daichin agar.
Tubers of Solanum tuberosum cv. Desiree are peeled and surface sterilized for 20 minutes in 0.6% hypochlorite solution containing 0.1% Tween-20. The potatoes are washed thoroughly in large volumes of sterile water for at least 2 hours. Discs of approximately 2 mm thickness are sliced from cylinders of tuber tissue prepared with a corkbore. Discs are incubated for 20 minutes in a suspension consisting of the MS30R3 medium without ZR and IAA, containing 106-107
bacteria/ml of Agrobacterium MOG101 containing the binary vector. The discs are subsequently blotted dry on sterile filter paper and transferred to solid MS30R3 medium with ZR and IAA. Discs are transferred to fresh medium with 100 mg/L cefotaxim and 50 mg/L vancomycin after 2 days. A week later, the discs are transferred again to the same medium, but this time with 100 mg/L kanamycin to select for transgenic shoots. After 4-8 weeks, shoots emerging from the discs are excised and placed onto rooting medium (MS30R3-medium without ZR and IAA, but with 100 mg/L cefotaxim and 100 mg/L kanamycin). The shoots are propagated axenically by meristem cuttings and transferred to soil after root development. Where
appropriate, 10 mg/L hygromycin is used for selection instead of 100 rag/L kanamycin.
Trehalose assay
Trehalose is determined essentially as described by Hottiger et al. (Hottiger et al. (1987) J. Bact. 169, 5518) . Potato tuber tissue is frozen in liquid nitrogen, powdered with pestle and mortar and subsequently extracted for 60 minutes at room temperature in app. 3 volumes of 500 mM
trichloroacetic acid. After centrifugation the pellet is extracted once more in the same way. The combined
supernatants from the two extractions are assayed for
anthrone positive material (Spiro R.G. (1966) Meth. Enzymol. 8, 3). Trehalose is determined qualitatively by TLC. The extracts are deionized (Merck, Ion exchanger V) and loaded onto Silica Gel 60 plates (Merck). After chromatography plates are developed with n-butanol-pyridine-water (15:3:2, v/v). Spots are visualized by spraying with 5 mg/ml vanillin in concentrated H2SO4 and heating at 130°C. Commercially available trehalose (Sigma) is used as a standard. Enzyme assays
In all determinations non-transgenic tuber material of variety Desiree is used as control. Protein content in all samples is determined as described by Bradford (Bradford (1976) Anal. Biochem. 72, 248). For assays on tuber extracts, frozen potato tuber slices of app. 100 mg are homogenized in 100 μl 20 mM HEPES pH 7.4, centrifuged (Eppendorf, 5 minutes at maximum speed). The supernatant is used for activity assays.
TPS activity - TPS activity is determined essentially as described by Hottiger et al. (Hottiger T., Schmutz, P., and Wiemken, A. (1987) J. Bact. 169, 5518). Tuber extract assay mixtures contained 50 mM tricine (K+) pH 7.0, 10 mM glucose6-phosphate, 5mM UDP-glucose, 12.5 mM MgCl2, in a total volume of 0.4 ml. In controls glucose-6-phosphate is omitted. Assay mixtures are incubated at 37°C for 5-30 min. The reaction is stopped by addition of 0.2 ml ice-cold 1 N perchloric acid. After neutralization with 0.2 ml 1 N KOH, the samples are stored on ice for 10 minutes and subsequently centrifuged at 2,000 × g. UDP is determined in the
supernatants. The assay mixture contained 140 mM tricine (K+) pH 7.6, 2 mM phosphoenolpyruvate, 0.31 mM NADH, 20 U lactate dehydrogenase from rabbit muscle (Sigma Type XXXIX) in a total volume of 1.96 ml. The reaction is started by addition of 20 U pyruvate kinase from rabbit muscle (Sigma Type III). The decrease of the absorbance at 340 nm at 37°C is used to calculate the UDP concentration. One unit of TPS activity is defined as nmol UDP formed per min at 37°C.
AGPase activity - AGPase activity is determined as described by Mύller-Rόber et al. (Mύller-Rόber B. , Sonnewald, U., and Willmitzer, L. (1992) EMBO J. 11, 1229). Production of glucose-1-phosphate from ADP-glucose is determined in a NAD- linked glucose-6-phosphate dehydrogenase system. The reaction assay contained 80 mM HEPES pH 7.4, 10 mM MgCl2, 1 mM ADP-glucose, 0.6 mM NAD, 10 μM glucose-1, 6-diphosphate, 3 mM DTT, 0.02% bovine serum albumin, 1 U phosphoglucomutase from rabbit muscle (Sigma), 2.5 U NAD-linked glucose-6-phosphate dehydrogenase from Leuconostoc mesenteroides and tuber extract. The reaction is initiated by addition of
sodiumpyrophosphate to a final concentration of 2 mM. NAD reduction is measured spectrophotometrically at 340 nm and 30°C. A unit of AGPase activity is defined as nmol glucose-1-phosphate generated per min at 30°C.
SPS activity - SPS activity is determined essentially as described by Lunn & ApRees (Lunn and ApRees (1990) Phytochem. 29, 1057). Assay mixtures contained 50 mM tricine (K+) pH 7.0, 5 mM fructose-6-phosphate, 5mM UDP-glucose, 12.5 mM MgCl2, tuber extract, and water in a total volume of 0.4 ml. In controls fructose-6-phosphate is omitted. Assay mixtures are incubated at 25°C for 5-30 min. The reaction is stopped by addition of 0.2 ml ice-cold 1 N perchloric acid. After neutralization with 0.2 ml 1 N KOH, the samples are stored on ice for 10 minutes and subsequently centrifuged at 2,000 x g. UDP is determined in the supernatants. The assay mixture contained 140 mM tricine (K+) pH 7.6, 2 mM
phosphoenolpyruvate, 0.31 mM NADH, 20 U lactate dehydrogenase from rabbit muscle (Sigma Type XXXIX) in a total volume of 1.96 ml. The reaction is started by addition of 20 U pyruvate kinase from rabbit muscle (Sigma Type III). The decrease of the absorbance at 340 nm at 37°C is used to calculate the UDP concentration. One unit of SPS activity is defined as nmole UDP formed per min at 37°C.
EXAMPLE I
Cloning of the Escherichia coli otsA gene In E.coli trehalose phosphate synthase (TPS) is encoded by the otsA gene located in the operon otsBA. The location and the direction of transcription of this operon on the E.coli chromosome are precisely known (Kaassen I., Falkenberg, P., Styrvold, O.B., and Strom, A.R. (1992) J. Bact. 174, 889). It is located in the 41-42' region of the E.coli chromosome, and is confined on a 2.9 kb HindIII fragment on EMBL4 genomic clone designated 7F11 of the map by Kohara et al. (Kohara Y., Akiyama, K. and Isono, K. (1987) Cell 50, 495). The position of the otsBA operon on this clone 7F11 is shown in Figure 2. DNA is prepared from a lysate of lclone 7F11, and digested with HindIII. We isolated the 2.9 kb HindIII fragment
containing otsBA (the 'righthand' HindII-site at 14.3 kb in the insert is omitted on the map by Kohara, as already noticed by Kaassen). The 2.9 kb HindIII-fragment is cloned in pUC18 linearized with HindIII. From the resulting plasmid an EcoRV/HindIII fragment of 2.1 kb containing the otsA gene is isolated, it is made blunt using Klenow polymerase and then cloned in vector pMOG180 linearized with BamHI and made blunt using Klenow polymerase. The resulting expression plasmid contained the E. coli otsA gene in the correct orientation under control of the Cauliflower Mosaic Virus (CaMV) 35S promoter with double enhancer (Guilley H. , Dudley, R.K., Jonard, G., Balazs, E., and Richards, K.E. (1982) Cell 30, 763), the Alfalfa Mosaic Virus (AlMV) RNA4 leader sequence (Brederode et al. F.T., Koper-Zwarthoff, E.C., and Bol, J.F. (1960) Nucl. Acids Res. 8, 2213) and the nopaline synthase transcription terminator sequence from Agrobacterium
tumefaciens. The expression cassette is cloned as an
EcoRI/HindIII fragment into the binary vector pMOG23
(deposited on January 29, 1990 at the Centraal Bureau voor Schimmelcultures under accession number 102.90) The resulting binary vector pMOG663 (see Figure 3) is used to transform potato.
Example II
Trehalose production in potato tubers transformed with
PMOG663.
Potato tuber discs are transformed with the binary vector pMOG663. Transgenic shoots are selected on kanamycin. A number of 20 independent transgenic shoots containing the plant expressible E.coli TPS-construct are analyzed for trehalose phosphate synthase (TPS) activity. Shoots found to contain the enzyme are grown to mature plants. Mature tubers of those transgenic potato plants, analyzed for trehalose, are found to contain elevated levels of trehalose in
comparison with non-transgenic control plants. Transgenic plant line 663.1 is propagated for further work. Example III
Construction of pMOG664
Two oligonucleotides corresponding to the cDNA sequence of the small subunit of ADP-glucose pyrophosphorylase (AGPase) from potato tuber (EMBL data bank accession number X61186) are synthesized. The sequences are as follows:
5' TCCCCATGGAATCAAAGCATCC 3' (SEQIDNO: 4)
5' GATTGGATCCAGGGCACGGCTG 3' (SEQIDNO: 5) The oligonucleotides are designed to contain suitable restriction sites (BamHI and Ncol, underlined) at their termini to allow assembly in an expression cassette in an antisense orientation. A fragment of about 1 kb is PCR amplified with these oligonucleotides using DNA isolated from a cDNA library from potato cv. Desiree prepared from 2 month old leaf tissue (Clontech) as a template. After sequencing it can be shown, that the fragment is identical with the AGPase sequence deposited in the EMBL data bank. Following digestion with BamHI and Ncol, the fragment is cloned in pM0G18 linearized with BamHI and Ncol. From the resulting plasmid the 1.85 kb EcoRI/BamHI fragment is isolated (containing the CaMV 35S promoter, the AlMV RNA4 leader and the AGPase fragment in an antisense orientation) as well as the 0.25 kb BamHI/HindIII fragment containing the nos-terminator. These two fragments are cloned in a three-way ligation with the binary vector pMOG22 linearized with EcoRI and HindIII. The binary vector pMOG22 contains a plant expressible HPTII gene for hygromycin selection in transgenic plants (pMOG22 has been deposited at the Centraal Bureau voor Schimmelcultures on January 29, 1990 under accession number 101.90). The resulting binary vector pMOG664 (see Figure 4) is used for potato transformation.
Example IV
Construction of pMOG665
A set of oligonucleotides complementary to the sequence of the maize sucrose phosphate synthase (SPS) cDNA (Worrell A.C., Bruneau, J-M., Summerfelt, K., Boersig, M., and
Voelker, T.A. (1991) Plant Cell 3, 1121) is synthesized. Their sequences are as follows:
5' CTAGGTCGTGATTCTGATACAGGTGGCCAGGTG 3' (SEQIDNO: 6)
5' CAGCATCGGCATAGTGCCCATGTATCACGTAAGGC 3' (SEQIDNO: 7)
These oligonucleotides are used to PCR amplify a DNA fragment of 370 bp using DNA isolated from a potato cv. Desiree cDNA library prepared from 2 month old leaf tissue (Clontech) as a template. After sequencing of this fragment it can be shown that it is highly complementary to the SPS sequence of maize (see Figure 5, and Worrell et al. (1991) Plant Cell 3, 1121). The PCR amplified fragment is made blunt-ended and cloned in pM0G18 linearized with Ncol and BamHI and made blunt-ended with Klenow polymerase. From a clone with the SPS fragment in the antisense orientation with respect to the CaMV 35S promoter, the EcoRI/HindIII fragment is cloned into the binary vector pMOG22 linearized with EcoRI, in a three-way ligation using a synthetic adapter with the following
sequence:
5' AGCTTCCCCCCCG 3' (SEQIDNO: 16)
¦ ¦ ¦ ¦ ¦ ¦ ¦ ¦ ¦
3' AGGGGGGGCTTAA 5' (SEQIDNO: 17)
The resulting binary vector pMOG665 (see Figure 6) is used for potato transformation. Example IV
Construction of pMOG666
The EcoRI fragment of plasmid pM0G665 containing the
antisense SPS cassette, is cloned in the binary, vector pMOG664 (containing the antisense AGPase cassette) linearized with EcoRI. The resulting binary vector carrying the two anti-sense constructs is called pM0G666 (see Figure 7) .
Example V
Trehalose production in potato transformed with pMOG663 and
PMOG664
Potato tuber discs of kanamycin resistant transgenic plant line 663.1, expressing TPS (example II) are transformed with the binary vector pMOG664, containing the antisense AGPase construct. Transgenic shoots are selected on 10 mg/L hygromycin. Transgenic shoots are recovered, and checked by PCR for the presence of both pMOG663 and pMOG664 sequences. Transgenic plants containing the plant expressible E. coli TPS construct and the antisense AGPase construct are analyzed for TPS and AGPase activity.
Analysis of transgenic tubers for AGPase activity shows reductions in activity levels in individual transgenic lines in comparison with non-transgenic controls. Northern blotting shows that also mRNA levels for AGPase are reduced in the transgenic plants compared to those in non-transgenic control plants. Trehalose levels in tubers of transgenic potato plants, found to exhibit TPS activity, and having reduced levels of AGPase, show an increase in comparison with the levels that can be found in tubers of transgenic plant line 663.1.
Example VI
Trehalose production in potato transformed with pMOG663 and
PMOG665
Potato tuber discs of transgenic plant line 663.1 expressing TPS are transformed with the binary vector pMOG665,
containing the antisense SPS construct. Transgenic shoots are selected on 10 mg/L hygromycin. Emerging shoots are checked by PCR for the presence of both pMOG663 and pMOG665
sequences. Transgenic shoots containing the plant expressible E. coli TPS construct and the antisense SPS construct are analyzed for TPS and SPS activity. Analysis of transgenic tubers for SPS activity shows
reductions in the levels for both enzymes in individual transgenic lines in comparison with non-transgenic controls. Northern blotting shows that also mRNA levels for SPS are reduced in the transgenic plants compared to those in non- transgenic control plants. Trehalose levels in tubers of transgenic potato plants, found to exhibit TPS activity, and having reduced levels of SPS, show an increase in comparison with the levels found in tubers of transgenic plant line 663.1. Example VII
Trehalose production in potato transformed with pMOG663 and
PMOG666
Potato tuber discs of transgenic plant line 663.1 expressing TPS are transformed with the binary vector pMOG666,
containing the two antisense AGPase and SPS constructs.
Transgenic shoots are selected on 10 mg/L hygromycin.
Emerging shoots are checked by PCR for the presence of the plant expressible E. coli TPS construct, and the antisense AGPase and SPS construct. Positive shoots are analyzed for TPS, AGPase and SPS activity.
Analysis of transgenic tubers for AGPase and SPS activity shows reductions in the levels for both enzymes in individual transgenic lines in comparison with non-transgenic controls. Northern blotting shows that also mRNA levels are reduced in the transgenic plants compared to those in non-transgenic control plants. Trehalose levels in tubers of transgenic potato plants, found to exhibit TPS activity, and having reduced levels of AGPase and SPS, show an increase in
comparison with the levels found in tubers of transgenic plant line 663.1. The following examples describe the identification of the nucleotide sequence encoding a full length E.coli trehalose phosphate synthase activity. The amino acid sequence of the complete E. coli TPS is also disclosed. Example VIII
Cloning of a full length E. coli otsA gene In E.coli trehalose phosphate synthase (TPS) is encoded by the otsA gene located in the operon otsBA. The location and the direction of transcription of this operon on the E.coli chromosome are known (Kaasen, I., Falkenberg, P., Styrvold, O.B., and Strom, A.R. (1992) J. Bact. 174. 889). The otsA gene is located at 42 , and according to Kaasen et al. confined on a 18.8 kb fragment present in the EMBL4 genomic clone designated 7F11 of the map by Kohara et al. (Kohara, Y., Akiyama, K., and Isono, K. (1987) Cell 50, 495). DNA prepared from a lysate of lambda clone 7F11, and digested with HindIII. The isolated 2.9 kb HindIII fragment (the 'right-hand' HindIII site at 14.3 kb in the insert was omitted on the map by Kohara et al., as already noticed by Kaasen et al.) is cloned in pUC18 linearized with HindIII. The 2.9 kb HindIII insert from the resulting plasmid, designated pMOG674, is sequenced. The sequence is found to contain part of the araH gene of the arabinose transport operon (Scripture, J.B., Voelker, C. , Miller, S., O' Donnell, R.T., Polgar, L., Rade, J., Horazdovsky, B.F., and Hogg, R.W. (1987) J. Mol. Biol. 197, 37), the otsB gene encoding TPP as localized by Kaasen et al. and part of the otsA gene encoding TPS. The otsA is found not to be confined to the 2.9 kb HindIII fragment as described by Kaasen et al. To complete the sequence an overlapping BamHI/EcoRI fragment is isolated and partially sequenced. The complete TPS-encoding sequence of the otsA gene is shown in Figure 11 (SEQIDNO: 2) . The position of the otsA gene on clone 7F11, with the restriction enzyme sites used, is shown in Figure 12. An additional HindIII site not present on the map published by Kohara et al. is found on the 'left-hand' site of the 2.9 kb HindIII fragment.
The HindIII site in pMOG18O is replaced by a SstI site, by cloning the oligonucleotide duplex:
SstI
5' AGCTCACGAGCTCTCAGG 3' (SEQIDNO: 8)
3' GTGCTCGAGAGTCCTCGA 5' (SEQIDNO: 9) into pMOG180 cut with HindIII. The resulting vector is designated pM0G746. The oligonucleotide duplex:
BamHI SphI HindIII
¦ smal ¦ ¦ BamHI
¦ ¦ ¦ ¦ ¦
5' GATCCCCCGGGGCATGCAAGCTTG 3' (SEQIDNO: 10)
3' GGGGCCCCGTACGTTCGAACCTAG 5' (SEQIDNO: 11) is cloned in vector pMOG746 linearized with BamHI. The vector with the oligonucleotide duplex in the desired orientation (checked by restriction enzyme digestion) is designated PMOG747. The 2.9 kb HindIII fragment of plasmid pMOG674 is cloned in pMOG747 linearized with HindIII, resulting in vector pMOG748. The app. 2.4 kb EcoRV/SstI and the app. 3.5 kb Sstl/Smal fragments of pMOG748 are isolated, ligated and transformed into IL. coli, thus deleting the 3' end of the 2.9 kb HindIII fragment. The resulting plasmid is designated pMOG749. The 5' end of the otsA gene is synthesized by PCR using the synthetic oligonucleotides TPS1 and TPS2 with PMOG749 as a template.
TPS1 5' GAGAAAATACCCGGGGTGATGAC 3' (SEQIDNO: 12)
TPS2 5" GATAATCGTGGATCCAGATAATGTC 3' (SEQIDNO: 13)
By sequencing it is confirmed that the 0.4 kb PCR fragment has the correct sequence. The 1 kb BamHI/HindIII fragment of pMOG749 is cloned together with the 0.4 kb Xmal/BamHI PCR fragment in pMOG747 linearized with Xmal and HindIII. In the resulting plasmid, digested with HindIII and SstI, the synthetic oligonucleotide duplex TPS6/7 is cloned, encoding the three C-terminal amino acids of TPS.
LysLeuAlaStop
5' AGCTGGCGTGAGGAGCGGTTAATAAGCTTGAGCT 3' (SEQIDNO: 14)
3' CCGCACTCCTCGCCAATTATTCGAAC 5' (SEQIDNO: 15)
In the resulting plasmid, digested with HindIII and SstI, the 0.25 kb HindIII/SstI fragment of plasmid pMOG749 is cloned, comprising the terminator from the Agrobacterium tumefaciens nopaline synthase (NOS) gene, resulting in plasmid pMOG798. This plasmid contains the E. coli otsA gene in the correct orientation under control of the Cauliflower Mosaic Virus (CaMV) 35S promoter with double enhancer (Guilley et al. (1982) Cell 30, 763), the Alfalfa Mosaic Virus (AMV) RNA4 leader sequence (Brederode et al. (1980) Nucl. Acids Res. 8, 2213) and the nopaline synthase transcription terminator sequence from Agrobacterium tumefaciens. The entire expression cassette is cloned as a 2.5 kb EcoRI/SstI fragment into the binary vector pMOG23 linearized with EcoRI and SstI. The resulting binary vector, pM0G799 (Fig. 13), is used to transform potato (An E. coli strain harbouring pMOG799 has been deposited at the Centraal Bureau voor Schimmelcultures, Phabagen collections, Padualaan 8, Utrecht, The Netherlands, on August 23, 1993, deposit number CBS 430.93).
Example IX
Trehalose production in potatoes transformed with pMOG799 Potato tuber discs are transformed with the binary vector pMOG799 using Agrobacterium tumefaciens. Transgenic shoots are selected on kanamycin. A number of 20 independent transgenic shoots are analyzed for trehalose phosphate synthase (TPS) activity. Shoots found to contain the enzyme are grown to mature plants. Analyses of mature tubers of those transgenic potato plants show elevated levels of trehalose in comparison with non-transgenic control plants. Transgenic plant line MOG799.1 is propagated for further work.
Example X
Construction of pMOG664
Two oligonucleotides corresponding to the cDNA sequence of the small subunit of ADP-glucose pyrophosphorylase (AGPaseB) from potato tuber cv. Desiree (Müller-Röber, B., Kossmann, J., Hannah, L.C., Willmitzer, L., and Sonnewald, U. (1990) Mol. Gen. Genet. 224, 136-146) are synthesized:
5' TCCCCATGGAATCAAAGCATCC 3' (SEQIDNO: 4)
5' GATTGGATCCAGGGCACGGCTG 3' (SEQIDNO: 5)
The oligonucleotides are designed to contain suitable restriction sites (BamHI and NcoI, underlined) at their termini to allow assembly in an expression cassette in an antisense orientation after digestion with these enzymes. A fragment of about 1 kb is PCR amplified with these oligonucleotides using DNA isolated from a cDNA library from potato cv. Desiree prepared from 2 month old leaf tissue (Clontech) as a template. By sequencing it is shown, that the fragment is identical with the AGPase B sequence from potato cv. Desiree (Mύller-Rόber, B., Kossmann, J., Hannah, L.C., Willmitzer, L., and Sonnewald, U. (1990) Mol. Gen. Genet. 224, 136-146). Following digestion with BamHI and Ncol, the fragment is cloned in pMOG18 linearized with BamHI and Ncol. From the resulting plasmid the l.85 kb EcoRI/BamHI fragment (containing the CaMV 35S promoter, the AMV RNA4 leader and the AGPase fragment in an antisense orientation), as well as the BamHI/HindIII fragment containing the terminator from the nopaline synthase (NOS) gene from Agrobacterium tumefaciens are cloned in a three-way ligation in the binary vector pMOG22 linearized with EcoRI and HindIII. The binary vector pMOG22 contains a plant expressible HPTII gene for hygromycin selection in transgenic plants (pMOG22 has been deposited at the Centraal Bureau voor Schimmelcultures on January 29, 1990 under accession number 101.90). The resulting binary vector pMOG664 (Fig. 4) is used for potato transformation.
Example XI
Construction of pMOGδOl
A set of oligonucleotides complementary to the sequence of the maize sucrose phosphate synthase (SPS) cDNA (Worrell, A.C., Bruneau, J-M., Summerfalt, K., Boersig, M. , and Voelker, T.A. (1991) Plant Cell 3, 1121) is synthesized. Their sequences are as follows:
5' CTAGGTCGTGATTCTGATACAGGTGGCCAGGTG 3' (SEQIDNO: 6)
5' CAGCATCGGCATAGTGCCCATGTATCACGTAAGGC 3' (SEQIDNO: 7)
These oligonucleotides are used to PCR amplify a DNA fragment of 370 bp using DNA isolated from a potato cv. Desiree cDNA library prepared from 2 month old leaf tissue (Clonteσh) as a template. By sequencing of this fragment it is shown, that it is homologous to the SPS sequence of maize (see Figure 4, and Worrell et al. (1991). The PCR fragment is used to screen a lambda gt10 library of potato cv. Desiree cDNA library prepared from 2 month old leaf tissue (Clontech). The insert of one positively hybridizing clone is sequenced. The sequence of the 654 bp DNA fragment is found to be 65% identical with the corresponding part of the maize SPS sequence (Starting at nucleotide number 349 in Figure 11 in Worrell et al. (1991). The EcoRI insert of this clone is cloned in pMOG180 digested with BamHI, in a three-way ligation with the following synthetic oligonuclotide duplex.
5' GATCGTCAGATCTAGC 3' (SEQIDNO: 14)
3' CAGTCTAGATCGTTAA 5' (SEQIDNO: 15)
The plasmid, having the SPS fragment in the antisense orientation with respect to the CaMV 35S promoter, is designated pMOG787. The EcoRI/HindIII fragment of plasmid pMOG787 is cloned in a three-way ligation with a synthetic linker:
5' AGCTTCCCCCCCG 3' (SEQIDNO: 16)
3' AGGGGGGGCTTAA 5' (SEQIDNO: 17) into the binary vector pMOG22 linearized with EcoRI. The binary vector pMOG22 contains a plant expressible HPTII gene for hygromycin selection in transgenic plants (pMOG22 has been deposited at the Centraal Bureau voor Schimmelcultures on January 29, 1990 under accession number 101.90). The resulting binary vector pMOG8Ol (Fig. 14) is used for potato transformation.
Example XII
Construction of pMOG602
The EcoRI fragment of plasmid pMOG801, containing the antisense SPS expression cassette, is cloned in the binary vector pMOG664 (containing the antisense AGPase cassette), linearized with EcoRI. The resulting binary vector is called pMOG802 (Fig 15).
Example XIII
Trehalose production in potato transformed with PM0G799 and
PMOG664
Potato tuber discs of kanamycin resistant plant line MOG799.1, expressing TPS (Example IX) are transformed with the binary vector pMOG664, containing the antisense AGPase expression cassette. Transgenic shoots, selected on 10 mg/L hygromycin, are analyzed for the presence of the TPS and antisense AGPase sequences by PCR. Transgenic plants containing both are analyzed for TPS and AGPase activity.
By analysis of transgenic tubers for AGPase activity it is shown that, reductions in activity levels in individual transgenic lines in comparison with non-transgenic controls occur. By Northern blots it is shown, that mRNA levels for AGPase are reduced in the transgenic plants compared to those in non-transgenic control plants. Trehalose levels in tubers of transgenic potato plants, found to exhibit TPS activity, and having reduced levels of AGPase, show an increase in comparison with the levels found in tubers of transgenic plant line MOG799.1.
Example XIV
Trehalose production in potato transformed with PMOG799 and
PMOG801
Potato tuber discs of kanamycin resistant plant line MOG799.1, expressing TPS (Example IX) are transformed with the binary vector pMOG8Ol, containing the antisense SPS expression cassette. Transgenic shoots, selected on 10 mg/L hygromycin, are analyzed for the presence of the TPS and antisense SPS sequences by PCR. Transgenic plants containing both are analyzed for TPS and SPS activity.
By analysis of transgenic tubers for SPS activity it is shown that reductions in activity levels in individual transgenic lines in comparison with non-transgenic controls occur. By Northern blots it is shown, that mRNA levels for SPS are reduced in the transgenic plants compared to those in nontransgenic control plants. Trehalose levels in tubers of transgenic potato plants, found to exhibit TPS activity, and having reduced levels of SPS, show an increase in comparison with the levels found in tubers of transgenic plant line MOG799.1. Example XV
Trehalose production in potato transformed with PM0G799 and
PMOG802
Potato tuber discs of kanamycin resistant plant line M0G799.1, expressing TPS (Example IX) are transformed with the binary vector pMOG802, containing the antisense SPS and AGPase expression cassettes. Transgenic shoots, selected on 10 mg/L hygromycin, are analyzed for the presence of the TPS, antisense AGPase and antisense SPS sequences by PCR. Transgenic plants containing all three constructs are analyzed for TPS, AGPase and SPS activity.
By analysis of transgenic tubers for AGPase and SPS activity it is shown, that reductions in the activity levels for both enzymes in individual transgenic lines in comparison with non-transgenic controls occur. By Northern blots it is shown that mRNA levels for AGPase and SPS are reduced in the transgenic plants compared to those in non-transgenic control plants. Trehalose levels in tubers of transgenic potato plants, found to exhibit TPS activity, and having reduced levels of SPS, show an increase in comparison with the levels found in tubers of transgenic plant line MOG799.1.
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT:
(A) NAME: MOGEN International N.V.
(B) STREET: Einsteiπweg 97
(C) CITY: IEIDEN
(D) STATE: Zuid-Holland
(E) COUNTRY: The Netherlands
(F) POSTAL CODE (ZIP) : NL-2333 CB
(G) TELEPHONE: (31) . (71) .256262
(H) TELEFAX: (31) . (71) .221471
(ii) TITLE OF INVENTION: PRODUCTION OF TREHAIDSE IN PLANTS
(iii) NUMBER OF SEQUENCES: 17
(iv) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFIWARE: PatentIn Release #1.0, Version #1.25 (EPO)
(v) CURRENT APPLICATION DATA:
APPLICATION NUMBER: TO PCT/EP93/02290
(2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 370 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA to iriRNA
(iii) HYPOTHETICAL: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Solanum tuberosum
(B) STRAIN: Desiree
(F) TISSUE TYPE: Leaf
(XI) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
CTAGGTCGTG ATTCTGATAC AGGTGGCCAG GTGAAGTA1G TAGTAGAGCT TGCTCGAGCA 60
CTTGCAAACA TGAAAGGAGT TCACCGAGTT GATCTCΠGA CTCGGCAGAT CACATCCCCA 120
GAGGTTGATT CTAGCEATGG TGAGCCAATT GAGATGCTCT CATGCCCATC TGATGCTTTG 180 GCTGCTGTGG TGCCTACTAT TOGGATCCCT GGGGACCAGG TGACAAGAIA TTCCAAAAGA 240 ATTTACATAC CAGAATTTGT TGATGGAGCA TTAAGCCACA TTCTGAATAT GGCAAGGGCT 300
ATAGGGGAGC AACTCAATGC TGGAAAAGCA GTGTGGCCTT ACGTGATACA TGGGCACTAT 360 GCCGATGCTG 370
(2) INFORMATICS FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGIH: 1446 base pairs
(B) TYPE: nucleic acid
(C) STRANDECNESS: double
(D) TOPOIOGY: linear
(ii) MDIECU1E TYPE: ENA (gencmic)
(iii) HYPOTHETICAL: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Escherichia coli
(vii) IMMEDIATE SOURCE:
(B) CUDNE: 7F11
(viii) POSITION IN GENCME:
(B) MAP POSITION: 41-42'
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 19..1446
(D) OTHER INFORMATION: /product= "trehalose phosphate synthase"
/gene= "otsA"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
GAGAAAATAA CAGGAGTG ATG ACT ATG ACT OCT TTA GTC GTA GTA TCT AAC 51
Met Thr Met Ser Arg Leu Val Val Val Ser Asn
1 5 10
CGG ATT GCA CCA CCA GAC GAG CAC GCC GCC ACT GCC GGT GGC CTT GCC 99 Arg Ile Ala Pro Pro Asp Glu His Ala Ala Ser Ala Gly Gly Leu Ala
15 20 25
GTT GGC ATA CTG GGG GCA CTG AAA GCC GCA GGC GGA CTG TGG TTT GGC 147 Val Gly Ile Leu Gly Ala Leu Lys Ala Ala Gly Gly Leu Trp Phe Gly
30 35 40
TGG ACT GCT GAA ACA GGG AAT GAG GAT CAG CCG CTA AAA AAG CTG AAA 195 Trp Ser Gly Glu Thr Gly Asn Glu Asp Gln Pro Leu Lys Lys Val Lys
45 50 55
AAA GCT AAC ATT ACG TGG GCC TCT TTT AAC CTC AGC GAA CAG GAC CTT 243 Lys Gly Asn Ile Thr Trp Ala Ser Phe Asn Leu Ser Glu Gln Asp Leu
60 65 70 75 GAC GAA TAC TAC AAC CAA TTC TCC AAT GCC GTT CTC TGG CCC GCT TTT 291 Asp Glu Tyr Tyr Asn Gln Phe Ser Asn Ala Val Leu Trp Pro Ala Ehe
8O 65 90
CAT TAT CGG CTC GAT CTG GIG CAA TTT CAG CCT CCT GCC TGG GAC GGC 339 His Tyr Arg Leu Asp Leu Val Gln Fhe Gln Arg Pro Ala Trp Asp Gly
95 100 105
TAT CIA CGC GTA AAT GCG TTG CTG GCA GAT AAA TTA CTG CCG CTG TTG 387 Tyr Leu Arg Val Asn Ala Leu Leu Ala Asp Lys Leu Leu Pro Leu Leu
110 115 120
CAA GAC GAT GAC ATT ATC TGG ATC CAC GAT TAT CAC CTG TTG CCA TTT 435 Gln Asp Asp Asp Ile Ile Trp Ile His Asp Tyr His Leu Leu Pro Phe
125 130 135
GCG CAT GAA TTA CGC AAA CGG GGA CTG AAT AAT CGC ATT GCT TTC TTT 483 Ala His Glu Leu Arg Lys Arg Gly Val Asn Asn Arg Ile Gly Ehe Fhe
140 145 150 155
CTG CAT ATT CCT TTC CCG ACA CCS GAA ATC TTC AAC GCG CTG COG ACA 531 Leu His Ile Pro Fhe F>ro Thr Pro Glu Ile Phe Asn Ala Leu Σ>ro Thr
160 165 170
TAT GAC ACC TTG CTT GAA CAG CTT TCT GAT TAT GAT TTG CTG GCT TTC 579 Tyr Asp Thr Leu Leu Glu Gln Leu Cys Asp Tyr Asp Leu Leu Gly Fhe
175 180 185
CAG ACA GAA AAC GAT CCT CTG GCG TTC CTG GAT TGT CTT TCT AAC CIG 627 Gln Thr Glu Asn Asp Arg Leu Ala Ehe Leu Asp Cys Leu Ser Asn Leu
190 195 200
ACC CGC GTC ACG ACA CCT AGC GCA AAA AGC CAT ACA GCC TGG GGC AAA 675 Thr Arg Val Thr Thr Arg Ser Ala Lys Ser His Thr Ala Trp Gly Lys
205 210 215
GCA TTT CGA ACA GAA GTC TAC CCG ATC GGC ATT GAA CCS AAA GAA ATA 723 Ala Fhe Arg Thr Glu Val Tyr Pro Ile Gly Ile Glu Pro Lys Glu Ile
220 225 230 235
GCC AAA CAG GCT GCC GGG CCA CIG CCG CCA AAA CTG GCG CAA CTT AAA 771 Ala Lys Gln Ala Ala Gly F>ro Leu Pro Pro Lys Leu Ala Gln Leu Lys
240 245 250
GCS GAA CIG AAA AAC CTA CAA AAT ATC TTT TCT CTC GAA CGG CTG GAT 819 Ala Glu Leu Lys Asn Val Gln Asn Ile Hie Ser Val Glu Arg Leu Asp
255 260 265
TAT TCC AAA GCT TIG CCA GAG CGT TTT CTC GCC TAT GAA GCG TTG CTG 867 Tyr Ser Lys Gly Leu Pro Glu Arg Ehe Leu Ala Tyr Glu Ala Leu Leu
270 275 280
GAA AAA TAT CCG CAG CAT CAT GGT AAA ATT CCT TAT ACC CAG ATT GCA 915 Glu Lys Tyr Pro Gln His His Gly Lys Ile Arg Tyr Thr Gln Ile Ala
285 290 295 CCA ACG TOG CGT GCT GAT GTG CAA GCC TAT CAG GAT ATT CGT CAT CAG 963 Pro Thr Ser Arg Gly Asp Val Gln Ala Tyr Gln Asp Ile Arg His Gln
300 305 310 315
CTCGAAAATGAAGCTGGACGAATTAATGCT AAA TAC GGG CAA TIA GGC 1011 Leu Glu Asn Glu Ala Gly Arg Ile Asn Gly Lys Tyr Gly Gln Leu Gly
320 325 330
TGGACGCCGCTTTATTATTTGAATCAGCATTTTGACCCT AAA TTA CTG 1059 Trp Thr Pro Leu Tyr Tyr Leu Asn Gln His Ehe Asp Arg Lys Leu Leu
335 340 345
ATG AAA ATA TTC CGC TAC TCT GAC GTG GGC TTA GTG ACG CCA CTG CCT 1107 Met Lys Ile Fhe Arg Tyr Ser Asp Val Gly Leu Val Thr Pro Leu Arg
350 355 360
GAC GGG ATG AAC CTG GTA GCA AAA GAG TAT GTT GCT GCT CAG GAC CCA 1155 Asp Gly Met Asn Leu Val Ma Lys Glu Tyr Val Ala Ala Gln Asp Pro
365 370 375
GCC AAT CCG GGC GTT CTT GTT CTT TCG CAA TTT GCG GGA GCG GCA AAC 1203 Ala Asn Pro Gly Val Leu Val Leu Ser Gln Ehe Ala Gly Ala Ala Asn
380 365 390 395
GAG TTA ACG TCG GCG TTA ATT GIT AAC CCC TAC GAT CCT GAC GAA GTT 1251 Glu Leu Thr Ser Ala Leu Ile Val Asn Pro Tyr Asp Arg Asp Glu Val
400 405 410
GCA GCT GCG CTG GAT CCT GCA TTG ACT ATG TOG CTG GCG GAA CCT ATT 1299 Ala Ala Ala Leu Asp Arg Ala Leu Thr Met Ser Leu Ala Glu Arg Ile
415 420 425
TCC CGT CAT GCA GAA ATG CIG GAC GTT ATC GTG AAA AAC GAT AIT AAC 1347 Ser Arg His Ala Glu Met Leu Asp Val Ile Val Lys Asn Asp Ile Asn
430 435 440
CAC TGG CAG GAG TGC TTC AIT AGC GAC CTA AAG CAG ATA GTT COG CGA 1395 His Trp Gln Glu Cys Ehe Ile Ser Asp Leu Lys Gln Ile Val Pro Arg
445 450 455
AGC GCG GAA AGC CAG CAG CGC GAT AAA GTT GCT ACC TTT CCA AAG CTT 1443 Ser Ala Glu Ser Gln Gln Arg Asp Lys Val Ala Thr Ehe Fro Lys Leu
460 465 470 475
GCG 1446
Ala (2) INFORMATION FOR SEQ ID NO: 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 476 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIEΏCN: SEQ ID NO: 3:
Met Thr Met Ser Arg Leu Val Val Val Ser Asn Arg Ile Ala I>ro Pro 1 5 10 15
Asp Glu His Ala Ala Ser Ala Gly Gly Leu Ala Val Gly Ile Leu Gly
20 25 30
Ala Leu Lys Ala Ala Gly Gly Leu Trp Ehe Gly Trp Ser Gly Glu Thr
35 40 45
Gly Asn Glu Asp Gln Pro Leu Lys Lys Val Lys Lys Gly Asn Ile Thr 50 55 60
Trp Ala Ser Ehe Asn Leu Ser Glu Gln Asp Leu Asp Glu Tyr T"yr Asn 65 70 75 60 Gln Fhe Ser Asn Ala Val Leu Trp Pro Ala Fhe His Tyr Arg Leu Asp
65 90 95
Leu Val Gln Phe Gln Arg Pro Ala Trp Asp Gly Tyr Leu Arg Val Asn
100 105 110
Ala Leu Leu Ala Asp Lys Leu Leu Pro Leu Leu Gln Asp Asp Asp Ile
115 120 125
Ile Trp Ile His Asp Tyr His Leu Leu Pro Phe Ala His Glu Leu Arg 130 135 140
Lys Arg Gly Val Asn Asn Arg Ile Gly Ehe Ehe Leu His Ile Pro Phe 145 150 155 160 Pro Thr E>ro Glu Ile Ehe Asn Ala Leu Pro Thr Tyr Asp Thr Leu Leu
165 170 175
Glu Gln Leu Cys Asp Tyr Asp Leu Leu Gly Fhe Gln Thr Glu Asn Asp
180 185 190
Arg Leu Ala Ehe Leu Asp cys Leu Ser Asn Lsu Thr Arg Val Thr Thr
195 200 205
Arg Ser Ala Lys Ser His Thr Ala Trp Gly Lys Ala Ehe Arg Thr Glu 210 215 220
Val Tyr Pro Ile Gly Ile GluPro Lys Glu Ile Ala Lys Gln Ala Ala 225 230 235 240 Gly Pro Leu Pro Pro Lys Leu Ala Gln Leu Lys Ala Glu Leu Lys Asn
245 250 255
Val Gln Asn Ile Fhe Ser Val Glu Arg Leu Asp Tyr Ser Lys Gly Leu
260 265 270
Pro Glu Arg Phe Leu Ala Tyr Glu Ala Leu Leu Glu Lys Tyr Pro Gln 275 260 265
His His Gly Lys Ile Arg Tyr Thr Gln Ile Ala Pro Thr Ser Arg Gly
290 295 300
Asp Val Gln Ala Tyr Gln Asp Ile Arg His Gln Leu Glu Asn Glu Ala
305 310 315 320
Gly Arg Ile Asn Gly Lys Tyr Gly Gln Leu Gly Trp Thr Pro Leu Tyr
325 330 335
Tyr I_eu Asn Gln His Ehe Asp Arg Lys Leu Leu Met Lys Ile Fhe Arg
340 345 350
Tyr Ser Asp Val Gly Deu Val Thr Pro Leu Arg Asp Gly Met Asn Leu
355 360 365
Val Ala Lys Glu Tyr Val Ala Ala Gln Asp Pro Ala Asn Pro Gly Val
370 375 360
Leu Val Leu Ser Gln Ehe Ala Gly Ala Ala Asn Glu Leu Thr Ser Ala
385 390 395 400
leu Ile Val Asn Pro Tyr Asp Arg Asp Glu Val Ala Ala Ala Leu Asp
405 410 415
Arg Ala Leu Thr Met Ser Leu Ala Glu Arg Ile Ser Arg His Ala Glu
420 425 430
Met Leu Asp Val Ile Val Lys Asn Asp Ile Asn His Trp Gln Glu Cys
435 440 445
Phe Ile Ser Asp Leu Lys Gln Ile Val Pro Arg Ser Ala Glu Ser Gln
450 455 460
Gln Arg Asp Lys Val Ala Thr Phe Pro Lys Leu Ala
465 470 475
(2) INFORMATION FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs
(B) TYPE: nucleic acid
(C) STRANDECNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:
TCCCCATGGA ATCAAAGCAT CC 22 (2) INFORMATION FOR SEQ ID NO: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: YES (XI) SEQUENCE DESCRIPTION: SEQ ID NO: 5:
GATTGGATCC AGGGCACGGC TG 22
(2) INFORMATICS FOR SEQ ID NO: 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: YES
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:
CTAGGTCGTG ATTCTGATAC AGGTGGCCAG GTG 33
(2) INFORMATION FOR SEQ ID NO: 7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (gencmic)
(iii) HYPOTHETICAL: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:
CAGCATCGGC AIACTGCCCA TGTATCACGT AAGGC 35 (2) INFORMATION FOR SEQ ID NO: 8: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:
AGCTCACGAG CTCTCAGG 18
(2) INFORMATION FOR SEQ ID NO: 9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: YES
(Xi) SEQUENCE DESCRIPHON: SEQ ID NO: 9:
CTGCTOGAGA GTCCTOGA 18 (2) INFORMATICS FOR SEQ ID NO: 10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEENESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: YES
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:
GATOCCCOGG GGCATGCAAG CTTG 24
(2) INFORMATICS FOR SEQ ID NO: 11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11:
GGGGCCCCCT AOCTTCGAAC CTAG 24 (2) INFORMATICS FOR SEQ ID NO: 12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: YES
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12:
GAGAAAATAC COGGGGTGAT GAC 23
(2) INFORMATICS FOR SEQ ID NO: 13:
(i) SEQUENCE CHARACTERISTICS:
(A) IENGIH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYEE: cDNA
(iii) HYPOTHETICAL: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13:
GAIAATCGTG GATCCAGAIA ATGTC 25
(2) INFORMATICS FOR SEQ ID NO: 14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 16 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: YES
(Xi) SEQUENCE DESCRIPTICS: SEQ ID NO: 14:
GATCCTCAGA TCTAGC 16
(2) INFORMATICS FOR SEQ ID NO: 15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 16 base pairs
(B) TYPE: nucleic acid
(C) STRANDEENESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15:
CACTCTAGAT CGTTAA 16
(2) INFORMATICS FOR SEQ ID NO: 16:
(i) SEQUENCE CΗARACTERISTICS:
(A) LENGTH: 13 base pairs
(B) TYPE: nucleic acid
(C) STRANDEENESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYEE: cDNA
(iii) HYPOTHETICAL: YES (xi) SEQUENCE DESCRIPTICS: SEQ ID NO: 16:
AGCTTCCCCC CCG 13
(2) INPORMATION FOR SEQ ID NO: 17:
(i) SEQUENCE CHARACTERISTTCS :
(A) LENGTH: 13 base pairs
(B) TYPE: nucleic acid
(C) STRANDEENESS: single
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: YES
(Xi) SEQUENCE DESCRIFΩCS: SEQ ID NO: 17:
AGGGGGGGCT TAA 13

Claims

1. A plant expressible gene which when expressed in a plant or plant cell increases the trehalose content of said plant or plant cell.
2. A plant expressible gene according to claim 1 which comprises in sequence:
(a) a transcriptional initiation region that is functional in said plant host,
(b) a DNA sequence encoding a trehalose phosphate synthase activity, and optionally
(c) a transcriptional termination sequence that is functional in said plant host.
3. A DNA sequence containing a plant expressible gene which comprises in sequence:
(a) a transcriptional initiation region that is functional in said plant host,
(b) a DNA sequence encoding a trehalose phosphate synthase activity, and optionally
(c) a transcriptional termination sequence that is functional in said plant host,
and a plant expressible gene comprising in sequence:
(a) a transcriptional initiation region that is functional in said plant host,
(b) a DNA sequence encoding an RNA sequence at least partially complementary to an RNA sequence which encodes sucrose phosphate synthase enzyme (SPS) naturally occurring in said plant host, and optionally
(c) a transcriptional termination sequence that is functional in said plant host.
4. A DNA sequence comprising a plant expressible gene which comprises in sequence:
(a) a transcriptional initiation region that is functional in said plant host,
(b) a DNA sequence encoding a trehalose phosphate synthase activity, and optionally
(c) a transcriptional termination sequence that is functional in said plant host, and
a plant expressible gene comprising in sequence:
(a) a transcriptional initiation region that is functional in said plant host,
(b) a DNA sequence encoding an RNA sequence at least partially complementary to an RNA sequence which encodes a ADP-glucose pyrophosphorylase enzyme naturally occurring in said plant host, and optionally
(c) a transcriptional termination sequence that is functional in said plant host.
5. A DNA sequence comprising a plant expressible gene which comprises in sequence:
(a) a transcriptional initiation region that is functional in said plant host,
(b) a DNA sequence encoding a trehalose phosphate synthase activity, and optionally
(c) a transcriptional termination sequence that is functional in said plant host,
and a plant expressible gene comprising in sequence:
(a) a transcriptional initiation region that is functional in said plant host,
(b) a DNA sequence encoding an RNA sequence at least partially complementary to an RNA sequence which encodes a sucrose phosphate synthase enzyme naturally occurring in said plant host, and optionally
(c) a transcriptional termination sequence that is functional in said plant host,
and a plant expressible gene comprising in sequence:
(a) a transcriptional initiation region that is functional in said plant host,
(b) a DNA sequence encoding an RNA sequence at least partially complementary to an RNA sequence which encodes a
ADP-glucose pyrophosphorylase enzyme naturally occurring in sai plant host, and optionally (c) a transcriptional termination sequence that is functional in said plant host.
6. A vector suitable for cloning which comprises a plant expressible gene according to claim 1 or 2.
7. A vector suitable for cloning which comprises a DNA sequence of any one of the claims 3 to 5.
8. A vector according to claim 6 or 7 which is a binary vector.
9. A microorganism comprising a vector of any one of the claims 6 to 8.
10. The microorganism of claim 9 which is of the genus Agrobacterium.
11. A method for obtaining a plant capable of producing trehalose comprising the steps of,
(1) introducing into a recipient cell of a plant a plant expressible gene which when expressed in a plant or plant cell increases the trehalose content of said plant or plant cell,
and a plant expressible gene comprising in sequence:
(a) a transcriptional initiation region that is functional in said plant host,
(b) a DNA sequence encoding a selectable marker gene that is functional in said plant host, and optionally
(c) a transcriptional termination sequence that is functional in said plant host,
(2) generating a plant from a transformed cell under conditions that allow for selection for the presence of the selectable marker gene.
12. A recombinant plant DNA genome which contains a plant expressible trehalose phosphate synthase gene that is not naturally present therein.
13. A recombinant plant DNA genome which comprises
(a) a plant expressible gene encoding trehalose phosphate synthase, and
(b) a plant expressible gene capable of inhibiting the biosynthesis of a sucrose phosphate synthesis activity.
14. A recombinant plant DNA genome which comprises:
(a) a plant expressible gene encoding trehalose phosphate synthase,
(b) a plant expressible gene capable of inhibiting the biosynthesis of an ADP-Glucose pyrophosphorylase activity.
15. A recombinant plant DNA genome which comprises:
(a) a plant expressible gene encoding trehalose phosphate synthase,
(b) a plant expressible gene capable of inhibiting the biosynthesis of an ADP-Glucose pyrophosphorylase activity, and
(c) a plant expressible gene capable of inhibiting the biosynthesis of an sucrose phosphate synthesis activity.
16. A plant cell having a recombinant plant DNA genome of any one of the claims 12 to 15.
17. The plant cell of claim 16 which contains increased levels of trehalose compared with a plant cell of the same species having a non-recombinant plant DNA genome.
18. A plant cell culture comprising plant cells of any one of the claims 16 or 17.
19. A method for the production of trehalose comprising the steps of:
(1) growing in culture plant cells which by virtue of a recombinant plant DNA genome are capable of producing (increased levels of) trehalose,
(2) isolating the trehalose from the said plant cell culture.
20. The method of claim 19 wherein the plant cell culture is that of claim 18.
21. A plant containing a cell of any one of the claims 16 to 17.
22. A plant consisting predominantly of cells of any one of the claims 16 to 17.
23. A plant capable of producing increased levels of trehalose as a result of genetic modification.
24. A plant having a recombinant plant DNA genome of any one of the claims 13 to 15.
25. The plant of any one of the claims 23 to 24 which contains increased levels of trehalose.
26. The plant of claim 25 which is belongs to the Angiospermae.
27. A part of a plant containing a cell of any one of the claims 16 to 17.
28. A part of a plant consisting predominantly of a cell of any one of the claims 16 or 17.
29. A part of a plant obtained from a plant of any one of the claims 22 to 25 wherein said part contains increased levels of trehalose.
30. A part according to any one of the claims 27 to 29 selected from the group consisting of bulbs, flowers, fruits, hairy roots, leaves, microtubers, pollen, roots, seeds, stalks and tubers.
31. A method of preserving a plant or plant part in the presence of trehalose, comprising the steps of:
(1) growing a plant of any one of the claims 25 to 26, or growing a plant part of any one of the claims 29 to 30,
(2) harvesting the plant or the plant part which contains trehalose, and
(3) air drying the plant or plant part or alternatively, (4) freeze drying the plant or plant part.
32. A dried plant or plant part which obtainable by the method of claim 31.
33. A method for the production of trehalose comprising the steps of:
(1) growing a plant of claim 23 under conditions allowing for the production of trehalose,
(2) harvesting said plant or a part thereof,
(3) isolating the trehalose from the said plant or the said part thereof.
34. Trehalose which is substantially free from bacterial or yeast contaminants.
35. An isolated DNA sequence encoding a trehalose phosphate synthase activity.
36. An isolated DNA sequence according to claim 34, which is obtained from E. coli.
37. An isolated DNA sequence according to claim 35 which is represented by SEQIDNO: 2, or an isolated DNA sequence hybridising therewith under stringent conditions.
38. An isolated nucleic acid sequence that codes for the amino acid sequence of SEQIDNO: 3.
PCT/EP1993/002290 1993-06-30 1993-08-24 Production of trehalose in plants WO1995006126A1 (en)

Priority Applications (21)

Application Number Priority Date Filing Date Title
PCT/EP1993/002290 WO1995006126A1 (en) 1993-08-24 1993-08-24 Production of trehalose in plants
AU49533/93A AU4953393A (en) 1993-08-24 1993-08-24 Production of trehalose in plants
CA002166063A CA2166063C (en) 1993-06-30 1994-06-30 Production of trehalose in plants
CN94193026A CN1131315C (en) 1993-06-30 1994-06-30 Prodn. of trehalose in plant
KR1019950706055A KR960703436A (en) 1993-06-30 1994-06-30 Production of trehalose in plants
JP50328695A JP3645260B2 (en) 1993-06-30 1994-06-30 Production of trehalose in plants
NZ269548A NZ269548A (en) 1993-06-30 1994-06-30 Recombinant production of trehalose in plants
AU73846/94A AU697997B2 (en) 1993-06-30 1994-06-30 Production of trehalose in plants
EP94923710A EP0711353B1 (en) 1993-06-30 1994-06-30 Production of trehalose in plants
SK1660-95A SK166095A3 (en) 1993-06-30 1994-06-30 Production of trehalose in plants
AT94923710T ATE284446T1 (en) 1993-06-30 1994-06-30 PRODUCTION OF TREHALOSE IN PLANTS
ES94923710T ES2229222T3 (en) 1993-06-30 1994-06-30 TREHALOSE PRODUCTION IN PLANTS.
PCT/EP1994/002167 WO1995001446A1 (en) 1993-06-30 1994-06-30 Production of trehalose in plants
HU9503723V HU221124B1 (en) 1993-06-30 1994-06-30 Production of trehalose in plants
CZ19953449A CZ290830B6 (en) 1993-06-30 1994-06-30 Nucleic acid, vector, microorganism, plant DNA genome, cell and plant, method of obtaining the nucleic acid and process for preparing trehalose therefrom
DE69434173T DE69434173T2 (en) 1993-06-30 1994-06-30 PREPARATION OF TREHALOSIS IN PLANTS
RO95-02295A RO115650B1 (en) 1993-06-30 1994-06-30 Nucleic acid, nucleic acid sequence and vector determining the production of trehalose and process of producing plants with increased trehalose content
UA95125515A UA39958C2 (en) 1993-06-30 1994-06-30 Nucleic acid when expressed in a plant or in plant cells leads to an increase in the content of trehalose, METHOD FOR PRODUCING plants with an increased ability to produce trehalose, recombinant genomic DNA PLANTS, E.COLI STRAIN, METHOD FOR SAVING PLANTS, METHOD FOR PRODUCING trehalose.
PL94312303A PL179629B1 (en) 1993-06-30 1995-12-22 Production of trehalose in plants
NO955354A NO955354L (en) 1993-06-30 1995-12-29 Preparation of trehalose in plants
FI956317A FI956317A0 (en) 1993-06-30 1995-12-29 Production of trehalose in plants

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/EP1993/002290 WO1995006126A1 (en) 1993-08-24 1993-08-24 Production of trehalose in plants

Publications (1)

Publication Number Publication Date
WO1995006126A1 true WO1995006126A1 (en) 1995-03-02

Family

ID=8165757

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1993/002290 WO1995006126A1 (en) 1993-06-30 1993-08-24 Production of trehalose in plants

Country Status (2)

Country Link
AU (1) AU4953393A (en)
WO (1) WO1995006126A1 (en)

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996000789A1 (en) * 1994-06-29 1996-01-11 Alko Group Limited Transgenic plants producing trehalose
WO1996021030A1 (en) * 1995-01-04 1996-07-11 Mogen International N.V. Enhanced accumulation of trehalose in plants
ES2110918A1 (en) * 1996-07-04 1998-02-16 Univ Poltecnica De Valencia Obtaining plants tolerant to osmotic stress by genetic manipulation of carbohydrate metabolism.
US5762961A (en) * 1996-02-09 1998-06-09 Quadrant Holdings Cambridge Ltd. Rapidly soluble oral solid dosage forms, methods of making same, and compositions thereof
EP0868916A2 (en) * 1997-03-04 1998-10-07 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Reduction inhibitory agent for active-oxygen eliminating activity
US5958455A (en) * 1996-02-09 1999-09-28 Quadrant Holdings Cambridge Ltd Oral solid dosage forms, methods of making same and compositions thereof
US6290991B1 (en) 1994-12-02 2001-09-18 Quandrant Holdings Cambridge Limited Solid dose delivery vehicle and methods of making same
WO2002072849A2 (en) * 2001-01-04 2002-09-19 K.U.Leuven Research & Development Stress resistance as a selectable marker for transgenic plants
US6455511B1 (en) 1994-09-22 2002-09-24 Quadrant Holdings Cambridge Limited Compositions for use in rehydration and nutrition during athletic exercise and methods of making same
US6468782B1 (en) 1996-12-05 2002-10-22 Quadrant Healthcare (Uk) Limited Methods of preserving prokaryotic cells and compositions obtained thereby
US6559364B1 (en) * 1997-10-30 2003-05-06 Mogen International N.V. Pre- and postharvest inhibition of remobilisation of storage compounds
US6586006B2 (en) 1994-08-04 2003-07-01 Elan Drug Delivery Limited Solid delivery systems for controlled release of molecules incorporated therein and methods of making same
US6632648B1 (en) 1996-05-14 2003-10-14 Elan Drug Delivery Limited Methods of terminal sterilization of fibrinogen
US6881877B2 (en) 1996-01-12 2005-04-19 Mogen International Nv Enhanced accumulation of trehalose in plants
US6964771B1 (en) 1995-06-07 2005-11-15 Elan Drug Delivery Limited Method for stably incorporating substances within dry, foamed glass matrices
US8877162B2 (en) 2000-05-10 2014-11-04 Novartis Ag Stable metal ion-lipid powdered pharmaceutical compositions for drug delivery
US9421166B2 (en) 2001-12-19 2016-08-23 Novartis Ag Pulmonary delivery of aminoglycoside
US9554993B2 (en) 1997-09-29 2017-01-31 Novartis Ag Pulmonary delivery particles comprising an active agent

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0451896A1 (en) * 1990-03-28 1991-10-16 Gist-Brocades N.V. New yeast strains with enhanced trehalose content, process to obtain such yeasts and the use of these yeasts
WO1993017093A2 (en) * 1992-02-14 1993-09-02 Oy Alko Ab Increasing the trehalose content of organisms by transforming them with combinations of the structural genes for trehalose synthase
EP0577915A1 (en) * 1992-07-09 1994-01-12 N.V. Algist-Bruggeman Transformed yeast strain possessing stress-resistance and/or improved fermentative ability

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0451896A1 (en) * 1990-03-28 1991-10-16 Gist-Brocades N.V. New yeast strains with enhanced trehalose content, process to obtain such yeasts and the use of these yeasts
WO1993017093A2 (en) * 1992-02-14 1993-09-02 Oy Alko Ab Increasing the trehalose content of organisms by transforming them with combinations of the structural genes for trehalose synthase
EP0577915A1 (en) * 1992-07-09 1994-01-12 N.V. Algist-Bruggeman Transformed yeast strain possessing stress-resistance and/or improved fermentative ability

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
BELL, W., ET AL.: "Characterization of the 56-kDa subunit of yeast trehalose-6-phosphate synthase and cloning of its gene reveal its identity with the product of CIF1, a regulator of carbon catabolite inactivation", EUROPEAN JOURNAL OF BIOCHEMISTRY, vol. 209, no. 3, November 1992 (1992-11-01), pages 951 - 959 *
COUTINHO, C., ET AL.: "Trehalose as cryoprotectant for preservation of yeast strains", J. BIOTECHNOLOGY, vol. 7, no. 1, 1988, pages 23 - 32 *
EMBL SEQUENCE DATABASE REL. ACC. NO. X69160, 27 May 1993 (1993-05-27) *
GONZALES, M.I., ET AL.: "Molecular cloning of CIF1, a yeast gene necessary for growth on glucose", YEAST, vol. 8, 1992, pages 183 - 192 *
KAASEN, I., ET AL.: "Molecular cloning and physical mapping of the otsBA gene, which encode the osmoregulatory trehalose pathway of Escherichia coli: Evidence that transcription is activated by KatF (AppR)", J. BACTERIOLOGY, vol. 174, no. 3, February 1992 (1992-02-01), pages 889 - 898 *
QUILLET, M., ET AL.: "Sur l'accumulation concominante du saccharose et du tréhalose chez plusieurs espèces de Sélaginelles indigènes et exotiques", COMPTES RENDUES ACAD. SC. PARIS, vol. 259, 20 July 1964 (1964-07-20), pages 635 - 637 *
TARCZYNSKI, M.C., ET AL.: "Evaluation of the concept of osmoprotection : Effect of mannitol production in transgenic tobacco", PLANT PHYSIOLOGY., vol. 99, no. 1, May 1992 (1992-05-01), ROCKVILLE, MD, USA., pages 27 *
TARCZYNSKI, M.C., ET AL.: "Expression of a bacterial mtlD gene in transgenic tobacco leads to production and accumulation of mannitol", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, vol. 89, April 1992 (1992-04-01), WASHINGTON US, pages 2600 - 2604 *
TOMOS, D.: "Life without water", CURRENT BIOLOGY, vol. 2, no. 11, 1992, pages 594 - 596 *

Cited By (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2303856A (en) * 1994-06-29 1997-03-05 Alko Group Ltd Transgenic plants producing trehalose
WO1996000789A1 (en) * 1994-06-29 1996-01-11 Alko Group Limited Transgenic plants producing trehalose
GB2303856B (en) * 1994-06-29 1998-12-30 Alko Group Ltd Transgenic plants producing trehalose
US6586006B2 (en) 1994-08-04 2003-07-01 Elan Drug Delivery Limited Solid delivery systems for controlled release of molecules incorporated therein and methods of making same
US6455511B1 (en) 1994-09-22 2002-09-24 Quadrant Holdings Cambridge Limited Compositions for use in rehydration and nutrition during athletic exercise and methods of making same
US6596702B2 (en) 1994-09-22 2003-07-22 Elan Drug Delivery Limited Compositions for use in rehydration and nutrition during athletic exercise and methods of making same
US6290991B1 (en) 1994-12-02 2001-09-18 Quandrant Holdings Cambridge Limited Solid dose delivery vehicle and methods of making same
WO1996021030A1 (en) * 1995-01-04 1996-07-11 Mogen International N.V. Enhanced accumulation of trehalose in plants
US6964771B1 (en) 1995-06-07 2005-11-15 Elan Drug Delivery Limited Method for stably incorporating substances within dry, foamed glass matrices
US6881877B2 (en) 1996-01-12 2005-04-19 Mogen International Nv Enhanced accumulation of trehalose in plants
US5958455A (en) * 1996-02-09 1999-09-28 Quadrant Holdings Cambridge Ltd Oral solid dosage forms, methods of making same and compositions thereof
US5762961A (en) * 1996-02-09 1998-06-09 Quadrant Holdings Cambridge Ltd. Rapidly soluble oral solid dosage forms, methods of making same, and compositions thereof
US6632648B1 (en) 1996-05-14 2003-10-14 Elan Drug Delivery Limited Methods of terminal sterilization of fibrinogen
ES2110918A1 (en) * 1996-07-04 1998-02-16 Univ Poltecnica De Valencia Obtaining plants tolerant to osmotic stress by genetic manipulation of carbohydrate metabolism.
US6468782B1 (en) 1996-12-05 2002-10-22 Quadrant Healthcare (Uk) Limited Methods of preserving prokaryotic cells and compositions obtained thereby
EP0868916A2 (en) * 1997-03-04 1998-10-07 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Reduction inhibitory agent for active-oxygen eliminating activity
EP0868916A3 (en) * 1997-03-04 2004-09-15 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Reduction inhibitory agent for active-oxygen eliminating activity
US7186824B2 (en) 1997-03-04 2007-03-06 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Reduction inhibitory agent for active-oxygen eliminating activity
US9554993B2 (en) 1997-09-29 2017-01-31 Novartis Ag Pulmonary delivery particles comprising an active agent
US6559364B1 (en) * 1997-10-30 2003-05-06 Mogen International N.V. Pre- and postharvest inhibition of remobilisation of storage compounds
US8877162B2 (en) 2000-05-10 2014-11-04 Novartis Ag Stable metal ion-lipid powdered pharmaceutical compositions for drug delivery
US9439862B2 (en) 2000-05-10 2016-09-13 Novartis Ag Phospholipid-based powders for drug delivery
WO2002072849A3 (en) * 2001-01-04 2003-02-06 Leuven K U Res & Dev Stress resistance as a selectable marker for transgenic plants
WO2002072849A2 (en) * 2001-01-04 2002-09-19 K.U.Leuven Research & Development Stress resistance as a selectable marker for transgenic plants
US9421166B2 (en) 2001-12-19 2016-08-23 Novartis Ag Pulmonary delivery of aminoglycoside

Also Published As

Publication number Publication date
AU4953393A (en) 1995-03-21

Similar Documents

Publication Publication Date Title
Goddijn et al. Inhibition of trehalase activity enhances trehalose accumulation in transgenic plants
WO1995006126A1 (en) Production of trehalose in plants
AU656920B2 (en) Transgenic plants having a modified carbohydrate content
US20080064864A1 (en) Isoforms of starch branching enzyme II (SBE-IIa and SBE-IIb) from wheat
US6881877B2 (en) Enhanced accumulation of trehalose in plants
EP0711353B1 (en) Production of trehalose in plants
AU715002B2 (en) Transgenic plants with improved biomass production
WO1996021030A1 (en) Enhanced accumulation of trehalose in plants
AU3606599A (en) Transgenic plants presenting a modified inulin producing profile
US5925804A (en) Production of trehalose in plants
AU720418B2 (en) Modified plants and plant products
CA2339346C (en) Selection method using a galactose metabolising enzyme
AU754482B2 (en) Enhanced accumulation of trehalose in plants
AU2003246315B2 (en) Transgenic plants presenting a modified inulin producing profile
WO2024134685A1 (en) A recombinant vector comprising 4cl11 orf from ocimum kilimandscharicum, and implementations thereof
MXPA97000296A (en) Increased accumulation of trehalosa in plan

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU BG BR BY CA CZ FI HU JP KR NO NZ PL RO RU SK UA US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA