MXPA97000296A - Increased accumulation of trehalosa in plan - Google Patents

Abstract

The invention provides a process for the production of trehalose in plant cells capable of producing trehalase by developing plant cells that have the genetic information required for the production of trehalose and trehalase, or by cultivating a plant or a part of the plant. same, comprising such plant cells, characterized in that the plant cells are grown, or the plant or a part thereof, are grown in the presence of a trehal inhibitor

Description

INCREASED ACCUMULATION OF TREHALOSA IN PLANTS FIELD OF THE INVENTION The invention relates to a method for the production of trehalose in plant cells and plants. The invention is particularly related to a method for increasing the levels of trehalose accumulation in plants, by inhibiting the degradation of trehalose by trehalase. The invention further comprises higher plants, preferably Angi osperms, and parts thereof, which, as a result of such methods, contain relatively high levels of trehalose. The invention also relates to plant cells, plants or parts thereof according to the invention, obtained after processing thereof.

BACKGROUND OF THE INVENTION Trehalose is a general name given to D-glucosyl-D-glucosides, which comprise disaccharides based on glucose molecules a-, a, β- and β, β-linked. Trehalose, and especially the a-REF: 23915 trehalose, alpha-D-glucopyranosyl (1-1) alpha-D-glucopyranoside is a widely diffused disaccharide of natural origin. However, trehalose is not generally found in plants, apart from a few exceptions, such as the plant species Selaginella l epidofhylla (Lycophyta) and Myrothamnus flabelli fol i a. Apart from these species, trehalose is found in root nodules of legumes (Sperma t ophyta e, Angi ospermae), where it is synthesized by bacteroides; the trehalose produced in this way is capable of diffusing to the root cells. Apart from these accidental occurrences, the plant species belonging to Spermatophyta apparently lack the ability to produce and / or accumulate trehalose. In the International patent application WO 95/01446, filed on June 30, 1994, in the name of MOGEN International NV, a method is described for the provision of plants not naturally capable of producing trehalose, with the ability to do so. Despite the absence of trehalose as a substrate in most higher plant species, the occurrence of trehalose degradation activity has been reported by a considerable number of higher plant species, including those known to lack trehalose The responsible activity could be attributed to a trehalase enzyme. Reports suggest that trehalose, when fed to sprout, of plants developed in vi tro is toxic or inhibitory to the growth of plant cells (Velutha K. et al., 1981, Plant Physiol. _68, 1369-1374) . Plant cells that produce low levels of trehalase were found to be generally more sensitive to the adverse effects of trehalose, than plants that show a higher level of trehalase activity. Trehalose analogs, such as trehalose-amines, were used to inhibit trehalose activity in shoots, making it possible to study the effects of trehalose feeding on plant cells. Outbreaks of plants that produce relatively high amounts of trehalase were adversely affected by the addition of trehalase inhibitors. Inhibition of trehalase activity in callus homogenates and suspension culture of various Angi osperms using Validamycin is described by Kendall et al., 1990, Phytochemistry 2_9 > 2525-2582. An objective of the present invention is to provide plants and plant parts capable of producing and accumulating trehalose.

BRIEF DESCRIPTION OF THE INVENTION The invention provides a process for the production of trehalose in plant cells, capable of producing trehalase by developing plant cells that have the genetic information required for the production of trehalose and trehalase, or by cultivating a plant or a part of it comprising such plant cells, characterized in that said plant cells are developed, or the plant or part of it is grown in the presence of a trehalase inhibitor. Preferred plants or plant parts, or plant cells, have been genetically altered to contain a chimeric trehalose phosphate synthase gene in an expressible form in plants. According to a modality said trehalose phosphate synthase gene, it comprises an open reading structure that codes for trehalose phosphate synthase from E. coli in an expressible form in plants. More preferred is a gene that codes for a bipartite enzyme, with trehalose-phosphate-synthase and trehalose-phosphate-and important activities and the ability to absorb impact energy. Although some cracks may still occur with very large deflections, they do not yet propagate to a catastrophic failure, which allows damage to the vehicle itself, even when the bumper is repeatedly bent to double what caused the failure before the invention, with the same impact energy levels. It is therefore an object of the present invention to provide a composite and improved bumper beam for a motor vehicle. Another object is to provide a composite impact beam of molding by injecting with a motor vehicle reaction, comprising interlaced and chopped glass fiber, in a pre-molding where most of the interlaced fibers are oriented longitudinally in the bumper and in where - the premolded is molded by reaction injection with a pure poethane / pure poethane resin, not filled - with a highly tolerable elongation characteristic. Another object is to provide a bumper composed of injection molded with reaction, pr = motor vehicle, comprising a pre-molding with layers of interlaced and chopped glass fibers where most of the fibers are oriented longitudinally in the bumper and there is a resin based on poethane / polimeric, with a net elongation in an excess of 50.

Also suitable as an inhibitor of trehalase is the 86 kD protein from the American cockroach (Periplaneta ameri cana). This protein can be administered to a plant in a form suitable for uptake, and it is also possible for the plants to be transformed with the DNA encoding said protein. The invention also provides plants and plant parts that accumulate trehalose in an amount of above 0.01% (fresh weight), p * referently of a Solanaceae species, in particular Sol an um tu-berosum or Ni co tiana tabac? M, in particularly a micro tuber of Solanum tuberosum that contains trehalose. The invention also comprises the use of a plant, or part of the plant, according to the invention to extract the trehalose, as well as the use thereof in a process of forced extraction of water from said plant or plant part. According to yet another embodiment of the invention, there is provided a plant-expressible chimeric gene, comprising in sequence a region of transcription initiation, obtainable from a gene, preferably expressed in a part of the plant, particularly the gene of the patatin from Solanum t uberosum, a 5 '-not translated guide, an open reading structure that encodes a trehalose-phosphate synthase activity, and downward direction of said open reading structure, a terminator region of transcription . According to yet another embodiment of the invention, there is provided a plant-expressible chimeric gene, comprising in sequence a region of transcription initiation, obtainable from a gene, preferably expressed in a plant part, particularly the gene of the patatin from Solanum t uberosum, a 5 '-not translated guide, an open reading structure that encodes a trehalase coupled in the antisense orientation, and downstream of the open reading structure, a terminator region of transcription. A preferred gene expressible in plants, according to the invention, is one in which the transcription terminator region is obtainable from the Solanui proteinase inhibitor gene II. tuberosum. The invention also provides recombinant plant vectors and genomes, comprising a chimeric gene expressible in plants according to the invention, as well as a plant cell having a recombinant genome, a plant or a part thereof, consisting essentially of cells. An additionally preferred plant species according to this aspect is Solanum t uberosum, and a microtuber of the same. The invention further provides a process for obtaining trehalose, comprising the steps of developing plant cells according to the invention or cultivating a plant according to the invention and extracting trehalose from said plant cells, plants or parts. The following figures further illustrate the invention.

DESCRIPTION OF THE FIGURES Figure 1. Schematic representation of the binary vector pMOG845.

Figure 2 Schematic representation of the vector of multiple copies pMOG1192.

Figure 3. Alignments for maximum amino acid similarities of neutral trehalase from S. cerevisi ae, with periplasmic trehalose from E. coli, trehalase from the small intestine of rabbit, and trehalase from the midgut of silkworm pupae, Bombyx mori. The identical residues among all the trehalases enzymes are indicated in bold italics. The conserved regions of the amino acid sequences were aligned to give the best fit. The empty spaces in the amino acid sequence are represented by dashed lines. The positions of the degenerate primers based on conserved amino acids are indicated by dashed arrows.

Figure 4 Alignment for the maximum similarity of amino acids, of the trehalases derived from E. colX (Ecoli2treh; Ecolitreha), from silkworm (Bommotreha), from yellow flour worm (Tenmotreha), from rabbit (Rabbitreha), from Solanum t uberosum see Kardal (Potatotreha), and S. cerevi siae (Yeasttreha). The empty spaces in the amino acid sequence are represented by dashed lines.

Figure 5. Trehalase activity in samples of Ni co tiana tabacum leaves see Samsun NN. The non-transgenic control plants are indicated by the letters a-l, the transgenic plants for pMOG1078 are indicated by numbers.

Figure 6. Accumulation of trehalose in microtubers, induced on stem segments derived from plants of Sol an um t uberosum, see Kardal, transgenic for pMOG845 (expression of TPSe with promoted by patatin) and for pMOG1027 (expression of trehalose antisense by 35SCaMV). N indicates the total number of selected transgenic lines. The experiments were performed in duplicate resulting in two values: a and b. ND: not determined.

DETAILED DESCRIPTION OF THE INVENTION According to the present invention, it has been found that the accumulation of an increased level of trehalose in plants and in parts of plants is feasible. This important finding can be exploited by adapting plant systems to produce and / or accumulate high levels of trehalose at low cost. According to one aspect of the invention, the accumulation of increased levels of trehalose is achieved by the inhibition of endogenous trehalases. The inhibition of trehalases can be carried out basically in two ways: by administering the trehalase inhibitors, exogenously, and by producing trehalase inhibitors, endogenously, for example by transforming the plants with DNA sequences encoding for trehalase inhibitors. This inhibition can also be well applied to plants that are transformed with enzymes that make possible the production of trehalose, but also to plants that are able to naturally synthesize trehalose. According to this first embodiment of the invention, the trehalase inhibitors are administered to the plant system exogenously. Examples of trehalase inhibitors that can be used in such a process according to the invention are trehazolin produced in My chromonospera, strain SANK 62390 (Ando et al., 1991, J. Antibiot. £ 4, 1165-1168), Validoxylamine A, B, G, D-glyco-Dihydrovalidoxyla ina A, L-ido-dihydrovalidoxylamine A, Deoxynojirimycin (Ka eda et al., 1987, J. Antibiot. £ 0 (4), 563-565), 5-epi- trehazolin (Trehalostatin) (Kobayashi Y. et al., 1994, J. Antibiot. £ 7, 932-938), castanospermine (Salleh HM &Honek JF March 1990, FEBS 262 (2), 359-362) and the protein of 86 kD from the American cockroach (Periplaneta ameri cana) (Hayaka et al., 1989, J. Biol. Chem. 264 (27), 16165-16169). A preferred inhibitor of trehalase according to the invention is validamycin A (1,5,6-trideoxy-3-o-β-D-glucopyranosyl-5- (hydroxymethyl) -1- [[4, 5, 6] trihydroxy-3- (hydroxymethyl) -2-cyclohexen-l-yl] aminoJ-D-chiro-inositol). Trehalase inhibitors are administered to plants or parts of plants, or to plant cell cultures, in a form suitable for uptake by plants, parts of plants or crops. Typically, the trehalase inhibitor is in the formula of an aqueous solution of between 10 M and 10 mM of active ingredient, preferably between 0.1 and 1 mM. Aqueous solutions can be applied to plants or parts of the plant by spraying on the leaves, watering, adding them to the medium of a hydroponics, and the like. Another appropriate validamicin formulation is solacol, a commercially available agricultural formulation (Takeda Chem. Industries, Tokyo). Alternatively, or in addition to the use of the exogenously administered trehalase inhibitors, the trehalase inhibitors can be provided by the introduction of the genetic information encoding them. One form of such an internally constructed trehalase inhibitor may consist of a genetic construct that causes the production of RNA that is sufficiently complementary to the endogenous RNA encoding trehalase, to interact with said endogenous transcript, thereby inhibiting the expression of said transcribed fc. This so-called "antisense procedure" is well known in the art (see among other European Patent EP 0,240,208 A and the Examples for inhibiting SPS described in the World Patent Application WO95 / 01446). A gene encoding trehalase has been isolated from a genomic library of potato cDNA, and has been sequenced. The predicted amino acid sequence of trehalase as shown in SEQ ID NO: 10 is derived from the nucleotide sequence described in SEQ ID NO: 9. A comparison of that sequence with the known sequences of non-plant trehalase teaches that homology is scarce. It is therefore questionable whether such trehalase sequences used in an antisense procedure are capable of inhibiting the expression of trehalase in plants. Of course, the most preferred embodiment of the invention is obtained by transforming a plant with the antisense trehalase gene, which exactly matches the endogenous trehalase gene. However, sequences that have a high degree of homology can also be used. Thus, the antisense trehalase gene to be used for the transformation of the potato will be directed against the nucleotide sequence described in SEQ ID NO: 9. It is also demonstrated in this application that the potato trehalase sequence can also It can be used to inhibit the expression of tr "ehalase in tomato, since the potato sequence is highly homologous to the tomato trehalase sequence, thus allowing the potato sequence to be used in at least closely related species. related, but perhaps also in other plants.This is even more the case, considering that it is usually enough to express only part of the homologous gene in the antisense orientation, in order to achieve effective inhibition of the expression of endogenous trehalase (see Van der Krol et al., 1990, Plant Molecular Biology, 1 £, 457-466.) In addition, it is shown in this application that the potato trehalase sequence can be used for a for the detection of homology in other species. The genetic sequences of trehalase from other plants can be elucidated using several different strategies. One of the strategies is to use the isolated potato cDNA clone as a probe to select a cDNA library containing the cDNA of the desired plant species. The positive reaction clones can then be isolated and subcloned into appropriate vectors. A "second strategy to identify such genes is through the purification of proteins that are involved in the degradation of l * a trehalose." An example for such a strategy is the purification of a protein with the activity of acid-invertase, potato tuber (Solanum t uberosum L.) (Burch et al., Phytochemistry, Vol. 3 £, No. 6, pp. 1901-1904, 1992) The protein preparation obtained also shows trehalose hydrolysis activity.The hydrolysis activity of disaccharide of the protein preparations obtained after the purification steps, can be checked periodically as described by Dahlqvist (Analytical Biochemistry 1_, 18-25, 1964) After the purification of the protein (s) with the hydrolysis activity of trehalose up to homogeneity, the N-terminal amino acid sequence or the sequence of internal fragments is determined after protein digestion. possible the design of oligonuclectidic probes, which are used in a polymerase chain reaction (PCR) or hybridization experiments to isolate the corresponding mRNAs, using standard molecular cloning techniques. Alternatively, the fc degenerate primers can be designed based on the conserved sequences present in the trehalase genes isolated from other species. These primers are used in a PCR strategy to amplify the putative trehalase genes. Based on sequential information or Southern blotting, PCR fragments of trehalase and corresponding cDNAs, isolated, can be identified. An isolated cDNA encoding a trehalose degradation enzyme is subsequently fused to a promoter sequence, in such a manner that transcription results in the synthesis of the antisense mRNA. Yet another form of such an internally constructed trehalase inhibitor, may consist of a genetic construct that causes the production of a protein that is capable of inhibiting the activity of trehalase in plants. A protein inhibitor of trehalase has been isolated and purified from the serum of adult American cockroaches (Periplaneta americana) at rest (Hayaka a et al., Supra). This protein, of which the sequence in said publication has been partially described, can be made expressible by the isolation of the gene coding for the protein, the fusion of the appropriate promoter gene, and the transformation of said fused gene, within the plant according to the standard methods of molecular biology. A promoter can be selected from any gene capable of driving transcription in plant cells. If accumulation of trehalose is only desired in certain parts of the plant, such as potato (mini-) tubers, DNA construction, trehalose inhibitor (eg, antisense construct) comprises a promoter fragment which is preferably expressed in (mini-) tubers, allowing the levels of endogenous trehalase in the rest of the cells of the plant to be substantially unaffected. In this way, any negative effects of trehalose for the surrounding cells of the plant, due to the diffusion of trehalose, are counterattacked by the unaffected activity of the endogenous trehalase, in the rest of the plant. In the example illustrating the invention, wherein trehalose phosphate synthase is produced under the control of the patatin promoter fragment, also the inhibitory construction of trehalase may comprise a promoter fragment of the fc patatin gene. However, if trehalose is to be accumulated in tomato fruit, a g * of trehalose-phosphate synthase expressible in plants must be used, which is at least expressed in the fruit of the tomato, as well as a construction of inhibitory DNA of trehalase, expressible in plants, which must be expressed preferably in the fruit and preferably not, or not substantially, outside the fruit. An example of a promoter fragment that can be used to promote the expression of DNA constructs, preferably in tomato fruit, is described in European Patent EP 0,409,629 Al. Numerous modifications of this aspect of the invention, which do not depart from the scope of this invention, are easily glimpsed by persons having ordinary experience in the art, to which this invention pertains.

An alternative method for blocking the synthesis of undesired enzymatic activity such as that caused by endogenous trehalase is the introduction into the genome of the host plant of an additional copy of said endogenous trehalase gene. It is frequently observed that the presence of a transgenic copy of an endogenous gene, silences the expression of the endogenous gene and the transgene (EP 0,465, 572 Al). According to one embodiment of the invention, the accumulation of trehalose is originated in plants where the capacity for production of trehalose has been introduced by the introduction of a genetic construct expressible in plants, which codes for trehalose-phosphate- synthase (TPS), see for example WO 95/06126. Any trehalose-phosphate synthase gene under the control of regulatory elements necessary for the expression of DNA in plant cells, either specifically or constitutively, can be used, as long as it is capable of producing trehalose-phosphate synthase activity , active. More preferred are the trehalose phosphate synthase genes, which also harbor a coding sequence for the activity of trehalose phosphate phosphatase, so-called bipartite enzymes. Such a gene, which in the past was only known to exist in yeast (see for example WO 93/17093), can also be found in most plants. This application describes the elucidation of such a gene from sunflower Helianthus annuus, while evidence is also given for the existence of a homologous gene in Ni cotiana tabacum. It is believed that the use of a bipartite enzyme increases the production of trehalose because it makes it possible to terminate the metabolic pathway from UDP-glucose and glucose-6-phosphate in trehalose at one and the same site. Hence, the synthesis in two steps is simplified in a one-step reaction, thereby increasing the reaction rate, and subsequently, the yield of trehalose. Since the genes involved in the synthesis of trehalose, especially genes that code for bipartite enzymes, become available from other sources, these can be used in a similar way to obtain a synthesis gene for trehalose, expressible in plants, of according to the invention. Sources for the isolation of trehalose synthesis activities include microorganisms (eg, bacteria, yeast, and fungi), but these genes can also be found in plants and animals. The invention also encompasses nucleic acid sequences that have been obtained by modifying the nucleic acid sequences encoding active enzymes in the synthesis of fc trehalose, by mutation of one or more codons, so that it results in changes of amino acids in the encoded protein, as long as the imitation of the amino acid sequence does not completely cancel out the synthesis activity of trehalose. According to another embodiment of the invention, the plants are genetically altered to produce and accumulate trehalose in specific parts of the plant, which were selected based on considerations such as the availability of the substrate for the enzyme, the insensitivity of the part of the plant for any putative adverse effects of trehalose on the functioning of the plant cell, and the like. The preferred sites for the expression of the synthesis enzyme of trehalose are the storage parts of starch in plants. In particular, potato tubers are considered as appropriate plant parts. A preferred promoter for achieving selective expression of the enzyme in microtubers and potato tubers is obtainable from the upstream region of the open reading structure of the potato patatin gene (Solanum t uberosum) . Plants that provide a gene encoding trehalose phosphate synthase can only be further modified by introducing additional genes coding for phosphatases that are capable of converting trehalose phosphate to trehalose. At least in potato tubers or microtubers, in the potato leaves and in the leaves and roots of tobacco, the activity of endogenous phosphatase seems to be present, so that the introduction of a trehalose-phosphate-phosphatase (TPP) gene is not an absolute requirement. The preferred plant hosts among the Sperma tophyta are the Angiospermae, mainly the Dicotyledoneae, which include among others the Solanaceae as a representative family, and the Monocotyl edoneae, which include among others the Gramineae as a representative family. Suitable host plants, as defined in the context of the present invention, include plants (as well as parts and cells of said plants) and their progeny, which have been genetically modified using recombinant DNA techniques to cause or enhance the production of trehalose. in the desired plant or in the organ of the plant; these plants can be used directly (for example, plant species that produce edible parts) in the processing, or the trehalose can be extracted and / or purified from said host. Crops with edible parts according to the invention include those that have flowers such as cauliflower (Brassica olerácea), artichoke (Cynara scolymus), fruits such as apple (Malus for example, domesticus), banana (Musa, for example acuminata) , blackberries (such as currant, Ribes for example rubrum), cherries (such as sweet cherries, Prunus, for example avium), cucumber (Cucumis, for example sativus), grape (Vitis, for example vi or fera), lemon ( Citrus lemon), melon (Cucumis meló), walnut (such as hazelnut, Juglans, for example regia, peanut, Arachis hypogeae), orange (Citrus, for example maximum), peach (Prunus, for example Persian), pear (Pyra , for example communis), pepper (Solanum, for example capsicum), plum (Prunus, for example domestica), strawberry (Fragaria, for example moschata), tomato (Lycopersicon, for example escuientum), leaves, such as alfalfa (Medicago sativa ), cabbages (such as Brassica olerácea), chicory (Cic horeum, for example endive), leek (Allium porrum), lettuce (Lactuca sativa), spinach (Spinaciaoleraceae), tobacco (Nicotiana tabacum), roots, such as maranta fc (Maranta arundinacea), beet (fleta vulgaris), carrot (Daucus carota), Chinese melon (Manihot esculenta), turnip (Brassica rapa), radish (Raphanus sativus), yam (Dioscorea esculenta), sweet potato (Ipomoea batatas) and seeds, such as beans (Phaseoius vulgaris), peas (Pisum sativum), soybeans (Glycin max), wheat (Triticum aestivum), barley (Hordeum vulgare), corn, Zea mays) , rice [Oriza sativa), tubers, such as rutabaga (Brassicß oleraceae), potato (Solanum tuberosum), and the like. * The edible parts can be preserved by drying in the presence of increased levels of trehalose, produced in them due to the presence of a gene expressible in plants, trehalose phosphate synthase. The method for producing the gene expressible in plants encoding a trehalose synthesis enzyme, or any other sense or antisense gene within a recipient plant cell, is not crucial, as long as the gene is expressed in said plant cell . The use of the transformation mediated by Agrobacterium um tumefaci ens or Agroba ct eri um rhi zogenes is preferred, but other methods are available for the introduction of DNA into plant cells. Examples are protoplast transformation using the calcium / polyethylene glycol method, electroporation, microinjection and bombardment of DNA coated particles (Potrykus, 1990, Bio / Technol.8, 535-542). Also combinations of Agrobacterium and bombardment of coated particles can be used. Transformation protocols that involve other live vectors than Agro-bacterium, such as viral vectors (for example, from the Cauliflower Mosaic Virus) can also be used.

(CaMV) and / or combinations of Agrobacterium um and viral vectors, a procedure termed as agroinfection (Grimsley N. et al., January 8, 1987, Nature 325, 177-179). After selection and / or screening, protoplasts, cells or plant parts that have been transformed are regenerated into whole plants, using methods known in the art (Horsh et al., 1985, Science 22_5, 1229-1231). The development of reproducible tissue culture systems for monocotyledonous crops, together with the methods of introducing genetic material into plant cells, have facilitated the transformation. Currently, the preferred methods for the transformation of monocotyledonous species are the transformation with the supervirulent Agrobacteri um strains, the bombardment with microprojectiles of explants or cells in suspension, and the direct uptake of DNA or electroporation (Shimamoto, et al., 1989, Nature 338, 274-276). The mediated transformation for Agrobacterium um is working very well in rice (WO 94/00977). Transgenic maize plants have been obtained by introducing the bar gene of Streptomyces hygroscopicus, which codes for phosphinothricin-acetyltransferase (an enzyme that inactivates the herbicide phosphinothricin), within embryonic cells of a suspension corn culture by bombardment with microprojectiles (Gordon-Kam, 1990, Plant Cell, 2, 603-618). The introduction of genetic material into the anorene protoplasts of other monocotyledonous crops, such as wheat and barley, has been reported (Lee, 1989, Plant Mol. Biol. 13, 21-30). The wheat plants have been regenerated from embryogenic culture in suspension, by selecting only the compact and nodular embryogenic callus tissues, aged, for the establishment of the embryogenic cultures in suspension (Vasil, 1990 Bio / Technol. 429-434). DNA sequences appropriate for the control of the expression of in-plant expressible genes (including marker genes), such as transcription initiation regions, augmentations, guides, non-transcribed and the like, can be derived from any gene that is expressed in a plant cell. It is also intended that the hybrid promoters be combined with functional portions of various promoters, or synthetic equivalents thereof. Apart from constitutive promoters, inducible promoters, or otherwise regulated promoters may be used in their expression pattern, for example, with respect to development or cell-type specific, to control the expression of genes expressible in plants, according to the invention, as long as they are expressed in parts of the plant that contain the substrate for TPS. To select or screen transformed cells, it is preferred to include a marker gene linked to the plant expressible gene according to the invention, to be transferred to a plant cell. The choice of a selectable marker gene in the transformation of the plant is perfectly within the reach of the average skilled worker; some examples of routinely used marker genes are the neomycin phosphotransferase genes, which confer resistance to kanamycin (EP-B 131,623), the glutathione-S-transferase gene of rat liver, which confers resistance to the herbicides derived of glutathione (EP-A 256,223), the glutamine synthetase which confers after overexpression resistance to glutamine synthetase inhibitors such as phosphinothricin (WO 87/05327), the Sto acetyltransferase gene. pyces viridochromogenes, which confers resistance to the selective agent phosphinothricin (EP-A 275,957), the gene coding for 5-enolshikimato-3-phosphate synthase (EPSPS) that confers tolerance to N-phosphonomethylglycine, the bar gene that confers resistance against Bialaphos (for example WO 91/02071) and the like. The effective choice of the marker is not crucial, as long as it is functional (eg selective) in combination with the plant cells of choice. The marker gene and the gene of interest do not have to be linked, since the cotransformation of the unbound genes (US Patent No. 4,399,216) is also an efficient process in the transformation of plants. The preferred plant material for transformation, especially for dicot crops, are leaf discs, which can be easily transformed and have good regeneration capacity (Horsch R., et al., (1985) Science 227_, 1229-1231). It is not important for the invention how the presence of two or more genes in the same plant is effected. This can, among other things, be achieved by one of the following methods: a) transformation of the plant line with a construction of multiple genes that contain more than one gene to be introduced, b) the cotransformation of different constructions for the same line vegetable, simultaneously, c) subsequent rounds of transformation of the same plant with the genes to be introduced, d) the crossing of the two plants, each of which contains a different gene to be introduced into the same plant, oe) combinations thereof. The field of application of the invention lies in agriculture and horticulture, for example due to the improved properties of plants modified as such (for example tolerance to adverse conditions, such as cold tolerance and preferably drought resistance, and increase in post-harvest quality and shelf life of plants and plant products), as well as in any form of industry where trehalose is or will be applied in a forced water extraction process, such as drying or lyophilization. Trehalose can be used or sold as such, for example in purified form or in mixtures, or in the form of a plant product, such as a tuber, a fruit, a flower containing trehalose, either in the native state or in the native state. (partially) dehydrated form, and the like. The plant parts that house (increased levels of) trehalose phosphate or trehalose can be used or sold as such or processed without the need to add trehalose.

Also the trehalose can be extracted and / or purified from the plants or plant parts that produce it, and subsequently be used in an industrial process. In food industries, trehalose can be used by adding trehalose to foods before dehydration. Dehydration of food is an important method of preservation. Trehalose appears especially useful for preserving food products by drying with conventional air, and for allowing rapid reconstitution after addition of water from a high quality product (Roser et al., July 1991, Trends in Food Science and Technology, pp. 166-169). The benefits include retention of natural flavors / fragrances, fresh product flavor, and nutritional value (proteins and vitamins). It has been shown that trehalose has the ability to stabilize proteins, for example vaccines, enzymes and membranes, and to form a stable, chemically inert crystal.

The low water activity of such perfectly dehydrated food products prevents chemical reactions that could cause rot. Field crops such as corn, Chinese melon, potato, sugar beet and sugar cane have long been used as a natural source for bulk carbohydrate production (starches and sucrose). The production of trehalose in such crops, facilitated by the genetic engineering of the biosynthetic pathway of trehalose within these plant species, could allow the exploitation of such crops manipulated by genetic engineering for the production of trehalose. Trehalose is also used to dehydrate or store biological macromolecules, such as peptides, enzymes, polynucleotides and the like. All references cited in this specification are indicative of the level of experience in the art to which the invention pertains. All publications, whether they are patents or others, to which reference is made previously or later in this specification, are incorporated by reference herein, as if each of them were individually incorporated by reference. In particular, international patent application WO 95/01446, cited here, which describes the production of trehalose in higher plants by genetic manipulation, is incorporated by reference herein.

The examples given below illustrate the invention and are not intended to indicate in any way the limits of the scope of the invention.

Experimental part Fc DNA manipulations All DNA procedures (isolation of E. coli DNA, restriction, ligation, transformation, etc.) are carried out according to standard protocols (Sambrook et al. (1989) Molecular Cloning: a laboratory manual, 2 * ed. Spring Harbor Laboratory Press, CSH, New York).

Strains In all the examples E. coli K-12 strain DH5a is used for cloning. The strains of Agrobacteri um t umefaci ens used for the plant transformation experiments are EHA 105 and MOG 101 (Hood et al 1993, Trans .. Research 2, 208-218).

Isolation of a patatine promoter / construction of PMOG546 A promoter fragment of patatin is isolated from the chromosomal DNA of Solanum t uberosum see Bintje using the polymerase chain reaction. A group of oligonucleotides is synthesized, complementary to the sequence of the upstream region of the patatiin? Pat21 gene (Bevan, M., Barker, R., Goldsbrough, A.-, Jarvis, M., Kavanagh, T and Iturriaga, G. (1986) Nucleic Acids Res. 1 £: 5564-5566), which consists of the following sequence: 'AAG CTT ATG TTG CCA TAT AGA GTA G 3' PatB33.2 (SEQ ID NO: 3) 5 'GTA GTT GCC ATG GTG CAA ATG TTC 31 PatATG.2 (SEQ ID NOM) These primers are used for the PCR amplification of a DNA fragment of 1123 base pairs, using chromosomal DNA isolated from potato, see Bintje, as a template. The amplified fragment shows a high degree of similarity to the patatina? Pat21 sequence, and is cloned using the EcoRI linkers within a pUC18 vector that results in the plasmid pMOG546.

Construction of pMOG799 pM0G799 harbors the TPS gene from E. coli under the control of the double-enhanced 35S Cauliflower Mosaic promoter. The construction of this binary vector is described in detail in International Patent Application WO 95/01446, incorporated by reference herein.

Construction of pMOG845 Plasmid? MOG546 containing the patatin promoter, is digested with Ncol-Kpnl, incubated with E. coli DNA polymerase I in the presence of dATP and dCTP, thereby destroying the Ncol and Kpnl site and subsequently becomes to flirt From the resulting vector, a 1.1 kb EcoRI-Smal fragment containing the patatin promoter is isolated and cloned into pMOG798 (described in detail in International Patent Application WO 95/01446) linearized with Smal-EcoRI , subsequently exchanging the 35S CaMV promoter for the patatin promoter. The resulting vector is linearized with HindIII and ligated with the following oligonucleotide duplex: (HmdlII) PstI Kpnl HindIII 'AGCT CTGCAG TGA GGTACC A 3' TCV 11 (SEQ ID NO: 5) 3 'GACGTC ACT CCATGG TTCGA 5' TCV 12 (SEQ ID NO: 6) After checking the orientation of the introduced oligonucleotide duplex, the resulting vector is linearized with PstI-HindIII followed by the insertion of a 950 base pair PstI-HindIII fragment harboring the potato proteinase inhibitor II terminator (PotPilI) (An, G., Mitra, A., Choi, HK, Costa, MA, An, K., Thornburg, RW and Ryan, CA (1989) The Plant Cell 1: 115-122). The PotPilI terminator is isolated by dp PCR amplification using the chromosomal DNA isolated from potato, see Desiree, as a template and the following group of oligonucleotides: 'GTACCCTGCAGTGTGACCCTAGAC 3' TCV 15 (SEQ ID NO: 7) 5 'TCGATTCATAGAAGCTTAGAT 3' TCV 16 (SEQ ID NO: 8) The TPS expression cassette subsequently cloned as an EcoRI-HindIII fragment within the primary vector pMOG402 which results in pMOg845 (Figure 1). A sample of the Dha strain of E. coli, harboring pMOG485 has been deposited at the Central Bureau voor Schimmelcultures, Oosterstraat 1, P. 0. Box 273, 3740 AG Baarn, The Netherlands, on January 4, 1995; The Access Number given by the Institution Depositarla Internacional is CBS 101.95.

Coupling of three progenitors fc The binary vectors are mobilized in couplings of three progenitors with the E. coli strain HB101 containing the plasmid pRK2013 (Ditta G., Stanfield, S., Corbin, D., and Helinski, DR et al. (1980) Proc. Natl. Acad. Sci. Usa 7_7, 7347) within Agrobacteri um t umefaci ens strain MOG101 or EHA105 and is used for transformation.

Transformation of tobacco (Ni cotiana tabacum SRl) » The tobacco is transformed by co-cultivating plant tissue with Agrobacterium um t umefaciens strain MOG101, which contains the binary vector of interest, as described. The transformation is carried out using the cocultivation of tobacco leaf discs (Ni cotiana tabacum SRl) as described by Horsch et al. 1985, Science 227, 1229-1231. The transgenic plants are regenerated from shoots that develop on the selection medium containing kanamycin, rooted and transferred to the soil.

Transformation of potato tuber discs fc The potato (Sol an um tuberosum see Kardal) is transformed with the Agrobacterium strain EHA105 that contains the binary vector of interest. The basic culture medium is MS30R3 consisting of MS salts (Murashige, T. and Skoog, F. (1962) Psysiol, Plan 1 £, 473), vitamins R3 (Ooms et al. (1987) Theor. Appl. Genet. 7_3, 744), 30 g / 1 of sucrose, 0.5 g / 1 of MES with final pH of 5.8 (adjusted with KOH) solidified when necessary with 8 g / 1 of Daichin agar. Tubers of Solanum tuberosum see Kardal, are peeled and superficially sterilized by burning them in 96% ethanol for 5 seconds. The flames are extinguished in sterile water and slices about 2 mm thick are cut. LQS discs are cut with a core from the vascular tissue and incubated for 20 minutes in MS30R3 medium containing 1-5 x 108 bacteria / ml of Agrobacterium um EHA105 containing the binary vector.

The tuber discs are washed in MS30R3 medium and transferred to the solidified post-culture medium (PM). PM consists of the M30R3 medium supplemented with 3.5 mg / l of zeatin riboside and 0.03 mg / l of indole-acetic acid (IAA). After two days, the discs were transferred to fresh PM medium with 200 mg / l cefotaxime and 100 mg / l vancoicin. Three days later, the tuber discs are transferred to shoot induction medium (SIM) which consists of PM medium with 250 mg / l carbenicillin and 100 mg / l kanamycin. After 4-8 weeks, the shoots emerging from the discs are placed and excised on rooting medium (MS30R3 medium with 100 mg / l cefotaxime, 50 mg / l vancomycin and 50 mg / l kanamycin). The shoots propagate axenically through cuts of the meristem.

Transformation protocols of potato stem segments The potato transformation experiments using stem internodules were performed in a similar manner as described by Newell C.A. et al., Plant Cell Reports 10: 30-34, 1990.

Induction of microtubers Stem segments from potato plants, which harbor an auxiliary meristem, are transferred to microtubule induction medium. The microtuber induction medium contains 1 X MS salts supplemented with vitamins R3, 0.5 g / 1 MES (final pH = 5.8, adjusted with KOH) and solidified with 8 g / 1 Daishi agar, 60 g / 1 of sucrose and 2.5 mg / l of kinetin). After 3 to 5 weeks of growth in the dark at 24 ° C, the micro tubers are formed.

Trehalose assay Trehalose was determined quantitatively by anion exchange chromatography with pulsed amperometric detection. The extracts were prepared by the addition of 1 ml of boiling water to 1 g of frozen material which was subsequently heated for 15 'at 100 ° C. Samples (25 μl) were analyzed on a Dionex DX-300 liquid chromatograph equipped with a 4 × 250 mm carbopac PA-1 column from Dionex 35391, and a 4 × 50 mm carbopac PA-1 precolumn from Dionex 4309.

The elution was with 100 mM NaOH at 1 ml / min. The sugars were detected with a pulsed amperometric detector (Dionex, PAD-2). Commercially available trehalose (Sigma) was used as a standard.

Isolation of Validamycin A fc Validamycin A is isolated from Solacol, a commercial agricultural formulation (Takeda Chem. Indus., Tokyo) as described by Kendall et al. (1990) Phytochemistry, Vol. 29, No. 8, pp. 2525-2528. The procedure involves ion exchange chromatography (QAE-Sephadex A-25 (Pharmacia), bed volume 10 ml, buffer buffer Na-Pi 0.2 mM pH 7) from a 3% agricultural formulation of Solacol. Loading 1 ml of Solacol on a column and eluting with water in 7 fractions, * recover in fraction 4 virtually all Validamycin. Based on 100% recovery, using this procedure, the concentration of Validamycin A was adjusted to 110"3 M in MS buffer, for use in trehalose accumulation tests.Alternatively, Validamycin A and B can be purified directly from Streptomyces hygroscopi cus variety limoneus, as described by Iwasa T. et al., 1971, in The Journal of Antibiotics 2 £ (2), 119-123, the content of which is incorporated by reference herein.

Construction of pMOG1027 fc pMOG1027 harbors the trehalase gene from Solanum tuberosum see Kardal, in the reverse orientation under the control of the promoter of the Cauliflower Mosaic 35S doubly increased. The construction of this vector is very similar to the construction of mMOG799 and can be reviewed by any person skilled in the art. After the mobilization of this binary vector by pairing three progenitors for Agrobacteri umf this strain can be used to transform plant cells and to generate transgenic plants that have reduced levels of trehalase activity.

Construction of pMOG1028 pMOG1028 harbors the trehalase gene from Solanum t uberosum see Kardal, in the reverse orientation under the control of the tuber-specific patatine promoter. The construction of this vector is similar to the construction of pMOG485 and can be performed by any person skilled in the art. After mobilization of this binary vector by pairing three progenitors for Agrobacterium, this strain can be used in potato transformation experiments to generate transgenic plants that have reduced levels of trehalase activity in the tuber tissue.

Construction of pMOG1078 To facilitate the construction of a binary expression cassette harboring the cDNA clone of trehalase in the "sense" orientation under the control of the doubly enhanced CaMV 35S promoter, two HindIII sites were removed from the cDNA coding region of trehalase (without changing the amino acid sequence) by point mutations based on PCR. In this way, a BamHI fragment containing the open reading structure of trehalase was genetically engineered. This fragment was subsequently used for cloning into the primary vector pMOG800 behind the constitutive promoter of 35S CaMV which produces pMOG1078. pMOG800 is derived from pMOG402; the Kpnl site in the pollinator has been restored. pMOG402 is derived, or from pMOG23 (described in International Patent Application WO 95/01446) and houses a restored neomycin-phosphotransferase gene (Yenofsky RL, Fine fc M, Pellow JW, Proc Natl Acad Sci USA 87: 3435 -3439, 1990) .

EXAMPLE 1 Trehalose production in tobacco plants transformed with pMOG799 Tobacco leaf discs are transformed with the binary vector pMOG799 using Agrobacterium tumefaciens. The transgenic shoots are selected on kanamycin. The transgenic plants are transferred to the greenhouse to flower and give seeds after self-pollination (Sl). The seeds of these transgenic plants are transgenically sterilized and germinated in vi tro on medium with kanamycin. Seedlings resistant to kanamycin and wild-type tobacco plants are transferred to MS medium supplemented with Validamycin A 10"J M. As a control, the transgenic seedlings and the wild type plants are transferred to the medium without Validamycin A. The analyzes of the leaves and roots of the plants developed on Validamycin A, show high levels of trehalose compared to the control plants (Table 1 ). Trehalose was not detected in wild-type tobacco plants.

TABLE 1 with Validamycin A without Validamycin A leaf roots root leaf pMOG799. 1 0 .0081 0 .0044 0.003 PM0G799. 13 0 .0110 0 .0080 PMOG799.31 0 .0008 0 .0088 SRl Wild type EXAMPLE 2 Production of trehalose in potato microtubers transformed with pMOG845 Tuber discs of the potato Solanum t uberosum see Kardal, are transformed with Agrobac teri um t umefaci ens EHA105 which houses the binary vector pMOG845. The transgenic shoots are selected on kanamycin. Microtubers (m-tubers) induced on stem segments of transgenic and wild-type plants grown on microtubule-inducing medium supplemented with Validamycin A 10"J M. As a control, microtubers are induced on media without Validamycin A. Microtubers induced on medium with Validamycin A showed high levels of trehalose compared to microtubers developed on medium without Validamycin A (Table 2). Trehalose was not detected in the microtubers of the ilvestre type.

Table 2 Trehalose (% of fresh weight) + Validamycin A - Validamycin A 845-2 0.016 845-4 845-8 0.051 845-13 0.005 845-22 0.121 845-25 0.002 Kardal (wild type) EXAMPLE 3 Production of trehalose in hydroponics of tobacco plants transformed with pMOG799 Seeds (Sl) from self-pollinated tobacco plants, transformed with the binary vector pMOG799 are surface sterilized and germinated in vitro on MS20MS medium containing 50 μg / ml of Kanamycin. Seedlings resistant to Kanamycin are transferred to the soil and grow in a growth chamber (temperature 23 ° C, 16 hours light / day). After four weeks, the seedlings were transformed to hydrocultures with ASEF clay spheres with approximately 450 ml of medium. The medium contains 40 g / 1 of Solacol dissolved in nano-water buffered with 0.5 g / 1 of MES to adjust the pH to 6.0, which is screened through a filter to remove solid particles. The essential salts are supplemented by the addition of POKON® (1.5 ml / l). The following antibiotics are added to prevent the growth of microorganisms. 500 μg / ml Carbenicillin, 40 μg / ml Nystatin and 100 μg / ml Vancomycin. As a control, the transgenic seedlings and the wild-type plants are transferred to medium without Solacol. The analysis of the leaves of the plants developed on Solacol shows high levels of trehalose compared to the control plants (Table 3). Trehalose was not detected in wild-type tobacco plants.

Table 3 Solacol Trehalose (% w / w) pMOG 799.1-1 + 0.008 pMOG 799.1-2 + 0.004 pMOG 799.1-3 pMOG 799.1-4 pMOG 799.1-5 + 0.008 pMOG 799.1-6 pMOG 799.1-7 + 0.005 pMOG 799.1-8 pMOG 799.1-9 pMOG 799.1-10 + 0.007 SR1-1 Wild type SR1-2 Wild type SR1-3 Wild type SR1-4 Wild type EXAMPLE 4 Cloning of a full-length cDNA encoding trehalose from potato tuber Using the amino acid sequence of the conserved regions of the known genes of trehalose (E. coli, yeast, rabbit, B. mori) (figure 3), four degenerate primers were designed: c c c ct GT A TTAT GGTGGIAGATTTAAIGAAGTCT? C ^ GGCTGGGAC Taa * 2 (SEQIDNOrll) GTICCIGGIGGICGITT TAAIGAGTT CGT AG Tas «25 < SEQIDN0: 12) T GA TG A A GGIGG TGS ICGI IAG T? TA C CT CA G G Tasss26 (SEQIDN0: 13) C G AT A I C TTI CCATCC AAICCITC Taa * 27 (SEQIDN0: 14) G A GC G The combinations of these primers in PCR experiments with genomic DNA and cDNA from leaf and tuber material of $. t uberosum see Kardal, respectively, as a template, resulted in several fragments of the expected length. A number of 190 base pair fragments obtained with the combination of primers Tase24 and Tase26 were subcloned into a pGEM T vector and sequenced. Several of the analyzed clones showed homology with the known trehalase sequences. To exclude the isolation of trehalase sequences not derived from plant, Southern blot analysis was performed with the gDNA from the potato see Kardal. A number of isolated clones did not cross-hybridize with the Kardal genomic DNA and were discarded. Two isolated clones were identical, gTasel5.4 derived from a genomic PCR experiment and cTase5.2 derived from a PCR on cDNA, showing both hybridization in Southern blot analysis. A single hybridization band (EcoRI 1.5 kb, HindIII 3 kb and BamHl greater than 12 kb) was detected suggesting the presence of only one copy of the isolated PCR fragment. A cDNA library outside the poly A + RNA was constructed from potato tubers (see Kardal) using a Stratagene cDNA synthesis kit and the Lambda ZAPII vector. Recombinant phages (500,000) were selected with the radiolabelled cTase5.2 PCR fragment, resulting in the identification of 3 positive clones. After purification, two clones were characterized with the restriction enzymes that reveal the inserts of 2.15 and 2.3 kb respectively. Its nucleotide sequence was 100% identical. The nucleic acid sequence of one of these cDNA clones of the trehalose of Sol anum t rans um, including its open reading structure, is described in SEQ ID NO: 9, while the amino acid sequence derived from this sequence of Nucleic acids are shown in SEQ ID NO: 10. A plasmid that houses an insert comprising the genetic information encoding trehalase, has been deposited under the number CBS 804.95 with the Central Bureau voor Schi melcultures, Oosterstraat 1, PO Box 273, 3740 AG Baarn, the Netherlands, on December 8, 1995.

EXAMPLE 5 Homology between the potato trehalase gene and other analogous sun The genomic DNA of tomato was isolated (Lycopersi with esculentum see Money maker), tobacco (Ni coti ana tabacum see Petit havanna, SRl) and potato (Sol an um t uberosum see Kardal), and subsequently digested with the restriction enzymes BamHl, BglII, Ncol, Spel , Accl, HindIII and EcoRI. After gel electrophoresis and Southern spotting, a potato trehalose cDNA probe labeled with [2P] -alpha-dCTP was hybridized for staining. Nearly similar strength hybridization signals were observed in the lines with potato and tomato genomic DNA, indicating a high degree of identity. Only a weak hybridization signal was observed in the bands that harbor the genomic DNA of tobacco, indicating a low degree of identity. A similar strategy can be used to identify the trehalase genes from other crops, and select the crops where the trehalase activity can be eliminated, via the antisense expression strategy, using a heterologous trehalase cDNA clone with sufficient homology. . Alternatively, a cDNA clone of the trehalase, homologous, can be isolated and used in the antisense expression strategy.

EXAMPLE 6 Overexpression of a potato trehalase cDNA in Nicotiana tabacum Tobacco leaf discs are transformed with the binary vector pMOG1078 using Agrobacteri um t umefa ci ens. The transgenic shoots are selected on kanamycin and transferred to the greenhouse. The trehalase activity was determined in leaf samples from 26 transgenic plants and 12 non-transgenic control plants (Figure 5). The trehalase activity up to about 17 μg trehalose / hour / μg protein was measured compared to about 1 μg trehalose / hour / μg protein for the non-transgenic controls. This clearly confirms the identity of the potato trehalase cDNA.

EXAMPLE 7 Transformation of PMOG845 transgenic potato plants, with pMOG1027 In order to supertransform pMOG845 transgenic potato lines with an antisense trehalase construct (pMOG1027), stem segments were cut from potato shoots grown in vitro, transgenic for pMOG845. Three progenitor lines, pMOG845 / ll, / 22 and / 28 were selected, which revealed that they accumulated trehalose in the microtubers, when they were developed on validamycin A. The stem segments were transformed with the binary vector pMOG1027 using Agrobac teri um t umefaci ens. The super-transformants were selected on hygromycin and developed in vi tro.

EXAMPLE 8 Production of trehalose in tubers of transgenic potato plants for pMOG845 and pMOG1027 Microtubers were induced on explants of transgenic potato plants pMOG845, supertransformed with pMOG1027 using medium without the inhibitor of trehalase, validamycin A. The accumulation of trehalose, up to 0.75 mg / g of fresh weight, was noted in the supertransformed lines, testing the reduced activity of trehalase in these lines, using the antisense trehalase expression strategy (Figure 6).

EXAMPLE 9 Isolation of a bipartite TPS / TPP gene from Hel i an th us ann uus To isolate a bipartite clone from H. annuus, a PCR amplification experiment was established using two degenerate primers, TPS-deg2 and TPS-deg5. This first group was used in combination with the cDNA constructed on H. annuus leaf RNA, as a template. A DNA fragment of approximately 650 base pairs was amplified having a high similarity on the amino acid level, when compared to the tps coding regions from E. coli and yeast. Based on their nucleotide sequence, the homologous primers were designed and used in a Marathon RACE protocol (Clontech) to isolate the 5 'and 3' portions of the corresponding tps cDNAs. Using combinations of SUNGSP1 (or 2) / API primers in the RACE PCR, no bands were observed while PCR supplemented with NSUNGSP1 (or 2) / AP2 resulted in several DNA fragments. Some of these fragments were hybridized with a sunflower tps fragment, labeled with -2P, after Southern blotting. Two fragments of approximately 1.2 kb and 1.7 kb, corresponding respectively to the 5 'and 3' part, were isolated from the gel and subcloned and sequenced. The nucleotide sequence revealed a clear homology with the known tps and tpp sequences, indicating the bipartite nature of the isolated cDNA (SEQ ID NO: 1). Using a unique Xmal site, present in both fragments, a complete TPS / TPP bipartite coding region was obtained and subcloned into pGEM-T (Promega) producing pMOG1192 (Figure 2).the.

TPSdßg2: tlg git kit tyy tic aya ylc cit tyc c (SEQIDNO: 23) TFSdegS: gyi aci arr ttc atl ccc tci c (SEQIDNO: 27) SUNGSP1: cga aac ggg ccc atc aat ta. { SEQIDNO: 15) SUGSP2: tcg atg aga tca atg ccg ag (SEQIDNO: 1 «) API (Clontech) cca tcc taa tac gac tca cta tag ggc (SEQIDNO: 17) NSUNGSP1: cac aac agg ctg gta tcc cg (SEQIDNO: 18) NSUNGSP2: caa taa cga act ggg aag cc (SEQXDNO: 19) AP2 (Clontech) act cac tat agg gct cga gcg ge (SEQIDNO: 20) EXAMPLE 10 Isolation of a bipartite TPS / TPP gene from Ni coti ana tabacum Another strategy to isolate the bipartite TPS / TPP genes from plants or other organisms involved the combined use of the TPS and TPP primers in a single PCR reaction. As an example, a PCR was performed using the cDNA generated on total RNA from tobacco leaves and the group of primers TPSdegl and TRE-TPP-16. Nested PCR, using the amplification mixture of the first reaction as a template, with TPSdeg2 and TRE-TPP-15 resulted in a DNA fragment of approximately 1.5 kb. Nested PCR of the original amplification mixture with TPSdeg2 and TRE-TPP-10 yielded a DNA fragment of approximately 1.2 kb. Initial amplification using the primer combination TPSdegl and TRE-TPP-6 followed by a nested PCR, using the primer combination TPSdeg2 and TRE-TPP-15, yielded a DNA fragment of approximately 1.5 kb. Based on the sequential analysis, the 1.2 kb and 1.5 kb amplified DNA fragments showed a high degree of identity to the TPS and TPP coding regions indicating that they encode the TPS / TPP bipartite proteins.

TPSdegl: GAY ITI ATI TGG RTI CAY GAY TAY CA (SEQIDNO: 21) TRE-TPP-16: CCI ACI GTR CAÍ GCR AAI AC (SEQIDNO: 22) TPSdeg2: TIG GIT KIT TYY TIC AYA YIC CIT TYC C (SEQIDNO: 23) T E-TPP-15; TGR TCS ARI ARY TCY TTI GC (SEQIDNO: 24) TRE-TPP-10: CCR TGY TCI GCI SWl ARI CC (SEQIDNO: 25) TRE-TPP-6: TCR TCI GTR AAR TCR TCI CC (SEQIDNO: 26) LIST OF SEQUENCES (1) GENERAL INFORMATION: (i) APPLICANT: (A) NAME: MOGEN INTERNATIONAL NV < B) STREET: Einsteinweg 97? C) CITY: Leyden (E) COUNTRY: THE NETHERLANDS ÍF) POSTAL CODE: 2:33 CB (G) TELEPHONE: (31) 71-5258282 (H) TELEFAX: (31) 71- 5221471 (ii) TITLE OF THE INVENTION: Increased accumulation of trehalose in plants (iii) SEQUENCE NUMBER: 27 (iv) COMPUTER LEGIBLE FORM: (A) TYPE OF MEDIUM: Diskette (B) COMPUTER: IBM compatible PC (C) ) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: Patentln Reléase # 1.0, Version # 1.25 (EPO) (2) INFORMATION FOR SEQ ID NO: 1: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 2621 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA to mRNA (iii) HYPOTHETICAL: no (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 25..2485 (D) OTHER INFORMATION: / function * "trehalose- phosphate-synthase and trehalose-phosphate-phosphatase "/ product *" bipartite enzyme "(xi) CHARACTERISTICS: (A) NAME / KEY: insecure (B) LOCATION: 1609..1611 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1: CTGATCCTGC GGTTTCATCA CAAT ATG ATA CTC TTA CAT CTG ATß CCC CTT 51 Met ie Leu Leu His Leu Met Pro Leu 1 5 CAG ATG CTC CCA AAT AGG TTG ATT GTC GTA TCG AAT CAG TTA CCC ATA 99 Gln Met Leu Pro Asn? Rg Leu lie al Val Ser? Sn Gln Leu Pro lie 10 15 20 25 ATC GCT AGG CTA AGA CTA ACG ACA ATG GAG GGT CCT TTT GGG ATT TC? 147 lie? Rg Leu Arg Leu Thr Thr Met Glu Gly Pro Phe Gly He Ser 30 35 40 CTT GGG ACG AG? GTT CG? TTT? C? TGC? C? TC? G? TG C? T T? C CC? 195 Leu Gly Thr Arg Val? Rg Phe Thr Cys Thr Ser Lys Met His Tyr Pro 45 50 55 C? G CCG TTG AGG 'TTT TCT? TT CTT GGC G? T CC? CT? ? ßß GCT 6? C ßTT 243 Gln Pro Leu Arg Phe Ser He Leu Gly? ap Pro Leu? rg? la? sp Val 60 65 70 GGC CCT? CC G ?? CAA GAT G? C GTG TC? A? G? C? TTG CTC G? T? ßß TTT 291 Gly Pro Thr Glu Gln? Sp? Sp Val Ser Lya Thr Leu Leu? Ap? Rg Phe * 75 80 85 ?? T TGC GTT GCG GTT TTT GTC CCT? CT TC? ??? TGG ß? CC? AT? TT? T 339? Sn Cys Val Wing Val Ph? Val Pro Thr Ser Lys Trp? Sp ßln Tyr Tyr 90 95 100 105 C? C TGC TTT TGT? GC? GT? T TTG TGG CCG? T? TTT CAT T? C ?? G GTT 387 His Cys Phe Cys Lys Gln Tyr Leu Trp Pro He Phe His Tyr Lys Val 110 115 120 CCC GCT TCT G? C GTC ?? G? GT GTC CCG ?? T? GT CGG G? T TC? TGG ?? C 435 Pro Wing Ser Asp Val Lys Ser Val Pro? Sn Ser? Rg? Ap Ser Trp? Sn 125 130 135 GCT T? T 'GTT. C? C GTG ?? C ??? G? ß TTT TCC C? G ?? G GTß? Tß ß? ß GC? 483? The Tyr Val His Val? Sn Lys Glu Phe Ser ßln Lys Val Het ßlu? The 140 145 150 GT? ? CC ?? T CGT? GC ?? T? T GT? TGG? T? C? T G? C TAC C? T TT? ? Tß 531 Val Thr? Sn Arg Ser Asn Tyr Val Trp He His? Sp Tyr Hia Leu Met 155 160 165? C? CT? CCG? CT TTC TTG? GG CGG G? T TTT TGT C TT TT? AA ATC ß? T 579 Thr Leu Pro Thr Phe Leu? Rg? Rg? ßp Phe Cys? Rg Phe Ly? He ßly 170 175 180 185 TTT TTT CTG C? T ? GC CCG TTT CCT TCC TCG G? ß 6TT T? C ?? ß? CC CTA 627 Phe Phe Leu His Ser Pro Phe Pro Ser Ser ßlu Val Tyr Lya Thr Leu 190 195 200 CC? ? TG AGA AAC G? G CTC TTG AAG GGT CTG TTA A? T GCT G? T CTT? TC 675 Pro Met Arg Asn Glu Leu Leu Lys Gly Leu Leu? Sn? La? Sp Leu He 205 210 215 GGG TTC CAT ACA TAC GAT TAT GCC CGT CAT TTT CT? TG TGT TGT GT 723 Gly Phe His Thr Tyr Asp Tyr Ala Arg His Phe Leu Thr Cys Cys Ser 223 225 230 CGA ATG TTT GGT TTG GAT CAT CAG TTG ??? GG GGG T? C? TT TTC TTG 771 Arg Met Phe Gly Leu Asp Hia Gln Leu Lys Arg Gly Tyr He Phe Leu 235 240 245 G ?? TAT AAT GGA? GG AGC ATT GAG ATC ?? G? T? ?? G GCß? GC GGG? TT 819 Glu Tyr Aan Gly Arg Ser He Glu He Lys He Lys? The Ser Gly He 250 255 260 265 CAT GTT GGT CGA ATG G? G TCG T? C TTG? GT C? G CCC G? T? CA? G? TT? 867 His Val Gly Arg Met Glu Ser Tyr Leu Ser Gln Pro? Sp Thr? Rg Leu .270 275 280 CAA GTT CAA G ?? GTC CAA A ?? CGT TCG ?? G G ?? ? TC OTG CT? CTG GG? 915 Gln Val Gln Glu Val Gln Lys? Rg Ser Lys Glu He Val Leu Leu ßly 285 290 295 ßTT G? T G? T TTG G? T? T? TTC ??? GßT ßTß ?? C TTC ?? ß ßTT TT? GCß 963 Val? ßp? Sp Leu? Sp He Phe Lys Gly Val? Sn Phe Ly? Val Leu? The 300 305 310 TTG G? G? AG TTA CTT A ?? TC? C? C CCG? GT TGG C ?? ßßß C6T ßTG G ?? 1011 Leu Glu Lys Leu Leu Lys Ser His Pro Ser Trp Gln ßly? Rg Val ßlu 315 320 325 ?? ß GTG C ?? ATC TTG A? T CCT CTG CGC C? TGC? G? C GTC G? T G? G 1059 Lys Val Gln He Leu? Sn Pro Leu? Rg? Rg Cys ßln? Sp Val? Sp ßlu 330 335 340 345? TC ?? T GCC G? G? T? ? G? ? C? GTC TGT G ?? ? G? ? TC ?? T ?? C G ?? CTG 1 07 He? ßn? Glu He? Rg Thr Val Cys ßlu? Rg He? An? An ßlu Leu 350 355 360 ßß? ? ßC CCG GG? T? C C? G CCC GTT GTß TT? ? TT ß? T ßßß CCC 6TT TCß 1155 ßly Ser Pro Gly Tyr Gln Pro Val Val Uu He? Ap ßly Pro Val Ser 365 370 375 TT? ? ßT G ?? ??? GCT GCT T? T T? T GCT? TC 6CC 6AT? Tß ßC? ? TT 6TT 1203 Leu Ser Glu Lys? The? The Tyr Tyr? The He? La? Sp Met? The He Val 380 385 390? C? CCG TTA CGT GAC G? A CTG? T CTT? TC CCG T? CG? GT? C GTC ßTT 1251 Thr Pro Leu? Rg? Sp ßly Leu? Sn Leu He Pro Tyr ßlu Tyr Val Val 395 400 405 TCC CGA CAA AGT GTT AAT GAC CCA A? T CCC ?? T? CT CC? ??? G? GC 1299 Ser? Rg Gln Ser Val Asn Asp Pro? Sn Pro? Sn Thr Pro Lys Lys Ser 410 415 420 425 ATG CTA GTG GTC TCC GAG TTC ATC GGT GTT TCA CT? TCT TT? ? CC Gßß 1347 Met Leu Val Val Ser Glu Phe He Gly Val Ser Leu Ser Leu Thr Gly 430 435 440 GCC ATA CGG GTC AAC CCA TGG GAT G? G TTG G? G? C? GC? G ?? GC? TT? 1395 - the He Arg Val Asn Pro Trp Asp Glu Leu Glu Thr? Glu? The Leu 445 450 455 T? C GAC GCA CTC ATG GCT CCT GAT G? C C? T ??? G ?? ? CC GCC C? C? TG 1443 Tyr? Ap? Leu Met? Pro? Sp? Sp His Lys ßlu Thr? His Met 460 465 470 ??? C? G T? T C ?? T? C? TT? TC TCC C? T G? T GT? GCT ?? C Tßß GCT? GC 1491 Lys Gln Tyr Gln Tyr He He Ser His? Sp Val? La? Sn Trp? Ser 475 < - '480 485 TTC TTT C ?? G? T TT? G? G C ?? GCG TGC? TC G? T C? T TCT CGT ??? Cß? 1539 Phe Phe Gln Asp Leu Glu ßln Wing Cys He? Sp His Ser? Rg Lys? Rg 490 495 500 505,. TGC? TG? AT TTA GGA TTT GGG TT? G? T? CT? G? GTC GTC TTT TTG? Tß 1587"'Cyß Met? ßn Leu Gly Phe Gly Leu? ßp Thr? Rg Val Val Phe Leu Mat 510 515 520? G?? GT TT? GC?? GT TGG? T? ?? ß? Tß TCT Tßß ?? ß ?? T 6CT T? T TCC 1635? Rg Ser Leu Wing Ser Trp He Lyß Met Ser Trp Lys? An? Tyr Ser 525 530 535 ATG GCT C? A AAT CGG GCC ATA CTT TTG GAC TAT G? C GGC? CT GTT? CT 1683 Mßt Ala Gln Asn Arg? The He Leu Leu? Sp Tyr? Sp ßly Thr Val Thr 540 545 550 CC? TCT? TC? ßT ?? TCT CC?? CT ß ?? ßCT 6TT? TC TCC? T? TC? C 1731 Pro Ser Be Ser Lyß Ser Pro Thr ßlu? The Val He Ser Met He? Sn 555 • 560 565 ??? CTG TGC ?? T G? T CC? ?? G AAC ATG ßTβ TTC? TC ßTT? ßT ßß? CßC 1779 Lyß Leu Cyß? ßn? ßp Pro Lys? Sn Met Val Phe He Val Ser ßly? Rg 570 575 580 585? GT? G? G? G A ?? ? TC TTG GC? GTT GßT TCß GCG CGT GTG? ß? ? CC CßC 1827 Ser? Rg ßlu Lys He Leu? The Val ßly Ser? La? Rg Val? Rg Thr? Rg 590 595 600 C? T TGC? CT G? G C? C GG? T? C TTT? T? ? ßß Tßß GCG GßT G? T C ?? H.H?? 1875 His Cys Thr Glu Hiß ßly Tyr Phe He? Rg Trp? The ßly? Sp ßln ßlu 605 610 615 TGG G ?? ACG TGC GCA CGT GAG AAT AAT GTC GGG TGG ATG G? T GG? ?? T 1923 Trp Glu Thr Cys Wing Arg Glu Asn Asn Val Gly Trp Mßt Aßp Gly? An 620 625 630 CTG AGG CCG GTT ATG AAT CTT TAT ACA G ?? CT? CT G? C GGT TCG T? T 1971 Leu Arg Pro Val Met Asn Leu Tyr Thr Glu Thr? ßp Gly Ser Tyr 635 640 645? TT GAA AAG AAA GAA ACT GCA ATG GTT TGG CAC T? T G ?? G? T GCT G? T 2019 He Glu Lya Lys Glu Thr Wing Met Val Trp His Tyr ßlu Asp Ala? Sp 650 655 660 665 ??? G? T CTT GGG TTG GAG CAG GCT ?? G G ?? CTG TTG ß? C C? T CTT ß ?? 2067 Lys? Sp Leu Gly Leu Glu Gln Ala Lys Glu Leu Leu Asp His Leu Glu 670 675 680 A? C GTG CTC GCT AAT GAG CCC GTT GG? GTG ?? T CG? ? C? GßT C ?? T? C 2115? Sn val Leu Ala? Sn Glu Pro Val Gly Val? Sn? Rg Thr Gly Gln Tyr 685 690 695? TT GT? G ?? GTT ??? DC? C? G TCC CCC? TT? T T? C CTT CTT GTT? Tß 2163 He val Glu val Lys Pro Gln Ser Pro He? ßn Tyr Leu Leu Val Met 700 705 710? C? TTC? T? GGC ACT GAT TGT AGA ATC TTT A? C TT? ?? TTC TTT ??? 2211 • 'Thr Phe He Gly Thr? Sp Cys? Rg He Phe? ßn Leu? Sn Phe Phe Lya 715 720 725 T? T G ?? TGC AAT TAT AGG GGG TC? CT? ??? GGT? T? ßTT GC? G? ß ?? G 2259 Tyr Glu Cys Asn Tyr Arg Gly Ser Leu Lyß Gly He Val Wing Glu Lya 730 735 740 745 ATT TTT GCG TTC ATG GCT ??? ?? G? ??? C? G GCT ß? T TTC ßTβ TTß 2307 He Phe? The Phe Met? The Lys Lys ßly Lys ßln? The? Ap Phe Val Uu 750 755 760? Cß TTß ?? T G? T AGA AGT GAT G ?? G? C? Tß TTT ßTß GCC? TT ßßß ß? T 2355 Thr Leu? ßn Aßp Arg Ser Aßp Glu? ßp Met Phe Val? The He ßly? Ap 765 770 775 ßß? ? T? ??? ?? ß GGT CGG? T? ? CT A? C AAC ?? TC GTG TTT? C? TßC 2403 ßly He Lya Lyß ßly? Rg He Thr? ßn? An? An Ser Val Phe Thr Cya 780 785 790 6T? ßTß ßß? G? G ??? CCG? GT GC? GCT G? ß T? C TTT TT? ?? T ß? T ßTC 2451 Val Val ßly Glu Lyß Pro Ser Ala Ala Glu Tyr Phe Uu? An? Ap Val 795 800 805 TCG? G? ? GC TCC GGG TGT CTC? GC ?? C C ?? Gß? T ß? TCCßß ?? ß 2495 Ser? Rg Ser Ser ßly Cyß Leu Ser? An ßln ßly 810 815 820 CTTCTCßTG? TCTTT? TG? G TT ??? AGTTT TCG? CTTTTT CTTC? TC ?? ß? TTC? Tßßß? 2555 A? GTTGTTC? ATATGAACTT GTGTTCTTGG TTCTGGATTT TAGGG? ßTCT? TGG? T? T ?? 2615 C? TTTC 2621 (2) INFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE CHARACTERISTICS: (A! LENGTH: 820 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (li) TYPE OF MOLECULE: protein (ix) DESCRIPTION OF THE SEQUENCE: SEQ ID NO 3: Met He Leu Leu His Leu Mss Pro Leu Gln Met Uu Pro? Sn? Rg Uu 1 5 10 15 He val Val Ser? ßn ßln Leu Pro He He??? Rg Uu? Rg Uu Thr 20 25 30 Thr Met ßlu Gly Pro Phe ßly He Ser Uu ßly Thr? Rg Val? Rg Phe 35 40 45 v «Thr Cya Thr Ser Lys Met His Tyr Pro ßln Pro Uu? Rg Phe Ser He 50 55 60 Leu ßly? Sp Pro Leu? Rg? La? Sp Val ßly Pro Thr ßlu ßln? Ap? Sp 65 70 75 80 Val Ser Lys Thr Leu Leu? Sp? Rg Phe? Sn Cys Val? Val Phe Val 85 90 95 Pro Thr Ser Lys Trp? ßp ßln Tyr Tyr Hiß Cys Phe Cys Lya ßln Tyr 100 105 110 Uu Trp Pro He Phe Hia Tyr Lya Val Pro? The Ser? Ap Val Lya Ser 115 120 125 '' Val Pro? An Ser? Rg? ßp Ser Trp? ßn? The Tyr Val Hia Val? an Lya 130 135 140 Glu Phe Ser Gln Lya Val Met Glu? the Val Thr? an? rg Ser? an Tyr 145 150 155 160 Val Trp He Hia? sp Tyr His Uu Met Thr Uu Pro Thr Phe Uu? rg 165 170 175 ? rg? sp Phe Cys? rg Phe Lyß He Gly Phe Phe Uu Hia Ser Pro Phe 180 185 190 Pro Ser Ser Glu Val Tyr Lys Thr Leu Pro Met? rg? sn ßlu Uu Uu 195 200 205 Lya Gly Leu Leu Aan Ala Aap Leu He Gly Phe His Thr Tyr Asp Tyr 210 215 220 Wing Arg Hia Phß Leu Thr Cya Cys Ser? Rg M? T Ph? Gly Uu? ßp Hi? 225 230 235 240 Gln Leu Lya Arg Gly Tyr He Phß Leu Glu Tyr? ßn Gly? Rg Ser He 245 250 255He Lya Wing Sßr Gly He Hiß Val Gly? Rg Met Glu Ser 260 265 270 Tyr Leu Ser Gln Pro Aap Thr Arg Uu Gln Val ßln ßlu Val ßln Lya 275 280 285 Arg Sßr Lya Glu He Val Leu Leu Gly Val? ßp? ap Uu? ap He Phe 290 295 300 fc Lys Gly Val Aßn Phe Lyß Val Leu? The Uu ßlu Lya Uu Uu Lys Ser 305 310 315 320 Hia Pro Ser Trp Gln Gly? Rg Val Glu Lya Val Gln He Uu? ßn Pro 325 330 335? Rg? Rg Cya Gln? Ap Val? Ap Glu. He? Sn? La ßlu He? Rg Thr 340 345 350 Val Cys Glu Arg He Asn? Sn Glu Leu ßly Ser Pro ßly Tyr ßln Pro 355 360 365 Val Val Leu He Asp Gly Pro Val Ser Uu Ser ßlu Lya Ala? Tyr 370 375 380 Tyr? La He Wing Asp Met? La He Val Thr Pro Uu? Rg? Sp ßly Uu 385 390 395 400? An Leu He Pro Tyr ßlu Tyr Val Val Ser? Rg ßln Ser Val? An? Ap 405 410 415 Pro? ßn Pro Aßn Thr Pro Lya Lys Ser Met Uu Val Val Ser Glu Phe 420 425 430 He ßly Val Ser Leu Ser Leu Thr ßly? The He? Rg Val? Sn Pro Trp 435 440 445? Ap ßlu Leu Glu Thr? La Glu? The Uu Tyr? Ap? The Uu Met? The Pro 450 455 460? ßp? ßp Hia Lyß Glu Thr? The Hiß Met Lyß ßln Tyr ßln Tyr Xle He 465 470 475 480 Ser His? Sp Val Ala? Sn Trp? The Sßr Phe Phe ßln? Sp Uu ßlu ßln 485 490 495? The Cys He Asp His Ser Arg Lys Arg Cys Met? Sn Uu ßly Phß ßly 500 505 510 Leu Aap Thr Arg Val Val Phe Leu Mßt Arg Sßr Leu? The Ser Trp He 515 520 525 Lys Met Sßr Trp Lys? Sn? The Tyr Ser Met? The ßln? An? Rg? The He 530 535 540 Uu Leu? Sp Tyr Asp Gly Thr Val Thr Pro Ser He Sßr Lya Ser Pro 545 550 555 560 Thr Glu Ala Val He Sßr Met He? An Lya Uu Cya K ?? ? ap Pro Lya 565 570 • 575? ßn Met Val Phe He Val Ser Gly? rg Ser? rg Glu Lya He Uu? the 580 585 590 fc Val Gly Ser Ala Arg Val? rg Thr? rg Hia Cya Thr ßlu Hia ßly Tyr 595 600 605 Phe He? Rg Trp? The ßly? Ap ßln ßlu Trp ßlu Thr Cys? La? Rg ßlu 610 615 620? An? ßn Val Gly Trp Met? Ap Gly? An Uu? Rg Pro Val Met? An Uu 625 630 635 640 Tyr Thr Glu Thr Thr? Sp Gly Ser Tyr He ßlu Lya Lya ßlu Thr? 645 645 655 Met Val Trp His Tyr ßlu? Sp? La? Sp Lys? ßp Uu ßly Uu ßlu ßln 660 665 670? The Lyß ßlu Leu Uu? Sp His Uu ßlu? Sn Val Uu? La? An ßlu Pro 675 680 685 Val ßly Val ? an? rg Thr ßly ßln Tyr He Val ßlu Val Lya Pro ßln 690. 695 700 Ser Pro He? an Tyr Uu Uu Val Met Thr Phe He ßly Thr? ap Cya 705 710 715 720? Rg He Phe? An Leu San Phe Phe Lys Tyr ßlu Cya? An Tyr? Rg ßly 725 730 735 Ser Uu Lys Gly He Val? La ßlu Lya He Phe? The Phe Met? The Lya 740 745 750 Lyß ßly Lya Gln? La? Ap Phe Val Uu Thr Uu? An? Ap? Rg Ser? Ap 755 760 765 Glu? Sp Met Phe Val? Lie Gly? Ap Gly He Lys Lys ßly? Rg Xle 770 775 780 Thr Asn Aan Aan Sßr Val Phe Thr Cys Val Val Gly Glu Lys Pro Ser 785 790 795 800? The? Glu Tyr Ph? Leu Aan Aap Val S? R? Rg S? R Ser? Sly Cys Uu 805 810 815 (2) INFORMATION FOR SEQ ID NO: 3; (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 25 base pairs (5) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) TYPE PE MOLECULE: DNA (genomic) ( iii) HYPOTHETICAL: yes (iii) ANTI-SENSE: no (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 3: AAGCTTATGT TGCCATATAG AGTAG_25_(2) INFORMATION FOR SEQ ID NO: 4: i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 24 pairs of bases (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (0) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) 'HYPOTHETICAL: yes (iii) ANTI-SENSE: no (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 4: GTAGTTGCCA TGGTGCAAAT GTTC 24 (2) INFORMATION FOR SEQ ID NO: 5: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (Ci CHAIN TYPE: simple ( Di TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (ili) HYPOTHETICAL: yes (Xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO. 5: AGCTCTGCAG TGAGGTACCA 20 (2) INFORMATION FOR SEQ. ID NO: 6: (i) CHARACTERISTICS OF THE SEQUENCE: A) LENGTH: 20 base pairs B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple O) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) ) (iii) HYPOTHETICAL: yes (xi) DESCRIPTION OF THE SEQUENCE: SEQ. ID NO: 6? GACGTCACTC CATGGTTCGA 20 (2) INFORMATION FOR SEQ. ID NO: 7: (i) CHARACTERISTICS OF THE SEQUENCE: '• -A) LENGTH: 24 pairs of bases' B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULAR: DNA (genomic) (iii) HYPOTHETICAL: yes (xi) DESCRIPTION OF THE SEQUENCE: SEQ. ID NO: 7: GTACCCTGC? GTGTG? CCCT? G? C 24 (2) INFORMATION FOR SEQ. ID NO: 8: (i) CHARACTERISTICS OF THE SEQUENCE: (A! LENGTH: 21 base pairs (B; TYPE: nucleic acid (C- TYPE OF CHAIN: simple (Di TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: yes (xi) DESCRIPTION OF THE SEQUENCE: SEQ. ID NO: 8 < TCGATTCATA GAAGCTTAGA T 21 2) INFORMATION -FOR SEQ. ID NO: 9: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 2207 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: double (D) TOPOLOGY: linear ii) TYPE OF MOLECULE: cDNA to ARNjn (iii) HYPOTHETIC: no (iii) ANTI-SENSE: no (iv) ORIGINAL SOURCE: lA) ORGANISM: Solanum tuberosum (B) CEPA: Kardal (xi) FEATURES: (A) NAME / KEY: CDS (B) LOCATION: 161..1906 (ix) CHARACTERISTICS: (A) NAME / KEY: characteristic mise B) LOCATION: 842,850 D) OTHER INFORMATION: / function - "putative glycosylation site" (xi) DESCRIPTION OF THE SEQUENCE: SEQ. ID NO: 9: CTTTTCTGAG T ?? T ?? C? T? GßC? TTß? TT TTTTTTC ?? T T? AT ?? C? CC TßC ??? C? TT 60 CCC? TTGCCG GC? TTCTCTO TTCTTAC ??? ?????? C? TT TTTTTGTTC? C? T ??? TT? ß 120 TTATGGCATC AGTATTGAAC CCTTTAACTT GTTAT? C ?? T? TG GGT A ?? GCT? T? . 175 ATT TTT ATG ATT TTT ACT ATG TCT ATG A? T? TG? TT ??? GCT G ?? CT 223 He Phß Met He Phß Thr Mßt Sßr Mßt? Sn Mßt He Lys? The Glu Thr 10 15 20 TGC AAA TCC ATT GAT A? G GGT CCT GT? ? TC CC? ? C? CC CCT TT? GTß 271 Cya Lya Ser He Aap Lya Gly Pro Val He Pro Thr Thr Pro Uu Val 25 30 35 ATT TTT CTT GAA AAA GTT CAA GA? GCT GCT CTT C ?? ? CT T? T GGC C? T 319 He Ph? Leu Glu Lys Val Gln Glu? La? Leu Gln Thr Tyr? Hia 40 45 50 ??? GGG TTT G? T GCT ??? CTG TTT GTT G? T? TG TC? CTG? ß? ß? ß? ßT 367 Lys ßly Phß Asp Ala Lys Leu Phe Val? Ap Mßt Ser Uu? Rg ßlu Ser 55 - '60 65 CTT TC? GAA ACA GTT GA? GCT TTT ?? T AAG CTT CCA AGA ßTT ßTG A? T 415 Leu Ser Glu Thr Val Glu? The Phe? ßn Lyß Uu Pro? Rg Val Val? An 70 75 80 85, GGT TC? ? TA TC? ??? ? GT G? T TTG G? T G6T TTT? T? ßßT? ßT T? C TTß 463"Gly Sßr He Ser Lys Ser? sp Leu? sp Gly Phe He ßly Ser Tyr Uu 90 95 100? GT? GT CCT G? T ?? GG? T TTG GTT T? T GTT ß ? G CCT? T? ß? T TTT? T? 511 Ser Ser Pro A? P Ly? A? P Le? Val? Tyr Val??? Pro Met? Ap Phe Val 105 110 115 GCT G? G CCT G ?? GGC TTT TTG CC? AAG GTG A? G? T TCT G? ß ßTß? ßß 559? The Glu Pro Glu Gly Phe Leu Pro Lyß Val Lys? ßn Ser Glu Val? Rg 120 125 130 GC? TGG GC? TTG ß? ß GTß C? T TC? CTT Tß? ? ß ?? T TT?? ßT? ßß ??? 607? the Trp? the Leu ßlu Val Hiß Ser Uu Trp Lys Kan Uu Ser? rg Lya 135 • 140 145 GTG 6CT G? TC? T GT? TTG G? ??? CC? G? G TTG T? T? CT TTG CTT CC? 655 Val? La? Sp His Val Uu ßlu Lya Pro ßlu Leu Tyr Thr Uu Uu Pro 150 155 160 165 TTß ??? ?? T CC ? ßTT? TT? TA CC? G?? TC? C? TT TT? ß ß? ß ßTT T? T 703 Leu Lyß? ßn Pro Val He He Pro Gly Ser? rg Phe Lya Glu Val Tyr 170 175 180 T? T TGG G? T TCT T? T TGG GT?? T?? ßß GGT TTG TT? ßC?? ßC ???? Tß 751 Tyr Trp Asp Ser Tyr Trp Val He Arg ßly Uu Uu? The Ser Lyß Met 185 190 195 T? T G? ACT GCA AAA GGG ATT GTG ACT A? T CTG GTT TCT CTG? T? G? T 799 Tyr Glu Thr Wing Lys Gly He Val Thr Asn Leu Val Ser Leu He Aap 200 205 210 CA? TTT GGT TAT GTT CTT A? C GGT GC? ? G? GC? T? C T? C? GT ?? C? G? 847 Gln Phe Gly Tyr Val Leu? Sn Gly? La? Rg? The Tyr Tyr Ser? Sn? Rg 215 220 225 AGT CAG CCT CCT GTC CTG GCC ACG ATG? TT GTT G? C? T? TTC ?? T C? G 895 Sßr Gln Pro Peo Val Leu? Thr Mßt He Val? Sp He Phe? Sn Gln 230 235 240 245? C? GGT GAT TTA AAT TTG GTT AGA AG? TCC CTT CCT ßCT TTß CTC AAG 943 Thr Gly Asp Leu Asn Leu Val Arg Arg Ser Uu Pro? Uu Uu Lya 250 2S5 260 G? G ?? T CAT TTT TGG A? T TC? GG? ? T? C? T ?? G GTG? CT? TT C ?? ß? T 991 Glu? ßn His Phe Trp? ßn Ser Gly He Hiß Lyß Val Thr He Gln? Ap 265"- 270 275 GCT C? G G? TC? AAC CAC AGC TT?? TG CGG T? CT? T GCT? T? T? B? T 1039? The ßln Gly Ser? ßn Hi? Ser Leu Ser? Rg Tyr Tyr? The Met Trp? An 280 285 290. ?? G CCC CGT CC? G ?? TCG TC?? CT? T? G? C? GT G?? C? GCT TCC GT? 1087 'Ly? Pro? Rg Pro Glu Ser Ser Thr He? ßp Ser ßlu Thr? La Ser Val 295 300 305 CTC CC? T ATA TGT GA? TO?? AG? G ?? TT? T? C CGT G ?? CTG GCA TC? 1135 Leu Pro? Sn He Cys Glu Ly?? Rg Glu Uu Tyr? Rg ßlu Uu? La Ser 310 315 320 325 GCT GCT G ?? AGT GG? TGG G? T TTC? GT TC? ? G? TGG? Tß AGC A? C Gß? 1183? The? Glu Sßr Gly Trp? ßp Phe Ser Ser? Rg Trp Met Ser? ßn Qly 330 335 340 TCT ß? T CTG AC? ? C? ? CT? ßT ACA? C? TC? ? TT CT? DC? ßTT ß? T TTß 1231 Sßr? ßp Uu Thr Thr Thr Ser Thr Thr Ser He Uu Pro Val? ap Uu 345 3S0 355 ?? T GC? TTC CTT CTG ?? ß? Tß ß ?? CTT ß? C? TT GCC TTT CT? GC? T 1279? An? The Phe Leu Uu Lya Met Glu Leu? Ap Xle? The Phe Uu? The? An 360 365 370 CTT GTT GG? G ?? GT AGC ACG GCT TCA C? T TTT? C? H.H?? GCT GCT C ?? 1327 Leu Val Gly Glu Ser Ser Thr? La Ser His Phe Thr ßlu? La? La ßln 375 380 385 ?? T? G? C? G AAG GCT AT? AAC TGT ATC TTT Tßß A? C GC? G? ß? Tß ßßß 1375? Sn? Rg Gln Lys? The He? Sn Cy? He Phe Trp? ßn? The Glu Met ßly 390 395 400 405 CAA TGG CTT GAT TAC TGG CTT ACC AAC AGC GAC AC? TCT G? G G? T? TT 1423 Gln Trp Leu Aap Tyr Trp Leu Thr Aan Ser Aap Thr Ser Glu? Sp He 410 415 420 TAT AA? TGG GAA GAT TTG CAC CAG A? C ?? G ?? G TC? TTT GCC TCT ?? T 1471 Tyr Lys Trp Glu Aap Leu Hia Gln Aan Lys Lys Ser Phe? The Ser? An 425 430 435 TTT GTT CCG CTG TGG ACT GAA ATT TCT TGT TCA G? T ?? T ?? T? TC ? C? 1519 Phß Val Pro Leu Trp Thr Glu He Ser Cyß Ser? Sp? Sn? ßn He Thr 440 445 450? CT C? G AAA GTA GTT CA? GT CTC? TG? GC TCG GGC TTG CTT C? G CCT 1567 Thr Gln Lys Val Val Gln S? R Leu Met Ser Ser Gly Uu Uu Gln Pro 455 460 465 GC? GGG ATT GCA ATG ACC TTG TCT A? T? CT GG? C? G C ?? Tßß ß? T TTT 1615? The Gly He? The Met Thr Leu Ser? An Thr Gly Gln ßln Trp? Sp Phe 470 J 475 480 485 CCG ?? T GGT TGG CCC CCC CTT C ?? C? C? T? ? TC? TT ß ?? ßßT CTC TT? 1663 Pro? Sn Gly Trp Pro Pro Leu Gln 'Hi? He He He? ßlu ßly Uu Uu 490 495 500 t AGG TCT GG? CTA GA? G? G GCA AGA ACC TT? GC? ??? ß? C? TT GCT? TT 1711 •• '? rg Ser Gly Leu Glu Glu? la? rg Thr Uu? la Lya? ap He? la Xle 505 510 515 CGC TGG TTA AGA ACT AAC TAT GTG? CT T? C ??? ? CC ßßT GCT? Tß 1759? Rg Trp Leu Arg Thr Aßn Tyr Val Thr Tyr Lyß Lyß Thr ßly? The Met 520 525 530 T? T G ?? AAA TAT G? T GTC? C? ??? TGT Gß? GC? T? T G? ßßT GGT ßßT 1807 Tyr ßlu Lys Tyr? sp Val Thr Lys Cys ßly? Tyr ßly ßly ßly ßly 535 540 545 ß ?? T? T? TG TCC C ?? ? CG GGT TTC Gß? Tßß TC? ?? T GGC ßTT GT? CTß 1855 ßlu Tyr Met Ser ßln Thr ßly Phe Gly Trp Ser? An ßly Val Val Uu 550 555 560 565 GC? CTT CTA GAß GA? TTT GG? TGG CCT ß ?? G? T TTß ?? ß? TT ß? T TOC 1903? The Uu Leu Glu Glu Phe Qly Trp Pro ßlu? Ap Uu Lya Xle? ßp Cys 570 575 580 T ?? Tß? ßC ?? GTAGAAAAGC C ??? TG ??? C? TC? TTG? GT TTT? TTTTCT TCTTTT? TT? 1963 ??? T ?? ßCTG C ?? TGGTTTG CTG? T? ßTTT? T? TTTT? T? TT? CT? TTTC? T ?? ßßTTTT 2023 TGTACCATAT CAAGTGATAT TACC? Tß ?? C T? TGTCGTTC ßß? CTCTTC ?? TCßß? TTT 2083 TGCAAAAATA ATGCAGTTTT Gß? ß ?? TCCß ATA? C? T? G? CC? TßT? TGG? TCT ??? TTß 2143 T ??? C? GCTT ACTATATTAA GT ???? G ??? G? TG? TTCCT CTGCTTT ??? ?????????? 2203 A ??? 2207 2) INFORMATION FOR SEQ. ID NO: 10: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 581 base pairs (B) TYPE: amino acid (Di TOPOLOGY: linear (ii) TIF 'OE MOLECULE: protei? A (xi) LE £ - PION OF SEQUENCE: SEQ ID NO: 10: Met Gly Lys Wing He He Phe Met He Phe Thr Met Ser Met? Sn Met 1 5 10 15 He Lys? Glu Thr Cya Lya Ser He? ßp Lyß ßly Pro Val He Pro 20. * 25 30 Thr Thr Pro Leu Val He Phe Leu Glu Lya Val ßln ßlu? La? The Uu 35 40 45 ßln Thr Tyr Gly Hia Lys Gly Phe? Sp? The Lya Uu Phe Val? ßp Met 50 55 60 Ser Uu? Rg Glu Ser Leu Ser Glu Thr Val Glu? The Ph? An Lys Uu 65 70 75 80 Pro? Rg val Val? Sn Gly S? R He Ser Lys Ser Asp Uu Asp Gly Phe 85 90 95 He Gly S? R Tyr Leu Being Pro Asp Lys? ßp Uu Val Tyr Val ßlu 100 105 110 Pro Met? ßp Phe Val? ßlu Pro ßlu ßly Phe Uu Pro Lya Val Lya 115 120 125? An Ser ßlu Val? Rg? The Trp? The Leu ßlu Val Hia Ser Uu Trp Lya 130 '135 140? Sn Uu Ser? Rg Lya Val? La? Ap Hi? Val Uu? Lis Lya Pro? Lis Uu 145 150 155 160 Tyr Thr Leu Leu Pro Uu Lyß? An Pro Val He Xle Pro ßly Ser? Rg 165 170 175 Phe Lya Glu Val Tyr Tyr Trp? Ap Ser Tyr Trp Val Xle? Rg ßly Uu 180 185 190 Uu? The Sßr Lya Met Tyr Glu Thr? La Lya Gly He Val Thr? ßn Uu 195 200 205 Val Ser Leu le Aap Gln Phe Gly Tyr Val Leu? Sn Gly? La? Rg? La 210 215 220 Tyr Tyr Sßr Aan? Rg Ser Gln Pro Pro Val Leu? Thr Met He Val 225 230 235 240? Sp Hß Phe Aan Gln Thr Gly Aap Leu? An Leu Val? Rg? Rg Ser Uu 245 250 255 Pro Wing Leu Leu Lya Glu Asn His Phß Trp? Sn Ser Gly He His Lya 260 265 270 Val Thr He Gln Asp Wing Gln Gly Sßr Asn His Ser Uu Ser? Rg Tyr 275 280 285"• / t? The Mßt Trp? Sn Lys Pro? Rg Pro Glu S? R Ser Thr Xle? ßp Ser 290 295 300 Glu Thr? La Se? -Val Leu Pro? ßn He Cys Glu Lys? Rg ßlu Uu Tyr 305 310 315 320? Rg Glu Leu Wing? Glu Ser Gly Trp? Ap Phe Ser Ser? Rg 325 330 335 Trp Met Ser Asn Gly Ser Aßp Uu Thr Thr Thr Ser Thr Thr Ser Xle 340 345 350 Uu Pro Val Asp Leu? Sn? The Phe Uu Uu Lys Met ßlu Uu? Sp Xle 355 360 365? The Phß Leu Ala Aßn Leu Val ßly ßlu Ser Ser Thr? The Ser Hiß Phe 370 375 380 Thr Glu? Ala Gln Aßn? Rg Gln Lyß? The He? An Cya He Phe Trp 385 390 395 400? ßn? The Glu Met Gly Gln Trp Leu? Ap Tyr Trp Uu Thr? An Ser? Ap 405 410 415 Thr Ser 'Glu? Ap He Tyr Lys Trp ßlu? Sp Uu Hia ßln? An Lya Lya 420 425 430 Ser Phe? La Ser? ßn Phe Val Pro Leu Trp Thr ßlu He Ser Cya Ser 435 440 445? Ap? ßn? sn He Thr Thr ßln Lys Val Val ßln Ser Uu Met Ser Ser 450 455 460 Gly Uu Leu Gln Pro? the Gly He? the Met Thr Uu Ser? an Thr ßly 465 470 475 480 Gln Gln Trp Asp Phe Pro? Sn Gly Trp Pro Pro Uu ßln His He He 485 490 495 Hß Glu Gly Leu Leu Arg Sßr Gly Leu Glu Glu Wing Arg Thr Leu? The 500 505 510 Lya? Ap He Wing He Arg Trp Leu? rg Thr? ßn Tyr Val Thr Tyr Lya 515 520 525 Lys Thr Gly Wing Mßt Tyr Glu Lys Tyr Asp Val Thr Lya Cyß Gly Wing 530 535 540 Tyr Gly Gly Gly Gly Tlu Mßt Ser Gln Thr Gly Phe Gly Trp Ser 545 550 555 560 Aßn Gly Val Val Leu? The Leu Leu Glu Glu Ph? Gly Trp Pro Glu? Ap 565 570 575 2) INFORMATION FOR SEQ. ID NO: 11: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid < Cj TYPE OF CHAIN: simple (J) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: yes (? x) FEATURES: (A). NAME / KEY: modified base (3) LOCATION: 6 (D) OTHER INFORMATION: base mod - i (ix) CHARACTERISTICS:. A) NAME / CI? VE: modified base -B) LOCATION: 5 (D) OTHER INFORMATION: / base mod - i (xi) DESCRIPTION OF THE SEQUENCE: SEQ. ID NO: 11: GGYGGNMGMT TYRWNGARKT MTAYKRYTGG GAC 33 2) INFORMATION FOR SEQ. ID NO: 12: (i) CHARACTERISTICS OF THE SEQUENCE: A) LENGTH: 26 base pairs B) TYPE: nucleic acid C) TYPE OF CHAIN: simple D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: yes (ix) CHARACTERISTICS: (A) NAME / KEY: modified base? ß) LOCATION: 3 • D) OTHER INFORMATION: / base mod - Xl) CHARACTERISTICS: (A) NAME / KEY: modified base (B) LOCATION: 6 (D) OTHER INFORMATION: / base mod «i (ix) FEATURES: (A) NAME / KEY: modified base IB)» LOCATION: 9 .0) * OTHER INFORMATION: / base mod - i (ix) FEATURES: (A) NAME / KEY: modified base IB) LOCATION: 12 iD) OTHER INFORMATION: / base mod - i (ix) FEATURES: (A) NAME / KEY: modified base iB) LOCATION: 15 (T) > OTHER INFORMATION: / base mod «i (ix) CHARACTERISTICS: IA) NAME / KEY: modified base (B) LOCATION: 21? D) OTHER INFORMATION: / base mod - (i) DESCRIPTION OF THE SEQUENCE: SEQ. ID NO: 12: C GTNCCNGGNG GNCGNTTYRW NGARKT 2) INFORMATION FOR SEQ. ID NO: 13: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 26 base pairs (3) TYPE: nucleic acid (OR CHAIN TYPE: simple (D) TOPOLOGY: linear (ü) TYPE OF MOLECULE: DNA (genomic) (iii) ) HYPOTHETICAL: yes (ix) FEATURES: (A) NAME / KEY: modified base (B) LOCALIZATION: 3 (D) OTHER INFORMATION: / base mod »i (ix) FEATURES: (A) NAME / KEY: modified base ( B) LOCALIZACIOM: 9 (C? OTHER INFORMATION: / base mod - i (ix) FEATURES: (Ai NAME / KEY: modified base (3) LOCALIZACICM: 12 (C? OTHER INFORMATION: / base mod - i (ix) CHARACTERISTICS: (A) NAME / KEY: modified base * (B) VOCALIZATION: 15 (C 'OTHER INFORMATION: / base mod « (ix) CHARACTERISTICS: (A) NAME / KEY: modified base (B) LOCATION: 18 (C) OTHER INFORMATION: / base mod » (xi) DESCRIPTION OF THE SEQUENCE: SEQ. ID NO: 13: GGNGGYTGNS NCGNYRNAG RTARTA 26 2) INFORMATION FOR SEQ. ID NO: 14: (i) CHARACTERISTICS OF THE SEQUENCE: (Ai LENGTH: 24 base pairs (B? TYPE: nucleic acid (i TYPE OF CAYENA: simple (D) TOPOLOGY: linear (ii) (T PO OF MOLECULE: DNA (genomic) * (iii) HYPOTHETICAL: yes Ix) FEATURES: () NAME / KEY: modified base (B) LOCALIZATION: 1 (D) OTHER INFORMATION: / base mod - (ix) FEATURES: (A, NAME / KEY: modified base (E) LOCALIZATION: 7 ( C, OTHER INFORMATION: / base mod »(ix) FEATURES: (A1 NAME / KEY: modified base (B) LOCATION: 19 (D) OTHER INFORMATION: / base mod - (ix) FEATURES: (Ai NAME / KEY: base modified (B) LOCALIZATION: 22 (; OTHER INFORMATION: / mod base - (xi) DESCRIPTION OF THE SEQUENCE: SEQ. ID NO: 14: NSCRTTNRYC CATCCRAANC CNTC 24 (2) INFORMATION FOR SEQ. ID NO: 15: (i) CHARACTERISTICS OF THE SEQUENCE: (A) ^ LENGTH: 20 base pairs (B? TYPE: nucleic acid (C) TYPE OF CHAIN: simple (Di TOPOLOGY: linear (ii) TYPE OF MOLECULE: CDNA (iii) HYPOTHETICAL: no (xi) DESCRIPTION OF THE SEQUENCE: SEQ. ID NO: 15: CGAAACGGGC CCATCAATTA 20 (2) INFORMATION FOR SEQ. ID NO: 16 (1) SEQUENCE CHARACTERISTICS:? A) LENGTH: 20 base pairs .3) TYPE: nucleic acid. (C) TYPE OF CHAIN: simple '(D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: no (xi) DESCRIPTION OF THE SEQUENCE: SEQ. ID NO: 16: TCGATGAGAT CAATGCCGAG 20) INFORMATION FOR SEQ. ID NO: 17: (i) CHARACTERISTICS OF THE SEQUENCE: (Ai LENGTH: 27 base pairs (Bi TYPE: nucleic acid (C) TYPE OF CHAIN: simple (Di TOPOLOGY: linear (ll) TYPE OF MOLECULE: cDNA (lii) HYPOTHETICAL: no (xi) DESCRIPTION OF THE SEQUENCE: SEQ. ID NO: 17: CCATCCTAAT ACGACTCACT ATAGGGC 27 2) INFORMATION-FOR SEQ. ID NO: 18: (i) CHARACTERISTICS OF THE SEQUENCE: A) LENGTH: 20 base pairs 3) TYPE: nucleic acid O CHAIN TYPE: simple? D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: no (xi) DESCRIPTION OF THE SEQUENCE: SEQ. ID NO: 18: CACAAACAGGC TGGTATCCCG 20 2) INFORMATION FOR SEQ. ID NO: 19: (i), CHARACTERISTICS OF THE SEQUENCE: i A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE : CDNA (iii) HYPOTHETICAL: no (xi) DESCRIPTION OF THE SEQUENCE: SEQ. ID NO: 19: CAATAACGAA CTGGGAAGCC 20 (2) INFORMATION FOR SEQ. ID NO: 20: MY CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 23 base pairs (B, TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA ( iii) HYPOTHETICAL: no (xi) DESCRIPTION OF THE SEQUENCE: SEQ. ID NO: 20: ACTCACTATA G3GCTCGAGC GGC 33. (2) INFORMATION ABOUT SEQ. ID NO: 21: (i) CHARACTERISTICS OF THE SEQUENCE. UJNGITUD: 26 base pairs (B? TYPE: nucleic acid (C) TYPE OF CHAIN: simple .. (Di TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: no (ix) CHARACTERISTICS: (A) NAME / KEY: modified base (Bi LOCALIZACTON: 4 (Di OTHER INFORMATION: / mod base «i (ix) FEATURES: (A) NAME / KEY: modified baae. (B) LOCATION: 6 . '(D. OTHER INFORMATION: / base mod «i (ix) CHARACTERISTICS: (A) NAME / KEY: modified baae (B * LOCAL! ZATION: 9 (D) OTHER INFORMATION: / mod base» (ix) FEATURES: (A) NAME / KEY: modified baße (B) LOCATION: 15_ (Say OTHER INFORMATION: / base mod - (xi) DESCRIPTION OF THE SEQUENCE: SEQ. ID NO: 21: GAYNTNATNT GGRTNCAYGA YTAYCA 26 (2) INFORMATION FOR SEQ. ID NO: 22: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: CDNA (iii) HYPOTHETIC: no (ix) CHARACTERISTICS: (A) NAME / KEY: modified base (B) LOCATION: 3 (D) OTHER INFORMATION: / base mod »i (ix) FEATURES: (A) NPMBRE / KEY: modified base (B) VOCALIZATION: 6 (n) OTHER INFORMATION: / baße mod «i (ix) CHARACTERISTICS: (A) NAME / KEY: modified base (B) LOCATION: 12 (C) OTHER INFORMATION: / mod base «i (ix) FEATURES: (A) NAME / KEY: modified base (B) LOCATION: 18 (D, OTHER INFORMATION: / base mod « (xi) DESCRIPTION OF THE SEQUENCE: SEQ. ID NO: 22: CCNACNGTRC ANGCRAANAC 20 »* (2) INFORMATION FOR SEO. ID NO: 23: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (OR CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (iü) HYPOTHETICAL: no (ix) FEATURES: (A) NAME / KEY: modified base ÍB) LOCATION: 2 (D) OTHER INFORMATION: / base mod - y (ix) FEATURES: (A) NAME / KEY: modified base (B) LOCATION: 5 (D) OTHER INFORMATION: / base mod «i (ix) CHARACTERISTICS: (A) NAME / KEY: modified base (B) LOCATION: 8 (D) - OTHER INFORMATION: / base mod« i ( ix) FEATURES: (A) NAME / KEY: modified base (3) LOCATION: 14 (D) - OTHER INFORMATION: / base mod «i (i) CHARACTERISTICS: (A) NAME / KEY: modified base (B) LOCATION: 20 (D). OTHER INFORMATION: / base mod - i (ix) FEATURES: (A) NAME / KEY: modified base (B). LOCATION: 23 (D) OTHER INFORMATION: / mod base » (xi) DESCRIPTION OF THE SEQUENCE: SEQ. ID NO: 23: TNGGNTKNTT YYTNCAYAYN CCNTTYCC 28 (2) INFORMATION FOR SEQ. ID NO: 24: (i) (CHARACTERISTICS OF THE SEQUENCE: • A) LENGTH: 20 base pairs (B) TYPE: nucleic acid! C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE : CDNA (iii) HYPOTHETICAL: no (ix) CHARACTERISTICS: (A) NAME / KEY: modified base (Bl LOCALIZACTON: 6 (Say OTHER INFORMATION: / baae mod «(ix) FEATURES: (A) NAME / KEY: modified base (B) LOCATION: 9. { Z) OTHER INFORMATION: / base mod = i (ix) CHARACTERISTICS: (A) NAME / KEY: modified base (B) LOCALIZACT N: 18 \ Z) OTHER INFORMATION: / base mod «i (xi) DESCRIPTION OF THE SEQUENCE: SEQ. ID NO: 24: TGRTCNARNA RYTCYTTNGC 20 (2) INFORMATION FOR SEQ. ID NO: 25: (i) CHARACTERISTICS OF THE SEQUENCE: i A) LENGTH: 20 base pairs (B) »TYPE: nucleic acid (C)" TYPE OF CHAIN: simple (D) TOPOLOGY: linear (Ü) TYPE OF MOLECULE: cDNA (iii) HYPOTHETIC: no (ix) CHARACTERISTICS: (A) NAME / KEY: modified base (B) LOCATION: 9 (D) OTHER INFORMATION: / base mod - (ix) CHARACTERISTICS:?) NAME / KEY: modified base! B) LOCATION: 12 (C) OTHER INFORMATION: / base mod - (ix) FEATURES: (A) NAME / KEY: modified baae < B) LOCALIZACTON: 15 OR OTHER INFORMATION: / baae mod - (ix) FEATURES: (A) NAME / KEY: baae modified 'B) LOCATION: 18: C) OTHER INFORMATION: / mod base »i (xi) DESCRIPTION OF THE SEQUENCE: SEQ. ID NO: 25: CCRTGYTCNG CNSWNARNCC (2) INFORMATION FOR SEQ. ID NO: 26: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (ii) TI PC OF MOLECULE : CDNA 1C (iii) HYPOTHETICAL: no (ix) CHARACTERISTICS: (A) NAME / KEY: modified base (B) LOCATION: 6 l (D) OTHER INFORMATION: / base mod * i (ix) FEATURES: (A) NAME / KEY: modified base (B) LOCATION: 17 2c (DI OTHER INFORMATION: / base mod - i (xi) DESCRIPTION OF THE SEQUENCE: SEQ. ID NO: 26: TCRTCNGTRA ARTCRTCNCC 20 2) INFORMATION FOR SEQ. ID NO: 27: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 22 base pairs 30 (ß) TYPE: nucleic acid (OR CHAIN TYPE: simple (D) TOPOLOGY: linear i 35 (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETIC: no 40 (ix) CHARACTERISTICS: (A) NAME / KEY: modified baae (B) LOCATION: 3? D) OTHER INFORMATION: / baae mod -i 45 (ix) CHARACTERISTICS: (A) NAME / KEY: modified base 'B) LOCATION: 6 (C) OTHER INFORMATION: / baae mod - i 50 (ix) CHARACTERISTICS: (A) NAME / KEY: modified baae? B) LOCATION: 15 (I.) OTHER INFORMATION: / mod base »i (ix) FEATURES: (A) NAME / KEY: modified base (B) LOCALI ZATION: 21 (jj OTHER INFORMATION: / base mod - i (xi) DESCRIPTION OF THE SEQUENCE: SEQ. ID NO: 27: GYNACNARRT TCATNCCRTC NC 22 It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

Having described the invention as above, property is claimed as contained in the following:

Claims (24)

1. A process for the production of trehalose in plant cells capable of producing trehalase, by developing plant cells that have the genetic information required for the production of trehalose and trehalase, or by cultivating a plant or a part thereof comprising such plant cells , characterized the process because said plant cells are developed, or the plant or a part of it, is grown in the presence of a trehalase inhibitor.

2. A process according to claim 1, characterized in that the plant cells have been genetically altered to contain a gene that codes for an enzyme that synthesizes trehalose, bipartite, in a form expressible in plants.

3. A process according to claim 1, characterized in that the plant cells have been genetically altered to contain a chimeric trehalose phosphate synthase gene, in an expressible form in plants, preferably wherein the trehalose-phosphate gene synthase comprises an open reading frame that encodes the trehalose phosphate synthase of E. coli, in expressible form in plants, more preferably wherein the reading structure encoding the trehalose phosphate synthase of E. coli, it is downstream of the CaMV 35S RNA promoter or the potato patatin promoter.

4. A process according to any one of claims 1 to 3, characterized in that a Solanum tuberosum plant is cultivated, preferably wherein said plant has microtubers.

5. A process according to claim 4, characterized in that the plant is grown in vi tro,

6. A process according to any of claims 1 to 5, characterized in that the trehalase inhibitor comprises validamycin A in a form suitable for uptake by said plant cells, by the plant, or a part thereof, preferably where the concentration of validamycin A is between 100 nM and 10 mM, more preferably between 0.1 and 1 mM.

7. A process according to any of claims 1 to 5, characterized in that the trehalase inhibitor comprises the 86 kD prot.ein of the cockroach (Periplaneta americana) in a form suitable for uptake by the plant cells, the plant or a part of it.

8. A process according to any one of claims 1 to 5, characterized in that the plant cells have been genetically altered to contain the genetic information for a trehalase inhibitor, preferably wherein the trehalase inhibitor is the antisense gene for the gene which encodes the information for trehalase, or where the inhibitor of trehalase is the 86 kD protein of the American cockroach (Periplaneta americana).

9. A process according to any of claims 1 to 8, characterized in that a plant, or a part of it accumulates trehalose in an amount above 0.01% (fresh weight).

10. A plant or a part thereof, or cells of the plant, obtainable by a process according to any of claims 1 to 9, characterized in that it contains trehalose in an amount above 0.01% (fresh weight), preferably in where said plant, or a part of it is a species of Solanaceae, more preferably Sol an um t uberosum or Ni cotiana tabacum.

11. A plant part according to claim 10, characterized in that it is a tuber or a microtuber.

12. The tuber or microtubers of Solanum tuberosum, characterized because they contain trehalose.

* 13. The use of a plant, or a part of the plant, according to claim 10, characterized in that it is for the extraction of trehalose.

14. The use of a plant, or part of the plant, according to claim 10, characterized in that it is for a process of forced extraction of water from said plant or part of the plant.

15. A plant according to claim 10, characterized in that it has an increased tolerance to extreme conditions, preferably increased tolerance to drought.

16. A plant-expressible chimeric gene, characterized in that it comprises in sequence a region of transcription initiation, obtainable from a gene, preferably expressed in a part of the plant, particularly the patatin gene from Solanum tuberosum, a 5 'guide untranslated, an open reading structure that encodes a trehalose phosphate synthase activity, and downstream of said open reading structure, a transcription terminator region, preferably wherein said transcription terminator region is obtainable from gene II of the proteinase inhibitor, from Solanum t uberosum.

17. A gene derived from a plant and a gene expressible in plants, characterized in that it encodes a bipartite enzyme synthesizing trehalose.

18. A vector, characterized in that it comprises a chimeric gene expressible in plants, according to claim 16 or 17.

19. A recombinant plant genome, characterized in that it comprises a chimeric gene according to claim 18.

20. A plant cell, characterized in that it has a recombinant genome according to claim 18.

21. A plant or a part thereof, characterized in that it consists essentially of cells according to claim 20, preferably a plant of the species Solanum t uberosum.

22. A part of the plant according to claim 21, characterized in that it is a tuber or a microtuber.

23. A process for obtaining trehalose, characterized in that it comprises the steps of developing the plant cells according to claim 20, or cultivating the plant according to claim 21, or cultivating a part of the plant according to any of the claims 21 or 22, extracting the trehalose from said cells of the plant or parts thereof.

24. A process for obtaining trehalose, characterized in that it comprises the steps of producing trehalose in cells of the plant, in a plant or in a part thereof, according to a process according to any of claims 1 to 9, and separating or extracting the trehalose from said plant cells, from the plant or from part thereof.