JPWO2005001088A1 - Application of a promoter that works by sugar deficiency in cultured plant cells to secretory production of useful proteins - Google Patents

Abstract

A nucleic acid molecule comprising a sugar deficiency inducible promoter sequence and a heterologous gene sequence operably linked to the sugar deficiency inducible promoter sequence. The sugar deficiency inducible promoter sequence may be selected from the group consisting of a β-galactosidase promoter sequence, a β-xylosidase promoter sequence, and a β-glucosidase promoter sequence. By using the nucleic acid molecule of the present invention, expression of a heterologous gene sequence can be easily controlled by controlling sugar deficiency.

Description

  The present invention relates to a novel promoter whose expression is induced by sugar deficiency and a production method using the same.

  Attempts to mass-produce useful proteins (for example, interferon) by genetic recombination techniques have been made for more than 20 years using E. coli and the like. However, since many proteins require post-translational modification called glycosylation for activity, the use of eukaryotic cells is desired for their production.

Secretory production of useful human-derived proteins (eg, therapeutic proteins such as interferon) by cultured plant cells has the following advantages:
1. Since plant cells are eukaryotic cells, protein processing and post-translational modifications similar to mammals occur;
2. There is no concern for contamination of viruses (such as HIV) and prions (BSE) that are of concern when using animal cells;
3. Plant media is composed of sugars and inorganic salts, allowing for inexpensive production; and In the case of secretory production, the target protein is secreted into the medium, so it is relatively easy to recover and purify;
5). Unlike the production method by cultivating genetically modified plants in the field, there is no contamination of the target protein in food crops and there is no risk of the gene being released into the environment.

  From the above points, the secretory production of useful proteins by plant cells is considered to be effective. However, considering profitability, it is important to suppress the purification cost as well as the productivity of the target protein. Therefore, a control method for specifically secreting the target protein into the medium is desired.

  Plants thus have many advantages in the production of useful proteins, and their use has been attempted in the past. Attempts to mass-produce foreign useful proteins in plants have been made for 10 years, but in many cases, research efforts have been focused on improving gene expression levels. However, high gene expression does not necessarily lead to high protein accumulation, and in many cases does not lead to practical use. In eukaryotes, protein synthesis occurs in multiple fields, and the accumulation location varies. In addition, attempts have been made to produce highly nutritious proteins in crops such as rice and improve the value of food, but in this case as well, there is a problem that the target protein does not accumulate highly. Therefore, despite the fact that many companies or public research institutions have various seeds, production of useful proteins by plants has not yet been put to practical use or industrialization.

  For example, regarding the production of foreign proteins using cultured cells, see, for example, Terashima M. et al. Et al., Appl. Microbiol. Biotechnol. , 52, 1999, 516-523 (Non-patent Document 1) secrete production of human α-antitrypsin (AAT) using rice cultured cells, and enables production of 24 mg per 1 g of dry cell weight. . However, this is a very efficient case, and it has been reported that almost no production is observed depending on the protein.

  Outside Japan, research on production of useful proteins using plants is active mainly in the United States. In the United States, field cultivation of genetically modified plants is easy to be recognized, and therefore production using recombinant plants is carried out without necessarily using cultured cells. ProdiGene (Texas, USA) already sells β-glucuronidase and avidin produced by recombinant maize as test reagents. Ventria Bioscience (California, USA) is producing AAT from transgenic rice and is seeking approval for clinical application by 2004.

  However, in Japan, almost no field cultivation of such genetically modified plants has been recognized. Therefore, it is preferable to produce foreign useful proteins using cultured cells as much as possible.

  From these facts, it is desired to establish a method for producing a large amount of a foreign useful protein stably in a genetically modified plant.

  Regarding the glucose deficiency responsive gene, Non-Patent Document 2 states that β-glucosidase (denoted as din2) is induced in the dark, and that din gene sugar-suppressed expression is mediated through phosphorylation of hexose by hexokinase. It is described that plants easily fall into a sugar-deficient state in the dark. However, this document merely describes the sugar deficiency inducibility of the expression of β-glucosidase, and does not disclose or suggest that the promoter of this gene is used for the expression of useful proteins.

  Patent Document 1 discloses that angiosperms are synthesized using α-amylases synthesized and their mRNA levels are greatly induced by sugar deficiency, and vectors containing α-amylase-derived vectors and genes encoding desired gene products. A method for producing a gene product in a host cell has been described. However, this document only confirms that expression is possible in rice using the rice α-amylase promoter, and it is unclear whether expression is possible in other plants.

Patent Documents 2 and 3 include that the promoter of a gene encoding rice α-amylase is responsive to glucose deficiency and human α1-antitrypsin (AAT) linked to the promoter of the gene encoding α-amylase. It has been described that transformed rice cells are initially maintained in a medium that maintains healthy cell growth and then replaced or diluted to AAT medium without sucrose. However, in Patent Documents 2 and 3, it is described in general explanation that a grass family plant can be used, but in the examples, a promoter of a gene encoding rice α-amylase is used. It has only been confirmed that it can be expressed in rice, and it is unclear whether it can be expressed in other plants.
U.S. Pat. No. 5,712,112 (columns 5, 9, 10, 51) US Pat. No. 6,048,973 (column 1, columns 9 to 12, column 51) International Publication WO98 / 42853 pamphlet (first page) Terashishima M. et al. Et al., Appl. Microbiol. Biotechnol. , 52, 1999, 516-523 Fujiki, F.M. Et al., Plant Physiol. Vol. 124, 2000, pp. 1139-1147 (page 1139 summary, text 1st paragraph, page 1140 table I)

  The present invention is intended to solve the above problems, and an object of the present invention is to provide a promoter that can be easily controlled in plant cells and a method for stably and mass-producing a protein using the promoter.

  As a result of intensive studies to solve the above problems, the present inventors have found that the promoters of the secretory β-xylosidase gene, β-galactosidase gene, and β-glucuronidase gene of Arabidopsis thaliana are significantly increased in cultured cells due to sugar deficiency. Based on this finding, the present invention has been completed. In particular, it has been found that when these sugar deficiency-inducible promoter and signal peptide are linked to a heterologous gene sequence, extracellular secretion of a product encoded by the heterologous gene sequence is efficiently performed.

  (1) A nucleic acid molecule comprising a sugar deficiency inducible promoter sequence and a heterologous gene sequence operably linked to the sugar deficiency inducible promoter sequence.

  (2) The sugar deficiency inducible promoter sequence is selected from the group consisting of a promoter sequence of a gene encoding β-galactosidase, a promoter sequence of a gene encoding β-xylosidase, and a promoter sequence of a gene encoding β-glucosidase. The nucleic acid molecule according to item (1) above.

(3) The sugar deficiency inducible promoter sequence is
(A) a nucleotide sequence represented by positions 643 to 1799 of SEQ ID NO: 1, positions 1 to 1763 of SEQ ID NO: 3, or positions 1 to 2058 of SEQ ID NO: 5;
(B) a nucleotide sequence comprising one or several nucleotide substitutions, deletions or additions compared to the nucleotide sequence of (a), having a sugar deficiency-inducing promoter activity;
(C) a nucleotide sequence that hybridizes with the nucleotide sequence of (a) or (b) under stringent conditions and has sugar deficiency-inducible promoter activity;
(D) a nucleotide sequence having at least 70% identity to the nucleotide sequence of (a) and having a sugar deficiency-inducing promoter activity; and (e) (a) to (d) A shortened sequence of any nucleotide sequence, selected from the group consisting of nucleotide sequences having sugar deficiency inducible promoter activity;
The nucleic acid molecule according to item (1), wherein when the heterologous gene sequence is operably linked to the nucleotide sequence, the nucleic acid molecule has an activity of promoting sugar deficiency-induced expression of the heterologous gene.

  (4) The nucleic acid molecule according to item (1), further comprising a signal peptide coding sequence.

  (5) In the above item (4), the signal peptide coding sequence is selected from the group consisting of β-galactosidase signal peptide coding sequence, β-xylosidase signal peptide coding sequence, and β-glucosidase signal peptide coding sequence. The described nucleic acid molecule.

(6) The signal peptide coding sequence is
(I) a nucleotide sequence encoding the amino acid sequence represented by positions 1 to 27 of SEQ ID NO: 2, positions 1 to 28 of SEQ ID NO: 4, or positions 1 to 28 of SEQ ID NO: 6;
(Ii) a nucleotide sequence comprising a substitution, deletion or addition of one or several nucleotides compared to the nucleotide sequence of (i), encoding a peptide having extracellular secretion activity;
(Iii) a nucleotide sequence that hybridizes with the nucleotide sequence of (i) or (ii) under stringent conditions and encodes a peptide having extracellular secretion activity; and (iv) against the nucleotide sequence of (i) A nucleotide sequence encoding a peptide having at least 70% identity and having extracellular secretion activity;
Selected from the group consisting of
The nucleic acid molecule according to item (4), wherein operably ligating the heterologous gene sequence to the nucleotide sequence results in extracellular secretion of the product of the heterologous gene.

  (7) The nucleic acid molecule according to item (1), wherein the heterologous gene sequence is a cytokine or hormone gene sequence.

  (8) The nucleic acid molecule according to item (1), wherein the heterologous gene sequence encodes a protein having a target function when expressed in a plant.

  (9) The nucleic acid molecule according to item (1), wherein the heterologous gene sequence is a gene sequence of interferon, antibody, human α-antitrypsin or green fluorescent protein.

  (10) The nucleic acid molecule according to item (1), wherein the heterologous gene sequence is a marker gene sequence.

  (11) The nucleic acid molecule according to item (1), further comprising a regulatory element.

  (12) The nucleic acid molecule according to item (11), wherein the regulatory element comprises at least one element selected from the group consisting of an intron, a terminator, and an enhancer.

  (13) A nucleic acid molecule comprising a promoter sequence of a gene encoding an exo-type glycolytic enzyme and a heterologous gene sequence operably linked to the promoter sequence.

  (14) The above item, wherein the promoter sequence is selected from the group consisting of a promoter sequence of a gene encoding β-galactosidase, a promoter sequence of a gene encoding β-xylosidase, and a promoter sequence of a gene encoding β-glucosidase. The nucleic acid molecule according to (13).

(15) The promoter sequence is
(A) a nucleotide sequence represented by positions 643 to 1799 of SEQ ID NO: 1, positions 1 to 1763 of SEQ ID NO: 3, or positions 1 to 2058 of SEQ ID NO: 5;
(B) a nucleotide sequence comprising one or several nucleotide substitutions, deletions or additions compared to the nucleotide sequence of (a), having a sugar deficiency-inducing promoter activity;
(C) a nucleotide sequence that hybridizes with the nucleotide sequence of (a) or (b) under stringent conditions and has sugar deficiency-inducible promoter activity;
(D) a nucleotide sequence having at least 70% identity to the nucleotide sequence of (a) and having a sugar deficiency-inducing promoter activity; and (e) (a) to (d) A shortened sequence of any nucleotide sequence, selected from the group consisting of nucleotide sequences having sugar deficiency inducible promoter activity;
The nucleic acid molecule according to item (13), wherein when the heterologous gene sequence is operably linked to the nucleotide sequence, the nucleic acid molecule has an activity of promoting sugar deficiency-induced expression of the heterologous gene.

  (16) The nucleic acid molecule according to item (13), further comprising a signal peptide coding sequence.

  (17) In the above item (16), the signal peptide coding sequence is selected from the group consisting of a β-galactosidase signal peptide coding sequence, a β-xylosidase signal peptide coding sequence, and a β-glucosidase signal peptide coding sequence. The described nucleic acid molecule.

(18) The signal peptide coding sequence is
(I) a nucleotide sequence encoding the amino acid sequence represented by positions 1 to 27 of SEQ ID NO: 2, positions 1 to 28 of SEQ ID NO: 4, or positions 1 to 28 of SEQ ID NO: 6;
(Ii) a nucleotide sequence comprising a substitution, deletion or addition of one or several nucleotides compared to the nucleotide sequence of (i), encoding a peptide having extracellular secretion activity;
(Iii) a nucleotide sequence that hybridizes with the nucleotide sequence of (i) or (ii) under stringent conditions and encodes a peptide having extracellular secretion activity; and (iv) against the nucleotide sequence of (i) A nucleotide sequence encoding a peptide having at least 70% identity and having extracellular secretion activity;
Selected from the group consisting of
The nucleic acid molecule according to item (16), wherein operably ligating the heterologous gene sequence to the nucleotide sequence results in extracellular secretion of the product of the heterologous gene.

  (19) The nucleic acid molecule according to item (13), wherein the heterologous gene sequence is a cytokine or hormone gene sequence.

  (20) The nucleic acid molecule according to item (13), wherein the heterologous gene sequence encodes a protein having a target function when expressed in a plant.

  (21) The nucleic acid molecule according to item (13), wherein the heterologous gene sequence is a gene sequence of interferon, antibody, human α-antitrypsin or green fluorescent protein.

  (22) The nucleic acid molecule according to item (13), wherein the heterologous gene sequence is a marker gene sequence.

  (23) The nucleic acid molecule according to item (13), further comprising a regulatory element.

  (24) The nucleic acid molecule according to item (23), wherein the regulatory element comprises at least one element selected from the group consisting of an intron, a terminator, and an enhancer.

  (25) A nucleic acid molecule comprising a promoter sequence of a gene encoding an enzyme capable of degrading metabolizable sugars and a heterologous gene sequence operably linked to the promoter sequence.

  (26) The promoter sequence of a gene encoding an enzyme capable of degrading metabolizable sugars encodes a promoter sequence of a gene encoding β-galactosidase, a promoter sequence of a gene encoding β-xylosidase, and β-glucosidase. The nucleic acid molecule according to item (25), selected from the group consisting of gene lomotor sequences.

(27) a promoter sequence of a gene encoding an enzyme capable of degrading the metabolizable sugar,
(A) a nucleotide sequence represented by positions 643 to 1799 of SEQ ID NO: 1, positions 1 to 1763 of SEQ ID NO: 3, or positions 1 to 2058 of SEQ ID NO: 5;
(B) a nucleotide sequence comprising one or several nucleotide substitutions, deletions or additions compared to the nucleotide sequence of (a), having a sugar deficiency-inducing promoter activity;
(C) a nucleotide sequence that hybridizes with the nucleotide sequence of (a) or (b) under stringent conditions and has sugar deficiency-inducible promoter activity;
(D) a nucleotide sequence having at least 70% identity to the nucleotide sequence of (a) and having a sugar deficiency-inducing promoter activity; and (e) (a) to (d) A shortened sequence of any nucleotide sequence, selected from the group consisting of nucleotide sequences having sugar deficiency inducible promoter activity;
The nucleic acid molecule according to item (25), having an activity of promoting sugar deficiency-induced expression of the heterologous gene when the heterologous gene sequence is operably linked to the nucleotide sequence.

  (28) The nucleic acid molecule according to item (25), further comprising a signal peptide coding sequence.

  (29) In the above item (28), the signal peptide coding sequence is selected from the group consisting of a β-galactosidase signal peptide coding sequence, a β-xylosidase signal peptide coding sequence, and a β-glucosidase signal peptide coding sequence. The described nucleic acid molecule.

(30) The signal peptide coding sequence is
(I) a nucleotide sequence encoding the amino acid sequence represented by positions 1 to 27 of SEQ ID NO: 2, positions 1 to 28 of SEQ ID NO: 4, or positions 1 to 28 of SEQ ID NO: 6;
(Ii) a nucleotide sequence comprising a substitution, deletion or addition of one or several nucleotides compared to the nucleotide sequence of (i), encoding a peptide having extracellular secretion activity;
(Iii) a nucleotide sequence that hybridizes with the nucleotide sequence of (i) or (ii) under stringent conditions and encodes a peptide having extracellular secretion activity; and (iv) against the nucleotide sequence of (i) A nucleotide sequence encoding a peptide having at least 70% identity and having extracellular secretion activity;
Selected from the group consisting of
The nucleic acid molecule according to item (28), wherein operably ligating the heterologous gene sequence to the nucleotide sequence results in extracellular secretion of the product of the heterologous gene.

  (31) The nucleic acid molecule according to item (25), wherein the heterologous gene sequence is a cytokine or hormone gene sequence.

  (32) The nucleic acid molecule according to item (25), wherein the heterologous gene sequence encodes a protein having a target function when expressed in a plant.

  (33) The nucleic acid molecule according to item (25), wherein the heterologous gene sequence is a gene sequence of interferon, antibody, human α-antitrypsin or green fluorescent protein.

  (34) The nucleic acid molecule according to item (25), wherein the heterologous gene sequence is a marker gene sequence.

  (35) The nucleic acid molecule according to item (25), further comprising a regulatory element.

  (36) The nucleic acid molecule according to item (35), wherein the regulatory element comprises at least one element selected from the group consisting of an intron, a terminator, and an enhancer.

(37) a nucleic acid molecule comprising a promoter sequence and a heterologous gene sequence operably linked to the promoter sequence, the promoter sequence comprising:
(A) a nucleotide sequence represented by positions 643 to 1799 of SEQ ID NO: 1, positions 1 to 1763 of SEQ ID NO: 3, or positions 1 to 2058 of SEQ ID NO: 5;
(B) a nucleotide sequence comprising one or several nucleotide substitutions, deletions or additions compared to the nucleotide sequence of (a), having a sugar deficiency-inducing promoter activity;
(C) a nucleotide sequence that hybridizes with the nucleotide sequence of (a) or (b) under stringent conditions and has sugar deficiency-inducible promoter activity;
(D) a nucleotide sequence having at least 70% identity to the nucleotide sequence of (a) and having a sugar deficiency-inducing promoter activity; and (e) (a) to (d) A shortened sequence of any nucleotide sequence, selected from the group consisting of nucleotide sequences having sugar deficiency inducible promoter activity;
A nucleic acid molecule having an activity of promoting expression of a heterologous gene when the heterologous gene sequence is operably linked to the nucleotide sequence.

  (38) The nucleic acid molecule according to item (37), further comprising a signal peptide coding sequence.

  (39) In the above item (38), the signal peptide coding sequence is selected from the group consisting of a β-galactosidase signal peptide coding sequence, a β-xylosidase signal peptide coding sequence, and a β-glucosidase signal peptide coding sequence. The described nucleic acid molecule.

(40) The signal peptide coding sequence is
(I) a nucleotide sequence encoding the amino acid sequence represented by positions 1 to 27 of SEQ ID NO: 2, positions 1 to 28 of SEQ ID NO: 4, or positions 1 to 28 of SEQ ID NO: 6;
(Ii) a nucleotide sequence comprising a substitution, deletion or addition of one or several nucleotides compared to the nucleotide sequence of (i), encoding a peptide having extracellular secretion activity;
(Iii) a nucleotide sequence that hybridizes with the nucleotide sequence of (i) or (ii) under stringent conditions and encodes a peptide having extracellular secretion activity; and (iv) against the nucleotide sequence of (i) A nucleotide sequence encoding a peptide having at least 70% identity and having extracellular secretion activity;
Selected from the group consisting of
The nucleic acid molecule according to item (38), wherein operably ligating the heterologous gene sequence to the nucleotide sequence results in extracellular secretion of the product of the heterologous gene.

  (41) The nucleic acid molecule according to (37), wherein the heterologous gene sequence is a cytokine or hormone gene sequence.

  (42) The nucleic acid molecule according to (37) above, wherein the heterologous gene sequence encodes a protein having a target function when expressed in a plant.

  (43) The nucleic acid molecule according to item (37), wherein the heterologous gene sequence is a gene sequence of interferon, antibody, human α-antitrypsin or green fluorescent protein.

  (44) The nucleic acid molecule according to item (37), wherein the heterologous gene sequence is a marker gene sequence.

  (45) The nucleic acid molecule according to item (37), further comprising a regulatory element.

  (46) The nucleic acid molecule according to item (45), wherein the regulatory element comprises at least one element selected from the group consisting of an intron, a terminator, and an enhancer.

(47) At least one promoter selected from the group consisting of a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar An array,
A vector comprising a heterologous gene sequence operably linked to the selected promoter sequence.

(48) At least one promoter selected from the group consisting of a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading metabolizable sugars An array,
A plant cell comprising a heterologous gene sequence operably linked to the selected promoter sequence.

  (49) The plant cell according to item (48), which is a dicotyledonous plant cell.

  (50) The plant cell according to item (48), which is a cultured cell.

  (51) The plant cell according to item (50), which is a cell that can proliferate 50 times or more in one week.

(52) A method for producing a protein, which comprises the following steps:
At least one promoter sequence selected from the group consisting of a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar;
Introducing a nucleic acid molecule comprising said protein coding sequence operably linked to said selected promoter sequence into a cell to obtain a transformed cell;
Culturing the transformed cell in the absence of sugar to secrete the protein; and recovering the protein.

  (53) The method according to item (52), wherein the cell is a plant cell.

  (54) The method according to (52) above, wherein the cell is a dicotyledonous plant cell.

  (55) The method according to item (52), wherein the cell is a cultured cell.

  (56) The method according to (55) above, wherein the cell is a cell that can proliferate 50 times or more in one week.

  (57) The method according to item (52), wherein the nucleic acid molecule further comprises a signal peptide coding sequence.

  (58) In the above item (57), the signal peptide coding sequence is selected from the group consisting of a β-galactosidase signal peptide coding sequence, a β-xylosidase signal peptide coding sequence, and a β-glucosidase signal peptide coding sequence. The method described.

(59) The signal peptide coding sequence is
(I) a nucleotide sequence encoding the amino acid sequence represented by positions 1 to 27 of SEQ ID NO: 2, positions 1 to 28 of SEQ ID NO: 4, or positions 1 to 28 of SEQ ID NO: 6;
(Ii) a nucleotide sequence comprising a substitution, deletion or addition of one or several nucleotides compared to the nucleotide sequence of (i), encoding a peptide having extracellular secretion activity;
(Iii) a nucleotide sequence that hybridizes with the nucleotide sequence of (i) or (ii) under stringent conditions and encodes a peptide having extracellular secretion activity; and (iv) against the nucleotide sequence of (i) A nucleotide sequence encoding a peptide having at least 70% identity and having extracellular secretion activity;
Selected from the group consisting of
58. The method of item (57) above, wherein operably ligating the heterologous gene sequence to the nucleotide sequence results in extracellular secretion of the product of the heterologous gene.

  (60) The method according to item (52), wherein the protein is a cytokine or a hormone.

  (61) The method according to item (52), wherein the protein is a protein having a target function when expressed in a plant.

  (62) The method according to item (52), wherein the protein is interferon, antibody, human α-antitrypsin or green fluorescent protein.

  (63) The method according to item (52), wherein the sugar is a metabolizable glycolytic sugar or a sugar that can be converted to the glycolytic sugar when metabolized.

  (64) The method according to item (52), wherein the sugar is selected from the group consisting of glucose, galactose, fructose, sucrose, and xylose.

(65) A protein production method comprising the following steps:
At least one promoter sequence selected from the group consisting of a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar;
Introducing a nucleic acid molecule comprising said protein coding sequence operably linked to said selected promoter sequence into a cell to obtain a transformed cell;
Culturing the transformed cell in the presence of sugar;
Culturing the transformed cell in the absence of sugar to secrete the protein; and recovering the protein.

  (66) A protein obtained by the method according to item (52).

  (67) Use of the nucleic acid molecule according to item (1) for sugar deficiency-inducible expression of a heterologous gene.

  The present invention provides an expression system that can easily control expression by controlling sugar deficiency.

  The promoter sequence of the gene encoding secretory β-galactosidase (Gal), the promoter sequence of the gene encoding β-xylosidase (Xyl), and the promoter sequence of the gene encoding β-glucosidase (Glc) must have sugar When cells containing a heterologous gene sequence operably linked to this promoter sequence are cultured in the presence of sugar and the cells have grown to some extent because expression is repressed by and is significantly induced by sugar deficiency Thus, the expression of the heterologous gene sequence can be efficiently induced by lowering the sugar concentration of the medium.

  Particularly in the present invention, further inclusion of a signal peptide coding sequence in the nucleic acid molecule of the present invention may result in more efficient expression of the product encoded by the heterologous gene sequence.

  By using the present invention, activation of industries related to the production of pharmaceuticals such as interferons, antibodies, vaccines and the like that have not been developed due to low productivity due to plant cells can be expected.

FIG. 1a is a graph showing the change in signal intensity ratio due to sugar deficiency for about 13,000 Arabidopsis genes. The horizontal axis shows the signal intensity in the presence of 2% sucrose, and the vertical axis shows the signal intensity in the absence of sucrose. FIG. 1b is a graph showing the change in signal intensity ratio due to sugar deficiency for 184 Arabidopsis genes obtained by screening first. The horizontal axis shows the signal intensity in the presence of 1% sucrose, and the vertical axis shows the signal intensity in the absence of sucrose. FIG. 2 is a photograph showing RNA gel blot analysis for 9 genes identified in the subarray. FIG. 3a is a graph showing the level of sucrose or glucose when sucrose is supplied to the detached leaves. At each time, the white bar on the left shows the results under sucrose feeding conditions, the middle black bar shows the results under sucrose deficient conditions, and the leftmost white bar shows the results when feeding sucrose again after 72 hours. Results are shown. Each also shows an error bar. FIG. 3b is a photograph showing RNA gel blot analysis showing the time course of transcript accumulation of 12 genes induced in detached leaves. FIG. 4a shows a graph showing the amount of soluble sugar in rosette leaves when the whole plant is shaded. The white bar indicates the amount of sucrose and the black bar indicates the amount of glucose. Each also shows an error bar. FIG. 4b is a photograph of an RNA gel blot showing the transcript of the AtSUG gene when the entire plant is shielded from light. FIG. 5a shows the yellowing of detached rosette leaves in the upper photograph and the amount of soluble sugar in the detached leaves in the lower graph. The white bar indicates the amount of sucrose and the black bar indicates the amount of glucose. Each also shows an error bar. FIG. 5b is a photograph of an RNA gel blot showing the transcript of the AtSUG gene in detached rosette leaves. FIG. 6 is a photograph of an RNA gel blot showing AtSUG transcripts when sucrose is depleted from detached leaves for 48 hours and then sugar or analog is fed over 24 hours. The results when the following are added are shown: Lane 1, no treatment; Lane 2, sugar starvation (48 hours); Lane 3, sucrose (24 hours); Lane 4, glucose (24 hours); Lanes 5, 2 -Deoxyglucose (24 hours); Lane 6, 3-O-methylglucose. FIG. 7 is a photograph of an RNA gel blot showing AtSUG transcripts with and without sucrose. FIG. 8 is a schematic diagram showing a phylogenetic tree of a family of β-galactosidase (also described as Gal) and β-xyloxase (also described as Xyl). FIG. 9 shows Gal-1, Gal-2, Gal-3, Gal-5 and Gal-6, and Xyl-1, Xyl− when Arabidopsis thaliana was grown in the absence of sucrose or containing 1% sucrose. 2 is a photograph of an RNA gel blot showing RNA amounts of 2 and Xyl-3. FIG. 10 is a photograph of an RNA gel blot showing the amounts of Gal-1, Xyl-1 and Glc-1 RNA when Arabidopsis thaliana was grown in the absence of sucrose or under conditions containing 1% sucrose. FIG. 11 is a schematic diagram comparing the structures of the Gal-1 gene product (724 amino acids), the Xyl-1 gene product (774 amino acids), and the Glc-1 gene product (577 amino acids). FIG. 12 is a schematic diagram showing the advantages of using cultured cells. FIG. 13 is a photograph of an RNA gel blot showing the amounts of RNAs of Gal-1, Xyl-1 and Glc-1 when cultured Arabidopsis cells are grown in the absence of sucrose or in a condition containing 1% sucrose. FIG. 14 is a graph showing the enzyme activities of Gal-1, Xyl-1 and Glc-1 when cultured Arabidopsis cells were grown in the absence of sucrose or in a condition containing 1% sucrose. FIG. 15 is a schematic diagram of regulation by sugar starvation in plant cells. FIG. 16 is a photograph of an RNA gel blot showing RNA amounts of Gal-1, Xyl-1 and Glc-1 when various sugars are added as a carbon source. FIG. 17a is a schematic diagram showing a part of a construction method of a plant introduction construct. FIG. 17b is a schematic diagram showing a part of the construction method of the plant introduction construct. FIG. 17c is a schematic diagram showing a part of the construction method of the plant introduction construct. FIG. 18 is a diagram showing that GFP secretion is induced by sugar deficiency in BY-2 cells. The graph shows the growth of transformed BY-2 cells. The inset in the graph shows the results of Western blotting.

  The present invention will be described in detail below. Throughout this specification, it is to be understood that the terms used in this specification are used in the meaning normally used in the art unless otherwise specified.

(1. Nucleic acid molecule)
In one embodiment, the nucleic acid molecule of the invention comprises a sugar deficiency inducible promoter sequence and a heterologous gene sequence operably linked to the sugar deficiency inducible promoter sequence.

  In another embodiment, the nucleic acid molecule of the present invention also includes a promoter sequence of a gene encoding an exoglycolytic enzyme and a heterologous gene sequence operably linked to the promoter sequence.

  In another embodiment, the nucleic acid molecule of the invention also includes a promoter sequence of a gene encoding an enzyme capable of degrading metabolizable sugars and a heterologous gene sequence operably linked to the promoter sequence.

  In particular, the nucleic acid molecule of the present invention preferably contains a signal peptide coding sequence. By including a signal peptide coding sequence, extracellular secretion of the product encoded by the heterologous gene sequence is more efficiently performed.

  As used herein, the term “nucleic acid molecule” is also used interchangeably with nucleic acid, oligonucleotide, and polynucleotide. Examples of nucleic acid molecules include cDNA, mRNA, genomic DNA and the like. As used herein, nucleic acids and nucleic acid molecules are included within the concept of the term “gene”, such as when the nucleic acids and nucleic acid molecules encode proteins. Nucleic acid molecules encoding certain gene sequences also include “splice variants” and “splice variants”. A splice variant and a splice variant are synonymous. Similarly, a particular protein encoded by a nucleic acid includes any protein encoded by a splice variant of that nucleic acid. As the name suggests, a “splice variant” is the product of alternative splicing of a gene. After transcription, the initial nucleic acid transcript may be spliced such that different (another) nucleic acid splice products encode different polypeptides. The production mechanism of splice variants varies, but includes exon alternative splicing. Other polypeptides derived from the same nucleic acid by read-through transcription are also encompassed by this definition. Any product of a splicing reaction (including recombinant forms of splice products) is included in this definition.

  In the present specification, a sugar deficiency-inducible promoter sequence refers to a promoter sequence whose expression is induced by sugar deficiency. Examples of the sugar deficiency inducible promoter sequence include a promoter sequence of a gene encoding β-galactosidase (Gal), a promoter sequence of a gene encoding β-xylosidase (Xyl), and a gene encoding β-glucosidase (Glc). Examples include promoter sequences and promoter sequences of sugar-responsive genes listed in Table 1. These promoter sequences were obtained from the Kazusa DNA Research Institute with the gene ID shown in Table 1, and this gene was deleted little by little from the 5 'end or 3' end to obtain a deleted sequence. This can be easily determined by ascertaining whether the missing sequence has sugar deficiency inducible promoter activity. Whether or not this deletion sequence has sugar deficiency-inducible promoter activity is determined by, for example, linking this deletion sequence to a reporter sequence, ligating it to a vector, introducing this vector into an appropriate host cell, It can be determined by checking whether expression is seen. The β-galactosidase that can be used herein is preferably Gal-1. Examples of β-xylosidases that can be used herein include Xyl-1 or Xyl-3, preferably Xyl-1. The β-glucosidase that can be used herein is preferably Glc-1. Sugar deficiency inducible promoter sequences are not limited to these: (b) nucleotide sequences comprising one or several nucleotide substitutions, deletions or additions compared to the nucleotide sequences of these promoter sequences, A nucleotide sequence having deficiency-inducible promoter activity; (c) a nucleotide sequence that hybridizes with the nucleotide sequence of (a) or (b) under stringent conditions and has sugar deficiency-inducible promoter activity; (d) ( a nucleotide sequence having at least 70% identity to the nucleotide sequence of a) and having a sugar deficiency-inducing promoter activity; and (e) any nucleotide of (a) to (d) Nucleotide that is a shortened sequence and has sugar deficiency inducible promoter activity It may be a de array. The shortened sequence may be a sequence having a length less than the full length and not less than a minimum length having sugar deficiency-inducing promoter activity. The minimum length of the shortened sequence is determined by deleting the original promoter sequence little by little from the 5 ′ end or 3 ′ end to obtain a shortened sequence, and whether this shortened sequence has sugar deficiency-inducible promoter activity. This can be easily determined. The length of the shortened sequence can be, for example, about 20 nucleotides or more and less than the full length. The length of the shortened sequence can be preferably about 30 nucleotides or more, about 40 nucleotides or more, about 50 nucleotides or more, about 60 nucleotides or more, about 70 nucleotides or more, about 80 nucleotides or more, or about 90 nucleotides or more. The length of the shortened sequence is preferably about 1200 nucleotides or less, more preferably about 1100 nucleotides or less, about 1000 nucleotides or less, about 900 nucleotides or less, about 800 nucleotides, about 700 nucleotides or less, about 600 nucleotides or less, about 500 nucleotides or less. , About 400 nucleotides or less, about 300 nucleotides or less, about 200 nucleotides or less, or about 100 nucleotides or less.

  In the present specification, “having a sugar deficiency-inducing promoter activity” means having an effect of increasing the expression level under sugar-deficient conditions as compared with the expression level under sugar-existing conditions. This effect is preferably greater when the saccharide concentration is about 15 mM or less than when the saccharide is present at about 50 mM or more, more preferably 2 times the expression level when the saccharide is present at about 50 mM or more. It can be more than double, 3 times, 4 times, 5 times, 10 times, 50 times, 100 times or more. Of course, the sugar deficiency-inducible promoter activity includes the case where it has the effect of being expressed under sugar-deficient conditions without being expressed under the presence of sugar.

  In this specification, “promoter” refers to a region on DNA that determines the transcription start point of a gene and directly regulates the transcription frequency, and is a base sequence that initiates transcription upon binding of RNA polymerase. is there. Since the promoter region is usually a region within about 2 kbp upstream of the first exon of the putative protein coding region, if the protein coding region in the genomic base sequence is predicted using DNA analysis software, The promoter region can be deduced. The putative promoter region varies for each structural gene, but is usually upstream of the structural gene, but is not limited thereto, and may be downstream of the structural gene. Preferably, the putative promoter region is present within about 2 kbp upstream from the first exon translation start. In the present specification, the “promoter sequence” means a sequence having promoter activity. Promoter activity refers to the activity to transcribe RNA from DNA. Therefore, the “promoter sequence” refers to a sequence that can synthesize RNA corresponding to DNA when the DNA is linked downstream (3 ′ side) and introduced into a cell.

  As is well known, the promoters for the above Gal-1, Xyl-1 and Glu-1 genes can be obtained from the upstream sequence of the coding region. The identification of the promoter region can be performed based on a method well known in the art. Briefly, an expression cassette is constructed in which a promoter region candidate sequence and a reporter gene (eg, GUS gene) are operably linked. Using the constructed expression cassette, an appropriate plant cell is transformed, and the transformed cell is regenerated into a plant. The expression of the reporter gene in the transformed plant is detected using an appropriate detection system (for example, dye staining). Based on the detection result, the promoter region and its expression characteristics can be confirmed.

  At least 50 (preferably) of the sugar deficiency inducible promoter sequence used in the present invention, the promoter sequence of a gene encoding an exolytic enzyme, or the promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar Nucleic acid molecules comprising at least 60, more preferably at least 80, even more preferably at least 100, even more preferably at least 150) nucleotide sequences have the same or similar activity as these promoter sequences obtain. Such activity can be confirmed by an assay using a beta glucuronidase (GUS) gene, a luciferase gene, or a GFP gene as a reporter gene, a biochemical or cytohistological assay. Such assays belong to well-known and conventional techniques in the art (Maliga et al., Methods in Plant Molecular Biology: A laboratory course. Cold Spring Harbor Laboratory Press (1995); Jefferson, Prince. (1987); Ow et al., Science 234: 856 (1986); Sheen et al., Plant J. 8: 777-784 (1995)), those skilled in the art will have at least 10 consecutive sequences of the present invention without any difficulty. A nucleic acid molecule comprising a single nucleotide sequence of a sugar-deficiency-inducible promoter sequence used in the present invention, a gene encoding an exolytic enzyme It can be confirmed that the promoter sequence or the promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar has the same, similar or substantially equivalent activity. In the present specification, when it is determined in the above assay that the same promoter activity is within the detection error range, the promoter activity is said to be substantially equal to or higher than that.

  The length of the promoter sequence used in the present invention is usually 10 nucleotides or more, preferably 20 nucleotides or more, 30 nucleotides or more, 40 nucleotides or more, 50 nucleotides or more, 60 nucleotides or more, 70 nucleotides or more, 80 nucleotides or more. , 90 nucleotides or more, 100 nucleotides or more, 150 nucleotides or more, 200 nucleotides or more, 300 nucleotides or more.

  The promoter sequence used in the present invention is a conventional promoter sequence (for example, a minimum promoter (a promoter consisting of about 80 base pairs derived from the 35S promoter (Hatton et al., Plant J., 7: 859-876 (1995); Rooster et al., Plant J., 15: 435-440 (1998); Washida et al., Plant Mol. Biol., 40: 1-12 (1999))). Even if the promoter sequence shows no or weak specificity, or shows another specificity, the sugar deficiency inducibility can be increased by adding or replacing the promoter sequence used in the present invention or a fragment thereof. A promoter sequence having (Hatton et al., Plant J., 7: 859-876 (1995); Rooster et al., Plant J., 15: 435-440 (1998); Washida et al., Plant Mol. Biol., 40: 1-12 (1999)). ).

  The sugar deficiency inducible promoter is preferably a promoter whose expression is induced when the sugar concentration is about 15 mM or less, more preferably about 10 mM, even more preferably about 5 mM or less, most preferably in the absence of sugar. Say. In the present specification, “expression is induced” means to include both increase in the expression level and expression under the condition of sugar deficiency but not at all under the condition of sugar presence.

  In the present specification, the sugar acting on a sugar deficiency inducible promoter is preferably a metabolizable sugar. A “metabolizable sugar” refers to a sugar that can be metabolized by entering at least a part of a glycolytic system when it is taken up and decomposed by a plant cell. Metabolizable sugars can be used interchangeably with sugars that can be metabolized by plants. Examples of metabolizable sugars include monosaccharides and disaccharides that can produce ATP by the glycolytic system via initial phosphorylation of the sugar. Examples of monosaccharides include glucose, fructose, xylose, galactose, maltose and arabinose. An example of a disaccharide is sucrose. Other phosphorylated sugars can also be metabolizable sugars. Since mannitol and sorbitol cannot produce ATP via the initial phosphorylation and cannot enter into the glycolysis system, they are not usually the sugars of the present invention. However, the metabolizable sugar varies depending on the target organism of the present invention, and when a specific sugar is confirmed to be metabolizable by the method described below, Sugars are also within the range of metabolizable sugars.

  Metabolizable sugars are well known in the art. Whether or not a specific sugar is a metabolizable sugar depends on whether or not the number of plant cells increases when the target plant cell is cultured for 1 to 4 weeks using that sugar as the sole carbon source. If the number of plant cells increases, the sugar can be determined to be a metabolizable sugar. The increase in the number of plant cells means that the number of plant cells after culturing for 1 to 4 weeks is preferably about 150% or more, more preferably about 200, assuming that the number of cells before the start of culture is 100%. % Or more, more preferably about 250% or more, more preferably about 300% or more, more preferably about 400% or more, more preferably about 500% or more.

  In the present specification, “expression” of a gene, polynucleotide, polypeptide or the like means that the gene or the like undergoes a certain action in vivo to take another form. Preferably, a gene, polynucleotide or the like is transcribed and translated into a polypeptide form, but transcription to produce mRNA can also be a form of expression. More preferably, such a polypeptide form may be post-translationally processed.

  Therefore, in the present specification, “reduction” of “expression” of genes, polynucleotides, polypeptides, etc. means that the amount of expression is significantly reduced when the factor of the present invention is applied, rather than when it is not applied. That means. Preferably, the decrease in expression includes a decrease in the expression level of the polypeptide. In this specification, “increase” in “expression” of a gene, polynucleotide, polypeptide, etc. means that the amount of expression increases significantly when the factor of the present invention is applied, rather than when it is not. Say. Preferably, the increase in expression includes an increase in the expression level of the polypeptide.

  As used herein, the terms “polypeptide”, “protein”, and “peptide” are used interchangeably herein and refer to a polymer of amino acids of any length. This polymer may be linear, branched, or cyclic. The amino acid may be natural or non-natural and may be a modified amino acid. The term can also be assembled into a complex of multiple polypeptide chains. The term also encompasses natural or artificially modified amino acid polymers. Such modifications include, for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation or any other manipulation or modification (eg, conjugation with a labeling component). This definition also includes, for example, polypeptides containing one or more analogs of amino acids (eg, including unnatural amino acids, etc.), peptide-like compounds (eg, peptoids) and other modifications known in the art. Is included.

  In general, one amino acid of a particular polypeptide sequence can be replaced with another amino acid without an apparent reduction or loss of biological activity possessed by that polypeptide. It is the ability and nature of the polypeptide to define the biological activity of a polypeptide. Thus, specific amino acid substitutions can be made at the amino acid sequence of the polypeptide or at the level of the nucleotide sequence encoding the polypeptide, resulting in a polypeptide that still retains its original properties after substitution. Accordingly, various modifications can be made in the polypeptides disclosed herein or in nucleotides having a nucleotide sequence encoding this polypeptide without any apparent loss of biological activity.

  As used herein, “biological activity” refers to an activity that a factor (eg, a polypeptide or a nucleic acid molecule) may have in vivo, and includes an activity that exhibits various functions. For example, when a factor is an enzyme, the biological activity includes the enzyme activity. In another example, when an agent is a ligand, the ligand includes binding to the corresponding receptor. For example, when a certain factor is an antisense molecule, its biological activity includes binding to a nucleic acid molecule of interest, thereby suppressing expression. Such biological activity can be measured by techniques well known in the art. When a factor is a promoter, its biological activity can be confirmed to be altered (preferably increased) by transcription specific to the promoter. Such confirmation can be performed using molecular biological techniques well known in the art.

  Generally herein, amino acid substitutions, additions, deletions or modifications can be made to produce a polypeptide. Amino acid substitution refers to the replacement of one amino acid with another amino acid. Addition of amino acid means insertion of one or more, for example, 1 to 10, preferably 1 to 5, more preferably 1 to 3 amino acids at any position in the original amino acid sequence. Say. Amino acid deletion refers to removal of one or more, for example, 1 to 10, preferably 1 to 5, more preferably 1 to 3 amino acids from the original amino acid sequence. Examples of amino acid modifications include, but are not limited to, amidation, carboxylation, sulfation, halogenation, alkylation, glycosylation, phosphorylation, hydroxylation, acylation (eg, acetylation) and the like. The amino acid to be substituted or added may be a natural amino acid, a non-natural amino acid or an amino acid analog. Natural amino acids are preferred.

  Nucleotides in which some nucleotides are deleted from full-length nucleotides and polypeptides in which some amino acids are deleted from full-length polypeptides are also called fragments. In the present specification, the “fragment” refers to a polypeptide or polynucleotide having a sequence length of 1 to n−1 with respect to a full-length polypeptide or polynucleotide (length is n). The length of the fragment can be appropriately changed according to the purpose. For example, the lower limit of the length is 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50 and more amino acids, and lengths expressed in integers not specifically listed here (eg 11 etc.) are also suitable as lower limits obtain. In the case of polynucleotides, examples include 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100 and more nucleotides, which are specifically listed here. Non-integer lengths (eg, 11 etc.) may also be appropriate as a lower limit.

  A polypeptide may be a polypeptide analog having biological activity unique to that polypeptide. In particular, where the polypeptide is an enzyme, the polypeptide may be an enzyme analog. As used herein, the term “enzyme analog” refers to a compound that is different from a natural enzyme but is equivalent to the natural enzyme in at least one chemical or biological function. Thus, enzyme analogs include those in which one or more amino acid analogs are added or substituted to the original natural enzyme. Enzyme analogs are subjected to such additions or substitutions such that their function (eg, α-phosphorylase activity or thermostability) is substantially similar to or better than that of the original natural enzyme. ing. Such enzyme analogs can be made using techniques well known in the art. Thus, the enzyme analog can be a polymer comprising an amino acid analog. In this specification, “enzyme” includes this enzyme analog unless otherwise specified.

  In the present specification, the “amino acid” may be a natural amino acid, a non-natural amino acid, a derivative amino acid, or an amino acid analog. Natural amino acids are preferred.

  The term “natural amino acid” refers to the L-isomer of a natural amino acid. Natural amino acids are glycine, alanine, valine, leucine, isoleucine, serine, methionine, threonine, phenylalanine, tyrosine, tryptophan, cysteine, proline, histidine, aspartic acid, asparagine, glutamic acid, glutamine, γ-carboxyglutamic acid, arginine, ornithine , And lysine. Unless otherwise indicated, all amino acids referred to herein are L-forms, but forms using D-form amino acids are also within the scope of the present invention.

  The term “unnatural amino acid” refers to an amino acid that is not normally found in proteins in nature. Examples of non-natural amino acids include norleucine, para-nitrophenylalanine, homophenylalanine, para-fluorophenylalanine, 3-amino-2-benzylpropionic acid, homo-arginine D-form or L-form and D-phenylalanine.

  “Derivative amino acid” refers to an amino acid obtained by derivatizing an amino acid.

  “Amino acid analog” refers to a molecule that is not an amino acid but is similar to the physical properties and / or function of an amino acid. Examples of amino acid analogs include ethionine, canavanine, 2-methylglutamine and the like.

  Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides may also be referred to by the generally accepted single letter code.

  In addition to the intended modification, modified polypeptides comprising modifications by substitution, addition or deletion of one or more or more amino acids to the amino acid sequence of the native polypeptide are within the scope of the present invention. is there. Such modified polypeptides containing one or more amino acid substitutions, additions or deletions are described in Molecular Cloning, A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press (1989), Current Protocol Moleculars. , Supplements 1-38, John Wiley & Sons (1987-1997), Nucleic Acids Research, 10, 6487 (1982), Proc. Natl. Acad. Sci. USA, 79, 6409 (1982), Gene, 34, 315 (1985), Nucleic Acids Research, 13, 4431 (1985), Proc. Natl. Acad. Sci USA, 82, 488 (1985), Proc. Natl. Acad. Sci. USA, 81, 5562 (1984), Science, 224, 1431 (1984), PCT WO85 / 00817 (1985), Nature, 316, 601 (1985) and the like.

  Deletion, substitution or addition of the amino acid of the polypeptide of interest can be performed by site-directed mutagenesis which is a well-known technique. Site-directed mutagenesis techniques are well known in the art. For example, Nucl. Acid Research, Vol. 10, pp. 6487-6500 (1982).

  As used herein with respect to a particular polypeptide having biological activity, “one or more or more amino acid substitutions, additions or deletions” or “at least one amino acid substitution, addition or deletion” “Deletion” means that at least one of the biological activities of the specific polypeptide is not lost, preferably equivalent to that based on the activity (for example, the specific polypeptide in nature) This refers to the number of substitutions, additions or deletions to such an extent. One skilled in the art can readily select a modified polypeptide having the desired properties.

  The specific modified polypeptide thus prepared is preferably about 40%, more preferably about 45%, more preferably about 50%, more preferably about 50% of the amino acid sequence of the polypeptide before the modification. 55%, more preferably about 60%, more preferably about 65%, more preferably about 70%, more preferably about 75%, more preferably about 80%, more preferably about 85%, more preferably about 90%. %, More preferably about 95%, and most preferably about 99% identity.

  In designing such modifications, the hydrophobicity index of amino acids can be considered. The importance of the amino acid hydrophobicity index for the biological function of a polypeptide is generally recognized in the art (Kyte. J and Doolittle, R. F. J. Mol. Biol. 157 (1): 105-. 132, 1982). The hydrophobic nature of amino acids contributes to the secondary structure of the polypeptide produced and then defines the interaction of the polypeptide with other molecules (eg, enzymes, substrates, receptors, DNA, antibodies, antigens, etc.) . Each amino acid is assigned a hydrophobicity index based on their hydrophobicity and charge properties. The hydrophobicity index assigned to each amino acid is as follows: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine / cystine (+2. 5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); (-1.3); Proline (-1.6); Histidine (-3.2); Glutamic acid (-3.5); Glutamine (-3.5); Aspartic acid (-3.5); Asparagine ( -3.5); lysine (-3.9); and arginine (-4.5)).

  A polypeptide in which a certain amino acid in a polypeptide is replaced by another amino acid having a similar hydrophobicity index and still has a biological function similar to this polypeptide (eg, a polypeptide having an equivalent enzymatic activity) Is well known in the art. In such amino acid substitution, the hydrophobicity index is preferably within ± 2, more preferably within ± 1, and even more preferably within ± 0.5. It is understood in the art that such amino acid substitutions based on hydrophobicity are efficient.

  Herein, the hydrophilicity index may also be taken into account when considering protein design and properties. As described in US Pat. No. 4,554,101, the following hydrophilicity indices have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartic acid (+3. 0 ± 1); glutamic acid (+ 3.0 ± 1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (−0.4); proline ( Alanine (−0.5); histidine (−0.5); cysteine (−1.0); methionine (−1.3); valine (−1.5); leucine (−0.5 ± 1); -1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); and tryptophan (-3.4). It is understood that one amino acid in a polypeptide can be replaced with another amino acid that has a similar hydrophilicity index to this amino acid and can still confer biological activity. In such amino acid substitution, the hydrophilicity index is preferably within ± 2, more preferably within ± 1, and even more preferably within ± 0.5.

  In the present invention, “conservative substitution” refers to a substitution in which the hydrophilicity index and / or the hydrophobicity index of the amino acid to be replaced with the original amino acid is similar as described above. Examples of conservative substitution include those having a hydrophilicity index or a hydrophobicity index within ± 2, preferably within ± 1, and more preferably within ± 0.5. But not limited to them. Thus, examples of conservative substitutions are well known to those skilled in the art and include, for example, substitutions within the following groups: arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine, and Examples include, but are not limited to, isoleucine.

  The sugar deficiency inducible promoter sequence of the present invention preferably encodes a promoter sequence of a gene encoding β-galactosidase (Gal), a promoter sequence of a gene encoding β-xylosidase (Xyl), and β-glucosidase (Glc). A promoter sequence of a gene encoding β-galactosidase or a promoter sequence of a gene encoding β-xylosidase. The sugar deficiency inducible promoter sequence of the present invention is preferably (a) a nucleotide shown at positions 643 to 1799 of SEQ ID NO: 1, positions 1 to 1863 of SEQ ID NO: 3, or positions 1 to 2058 of SEQ ID NO: 5. (B) a nucleotide sequence comprising one or several nucleotide substitutions, deletions or additions compared to the nucleotide sequence of (a), wherein the nucleotide sequence has sugar deficiency-inducible promoter activity; ) A nucleotide sequence that hybridizes with the nucleotide sequence of (a) or (b) under stringent conditions and has sugar deficiency inducible promoter activity; (d) at least 70% of the nucleotide sequence of (a) A nucleotide sequence having identity and having a sugar deficiency inducible promoter activity; (E) a heterologous gene selected from the group consisting of nucleotide sequences having a nucleotide deficiency-inducing promoter activity, which is a shortened sequence of any one of the nucleotide sequences of (a) to (d) When sequences are linked, they have the activity of promoting sugar deficiency-inducible expression of the heterologous gene.

  As used herein, the terms “polynucleotide”, “oligonucleotide”, and “nucleic acid” are used interchangeably herein and refer to a polymer of nucleotides of any length. The term also includes “derivative oligonucleotide” or “derivative polynucleotide”. “Derivative oligonucleotide” or “derivative polynucleotide” refers to an oligonucleotide or polynucleotide that includes a derivative of a nucleotide or that differs in the linkage between nucleotides, and is used interchangeably. Specific examples of such an oligonucleotide include, for example, 2′-O-methyl-ribonucleotide, a derivative oligonucleotide in which a phosphodiester bond in an oligonucleotide is converted to a phosphorothioate bond, and a phosphodiester bond in an oligonucleotide. Is an N3′-P5 ′ phosphoramidate bond derivative oligonucleotide, a ribose and phosphodiester bond in the oligonucleotide converted to a peptide nucleic acid bond, uracil in the oligonucleotide is C− A derivative oligonucleotide substituted with 5-propynyluracil, a derivative oligonucleotide where uracil in the oligonucleotide is substituted with C-5 thiazole uracil, and cytosine in the oligonucleotide is C-5 propynylcytosine Substituted derivative oligonucleotides, derivative oligonucleotides in which the cytosine in the oligonucleotide is replaced with phenoxazine-modified cytosine, derivative oligonucleotides in which the ribose in the DNA is replaced with 2'-O-propylribose Examples thereof include derivative oligonucleotides in which ribose in the oligonucleotide is substituted with 2′-methoxyethoxyribose. Unless otherwise indicated, a particular nucleic acid sequence may also be conservatively modified (eg, degenerate codon substitutes) and complementary sequences, as well as explicitly indicated sequences. Is intended to be included. Specifically, degenerate codon substitutes have the third position of one or several or more selected (or all) codons replaced with a mixed base and / or deoxyinosine residue. Can be achieved by creating sequences (Batzer et al., Nucleic Acid Res. 19: 5081 (1991); Ohtsuka et al., J. Biol. Chem. 260: 2605-2608 (1985); Rossolini et al., Mol. Cell. Probes. 8: 91-98 (1994)).

  As used herein, “substitution, deletion or addition” of a polypeptide sequence or nucleotide sequence refers to an amino acid or a substitute thereof, or a nucleotide or a substitute thereof, respectively, relative to the original polypeptide or polynucleotide. Replace, remove, or add. Such substitution, deletion or addition techniques are well known in the art, and examples of such techniques include site-directed mutagenesis techniques. There may be any number of substitutions, deletions or additions, as long as it is one or more, and such numbers are intended for the function (eg, a sugar deficiency inducible promoter) in the variant having the substitution, deletion or addition. As long as the sugar deficiency-inducibility and promoter activity of the heterologous gene sequence are maintained as desired protein activity). For example, such a number can be one or several, and preferably can be within 20%, within 10%, or less than 100, less than 50, less than 25, etc. of the total length. The sugar deficiency inducible promoter sequence used in the present invention can be of any length as long as it retains the sugar deficiency inducible promoter activity. Such a sequence can be easily determined by, for example, deleting the nucleotide sequence of the original promoter sequence little by little from the 5 ′ side or the 3 ′ side and confirming whether the sugar deficiency-inducing promoter activity is retained. Can be done. Such methods for shortening promoter sequences are well known to those skilled in the art and can be easily implemented.

  In the present specification, the “variant” refers to a substance in which a part of the original substance such as a polypeptide or polynucleotide is changed. Such variants include substitutional variants, addition variants, deletion variants, truncated variants, allelic variants, glycosylation variants, lipidation variants, complex molecule variants, and the like. Can be mentioned. Preferably, the modified substance retains at least one, more preferably a plurality of characteristics (for example, biological characteristics) of a substance (for example, an enzyme) that is the basis of modification. Etc. An allele refers to genetic variants that belong to the same locus and are distinguished from each other. Therefore, an “allelic variant” refers to a variant having an allelic relationship with a certain gene. Such allelic variants usually have the same or very similar sequence as their corresponding alleles, usually have nearly the same biological activity, but rarely have different biological activities. May have. “Species homologue or homolog” means homology (preferably at least 60% homology, more preferably at least 80%, at a certain amino acid level or nucleotide level within a certain species. 85% or higher, 90% or higher, 95% or higher homology). Methods for obtaining such species homologues are well known in the art. “Ortholog” is also called an orthologous gene, which is a gene derived from speciation from a common ancestor with two genes. For example, in the case of the hemoglobin gene family having a multigene structure, the human and mouse α hemoglobin genes are orthologs, but the human α and β hemoglobin genes are paralogs (genes generated by gene duplication). . In addition, when comparing human cystatin A, a cysteine protease inhibitor, with rice oryzacystatin, only three short amino acid motifs that are considered important for interaction with the target protease are conserved. The amino acid commonality of the other parts is very low. However, since both belong to the cystatin gene superfamily and have a common ancestor gene, not only the overall amino acid homology, but also the amino acid sequences having high local homology in common. If it exists, it can be an ortholog. As described above, since orthologs can usually perform the same functions as the original species in another species, the sugar deficiency-inducible promoter used in the present invention, an enzyme capable of degrading metabolizable sugars. Orthologs of promoters of genes encoding can also be useful in the present invention.

  “Conservative (modified) variants” applies to both polypeptide and nucleotide sequences. With respect to a particular nucleotide sequence, a conservatively modified variant refers to a nucleotide sequence that encodes the same or essentially the same polypeptide sequence. When the nucleotide sequence does not encode a polypeptide sequence, such as an antisense coding sequence, a conservatively modified variant refers to a sequence that is essentially identical. Because of the degeneracy of the genetic code, a large number of functionally identical nucleotide sequences encode any given polypeptide. For example, the codons GCA, GCC, GCG, and GCT (GCU) all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such nucleotide sequence variations are “silent modifications (mutations),” which are one species of conservatively modified mutations. Every nucleotide sequence herein that encodes a polypeptide also describes every possible silent variation of that nucleotide sequence. In the art, a molecule in which each codon in a nucleotide sequence (except ATG (AUG), which is usually the only codon for methionine, and TGG, which is usually the only codon for tryptophan), is functionally identical. It is understood that it can be modified to produce. Accordingly, each silent variation of a nucleotide sequence that encodes a polypeptide is implicit in each described sequence. Preferably, such modifications can be made to avoid substitution of cysteine, an amino acid that greatly affects the conformation of the polypeptide. Such base sequence modification methods include restriction enzyme digestion, DNA polymerase, Klenow fragment, DNA ligase treatment and other ligation treatments, site-specific base substitution methods using synthetic oligonucleotides (specification) Site-directed mutagenesis; Mark Zoller and Michael Smith, Methods in Enzymology, 100, 468-500 (1983)), but other modifications may also be made by methods usually used in the field of molecular biology. it can.

  The signal peptide coding sequence and the heterologous gene sequence can be altered according to the frequency of codon usage in the organism to be introduced. Codon usage reflects the frequency of use of genes that are highly expressed in the organism. For example, if intended to be expressed in E. coli, optimize for expression in E. coli according to published codon usage tables (eg, Sharp et al., Nucleic Acids Research 16, No. 17, pages 8207 (1988)). be able to.

  As used herein, “identity” of nucleotide sequences (or polypeptide sequences) refers to the appearance of identical nucleotides (amino acids when comparing polypeptide sequences) between two or more nucleotide sequences (or polypeptide sequences). The degree to do. Identity generally compares the length of two or more nucleotide sequences (or polypeptide acid sequences) and compares these two or more sequences aligned in an optimal manner that may include additions or deletions. Determined by. The percent identity determines the number of positions where nucleotides (amino acids when comparing polypeptide sequences) are identical between the two or more sequences, and divides the number of identical positions by the total number of compared positions; The result obtained is then multiplied by 100 to obtain the percent identity between these two sequences. When directly comparing two or more gene sequences, the DNA sequences between the gene sequences are typically at least 50% identical, preferably at least 70% identical, more preferably at least 80%, 90% Those genes are identical if they are%, 95%, 96%, 97%, 98% or 99% identical.

  In the present specification, “similarity” of nucleotide sequences (or polypeptide sequences) means two or more nucleotide sequences (or polypeptide sequences) when conservative substitutions are regarded as positive (identical) in the above-mentioned identity. ) Of each other's identity. Thus, if there is a conservative substitution, identity and similarity differ depending on the presence of the conservative substitution. When there is no conservative substitution, identity and similarity indicate the same numerical value.

  The percent identity can be determined, for example, using NCBI's BLAST 2.2.9 (issued 2004.12). In the present specification, the identity value usually refers to a value when the BLAST is used and aligned under default conditions. However, if a higher value is obtained by changing the parameter, the highest value is the identity value. When identity is evaluated in a plurality of areas, the highest value among them is set as the identity value.

  The degree of identity or similarity of two or more nucleotide sequences can be confirmed by examining hybridization under stringent conditions in addition to direct sequence comparison.

  As used herein, the term “stringent conditions” refers to conditions that hybridize to specific sequences but not to non-specific sequences. The setting of stringent conditions is well known to those skilled in the art and is described, for example, in Molecular Cloning (Sambrook et al., Supra). Specifically, for example, using a filter on which colony or plaque-derived DNA is immobilized, 50% formamide, 5 × SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 × Denhardt's solution (0.2% BSA, 0.2% Ficoll 400 and 0.2% polyvinylpyrrolidone), 10% dextran sulfate, and 20 μg / ml denatured sheared salmon sperm DNA at 65 ° C. After performing hybridization for 24 to 24 hours, a 0.1- to 2-fold concentration of SSC (saline-sodium citrate) solution (the composition of the 1-fold concentration of SSC solution is 150 mM sodium chloride, 15 mM sodium citrate). Use and wash the filter at 65 ° C It refers to a polynucleotide which can be identified by using a condition that.

  In the present specification, the promoter sequence of a gene encoding an exo-type glycolytic enzyme refers to a promoter sequence possessed by an exo-type glycolytic enzyme gene.

  As used herein, “exo-type glycolytic enzyme” refers to an enzyme that acts on the terminal portion of a sugar chain to sequentially release terminal sugar residues. Examples of exo-type glycolytic enzymes include, but are not limited to: β-galactosidase, β-xylosidase, β-glucosidase, α-xylosidase and β-fucosidase. In the present invention, any nucleotide sequence can be used as long as it is a nucleotide sequence upstream of a nucleotide sequence encoding such an enzyme and exhibits a promoter activity in the target organism.

  The promoter sequence of the gene encoding the exoglycolytic enzyme of the present invention is preferably a promoter sequence of a gene encoding β-galactosidase, a promoter sequence of a gene encoding β-xylosidase, and a gene encoding a β-glucosidase. It is selected from the group consisting of promoter sequences, more preferably a promoter sequence of a gene encoding β-galactosidase, and a promoter sequence of a gene encoding β-xylosidase. The sugar deficiency inducible promoter sequence of the present invention is preferably (a) a nucleotide shown at positions 643 to 1799 of SEQ ID NO: 1, positions 1 to 1863 of SEQ ID NO: 3, or positions 1 to 2058 of SEQ ID NO: 5. (B) a nucleotide sequence comprising one or several nucleotide substitutions, deletions or additions compared to the nucleotide sequence of (a), wherein the nucleotide sequence has sugar deficiency-inducible promoter activity; ) A nucleotide sequence that hybridizes with the nucleotide sequence of (a) or (b) under stringent conditions and has sugar deficiency inducible promoter activity; (d) at least 70% of the nucleotide sequence of (a) A nucleotide sequence having identity and having a sugar deficiency inducible promoter activity; (E) a heterologous gene selected from the group consisting of nucleotide sequences having a nucleotide deficiency-inducing promoter activity, which is a shortened sequence of any one of the nucleotide sequences of (a) to (d) When sequences are linked, they have the activity of promoting sugar deficiency-inducible expression of the heterologous gene.

  In the present specification, the promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar refers to a promoter sequence of a gene encoding an enzyme capable of hydrolyzing a metabolizable sugar. As used herein, “an enzyme capable of degrading metabolizable sugars” is an enzyme capable of degrading metabolizable sugars as described above. Examples of such enzymes include, but are not limited to: β-galactosidase, β-xylosidase, β-glucosidase, α-xylosidase and β-fucosidase. In the present invention, any nucleotide sequence can be used as long as it is a nucleotide sequence upstream of a nucleotide sequence encoding such an enzyme and exhibits a promoter activity in the target organism.

  The promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar of the present invention is preferably a promoter sequence of a gene encoding β-galactosidase, a promoter sequence of a gene encoding β-xylosidase, and β-glucosidase. It is selected from the group consisting of promoter sequences of encoding genes, more preferably a promoter sequence of a gene encoding β-galactosidase or a promoter sequence of a gene encoding β-xylosidase. The sugar deficiency-inducible promoter sequence of the present invention is preferably a nucleotide sequence represented by (a) positions 643 to 1799 of SEQ ID NO: 1, positions 1 to 1763 of SEQ ID NO: 3, or positions 1 to 2058 of SEQ ID NO: 5. (B) a nucleotide sequence comprising one or several nucleotide substitutions, deletions or additions compared to the nucleotide sequence of (a), wherein the nucleotide sequence has sugar deficiency inducible promoter activity; ) A nucleotide sequence that hybridizes with the nucleotide sequence of (a) or (b) under stringent conditions and has sugar deficiency inducible promoter activity; (d) at least 70% of the nucleotide sequence of (a) A nucleotide sequence having identity and having a sugar deficiency inducible promoter activity, and e) a shortened sequence of any one of the nucleotide sequences of (a) to (d), wherein the heterologous gene sequence is selected from the group consisting of nucleotide sequences having sugar deficiency-inducing promoter activity and operably operated on the nucleotide sequence When ligated, it has an activity to promote sugar deficiency-inducible expression of the heterologous gene.

  In the present invention, other promoters may be used in addition to the promoter sequence of a gene that encodes a sugar deficiency-inducing promoter, an exo-type glycolytic enzyme, or a gene that encodes an enzyme capable of degrading a metabolizable sugar. Good. Examples of other promoters that can be used include, but are not limited to, CaMV35S promoter, nopaline synthase promoter, ubiquitin promoter, and the like, and modified promoters thereof. In the present invention, any nucleotide sequence can be used as long as it exhibits promoter activity in the target organism. Such other promoters may be site specific promoters, time specific promoters, constitutive promoters, stress (or stimulation) responsive promoters, stress (or It may be a stimulating) inducible promoter or a stress (or stimulating) reducing promoter. Examples of constitutive promoters include the CaMV35S promoter, nopaline synthase promoter and ubiquitin promoter. Examples of specific promoters include tissue specific promoters and organ specific promoters.

  In the present invention, a heterologous gene sequence linked to a promoter deficiency inducible promoter, a promoter sequence of a gene encoding an exo-type glycolytic enzyme or a promoter sequence of a gene encoding an enzyme capable of degrading metabolizable sugars is linked. Any nucleotide sequence can be used as long as it is heterologous to the promoter sequence. The heterologous gene sequence can be, for example, a protein coding sequence, an antisense coding sequence, a ribozyme coding sequence, a nucleotide sequence for analysis purposes, and the like. The heterologous gene sequence can preferably be a protein coding sequence or an antisense coding sequence. The heterologous gene sequence may be a naturally occurring nucleotide sequence, a modified natural nucleotide sequence, an artificially synthesized gene, or a complex thereof ( For example, it may be a fusion).

  As used herein, “operably linked” refers to transcriptional regulatory sequences (eg, promoters, terminators) that a desired nucleotide sequence (eg, heterologous gene sequence) provides expression (ie, activation). Enhancer etc.) or translational regulatory sequence (eg intron, splice donor, splice acceptor etc.). For example, in order for a promoter to be operably linked to a gene, the promoter is usually placed immediately upstream of the gene, but need not necessarily be adjacent.

  For DNA synthesis techniques and nucleic acid chemistry for producing artificially synthesized nucleotide sequences, see, for example, Gait, M. et al. J. et al. (1985). Oligonucleotide Synthesis: A Practical Approach, IRLPpress; Gait, M .; J. et al. (1990). Oligonucleotide Synthesis: A Practical Approach, IRL Press; Eckstein, F .; (1991). Oligonucleotides and Analogues: A Practical Approac, IRL Press; Adams, R .; L. etal. (1992). The Biochemistry of the Nucleic Acids, Chapman &Hall; Shabarova, Z. et al. et al. (1994). Advanced Organic Chemistry of Nucleic Acids, Weinheim; Blackburn, G .; M.M. et al. (1996). Nucleic Acids in Chemistry and Biology, Oxford University Press; Hermanson, G .; T. T. et al. (I996). Bioconjugate Technologies, Academic Press, etc., which are incorporated herein by reference in the relevant part.

  The heterologous gene sequence in the present specification may be any as long as it can be expressed in the target organism. For example, if it is intended to be expressed in a specific plant, it may be expressed in that specific plant.

  In one embodiment, the heterologous gene sequence is a protein coding sequence. The protein coding sequence may be any as long as it encodes a useful protein that is intended to be expressed in large quantities, and such is also included within the scope of the present invention. Examples of protein coding sequences include, but are not limited to, for example, pharmaceutically active peptides (eg, cytokines (interferons, interleukins, chemokines, granulocyte macrophage colony stimulating factor (GM- CSF), macrophage colony stimulating factor (M-CSF), granulocyte colony stimulating factor (G-CSF), multi-CSF (IL-3), erythropoietin (EPO), leukemia inhibitory factor (LIF), c-kit ligand ( Hematopoietic factors such as SCF), tumor necrosis factor, platelet derived growth factor (PDGF), epidermal growth factor (EGF), fibroblast growth factor (FGF), hepatocyte growth factor (HGF), vascular endothelial growth factor ( VEGF); hormones (insulin, growth hormone, thyroid gland) Vaccine antigen; antigen (eg, human antibody (preferably fully human antibody), humanized antibody, multispecific antibody, chimeric antibody, single chain antibody, Fab Fragmente F (ab ′) fragment, Fab expression live) Fragments produced by Larry, anti-idiotype (anti-Id) antibodies, epitope-binding fragments); blood products; peptides useful in agricultural production (eg, antibacterial proteins); synthetic secondary metabolites with physiological or pharmacological effects Various enzymes and hydrolases; inhibitors that regulate enzymatic reactions; soybean glycinin, which is thought to have blood pressure effects; or artificial proteins designed to excise bioactive peptides by enzymatic degradation in the digestive tract . Examples of nutritionally significant substances include, but are not limited to, casein, leguminous albumin and globulin, vitamins synthase, sugar synthase, and lipid synthase. Further, examples of proteins involved in processing characteristics as raw materials for various processed foods include wheat glutenin (baking), soybean globulin group (tofu), and milk casein group (cheese). Proteins that enhance the taste or functionality of foods (eg, cyclodextrin, oligosaccharides, synthases of special sugars or amino acids such as γ-aminoacetic acid, pigment synthases that improve the appearance, and participation in taste component synthesis Or artificial proteins designed to excise peptides with physiological effects (for example, angiotensin-converting enzyme-inhibiting peptides that have blood pressure effects) upon enzymatic digestion in the digestive tract. However, it is not limited to these. The heterologous gene sequence is preferably a cytokine or hormone gene sequence. The heterologous gene sequence more preferably encodes a protein having the desired function when expressed in a plant. In the present specification, “a protein having a target function when expressed in a plant” means that a gene product expressed in the plant performs the target function in an animal, a plant or in vitro. That means. For example, the glycosylation of a gene product expressed in a plant is the same as when expressed in an animal, or performs a desired function in vitro or when administered to an animal, or It means that it does not exert harmful effects. The target function refers to a function that is exhibited when the protein is produced by a conventional method. For example, if the heterologous gene sequence encodes an antibody, the antibody may function as a protective antibody (ie, as a therapeutic or prophylactic agent) when administered in an animal, or it may be specific in vitro. It may bind to an antigen (ie function as a diagnostic agent). The heterologous gene sequence is more preferably an interferon (α, β or γ), antibody, human α-antitrypsin (AAT) or green fluorescent protein (GFP) gene sequence, more preferably an antibody or green fluorescent protein. And most preferred is green fluorescent protein.

  In one embodiment, the heterologous gene sequence can be a marker gene. The marker gene is synonymous with a selection gene, and refers to a nucleotide that can distinguish between a cell in which the selection marker is present and a cell in which the selection marker is not present by expression of a product encoded by the selection marker.

  In one embodiment, the heterologous gene sequence can be an antisense coding sequence. The antisense coding sequence may be anything as long as it encodes an antisense sequence of a specific gene intended to suppress or prevent expression and has antisense activity. Also within the scope of the present invention. An antisense sequence refers to a sequence that is complementary to a coding sequence (also referred to as a sense sequence).

  As used herein, “antisense activity” refers to an activity that can specifically suppress or reduce the expression of a target gene. More specifically, depending on a certain nucleotide sequence introduced into the cell, an activity that can reduce the protein expression level by specifically reducing the mRNA level of a gene having a nucleotide sequence region complementary to that sequence. Say. As a technique, there are a method of directly introducing an RNA molecule complementary to mRNA produced from a target gene into a cell, and a method of introducing a construction vector capable of expressing RNA complementary to a target gene in the cell. Broadly divided. The latter is common in plants.

  Antisense activity is usually achieved by a nucleotide sequence that is at least about 8 nucleotides in length that is complementary to the coding sequence of a gene intended to suppress or block expression. The antisense coding sequence is preferably at least about 9 nucleotides in length, more preferably about 10 nucleotides in length, more preferably about 11 nucleotides in length, more preferably about 12 nucleotides in length, more preferably about 13 A nucleotide length, more preferably about 14 nucleotides long, more preferably about 15 nucleotides long, more preferably about 20 nucleotides long, more preferably about 25 nucleotides long, more preferably about 30 nucleotides long. It may be nucleotides long, more preferably about 40 nucleotides long, more preferably about 50 nucleotides long. Preferably, the sequence complementary to the coding sequence of the gene of interest is not continuously present in the antisense coding sequence, but is present continuously.

  In the present specification, the lengths of nucleotide sequences and polypeptide sequences can be represented by the number of nucleotides or amino acids, respectively. However, the above numbers are not absolute, and as long as they have the same function, the upper limit or addition The above-mentioned number is intended to include a number above and below the number (or, for example, 10% above and below). In order to express such intention, in this specification, “about” may be added before the number. However, it should be understood herein that the presence or absence of “about” does not affect the interpretation of the value.

  The antisense coding sequence is preferably at least about 70% identical to the sequence of the antisense strand of the gene intended to suppress or prevent expression (complementary strand of the coding strand), more preferably at least about 80. % Nucleotide identity, more preferably about 90% identity, and most preferably about 95% identity. The antisense coding sequence is preferably complementary to the sequence at the 5 'end of the nucleic acid sequence of the gene of interest. Also included in the antisense coding sequence are those having one, several or one or more nucleotide substitutions, additions and / or deletions relative to the antisense coding sequence as described above. As used herein, “antisense activity” includes, but is not limited to, a decrease in gene expression.

  General antisense technology is described in textbooks (Murray, JAH eds., Antisense RNA and DNA, Wiley-Liss Inc, 1992). Furthermore, the latest research has revealed a phenomenon called RNA interference (RNAi), which has led to the development of antisense technology. In RNAi, when a short double-stranded RNA (about 20 bases) having a sequence homologous to the target gene is introduced into the cell, the mRNA of the target gene homologous to the RNA sequence is specifically degraded and the expression level is reduced. Is a phenomenon that decreases. This phenomenon, first discovered in nematodes, has been found to be a universal phenomenon in organisms including plants. It was elucidated that the molecular level mechanism by which the expression of a target gene is suppressed by antisense technology goes through a process similar to this RNAi. In conventional antisense technology, an expression vector is constructed in which a single DNA sequence complementary to the nucleotide sequence of a target gene is linked to an appropriate promoter and an artificial mRNA is expressed under the control of the expression vector. To be introduced. In recent antisense technology using RNAi, an expression vector designed so that a double-stranded RNA can be constructed in a cell is often used. In antisense technology using RNAi, the basic structure of the antisense coding sequence is that one DNA sequence complementary to a target gene is linked under one promoter, and the same one is further reversed in the opposite direction. It is made by connecting two. In a single-stranded mRNA transcribed from an antisense coding sequence having this basic structure, a single nucleotide sequence portion connected in the reverse direction is in a complementary relationship. It takes a double-stranded RNA state with a hairpin-like secondary structure, which causes mRNA degradation of the target gene according to the RNAi mechanism. In plants, an example used in Arabidopsis thaliana has been reported (Smith, NA, et al., Nature 407.319-320, 2000). Also, RNAi in general is summarized in a recent review (Morita and Yoshida, Protein / Nucleic Acid / Enzyme 47, 1939-1945, 2002). The contents described in these documents are incorporated herein by reference in their entirety.

  In the present specification, “RNAi” is an abbreviation for RNA interference, and by introducing a factor causing RNAi such as double-stranded RNA (also referred to as dsRNA) into cells, homologous mRNA is specifically degraded, It refers to a phenomenon in which the synthesis of a gene product is suppressed and the technology used for it. As used herein, RNAi can also be used interchangeably with an agent that causes RNAi in some cases.

  As used herein, “factor causing RNAi” refers to any factor capable of causing RNAi. In the present specification, the “factor causing RNAi” with respect to “gene” means that RNAi related to the gene is caused and an effect brought about by RNAi (for example, suppression of expression of the gene) is achieved. Factors that cause such RNAi include, for example, at least 10 nucleotides, including sequences having at least about 70% homology to a portion of the nucleic acid sequence of the target gene or sequences that hybridize under stringent conditions Examples include, but are not limited to, expression vectors designed so that an RNA containing a long double-stranded portion or a variant thereof can be constructed.

  As the heterologous gene sequence, a sequence that is identical to any of a naturally occurring protein coding sequence, a naturally occurring antisense coding sequence, a naturally occurring ribozyme coding sequence, and the like can be used. Nucleotide sequences having such identity include, for example, at least about 30%, about 35%, about 40%, about 45% relative to a comparative nucleotide sequence when compared using Blast default parameters. %, About 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99% identity or similar Or at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60% relative to the amino acid sequence encoded by the Nucleotide sequences encoding amino acid sequences having about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99% identity or similarity. But it is not limited to them.

  The heterologous gene sequence is at least one selected from the group consisting of a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading metabolizable sugars. Heterologous to one promoter sequence. The heterologous gene sequence is preferably also heterologous to the signal sequence coding sequence. “Heterologous” with respect to two sequences means that these two sequences are derived from different genes or from different species. The term heterologous is at least selected from the group consisting of a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar. It consists of the relationship between one promoter sequence and a heterologous gene sequence, a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar. A relationship between at least one promoter sequence selected from the group and other regulatory sequences, a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and an enzyme capable of degrading a metabolizable sugar Selected from the group consisting of promoter sequences of genes encoding Relationship between the at least one promoter sequence and signal coding sequence, the relationship between a plurality of regulatory sequences other than the promoter sequence used in the present invention is applied to a relationship between the relationship between the regulatory sequence and the heterologous gene sequence. For example, at least one selected from the group consisting of an Arabidopsis sugar deficiency-inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar The promoter sequence is heterologous to the Arabidopsis actin gene. Similarly, at least one selected from the group consisting of an Arabidopsis sugar deficiency-inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar. One promoter sequence is heterologous to the human interferon gene. When a heterologous gene sequence is derived from a heterologous organism, it is also called a foreign gene. In this case, the “foreign gene” refers to a gene that does not exist naturally in an organism.

  The nucleic acid of the present invention comprises a signal peptide coding sequence in addition to a promoter deficiency inducible promoter, a promoter sequence of a gene encoding an exo-type glycolytic enzyme or a promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar. Can be included.

  As used herein, “signal peptide coding sequence” refers to a nucleotide sequence that encodes a signal peptide. In the present specification, the “signal peptide” refers to an amino acid sequence that mainly serves for attachment of the nascent polypeptide chain to the endoplasmic reticulum membrane and transmembrane vortex, which includes hydrophobic amino acid residues. The length of the signal peptide is preferably about 10 to about 50, more preferably about 13 to about 40, and more preferably about 15 to about 30. Whether or not a signal peptide is included in a specific amino acid sequence can be determined according to a method well known in the art, but preferably, Kyte. J and Doolittle, R.A. F. J. et al. Mol. Biol. 157 (1): 105-132, 1982, when the hydrophobicity index is analyzed, and when about 10 to about 50 amino acids at the N-terminus are hydrophobic, this hydrophobic amino acid moiety is a signal peptide peptide It can be determined that The signal peptide preferably has a sequence that can be degraded by a signal peptidase.

  The signal peptide coding sequence can be any nucleotide sequence that encodes a signal peptide that results in secretion of the polypeptide bound to the signal peptide to the outside of the cell. Examples of signal peptide coding sequences include β-galactosidase signal peptide coding sequence, β-xylosidase signal peptide coding sequence, and β-glucosidase signal peptide coding sequence. The signal peptide coding sequence may be homologous to a sugar deficiency inducible promoter, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, or a promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar, Different types may be used.

  The signal peptide coding sequence is preferably (i) a nucleotide sequence encoding the amino acid sequence shown at positions 1 to 27 of SEQ ID NO: 2, positions 1 to 28 of SEQ ID NO: 4, or positions 1 to 28 of SEQ ID NO: 6. (Ii) a nucleotide sequence comprising a substitution, deletion or addition of one or several nucleotides compared to the nucleotide sequence of (i) and encoding a peptide having extracellular secretion activity; (iii) ) A nucleotide sequence that hybridizes with the nucleotide sequence of (i) or (ii) under stringent conditions and encodes a peptide having extracellular secretion activity; and (iv) at least 70 relative to the nucleotide sequence of (i) % Of the nucleotide sequence having the identity and having the extracellular secretion activity. It is selected from the group consisting of sul nucleotide sequences, when operably said heterologous gene sequence to said nucleotide sequence is linked, leading to extracellular secretion of the product of the heterologous gene.

  The nucleic acid of the present invention further comprises a regulatory element in addition to a promoter deficiency inducible promoter, a promoter sequence of a gene encoding an exo-type glycolytic enzyme or a promoter sequence of a gene encoding an enzyme capable of degrading metabolizable sugars. obtain. As used herein, “regulatory element” refers to an element that directly or indirectly affects the expression of a coding sequence. Examples of regulatory elements include, but are not limited to, promoters, introns, terminators, enhancers, silencers, transcription termination sequences, translation termination sequences, transcription origins, intron sequences, and the like. The regulatory element may preferably comprise at least one element selected from the group consisting of promoter, intron, terminator and enhancer.

  In the present specification, the expression "specifically expresses" a gene means that the gene is expressed at a different (preferably higher) level in a specific part or time of the plant than other parts or time. . With specific expression, it may be expressed only at a certain site (specific site) or may be expressed at other sites. The expression specifically preferably means that it is expressed only at a certain site.

  In the present specification, when used for expression of a gene, “site specificity” generally means a part of an organism (eg, plant) (eg, in the case of a plant, protein body, root, stem, stem, leaf, flower). , Seed, endosperm, embryo, embryo, fruit, etc.) the specificity of expression of that gene. “Time-specificity” refers to the stage of development of an organism (eg, a plant) (for example, if it is a plant, the growth stage (eg, the specific stage of formation of a protein body, the number of days of germination after germination)) Specificity of gene expression. Such specificity can be introduced into a desired organism by selecting an appropriate promoter.

  In the present specification, expression of a promoter as “constitutive” means that it is expressed in all tissues of an organism in an almost constant amount regardless of whether the organism is growing or juvenile or mature. Refers to nature. Specifically, when Northern blot analysis is performed under the same conditions as in the examples of the present specification, for example, at an arbitrary time point (for example, two or more points (for example, in the case of plants, germination day 5 and day 15) ), The expression is constitutive by the definition of the present invention when expression is observed at any of the same or corresponding sites. Constitutive promoters are thought to play a role in maintaining homeostasis of organisms in normal growth environments.

  The expression of the promoter being “stress (or stimulation) responsive” means the property that the expression level changes when an organism is given at least one stress (or stimulation). In particular, the property of increasing the expression level is referred to as “stress (or stimulation) induction”, and the property of decreasing the expression level is referred to as “stress (or stimulation) reduction”. The expression of “stress (or irritation) reduction” is a concept that overlaps with “constitutive” expression because it is premised on that expression is observed under normal conditions. These properties can be determined by extracting RNA from any part of the organism and analyzing the expression level by Northern blot analysis or quantifying the expressed polypeptide by Western blot. An organism transformed with a vector incorporating a stress (or stimulation) inducible promoter with a selectable marker and a heterologous gene sequence (eg, a plant or plant part (specific cells, tissues, etc.)) is inducible by the promoter. By using a stimulating factor having the expression, a selectable marker and a heterologous gene sequence can be expressed only under certain conditions.

  As used herein, “intron” refers to a nucleotide sequence that exists between any two exons and is transcribed into RNA but not found in mature RNA. Introns may have an effect of increasing the expression level of a polypeptide when present. The intron can be an intron from any organism, but is preferably an intron from the organism into which the selectable marker is to be introduced. In the present invention, any nucleotide sequence can be used as long as it shows intron activity in the target organism.

  As used herein, “exon” refers to a nucleotide sequence that is transcribed into RNA and translated into a polypeptide.

  In the present specification, the terminator is a sequence that is located downstream of a protein coding region and is involved in termination of transcription when a nucleotide sequence is transcribed into mRNA, and addition of a poly A sequence. It is known that the terminator is involved in the stability of mRNA and affects the expression level of the gene. The terminator can be a terminator derived from any organism, but is preferably a terminator derived from the organism into which the selectable marker is to be introduced. Examples of terminators that can be used in the present invention include CaMV35S terminator, terminator of nopaline synthase (Tnos), terminator of tobacco PR1a gene, Tml terminator, 10 KDa prolamin terminator, and their modified terminators. It is not limited. In the present invention, any nucleotide sequence can be used as long as it exhibits terminator activity in the target organism.

  As used herein, an “enhancer” can be used to increase the expression efficiency of a target gene. Such enhancers are well known in the art. A plurality of enhancers may be used, but one may be used or may not be used. The enhancer can be an enhancer from any organism, but is preferably an enhancer from the organism into which the selectable marker is to be introduced. In the present invention, any nucleotide sequence can be used as long as it shows enhancer activity in the target organism. When used in plants, as an enhancer, for example, an enhancer region containing an upstream sequence in the CaMV35S promoter is preferable.

  As used herein, “silencer” refers to a sequence having a function of suppressing and resting gene expression. In the present invention, any silencer may be used as long as it has the function, and the silencer may not be used.

  Regulatory sequences are preferably operably linked to promoters and heterologous gene sequences. As used herein, “operably linked” refers to a transcriptional regulatory sequence (eg, promoter, terminator, silencer, enhancer, etc.) or translation that results in expression (ie, activation) of the desired nucleotide sequence. It is arranged under the control of a regulatory sequence (eg, intron, splice donor, splice acceptor, etc.). For example, in order for a promoter to be operably linked to a gene, the promoter is usually placed immediately upstream of the gene, but need not necessarily be adjacent.

  In some cases, the promoter and heterologous gene sequences should be processed in order to operably link the promoter and heterologous gene sequences to the regulatory sequences. For example, when the distance between the promoter and the coding region is too long and a decrease in transcription efficiency is expected, or the interval between the ribosome binding site and the translation initiation codon is not appropriate. Examples of processing means include digestion with restriction enzymes, digestion with exonucleases such as Bal31 and ExoIII, or introduction of site-directed mutagenesis using single-stranded DNA such as M13 or PCR.

  The nucleic acid molecule of the present invention is preferably an isolated nucleotide. As used herein, an “isolated” nucleotide refers to other biological factors within the cells of the organism in which it is naturally occurring (eg, factors other than nucleotides and nucleotides other than the nucleotide of interest). ) Is substantially separated or purified from). “Isolated” nucleotides include nucleotides purified by standard purification methods. Thus, an isolated nucleotide includes a chemically synthesized nucleotide. In addition, nucleotides mixed with other substances after being purified by a standard purification method and nucleotides dissolved in a buffer also correspond to the isolated nucleotides referred to in this specification.

  As used herein, a “purified” nucleotide refers to a nucleotide in which at least a part of the factors naturally associated with the nucleotide has been removed. Thus, usually the purity of the nucleotide in the purified nucleotide is higher (ie, enriched) than the state in which the nucleotide is normally present.

  In the present specification, the “nucleotide” may be natural or non-natural. “Derivative nucleotide” or “nucleotide analog” refers to a nucleotide that is different from a naturally occurring nucleotide but has the same function as the original nucleotide. Such derivative nucleotides and nucleotide analogs are well known in the art. Examples of such derivative nucleotides and nucleotide analogs include, but are not limited to, phosphorothioates, phosphoramidates, methyl phosphonates, chiral methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNA). .

  The nucleic acid molecule of the present invention is selected from the group consisting of a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar. As long as at least one promoter sequence has sugar deficiency inducibility and has the necessary promoter activity, even if a part of the nucleotide sequence is deleted as described above, a part is replaced by another nucleotide. May be inserted, or other nucleotide sequences may be partially inserted. Alternatively, another nucleic acid may be bound to the 5 'end and / or the 3' end. Further, at least one selected from the group consisting of a natural sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading metabolizable sugars. Hybridizes with a nucleic acid molecule containing a promoter sequence under stringent conditions and encodes a natural sugar deficiency-inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and an enzyme capable of degrading a metabolizable sugar It may be a nucleotide sequence having substantially the same function as at least one promoter sequence selected from the group consisting of promoter sequences of the genes to be selected. Such nucleotide sequences are known in the art and can be used in the present invention.

  Such a nucleic acid molecule can be prepared using a well-known PCR method, and can also be chemically synthesized. These methods may be combined with, for example, a site-directed mutagenesis method or a hybridization method.

(2. Vector)
The vector of the present invention is at least selected from the group consisting of a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar. One promoter sequence and a heterologous gene sequence operably linked to the selected promoter sequence.

  Regarding sugar deficiency-inducible promoter sequences, promoter sequences of genes encoding exo-type glycolytic enzymes, promoter sequences of genes encoding enzymes capable of degrading metabolizable sugars, operably linked heterologous gene sequences, etc. , As described in 1 above.

  As used herein, “vector” refers to a nucleic acid molecule capable of transferring a heterologous gene sequence into a target cell. Such a vector can be autonomously replicated in the target cell or can be integrated into the chromosome of the target cell and contains a promoter at a position suitable for transcription of the modified nucleotide sequence. Are illustrated. The cell of interest can be a host cell, such as a plant cell and a plant individual. In the present specification, the vector may be a plasmid, an expression vector, a recombinant vector and the like.

  As used herein, “expression vector” refers to a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar. A vector capable of expressing in a cell of interest a heterologous gene sequence operably linked to at least one promoter sequence selected from the group consisting of: The expression vector is at least one selected from the group consisting of a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading metabolizable sugars. In addition to promoter sequences and heterologous gene sequences, various regulatory elements such as enhancers that regulate their expression, and optionally factors necessary for replication in the cell of interest and selection of recombinants (eg, Origin of replication (ori), and selectable markers such as drug resistance genes). In the expression vector, the modified nucleotide sequence is operably linked so as to be transcribed and translated. Regulatory elements include promoters, terminators and enhancers. The definition of the regulatory element is as described above. When the expressed enzyme is intended to be secreted outside the cell, the base sequence encoding the secretory signal peptide is bound upstream of the modified base sequence in the correct reading frame. The type of expression vector used for introduction into a particular organism (eg, bacterium), the types of regulatory elements and other factors used in the expression vector can vary depending on the cell of interest, This is a matter well known to those skilled in the art.

  Examples of vectors in the present specification include vectors that can be replicated and isolated and purified by common bacteria used in genetic experiments (typically, E. coli strains derived from E. coli K12). This is necessary for constructing the target nucleic acid molecule to be introduced into the target organism (eg, plant). Specifically, there are commercially available construction plasmids such as pBR322 plasmid of E. coli, pUC18, pUC19, pBluescript, pGEM-T, and pGEM-T Easy. When a gene fragment is directly introduced into a plant cell such as electroporation method, polyethylene glycol method or particle gun method for transformation, the gene to be introduced is introduced using such a commercially available general plasmid. Should be constructed. In addition, as a special example of a vector, when transforming a plant cell using an Agrobacterium-mediated gene transfer method, the replication origin of both E. coli and Agrobacterium, and the border region that can be introduced into the plant are defined. It is necessary to use a plasmid called a “binary vector” having a nucleotide sequence corresponding to the border sequence derived from the T-DNA (Left border and Right Border). For example, pBI101 (commercially available from Clontech), pBIN (Bevan, N., Nucleic Acid Research 12, 8711-8721, 1984), pBINPlus (van Engelen, FA et al., Transgenic Research 4, 288-290, 1995), pTN. (Fukuoka H et al., Plant Cell Reports 19, 2000), pPZP (Hajdukiwicz P et al., Plant Molecular Biology 25, 989-994, 1994) and the like. In addition, examples of vectors that can be used in plants include tobacco mosaic virus vectors. However, since this type of vector does not introduce a target gene into a plant chromosome, it is necessary to propagate the transgenic plant with seeds. The use is limited when there is no, but it can be used in the present invention.

  The expression vector can include the selectable marker of the present invention in an expression cassette. An “expression cassette” is a nucleotide sequence to be expressed (eg, a structural gene), a promoter sequence that regulates its expression, a terminator sequence that terminates mRNA transcription, and various other regulatory elements as necessary. 1 unit of an artificially constructed gene that is operably linked to the nucleotide sequence to be expressed in the cell of interest. Representative examples of expression cassettes include selectable marker (eg, hygromycin resistance gene) expression cassettes for selecting only transformed cells of the target cells, and useful protein coding sequences to be expressed in host cells. Of the expression cassette. The type, structure, and number of expression cassettes to be prepared should be properly used depending on the organism, host cell, and purpose, and combinations thereof are well known to those skilled in the art.

  An “expression vector” may also be defined as a “vector” that may include one or more of the above “expression cassettes”. Each expression cassette to be introduced into the target cell may be arranged on a separate vector, or all the expression cassettes may be linked on one vector. For example, when a selectable marker coding sequence is further used in the present invention, a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a gene encoding an enzyme capable of degrading a metabolizable sugar An expression cassette comprising at least one promoter sequence selected from the group consisting of promoter sequences and a gene gene sequence operably linked to the promoter sequence and an expression cassette comprising a selectable marker coding sequence on the same expression vector It may be present or on a separate expression vector. Preferably they are on the same expression vector. More preferably, at least one selected from the group consisting of a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar. The expression cassette comprising the promoter sequence and the gene gene sequence operably linked to the promoter sequence and the expression cassette comprising the selectable marker coding sequence are contained in the same expression cassette. In the present invention, a binary vector type expression vector may be used as an expression vector for plants.

(3. Plant cells)
The plant cell of the present invention is selected from the group consisting of a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar. At least one promoter sequence and a heterologous gene sequence operably linked to the selected promoter sequence.

  Regarding sugar deficiency-inducible promoter sequences, promoter sequences of genes encoding exo-type glycolytic enzymes, promoter sequences of genes encoding enzymes capable of degrading metabolizable sugars, operably linked heterologous gene sequences, etc. , As described in 1 above.

  The plant cells used in the present invention may be cells derived from any plant (for example, monocotyledonous plants, dicotyledonous plants, etc.).

  As the plant cell, a cell derived from a flowering plant (monocotyledonous or dicotyledonous) is preferably used, more preferably a dicotyledonous plant cell is used, more preferably a grass family, solanaceae, cucurbitaceae, or cruciferous. Cells derived from plants of the family Apiaceae, Rosaceae, Leguminosae, and Muraceae are used. More preferably, wheat, corn, rice, barley, sorghum, tobacco, bell pepper, eggplant, melon, tomato, strawberry, sweet potato, Arabidopsis, rape, cabbage, leek, broccoli, soybean, alfalfa, flax, carrot, cucumber, citrus, Cells derived from Chinese cabbage, lettuce, peach, potato, purple, purple, poplar and apple are used. Even more preferably, cells derived from tobacco or Arabidopsis thaliana are used. Most preferably, cells derived from Arabidopsis thaliana are used.

  Plant cells can be plant parts, organs, tissues, cultured cells, and the like. It is preferably a cultured cell. When aiming for high protein production using plants, it is particularly preferable to secrete the target protein into the culture medium using cultured cells, since the protein extraction and purification steps can be greatly omitted. The plant cell is preferably a cultured cell having a high growth rate. The rapid growth rate means that when the cultured cells are cultured for 1 week under arbitrary culture conditions, the number of cells at the start of the culture is preferably about 10 times or more, more preferably about 20 times or more, more preferably about 30 times or more, more preferably about 40 times or more, more preferably about 50 times or more, more preferably about 60 times or more, more preferably about 70 times or more, further preferably about 80 times or more, particularly preferably about 90 times. As mentioned above, it means that it can proliferate to the number of cells about 100 times or more preferably.

  Examples of such cultured cells with a high growth rate include cells that can grow 50 times or more in one week (for example, tobacco BY-2 cells), but are not limited thereto. Tobacco BY-2 cells were originally from Nicotiana tabacum L. cv. A strain established from callus induced on the hypocotyl of Bright Yellow 2, which requires auxin for growth. Cultured cells having the same properties as BY-2 cells are described in Kato, A. et al. Et al., "Fermentation Technology Today", 1972, pp. 689-695; can be distributed by Prof. Seiichiro Serizawa, Graduate School of Frontier Sciences, University of Tokyo. Tobacco BY2 cells have an advantage that they have an unusually fast growth rate (about 100 times per week) as a cultured cell of plants, a uniform cell population, and easy transformation. Similar to BY-2 cells, a rapidly proliferating cell population was prepared according to the method described in the above-mentioned Kato et al., 0.2 mg / l 2,4-dichlorophenoxyacetic acid, 0.4 mg / l thiamine hydrochloride. By inducing callus from tobacco hypocotyls in RM-1964 medium (Linsmeier and Skoog, Physiol. Plant. 18, 1965, p.100) containing 30 g / l sucrose and further culturing the callus in the same medium Can be obtained. Regarding cultured cells derived from Arabidopsis thaliana, cells that can proliferate 50 times or more in one week are known. Most preferably, cultured cells derived from Arabidopsis thaliana are used. Arabidopsis has a small genome size, all genetic information has been elucidated, basic knowledge of cell physiology is abundant, information on tools such as promoters that can be used for inductive production is substantial, and gene manipulation is easy This is because various modifications can be made.

  The cells of the present invention can be produced using transformation methods well known in the art using these cells. Alternatively, the cells of the present invention can be cells obtained from progeny obtained by redifferentiating cells produced according to transformation methods well known in the art, obtaining transformed individuals, and mating the individuals. .

  Methods for transforming cells, tissues, organs or individuals are well known in the art. Such techniques are sufficiently described in the literature cited in the present invention. The introduction of the nucleic acid molecule into the biological cell may be vortex or constitutive. Transient or homeostatic gene transfer techniques are each well known in the art. Techniques for producing transformed plants by differentiating cells used in the present invention are also well known in the art, and it is understood that such techniques are well described in the literature cited in the present invention. . Techniques for obtaining seeds from transformed plants are also well known in the art, and such techniques are described in the literature cited in the present invention.

  “Transformant” refers to all or part of a living organism such as a cell produced by transformation. A plant cell is illustrated as a transformant. A transformant is also referred to as a transformed cell, transformed tissue, transformed host, etc., depending on the subject, and encompasses all of these forms herein, but may refer to a particular form in a particular context. .

  In a preferred embodiment, the nucleic acid molecule of the present invention can be introduced into both chromosomes in the plant of the present invention, but those introduced only in a pair can also be useful.

  As a method for placing a nucleic acid molecule and a target cell under conditions that allow transformation with the nucleic acid molecule, any method for introducing DNA into a plant cell may be described in detail elsewhere in this specification. Any of them can be used, for example, the Agrobacterium method (Japanese Patent Laid-Open No. 59-140885, Japanese Patent Laid-Open No. 60-70080, WO 94/00977), the electroporation method (Japanese Patent Laid-Open No. 60-251887). ), A method using a particle gun (gene gun) (Japanese Patent No. 2606856, Japanese Patent No. 2517813) and the like. Among these methods, examples of physical methods include a polyethylene glycol method (PEG method), an electroporation method, a microinjection method, and a particle gun method. These methods are highly useful in that they can be applied to both monocotyledonous and dicotyledonous plants. However, in the polyethylene glycol method and the electroporation method, since the cell wall becomes an obstacle, protoplasts must be used, and the frequency of integration of the introduced gene into the chromosomal DNA of plant cells is a problem. In addition, in the microinjection method using callus or tissue without using protoplasts, there are many difficulties in terms of needle thickness, tissue fixation, and the like. Even in the particle gun method using tissue, there are problems such as the appearance of mutations in the form of chimeras. Moreover, in these physical methods, the introduced foreign gene is generally easily incorporated into the nuclear genome as a multi-copy gene in an incomplete state. It is known that when multiple copies of a foreign gene are introduced, the gene is easily inactivated.

  On the other hand, methods for introducing an isolated gene using organisms include an Agrobacterium method, a virus vector method, and a method using pollen as a vector, which has been developed recently. These methods have the advantage that the culture does not last for a long period of time and is not susceptible to damage such as somaclonal mutation because gene transfer is performed using plant callus, tissue or plant without using protoplasts. ing. Among them, the method using pollen as a vector has few experimental examples, and there are many unknown parts as plant transformation methods. Although the viral vector method has the advantage that the gene to be introduced to the entire plant infected with the virus spreads, it is only amplified and expressed in each cell, and there is no guarantee that it will be transmitted to the next generation, Another problem is that long DNA fragments cannot be introduced. The Agrobacterium method has many advantages such as that DNA of about 20 kbp or more can be introduced into a chromosome without large rearrangement, the number of copies of the introduced gene is as few as several copies, and reproducibility is high. . Since Agrobacterium is out of the host range for monocotyledonous plants such as gramineous plants, introduction of foreign genes into gramineous plants has been conventionally performed by the physical methods described above. However, in recent years, the Agrobacterium method has been applied to monocotyledonous plants, such as rice, where the culture system has been established. Rather, the Agrobacterium method is now preferred. .

  In the introduction of foreign genes by the Agrobacterium method, when a low molecular weight phenolic compound such as acetosyringone synthesized by plants acts on the Ti plasmid Vir region, the T-DNA region is excised from the Ti plasmid and undergoes several processes. It is integrated into the nuclear chromosomal DNA of plant cells. In the dicotyledonous plant, since the plant itself has such a phenol compound synthesis mechanism, a foreign gene can be easily introduced by a leaf disk method or the like, and the reproducibility is also high. On the other hand, in monocotyledonous plants, since such plants do not synthesize such phenolic compounds, it was difficult to produce transformed plants using Agrobacterium. However, it is now possible to introduce foreign genes into monocotyledons by adding acetosyringone during Agrobacterium infection.

  When the present invention is used in plants, plant expression vectors can be introduced into plant cells by methods well known to those skilled in the art, for example, methods involving Agrobacterium and methods for direct introduction into cells. As a method using Agrobacterium, for example, the method of Nagel et al. (Nagel et al. (1990), Microbiol. Lett., 67, 325) can be used. This method involves first transforming Agrobacterium by electroporation, for example with an expression vector suitable for plants, and then transforming the transformed Agrobacterium into Gelvin et al. (Edited by Gelvin et al. (1994), Plant Molecular Biology Manual). (Kluwer Academic Press Publishers)). For methods of introducing plant expression vectors directly into cells, see electroporation (see Shimamoto et al. (1989), Nature, 338: 274-276; and Rhodes et al. (1989) Science, 240: 204-207. ), Particle gun method (see Christou et al. (1991), Bio / Technology 9: 957-962) and polyethylene glycol (PEG) method (Datta et al. (1990), see Bio / Technology 8: 736-740). ). These methods are well known in the art, and a method suitable for the plant to be transformed can be appropriately selected by those skilled in the art.

  In the present invention, in the transformant, the target nucleic acid molecule (transgene) may or may not be introduced into the chromosome. Preferably, the nucleic acid molecule of interest (transgene) has been introduced into a chromosome, and more preferably has been introduced into both two chromosomes.

  When performing the transformation treatment, a selection marker gene is used if necessary. Cells in which the nucleic acid molecule of the present invention has been introduced from among cells that have undergone transformation treatment by using a combination of a selection marker and an appropriate selection factor (for example, antibiotic, dye, etc.). Can be selected more efficiently. However, this step is not necessarily essential in the present invention. Such selection methods vary depending on the characteristics of the selectable marker possessed by the introduced nucleic acid molecule. For example, when a resistance gene for an antibiotic (eg, hygromycin, kanamycin, etc.) is introduced as a selectable marker, its identification The target cell can be selected using any antibiotic. Alternatively, when a marker gene (for example, a green fluorescent gene) is used as a selection marker, target cells can be selected using such a marker as a guide. Alternatively, when the foreign gene itself causes a phenotypically distinguishable difference, the transgenic cell may be selected based on such a difference. Examples of such distinguishable differences include, but are not limited to, the presence or absence of pigment expression.

  The transformed cells thus obtained can then be redifferentiated into plant tissues, plant organs and / or plants by methods well known in the art.

  Techniques and media known in the art are used for culturing, differentiation and regeneration of plant cells, plant tissues and plants. Examples of such a medium include, but are not limited to, Murashige-Skoog (MS) medium, GaMborg B5 (B) medium, White medium, Nitsch & Nitsch (Nitsch) medium, and the like. These media are usually used after adding an appropriate amount of a plant growth regulator (plant hormone) or the like.

  In the present specification, in the case of a plant, “redifferentiation” of the plant means a phenomenon in which the whole individual is restored from a part of the individual. For example, by redifferentiation, an organ or a plant is formed from a tissue piece such as a cell (a leaf, a root, etc.).

  A method for redifferentiating a transformant into a plant is well known in the art. Such methods include Rogers et al., Methods in Enzymology 118: 627-640 (1986); Tabata et al., Plant Cell Physiol. , 28: 73-82 (1987); Shaw, Plant Molecular Biology: A practical approach. IRL press (1988); Shimamoto et al., Nature 338: 274 (1989); Maliga et al., Methods in Plant Molecular Biology: A laboratory course. Examples thereof include, but are not limited to, those described in Cold Spring Harbor Laboratory Press (1995). Therefore, those skilled in the art can regenerate by appropriately using the well-known method according to the transformed plant for the purpose. The transgenic plant thus obtained is introduced with a gene of interest, and the introduction of such a gene can be performed by a method described herein such as Northern blot or Western blot analysis or other methods. This can be confirmed using well-known conventional techniques.

  Furthermore, seeds can be obtained from the obtained transformed plant body. Expression of the introduced gene can be detected by Northern blotting or PCR. If necessary, the expression of a protein as a gene product can be confirmed by, for example, Western blotting.

  Although the present invention has been shown to be particularly useful in plants, it can also be used in other organisms. The molecular biology techniques used in the present invention are well known and commonly used in the art, see, for example, Ausubel F. et al. A. (1988), Current Protocols in Molecular Biology, Wiley, New York, NY; Sambrook J, et al. (1987) Molecular Cloning: A Laboratory Manual, 2nd edition and its third edition NY, a separate volume of experimental medicine, “Gene Transfer & Expression Analysis Experimental Method”, Yodosha, 1997, and the like.

(4. Organization)
The tissue of the present invention is at least selected from the group consisting of a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar. One promoter sequence and a heterologous gene sequence operably linked to the selected promoter sequence.

  Regarding sugar deficiency-inducible promoter sequences, promoter sequences of genes encoding exo-type glycolytic enzymes, promoter sequences of genes encoding enzymes capable of degrading metabolizable sugars, operably linked heterologous gene sequences, etc. , As described in 1 above.

  In the present specification, the “tissue” of an organism refers to a group of cells having a certain similar action in the group. Thus, the tissue can be part of an organ. In an organ, it often has cells having the same function, but there may be a mixture of subtly different functions. Therefore, in this specification, as long as tissues share certain characteristics, various cells May be mixed. A “tissue” usually has the same origin, but even cell populations with different origins can be referred to as a tissue if they have the same function and / or morphology. Usually, tissue constitutes part of an organ. Plants are roughly classified into meristems and permanent tissues according to the stage of development of the constituent cells, and are classified into single tissues and composite tissues according to the types of constituent cells.

  The tissue of the present invention can be obtained by tissue differentiation according to a method known in the art using cells produced according to the following “8. Method for producing transformed cells”. Alternatively, the tissue of the present invention is a tissue obtained from progeny obtained by redifferentiating cells produced according to “8. Method for producing transformed cells”, obtaining transformed individuals, and mating the individuals. possible.

(5. Organ)
The organ of the present invention is at least selected from the group consisting of a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading metabolizable sugars. One promoter sequence and a heterologous gene sequence operably linked to the selected promoter sequence.

  Regarding sugar deficiency-inducible promoter sequences, promoter sequences of genes encoding exo-type glycolytic enzymes, promoter sequences of genes encoding enzymes capable of degrading metabolizable sugars, operably linked heterologous gene sequences, etc. , As described in 1 above.

  In this specification, an “organ” refers to a structure having one independent form and a structure that performs a specific function by combining one or more kinds of tissues. Examples of the plant include, but are not limited to, callus, root, stem, stem, leaf, flower, seed, germ, embryo, fruit, and endosperm.

  The organ targeted by the present invention may be any organ, and the tissue or cell targeted by the present invention may be derived from any organ of an organism. In general, in a multicellular organism (eg, a plant), an organ consists of several tissues with a specific spatial arrangement, and a tissue consists of many cells.

  The organ of the present invention can be obtained by tissue differentiation according to a method known in the art and formation of an organ using cells produced according to a transformation method well known in the art. Alternatively, the organ of the present invention is an organ obtained from progeny obtained by redifferentiating cells produced according to a known method for producing transformed cells in the art, obtaining transformed individuals, and mating the individuals. It can be.

(6. Organism)
The organism of the present invention is selected from the group consisting of a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading metabolizable sugars. At least one promoter sequence and a heterologous gene sequence operably linked to the selected promoter sequence.

  Regarding sugar deficiency-inducible promoter sequences, promoter sequences of genes encoding exo-type glycolytic enzymes, promoter sequences of genes encoding enzymes capable of degrading metabolizable sugars, operably linked heterologous gene sequences, etc. , As described in 1 above.

  In the present specification, the “organism” (or “plant” in the case of plants) is used in the broadest sense in the field, and refers to a living phenomenon (or plant), typically a cell structure. It has various properties such as proliferation (self-reproduction), growth, regulation, substance metabolism, repair ability, etc., and usually has inheritance governed by nucleic acids and proliferation involved in metabolism governed by proteins as basic attributes. Living organisms include prokaryotes, eukaryotes (plants, animals, etc.) and the like. Preferably, in the present invention, the organism may be a plant. As used herein, preferably such a plant may be fertile. More preferably, such a plant can produce seeds.

  The organism of the present invention can be obtained by redifferentiating a cell produced according to a transformation method well known in the art according to a method known in the art. Alternatively, the organism of the present invention is an organism obtained from progeny obtained by redifferentiating cells produced according to transformation methods well known in the art, obtaining transformed individuals, and mating the individuals. possible.

  As used herein, “plant” is a collective term for organisms belonging to the plant kingdom, characterized by chlorophyll, hard cell walls, the presence of abundant permanent embryonic tissues, and organisms that are not capable of motility. . Typically, a plant refers to a flowering plant having cell wall formation and anabolism by chlorophyll. Plants include both monocotyledonous and dicotyledonous plants. Preferable plants include monocotyledonous plants belonging to the family Gramineae such as wheat, corn, rice, barley and sorghum. The plant is preferably an edible crop or a medicinal plant. Other examples of preferred plants include tobacco, bell pepper, eggplant, melon, tomato, strawberry, sweet potato, cabbage, leek, broccoli, carrot, cucumber, citrus, Chinese cabbage, lettuce, peach, potato, purple, orange and apple. It is done. More preferably, the plant may be tobacco, rice, tomato, strawberry, purple or auren. Preferred plants are not limited to crops, but also include flowers, trees, lawns, weeds and the like. Unless otherwise indicated, a plant means any plant, plant organ, plant tissue, plant cell, and seed. Examples of plant organs include roots, leaves, stems and flowers. Examples of plant cells include callus and suspension culture cells.

  Examples of gramineous plants include plants belonging to Oryza, Hordenum, Secale, Scccharum, Echinochloa, or Zea, and include, for example, rice, barley, rye, millet, sorghum, corn, and the like.

  Plants that contain heterologous nucleotide sequences can express gene products that are not naturally expressed.

  In a preferred embodiment, in the organism of the present invention, the nucleic acid molecule of the present invention can be introduced into both chromosomes, but those introduced in only one pair can also be useful.

(7. Protein production method)
The protein production method of the present invention is selected from the group consisting of a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar. Introducing into the cell a nucleic acid molecule comprising at least one promoter sequence selected and the protein coding sequence operably linked to the selected promoter sequence to obtain a transformed cell; Culturing in the absence of sugar to secrete the protein; and recovering the protein.

  Regarding sugar deficiency-inducible promoter sequences, promoter sequences of genes encoding exo-type glycolytic enzymes, promoter sequences of genes encoding enzymes capable of degrading metabolizable sugars, operably linked heterologous gene sequences, etc. , As described in 1 above.

  In the method of the present invention, first, a deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar are selected. A nucleic acid molecule comprising at least one promoter sequence and the protein coding sequence operably linked to the selected promoter sequence is introduced into the cell to obtain a transformed cell.

  The cell used in the production method of the present invention can be any cell among plant cells, bacterial cells and animal cells, but is preferably a plant cell.

  As the plant cell, a cell derived from a flowering plant (monocotyledonous or dicotyledonous) is preferably used, more preferably a dicotyledonous plant cell is used, more preferably a grass family, solanaceae, cucurbitaceae, or cruciferous. Cells derived from plants of the family Apiaceae, Rosaceae, Leguminosae, and Muraceae are used. More preferably, wheat, corn, rice, barley, sorghum, tobacco, bell pepper, eggplant, melon, tomato, strawberry, sweet potato, rape, cabbage, leek, broccoli, soybean, alfalfa, flax, carrot, cucumber, citrus, Chinese cabbage, Cells derived from lettuce, peach, potato, purple, auren, poplar and apple are used. Most preferably, tobacco-derived cells are used.

  Plant cells can be plant parts, organs, tissues, cultured cells, and the like. It is preferably a cultured cell. The plant cell is preferably a cultured cell having a high growth rate. The rapid growth rate means that when the cultured cells are cultured for 1 week under arbitrary culture conditions, the number of cells at the start of the culture is preferably about 10 times or more, more preferably about 20 times or more, more preferably about 30 times or more, more preferably about 40 times or more, more preferably about 50 times or more, more preferably about 60 times or more, more preferably about 70 times or more, further preferably about 80 times or more, particularly preferably about 90 times. As mentioned above, it means that it can proliferate to the number of cells about 100 times or more preferably.

  Examples of such cultured cells with a high growth rate include tobacco BY-2 cells, but are not limited thereto. A cell line having a high growth rate has been established even in cultured cells derived from Arabidopsis thaliana. Examples of such cell lines include James A. et al. H. Examples include cell lines established by Dr. Murray, Institute of Biotechnology, University of Cambridge, Tennis Court Road, Cambridge CB2 1QT, and United Kingdom. Of course, a cell line having a high growth rate can also be obtained by culturing an Arabidopsis plant to grow cultured cells, and repeatedly selecting cells having a high growth rate from the grown cells. These cells are as described above.

  The cells of the present invention can be transformed with these cells using transformation methods well known in the art as described in “3. Cells” above. Alternatively, the transformed cell may be a cell obtained from a progeny obtained by redifferentiating a cell produced according to a transformation method well known in the art, obtaining a transformed individual, and mating the individual. .

  The nucleic acid molecule used to transform the cell can further include a signal peptide coding sequence. The signal peptide coding sequence is as described in 1 above.

  Then, the transformed cell may be cultured as it is in the absence of sugar to secrete the protein. Alternatively, the transformed cells may be first grown in the presence of sugar and then transferred to the absence of sugar and cultured.

  As used herein, a “sugar” can be any sugar, but is preferably a metabolizable glycolytic sugar or a sugar that can become a glycolytic sugar when metabolized. A glycolytic sugar refers to a sugar that can be metabolized. Metabolizable sugars are as described in “1. Nucleic acid molecules” above. The metabolizable sugar is preferably glucose, fructose, xylose, galactose, sucrose, maltose and arabinose, more preferably sucrose. This is because sucrose is inexpensive and easily available compared to other monosaccharides.

  The sugar concentration when the transformant is cultured can be easily determined by a method known in the art. Appropriate medium compositions for the cells of interest are known in the art. The medium may be liquid or solid, but is preferably liquid. It is preferable to perform shaking culture in a liquid medium. This is because the cells grow rapidly when shake-cultured in a liquid.

  When the transformed cells are cultured in the presence of sugar before the transformed cells are cultured in the absence of sugar, the sugar concentration under these conditions is preferably about 10 mM or more, more preferably about 15 mM. Or more, more preferably about 20 mM or more. There is no particular upper limit on the sugar concentration, but there is no particular lower limit if necessary, but the concentration can be about 200 mM or less, about 150 mM or less, about 100 mM or less, or about 90 mM or less as necessary. When transformed cells are cultured in the presence of sugar, the sugar deficiency responsive promoter does not respond, and normal metabolism that the cell normally has occurs. In the presence of sugar, transformed cells preferably grow rapidly.

  Transfected cells are cultured in the presence of sugar and then transferred to the absence of sugar, for example, by starting to culture the transformed cells in the presence of a certain concentration of sugar and culturing for a period of time. By the growth of the transformed cells, sugar may be transferred from the medium. Preferably, however, after the transformed cells have been cultured in the presence of sugar for a period of time, the transformed cells are recovered according to methods known in the art and placed in a new medium without sugar. Can be achieved. When cells are cultured in a liquid medium, for example, it is preferable to collect the cells by passing them through a mesh having an appropriate mesh size that does not allow the cells to pass through (for example, a 20 μm mesh). The mesh can be manufactured from any material. For example, a nylon mesh can be used. Cultured cells can also be collected by centrifugation at 1,000 g × 5 minutes. When cells are cultured on a solid medium, the cell mass can be picked with tweezers or the like and replaced with a new medium.

  “In the absence of sugar” mainly refers to conditions in which sugar is substantially absent. The condition in which sugar is substantially absent refers to a condition in which a sugar deficiency responsive promoter promotes expression. The concentration of sugar under conditions substantially free of sugar is preferably less than 15 mM to bake, more preferably less than about 10 mM, even more preferably less than about 5 mM, still more preferably less than about 3 mM. Even more preferably less than about 1 mM, particularly preferably less than about 0.1 mM. Conditions that are substantially free of sugar include conditions where no sugar is present.

  Methods for preparing media containing appropriate concentrations of sugar are well known to those skilled in the art.

  When a transformed cell is cultured in the absence of sugar, a sugar deficiency inducible promoter in the transformed cell responds and expression of a heterologous gene sequence operably linked to the sugar deficiency inducible promoter occurs. Furthermore, operably linked to the heterologous gene sequence is a signal peptide coding sequence that results in secretion of the gene product encoded by the heterologous gene sequence.

  The secreted protein is then recovered. The protein can be recovered using methods well known in the art.

  Protein separation techniques are well known in the art, and any technique that can separate proteins may be used. In order to isolate or purify a protein (for example, a useful protein) encoded by a protein coding sequence from the culture of the transformed cell of the present invention, a commonly used conventional protein isolation or purification method well known in the art Can be used. For example, when the polypeptide of the present invention is secreted outside the transformant of the present invention, the culture is treated by a method such as centrifugation to obtain a soluble fraction. . From the soluble fraction, anion exchange chromatography using a resin such as a solvent extraction method, a salting out method using ammonium sulfate, a precipitation method using an organic solvent, diethylaminoethyl (DEAE) -Sepharose, DIAION HPA-75 (Mitsubishi Chemical), etc. Chromatography method, cation exchange chromatography method using resin such as S-Sepharose FF (Pharmacia), hydrophobic chromatography method using resin such as butyl sepharose and phenyl sepharose, gel filtration method using molecular sieve, affinity chromatography A purified sample can be obtained by using a technique such as a chromatography method, a chromatofocusing method, an electrophoresis method such as isoelectric focusing.

  As used herein, an “isolated” polypeptide refers to other biological factors within the cells of the organism in which the polypeptide naturally occurs (eg, other than a polypeptide and a polypeptide of interest). Or substantially isolated from or purified from such a polypeptide. An “isolated” polypeptide includes a polypeptide purified by standard purification methods. Thus, an isolated polypeptide includes a chemically synthesized polypeptide. In addition, a polypeptide mixed with other substances after being purified by a standard purification method, a polypeptide dissolved in a buffer solution, and the like also correspond to the isolated polypeptide referred to in this specification.

  As used herein, a “purified” polypeptide refers to a polypeptide from which at least a part of factors naturally associated with the polypeptide has been removed. Thus, typically, the purity of the polypeptide in a purified polypeptide is higher (ie, enriched) than the state in which the polypeptide is normally present.

  When the protein of interest accumulates in a dissolved state in the cells of the transformant of the present invention, the cells in the culture are collected by centrifuging the culture, washed, and then ultrasonically disrupted. A cell-free extract is obtained by crushing cells with a machine, French press, Manton Gaurin homogenizer, Dynomill or the like. From the supernatant obtained by centrifuging the cell-free extract, a solvent extraction method, a salting-out method using ammonium sulfate, a desalting method, a precipitation method using an organic solvent, diethylaminoethyl (DEAE) -Sepharose, DIAION Anion exchange chromatography using a resin such as HPA-75 (Mitsubishi Chemical), cation exchange chromatography using a resin such as S-Sepharose FF (Pharmacia), and a resin such as butyl sepharose and phenyl sepharose were used. By using a method such as hydrophobic chromatography, gel filtration using a molecular sieve, affinity chromatography, chromatography focusing, electrophoresis such as isoelectric focusing, etc., a purified preparation can be obtained.

  If the target protein is expressed in an insoluble form in the cells, the cells are similarly recovered and then disrupted, and the protein is recovered from the precipitate fraction obtained by centrifuging. The protein insoluble material is solubilized with a protein denaturant. This solubilized solution was diluted or dialyzed so that the protein denaturant concentration did not contain protein denaturant or the protein denaturant concentration was so dilute that protein was not denatured, and the target protein was constituted into a normal three-dimensional structure. Thereafter, a purified preparation can be obtained by the same isolation and purification method as described above. Moreover, when it can accumulate | store in the specific organelle in a cell, for example, a protein body, the target protein can also be refine | purified after isolate | separating the organelle.

  The protein can be purified according to a conventional protein purification method (J. Evan. Sadler et al .: Methods in Enzymology, 83, 458). For example, the target protein can be produced as a fusion protein with other proteins and purified using affinity chromatography using a substance having affinity for the fused protein [Akio Yamakawa, Experimental Medicine (Experimental Medicine, 13, 469-474 (1995)]. For example, according to the method described by Lowe et al. (Larsen et al., Proc. Natl. Acad. Sci., USA, 86, 8227 (1989), Kukouska-Latallo JF, Genes Dev., 4, 1288 (1990)). Thus, the target protein can be produced as a fusion protein with protein A and purified by affinity chromatography using immunoglobulin G.

  For example, a target protein and a purification tag (for example, a His tag (for example, a 6 × His tag composed of 6 His residues), an HA tag, a protein A, an IgG domain, or a maltose-binding protein) are fused, For example, if a fusion protein designed to add a cleavage site by a protease is produced between the target protein and the purification tag, the fusion protein is purified using affinity chromatography on the purification tag, and then purified. For example, the target protein can be easily purified by cleaving the target protein from the fusion protein using a protease.

  For example, when using a 6 × His tag, cells expressing the fusion protein are collected by centrifugation (eg, about 6000 × g for 20 minutes) and the cell pellet is placed in a chaotropic agent 6M guanidine HCl at 4 ° C. Solubilize by stirring for 3-4 hours. Cell debris is then removed by centrifugation and the supernatant containing the polypeptide is loaded onto a nickel-nitrilotriacetic acid (“Ni-NTA”) affinity resin column (available from QIAGEN, Inc. supra). Proteins with a 6 × His tag bind with high affinity to Ni-NTA resin and can be purified in a simple one-step procedure (for details see The QIA expressionist (1995) QIAGEN, Inc., supra. See Briefly, the supernatant is loaded onto a 6M guanidine-HCl, pH 8 column and the column is first washed with 10 volumes of 6M guanidine-HCl, pH 8, and then with 10 volumes of 6M guanidine-HCl, pH 6. Wash and finally elute the polypeptide with 6M guanidine-HCl, pH 5. The purified protein is then regenerated by dialysis against phosphate buffered saline (PBS) or 50 mM sodium acetate, pH 6 buffer and 200 mM NaCl. Alternatively, the protein can be successfully refolded while immobilized on a Ni-NTA column. The recommended conditions are as follows: regeneration using a linear gradient of 6M-1M urea in 500 mM NaCl, 20% glycerol, 20 mM Tris / HCl pH 7.4 with protease inhibitors. Regeneration is preferably performed over 1.5 hours or more. After regeneration, the protein is eluted by the addition of 250 mM imidazole. Imidazole is removed by a final dialysis step against PBS or 50 mM sodium acetate pH 6 buffer and 200 mM NaCl. In this way, a purified protein is obtained.

  Alternatively, the target protein can be produced as a fusion protein with a FLAG peptide and purified by affinity chromatography using an anti-FLAG antibody (Larsen et al., Proc. Natl. Acad. Sci., USA, 86, 8227 (1989). ), Kukouska-Latallo JF, Genes Dev., 4, 1288 (1990)).

  Furthermore, it can also be purified by affinity chromatography using an antibody against the polypeptide of interest itself. The protein of the present invention can be obtained by known methods [J. Biomolecular NMR, 6,129-134, Science, 242, 1162-1164, J. Biol. Biochem. 110, 166-168 (1991)], it can be produced using an in vitro transcription / translation system.

  The present invention provides a composition comprising the translation product of the nucleotide of interest produced by the method of the present invention. The translation product contained in such a composition will vary depending on the nucleotide of interest used, but may preferably be a protein.

  In the following, the present invention will be described based on examples which are preferred embodiments of the present invention. However, the following examples are provided for illustrative purposes only. Accordingly, the scope of the present invention is not limited to the detailed description of the invention nor the following examples, but is limited only by the scope of the claims. Patents, patent applications, and documents cited herein should be incorporated by reference in their entirety, as if the contents themselves were specifically described herein. Understood.

(Example 1: Isolation of a sugar deficiency responsive gene)
(Outline of Example 1)
To identify sugar-responsive genes, Arabidopsis cDNA macroarrays were hybridized with probes prepared from seedlings cultured in the presence or absence of sucrose. Initial screening identified 36 affected cDNAs. Twelve of these cDNAs were identified as being induced under sugar-deficient conditions. Nine of these were novel with respect to known sugar responses. Based on the properties of the encoded proteins, they were classified into three groups involved in amino acid metabolism, carbohydrate metabolism and unknown. Subsequently, the correlation between these expression profiles and sugar levels was analyzed using plants. When the detached leaves were subjected to sucrose deficiency for 36 hours, there was a significant decrease in glucose but no sucrose reduction and concomitantly all 12 genes were induced. However, these transcripts declined rapidly within 7 hours when the sample was re-fed with sucrose. A similar pattern of induction and suppression was observed by dark treatment of the entire plant, but not during natural senescence of mature leaves. Inhibition analysis with glucose analogs showed that nine of these genes could be associated with the hexokinase signaling pathway. This observation indicates that plants activate a set of genes involved in substance recycling during sugar deficiency and that these genes are functionally diverse, but simultaneously and coordinated Suggests to be regulated.

  Details of this method and results are described below.

(1.1 Materials and methods)
(1.1.1 Plant material and growth conditions)
Arabidopsis (ecotype Columbia) was lighted in 0.5 × MS liquid medium (Murashige and Skoog basic salt, pH 5.8) containing 2% sucrose (w / v) for 16 hours light period / 8 hours dark period Grown at 21 ° C. in cycles. Three weeks after sowing, the seedlings were depleted of sugar by transplanting to sucrose-free medium and further cultured in the dark for up to 79 hours. After 72 hours of culture in sucrose-free medium, the seedlings were re-fed with sucrose by transplanting the seedlings in a medium supplemented with 2% sucrose (w / v) for 7 hours.

(1.1.2 Preparation of cDNA Macroarray)
The Arabidopsis cDNA macroarray was supplied by Kazusa DNA Laboratory. The filter (8 × 12 cm) contained approximately 13,000 PCR amplified cDNA fragments prepared from four different tissues (above-ground organs, flower buds, roots and green longhorn). Amplicon and array fabrication are described in Asamizu et al., DNA Research 7, 2000, pp. 175-180 and Sasaki et al., DNA Research 8, 2001, pp. 153-161.

(1.1.3 RNA extraction and macroarray hybridization)
Total RNA was isolated from the sprout using the AGPC (acid guanidinium-phenol-chloroform) method (Suzuki et al., Plant Cell and Environment 24, 2001, pp. 1177-1188). Poly (A) ⁺ RNA was purified from 600 μg of total RNA using the PolyATract mRNA Isolation System (Promega). 0.3 μg poly (A) ⁺ RNA and 1 μg oligo (dT) in 12 μl solution were denatured at 70 ° C. for 10 minutes and cooled on ice for 3 minutes and 28 μl total volume (3 μl buffer, 3 μl 25 mM MgCl ₂ , 1.5 μl each 10 mM dNTP, 1 μl 0.1 M DTT, 6 μl [α- ³³ P] dCTP and 1.5 μl reverse transcriptase) for reverse transcription at 37 ° C. for 90 minutes Provided. The resulting ³³ P-labeled cDNA probe was purified by a Quant ^™ G-50 Micro column (Amersham Pharmacia Biotech). After prehybridization at 65 ° C. for 1 hour in Church-phosphate buffer (pH 7.2) (0.5 M Na ₂ HPO ₄ , 1 mM EDTA and 7% SDS) supplemented with 10 μl oligo (dA) The microarray filter was subjected to hybridization with the probe in a total volume of 10 ml for 16-20 hours at 65 ° C. The filters were washed once with 2 × SSC containing 0.1% SDS and twice in 0.5 × SSC containing 0.1% SDS for 30 minutes each at 65 ° C. Each microarray filter was used sequentially for alternative hybridization with ³³ P-labeled cDNA probes prepared from treated and untreated plant material.

(1.1.4 Data analysis)
Filters were scanned using BAS 5000 and signal intensity was analyzed by Array Vision (Amersham Pharmacia Biotech) with background subtraction. Spots showing values below background were excluded from further analysis. To improve the comparison between different hybridizations, the quantified signal intensity was normalized with respect to the integrated value per filter. Induced or repressed sugar responsive genes were identified using the criteria of greater than 3 times the untreated level or less than 0.3 times the untreated level.

(1.1.5 Subarray production, hybridization and data analysis)
In order to eliminate inconsistent clones among the genes identified by the initial array screening, a subarray was constructed with 184 genes and 8 controls, and these adjacent overlapping genes totaled 384 A cDNA subarray of elements is generated (Gene-Lab Co. Ltd.). Hybridization was performed according to the protocol used for cDNA macroarray analysis. The reproducibility of the hybridization signal was evaluated from the average of triplicate experiments.

(1.1.6 RNA gel blot analysis)
Total RNA was obtained from Suzuki et al., Plant Cell and Environment 24, 2001, pp. Extracted from total seedlings or detached leaf tissue as described in 1177-1188. 10 μg of each RNA sample was size fractionated by 1.2% formaldehyde-agarose gel electrophoresis, transferred to a nylon membrane, and crosslinked by UV irradiation. The membrane was subjected to hybridization at 42 ° C. for 16 hours, washed twice at 65 ° C. in 0.5 × SSC containing 0.1% SDS, and Suzuki et al., Plant Cell and Environment 24, 2001, pp. . X-ray film was contacted as described in 1177-1188.

(1.1.7 Determination of soluble sugar)
Soluble sugar was extracted sequentially with 4 mL 80% (v / v) ethanol and 1 mL 50% ethanol. The two layers were pooled and incubated at 80 ° C. for 30 minutes. The solution was centrifuged at 9,000 rpm for 10 minutes and the supernatant was dried in a Speed Vac Concentrator. The dried residue was resuspended in 400 μl of 80% ethanol, mixed with 400 μl of chloroform, and centrifuged at 7,500 rpm for 10 minutes. The supernatant was analyzed for soluble sugars by the enzymatic method (Sigma Diagnostics Glucose reagent, USA).

(1.2 Results)
(1.2.1 Identification of sugar-responsive genes)
Using a cDNA macroarray for about 13.000 Arabidopsis genes, we screened for cDNAs that had altered transcript levels in response to sugar deficiency. Probe cDNA was prepared from hydroponically grown seedlings that had been subjected to sugar deprivation for 79 hours, or hydroponically grown seedlings that had been returned to a sucrose-rich medium after 72 hours of sucrose depletion for 7 hours. Hybridization was performed in duplicate for each sample to obtain high reproducibility. After scaling with the Array Vision, the signal intensity was normalized and the ratio of the intensities between the two probes was calculated. Initial screening resulted in 184 genes whose signal ratio changed by more than 3 fold or less than 0.3 fold (FIG. 1a). Subsequently, duplicate subarrays (each containing 192 genes) were prepared. Of these, 184 were the first identified genes and 8 were positive control genes. Differential hybridization of subarrays with probes prepared from seedlings 3 weeks after seeding, always cultured in the absence or presence of 1% sucrose in the dark, compared transcript levels of 73 genes to controls Showed a 1.5-fold increase or decrease (FIG. 1b).

(1.2.2 Accumulation of transcripts)
Seedlings grown in culture medium containing 1% sucrose were transferred to fresh medium without sucrose and incubated for 12 hours, 36 hours and 79 hours and RNA for 73 genes identified in the subarray Gel blot analysis was performed (Figure 2). The expression pattern of 9 genes induced by sugar deficiency was analyzed by RNA blot hybridization (FIG. 2). For all nine genes, RNA gel blot assay data is consistent with the subarray profile, and we conclude that the quantitative results for these arrays are valid and this isolation the gene was designated AtSUG (a rabidopsis t haliana s ugar u p-regulated) 1~9.

(1.2.3 Response of detached leaves)
When sucrose was fed to a sample of developed leaves detached from the plant 25 days after sowing, it was found that the levels of sucrose and glucose remained relatively constant (FIG. 3a). In contrast, when sucrose was depleted from the sample, the sucrose level gradually decreased and the glucose level rapidly decreased (FIG. 3a). In particular, glucose decreased to less than 10% of the starting level after 79 hours (FIG. 3a). When the sample was depleted of sucrose for 72 hours and then fed 30 mM sucrose for 7 hours, both sucrose and glucose showed a level equal to that in the sample fed with sugar (Figure 3a).

When the transcript accumulation profile was examined for 73 genes identified to respond to sugar binding by RNA blot hybridization, 12 genes were induced. Subsequently, the time course of accumulation of the induced 12 gene transcripts was examined in the detached leaves fed with sucrose and the detached leaves deficient in sucrose (FIG. 3b). None of these transcripts were present in the sample fed sucrose, but they accumulated rapidly when sucrose was depleted. Remarkably, sucrose-inducible transcripts were reduced within 7 hours after refeeding sucrose (FIG. 3b). These patterns seem to be shared in general, but the two (AtSUG4 and AtSUG10) showed some differences. Based on the putative function of the encoded protein, the 12 genes induced were classified into three groups (amino acid metabolism, carbohydrate metabolism and unknown) (Table 1).

[Table 1]

(1.2.4 Effects of dark places)
When the whole plant was shaded, both sucrose and glucose content in rosette leaves were significantly reduced to 25% of the initial level after 3 days (FIG. 4a). This decrease was more pronounced for glucose than sucrose and showed a 70% decrease after 1 day of treatment (FIG. 4a). All AtSUG transcripts in detached leaves were highly induced within 1 day after being transferred to the dark and this level was maintained for up to 3 days (FIG. 4b).

(1.2.5 Effects of aging)
The detached leaves are known to age and are visibly yellowed (FIG. 5a). Detached rosette leaves (which were aged) were used to examine changes in sugar content and AtSUG transcription levels. The experimental system was set up with a Columbia ecotype. In this experimental system, rosette leaves spread well after about 25 days of germination and inflorescence and flowers appear on day 35. On day 50, rosette leaves lose chlorophyll, and day 70 plants mature and reach an aging state. Sucrose and glucose (which accumulated until day 25) decreased rapidly during the next 10 days (FIG. 5a). However, the amounts of both these sugars subsequently increased and reached about the same level on day 70 as on day 25. This may indicate degradation of accumulated starch or cellular compounds (Figure 5a).

  Surprisingly, the response of AtSUG was variable (Figure 5b). It is the first time that not all transcripts have been induced and then induction becomes evident after day 50. AtSUG3 and AtSUG5 transcripts were present in non-senescent leaves on day 25 and persisted at a relatively constant level during the senescence period (FIG. 5b). These results suggest that the AtSUG expression system is different from artificial aging induced by darkness and sugar deficiency, and natural aging associated with addiction.

(1.2.6 Effects of glucose analog)
The effect of 2-deoxyglucose, which is phosphorylated by hexokinase but not subsequently metabolized to glucose-6-phosphate, is thought to indicate involvement of the hexokinase signaling pathway. 3-O-methylglucose is not a substrate for hexokinase, and its effect indicates hexokinase-dependent signaling. All AtSUG was first derepressed by depletion when sucrose was depleted from detached leaves for 48 hours and then sugar or analog was fed for 24 hours (FIG. 6). Refeeding of sucrose and glucose suppressed their expression, but the latter was insufficient to be effective for some genes. 2-Deoxyglucose also suppressed the expression of the majority of AtSUG, but not all, and did not suppress AtSUG5, AtSUG7 and AtSUG10. 3-O-methylglucose did not show any effect on AtSUG. These results indicate that 9 out of 12 AtSUG are probably under the control of the hexokinase signaling pathway, while 3 are clearly independent.

(Example 2: Confirmation of sugar deficiency responsive expression in plants of β-galactosidase, β-xylosidase and β-glucosidase)
The above-mentioned 1.2.2 except that AtSUG1 to 12 isolated in Example 1 were grown in the presence of sucrose and in the absence of sucrose under the condition containing 1% sucrose in the presence of sucrose. Was examined by RNA gel blot analysis in the same manner as described in. The results are shown in FIG. As a result, it was found that AtSUG6 and AtSUG7 were significantly induced in response to sugar deficiency. Therefore, the sequences of AtSUG6 and AtSUG7 were sequenced using a DNA sequencer (Model 373, PE Biosystems, Foster City, CA). As a result of searching the determined sequence for homology with other sequences, it was found that AtSUG6 encodes β-galactosidase and AtSUG7 encodes β-xylosidase.

  By using the obtained sequence, sequence analysis is performed with analysis software called ClustalW on the website of Japan DNA Data Bank (http: www. A phylogenetic tree of the family of (also described as Gal) and β-xyloxase (also described as Xyl) was generated. The results are shown in FIG. In the β-galactosidase family, Gal-1 to Gal-6 exist. There are Xyl-1 to Xyl-3 in the β-xylosidase family.

  To see the expression patterns of these similar genes, use the respective genes as probes for the expression of Gal-1 to Gal-6 and Xyl-1 to Xyl-3 in the presence and absence of sucrose. In the presence of sucrose, RNA gel blot analysis was performed in the same manner as described in 1.2.2 above, except that growth was performed under conditions containing 1% sucrose. The results are shown in FIG. As a result, it was found that Gal-1 and Xyl-1 respond sensitively to sugar deficiency and that expression is significantly induced by sugar deficiency. Expression of Xyl-3 was promoted by sugar deficiency.

  Since these glycolysis-related genes respond sensitively to sugar deficiency, it is thought that other glycolysis-related genes may respond similarly, and Glc-1 is used as a probe for β-glucosidase (Glc-1). In the presence of sucrose, it was examined by RNA gel blot analysis in the same manner as described in 1.2.2 above, except that growth was performed under the condition containing 1% sucrose. The results are shown in FIG. As a result, it was found that expression of β-glucosidase was also significantly induced in response to sugar deficiency.

  When the structures of the Gal-1 gene product (724 amino acids), Xyl-1 gene product (774 amino acids) and Glc-1 gene product (531 amino acids) were compared, all had a signal peptide at the N-terminus. (Fig. 11). Therefore, these gene products are expected to be secreted extracellularly. All of these have glycosylation signals and were considered to be glycoproteins. For the other parts, the homology between these three gene products was low.

(Example 3: Confirmation of glucose deficiency responsive expression in cultured cells of β-galactosidase, β-xylosidase and β-glucosidase)
Cultured cells are characterized in that the sugar source can be easily adjusted and cell wall proteins are secreted into the culture medium (see FIG. 12). If the expression of β-galactosidase, β-xylosidase and β-glucosidase is also induced in cultured cells by sugar deficiency, it is possible to construct a glucose deficiency inducible expression system using the promoters of these genes It is. Therefore, Arabidopsis thaliana (ecotype Columbia) was prepared in 0.5 × MS liquid medium (Murashige and Skog basic salt, pH 5.8) containing 2% sucrose (w / v) for 16 hours light period / 8 hours dark period. And grown at 21 ° C. One week after sowing, the hypocotyl part of Arabidopsis thaliana was excised, and this part was cut into 3% sucrose and 1 mg / L 2,4-dichlorophenoxyacetic acid, 1 × B5 vitamin (0.4 mg / L myo-inositol, 0.004 mg / L nicotinamide, 0.004 mg / L pyridoxine HCl, 0.04 mg / L thiamine HCl) and 0.8% agarose and incubate at 21 ° C. for 1 month in the dark Induced callus. After 1 month, induced callus was treated with 3% sucrose without agarose and 1 mg / L 2,4-dichlorophenoxyacetic acid, 1 × B5 vitamin (0.4 mg / L myo-inositol, 0.004 mg / L nicotinamide, Planted in 1 × MS medium containing 0.004 mg / L pyridoxine HCl, 0.04 mg / L thiamine HCl) and suspended in the dark at 21 ° C. with shaking at 100 rpm for 1 week. After 1 week of suspension culture, the Arabidopsis cultured cells were transformed into 0, 10, 30 or 90 mM sucrose and 1 mg / L 2,4-dichlorophenoxyacetic acid, 1 × B5 vitamin (0.4 mg / L myo-inositol, 0. 004 mg / L nicotinamide, 0.004 mg / L pyridoxine HCl, 0.04 mg / L thiamine HCl) was subcultured at 21 ° C. for 36 hours. At the beginning of subculture (0 hour), 12 hours, 24 hours and 36 hours after subculture, a part of the cultured cells was taken out, and expression of Gal-1, Xyl-1 and Glc-1 in these cells Were examined by RNA gel blot analysis in the same manner as described in 1.2.2 above, except that each gene was used as a probe for each gene. The results are shown in FIG. As a result, Gal-1, Xyl-1, and Glc-1 are remarkably induced to express mRNA in cultured cells due to sugar deficiency, and in the presence of sucrose, mRNA expression of these genes is almost completely suppressed. I understood.

  In order to determine whether the actual enzyme activities of Gal-1, Xyl-1 and Glc-1 in the culture are also increased in a glucose deficiency-inducing manner, 3% sucrose and 1 mg / L 2,4- Pre-culture in 1 × MS medium containing dichlorophenoxyacetic acid, 1 × B5 vitamin (0.4 mg / L myo-inositol, 0.004 mg / L nicotinamide, 0.004 mg / L pyridoxine HCl, 0.04 mg / L thiamine HCl) Then, the cultured cells are transferred to the same medium containing 3% sucrose or without sucrose and subcultured, and then the culture supernatant is obtained after 10 hours, 20 hours, 30 hours or 40 hours. 0.1 ml was collected and artificial substrates (methylumbelliferone-Gal, methylumbelliferone-Xyl and methylumbelliferone-G, respectively) were collected. This supernatant was measured by measuring the fluorescence of free 4-methylumbelliferone (4-MU) in the supernatant using a fluorescence microscope with an excitation wavelength of 365 nm and an absorption wavelength of 455 nm. Β-galactosidase activity, β-xylosidase activity and β-glucosidase activity were measured. The results are shown in FIG. As a result, it was confirmed that expression of β-galactosidase, β-xylosidase and β-glucosidase was significantly induced at the protein level and secreted into the culture medium due to sugar deficiency.

  From these results, at the time of sugar deficiency (sugar starvation), the expression of the cell wall degrading enzyme gene is induced by the sugar starvation, the cell wall degrading enzyme is secreted, and the sugar chain present in the cell wall is degraded by this cell wall degrading enzyme. Monosaccharides such as xylose and glucose are liberated, and it is considered that the liberated sugar is used as a carbon source by the plant (FIG. 15). In other words, if a plant falls into a sugar-starved state due to photosynthesis inhibition or the like, it is considered that the cell wall polysaccharide is decomposed and used as an energy source.

  In order to confirm what kind of sugars Gal-1, Xyl-1 and Glc-1 are under control of glucose deficiency-inducible expression, the above Arabidopsis cultured cells were treated with 3% sucrose and 1 mg / L 2. , 4-dichlorophenoxyacetic acid, 1 × B5 vitamin (0.4 mg / L myo-inositol, 0.004 mg / L nicotinamide, 0.004 mg / L pyridoxine HCl, 0.04 mg / L thiamine HCl) 1 × MS medium Then sucrose, glucose, galactose, fructose, xylose, mannose, mannitol, or the glucose analog 2-deoxy-glucose (2-d-gluc) or 3% sucrose, respectively. 3-O-methylglucose (3-oM-gl The c) in the same medium containing 3% were incubated for 24 hours at 21 ° C. in the dark. After culturing for 24 hours, cultured cells were collected, mRNA was isolated, and examined by RNA gel blot analysis. The results are shown in FIG. As a result, mRNA expression of Gal-1, Xyl-1 and Glc-1 is suppressed by metabolizable sugars such as sucrose, glucose, galactose, fructose and xylose, while 2-deoxy-glucose, mannose, 3-O- It was found that the expression of Gal-1, Xyl-1 and Glc-1 mRNAs was not suppressed by sugars that were not metabolized by plants (methylglucose and mannitol) (that did not enter the glycolytic system). From this, it was found that mRNA expression of Gal-1, Xyl-1 and Glc-1 was controlled by the presence or absence of metabolizable sugars (FIG. 15). As a result, expression control by sugar is expected to be controlled by substances after glycolysis.

(Example 4: Expression of heterologous gene sequence by β-galactosidase promoter or β-xylosidase promoter in tobacco BY-2 cells)
Controlling the expression level and expression timing of the target protein gene is an important factor when aiming at efficient protein production. In addition, the proliferation of cultured cells is also important for high protein production. For example, tobacco BY-2 cells (Kato, A. et al., “Fermentation Technology Today”, 1972, pp. 689-695 can be prepared; Moriichiro Serizawa, Graduate School of Frontier Sciences, University of Tokyo; Is a very fast growing cell line that grows about 100 times in a week. It is considered that useful protein production using a sugar deficiency-inducible promoter can be performed more efficiently if such rapidly cultured cells are used. Therefore, it was investigated whether the promoter of a sugar deficiency-inducing gene isolated from Arabidopsis thaliana can be expressed in a sugar deficiency-inducing manner in tobacco, which is a heterologous plant.

(4.1 Preparation of a structure in which a heterologous gene sequence is linked to the promoter of β-galactosidase gene)
A 1418-bp promoter (Gal-P) derived from the β-galactosidase (Gal-1) gene (MIP ID #: At5g56870) as a promoter and a signal peptide and a region containing a 27 amino acid sequence signal peptide (SP) coding sequence (Gal- P-SP) and a GFP coding sequence as a heterologous gene sequence. As the promoter region of Gal-1, a DNA sequence 1418 bp upstream from the start codon of Gal-1 was used. Of course, as is known to those skilled in the art, such a long region is not essential as a promoter sequence, and similar results can be obtained using shorter sequences.

Specifically, Arabidopsis thaliana (ecotype: Colombia) genomic DNA was prepared by the cetyltrimethylammonium bromide precipitation method (Murray and Thompson, Nucleic Acids Res 8, 1980, pp. 4321-4325). Takara Bio's pyrobest using Primer 1 (Gal-P-Hind) (AAGCTTATATGGACTAGTAGGACGTAAGC; SEQ ID NO: 7) and Primer 2 (Gal-SP-Bam) (GGATCCATAAGAGACTGATGGCTTTTACTATACAAC; SEQ ID NO: 8) using the prepared genomic DNA as a template By performing PCR using polymerase, the promoter sequence of β-galactosidase and the signal peptide coding sequence (Gal-P-SP) following it were amplified. Primer 1 has a sequence consisting of a HindIII sequence and a sequence upstream of the gal promoter. Primer 2 has a sequence consisting of a sequence from the predicted cleavage site of the gal signal peptide to 5 amino acids downstream and the sequence of the BamHI site. The PCR reaction conditions at this time were as follows according to the attached instruction manual:
PCR reaction conditions of 30 cycles at 94 ° C. for 30 seconds, 55 ° C. for 30 seconds and 72 ° C. for 1 minute, followed by 30 cycles followed by 72 ° C. for 5 minutes

  After confirming amplification of the PCR product by electrophoresis, the amplified DNA fragment 1 was ligated to a pGEM-T (registered trademark) Easy vector (obtained from Promega). cloned into E. coli. The cloned base sequence was determined, and it was confirmed that the target DNA fragment was cloned. This E.I. After large-scale culture of E. coli, the E. coli The vector is extracted from E. coli, and the extracted vector is cleaved with restriction enzymes HindIII and BamHI, electrophoresed, recovered from the gel and purified to obtain the promoter sequence of the gene encoding β-galactosidase and the signal following it. DNA fragment 1 containing the peptide coding sequence (Gal-P-SP; also referred to as Gal-P-Gal-SP) was obtained (see FIG. 17a).

  On the other hand, pBI121 (obtained from Clontech) was cleaved with restriction enzymes EcoRI and HindIII to obtain vector fragment 2 having no CaMV 35S promoter, GUS gene and Nos terminator. In addition, CaMV35S-sGFP (S65T) -NOS3 ′ (Fukuda Hiroho, Nishimura Mikio, Nakamura Kenzo supervision, “Experimental protocol for observing plant cells, from gene expression to intracellular structure / function”, Shujunsha, 1997, pp. 196-228. 196-199 (provided by Yasuo Niwa) was cleaved with restriction enzymes EcoRI and HindIII, electrophoresed, recovered from the gel and purified to obtain the CaMV35S promoter, sGFP gene and NOS terminator. Fragment 2 containing was obtained. Vector fragment 2 and fragment 2 were ligated to obtain vector 4 containing a CaMV35S promoter, sGFP gene and NOS terminator downstream of the kanamycin resistance gene. This vector is designated as E. coli. cloned into E. coli and this E. coli. After large-scale culture of E. coli, the E. coli Vector 4 was extracted from E. coli, and the extracted vector 4 was cleaved with HindIII and BamHI to obtain a vector fragment 5 containing a promoter insertion site, sGFP gene and NOS terminator downstream of the kanamycin resistance gene (FIG. 17b). checking).

  Next, the DNA fragment 1 prepared above and the vector fragment 5 are ligated, and a sequence encoding the first 5 amino acids of the Gal promoter, Gal signal peptide coding sequence, and Gal mature polypeptide sequence downstream of the kanamycin resistance gene. Then, plasmid 6 (construct for introduction into plant; pBI-Gal-P-SP-GFP) in which the GFP gene sequence and the Nos terminator sequence were linked was obtained.

(4.2 Establishment of transformed BY2 cells)
This plant introduction construct (pBI-Gal-P-SP-GFP) was supervised by Hiroho Fukuda, Mikio Nishimura, Kenzo Nakamura, "Experimental protocol for watching plant cells, from gene expression to intracellular structure / function", Hidejun 1997, pp. Introduced into Agrobacterium tumefaciens (EHA105 strain) according to the Agrobacterium method described in 125-129, and infected with Agrobacterium tumefaciens into which pBI-Gal-P-SP-GFP was introduced into the tobacco cultured cell BY-2 strain. BY-2 cells were prepared from BY-2 solid medium containing 200 μg / mL kanamycin and 500 μg / mL carbenicillin (supervised by Hiroho Fukuda, Mikio Nishimura, Kenzo Nakamura, “Experimental protocol for plant cells. “To function”, described in Shujunsha, 1997, pp. 187-191), transformed BY-2 cells were obtained. The obtained transformed BY-2 cells were prepared in a liquid BY-2 medium containing 3% sucrose in the presence of kanamycin (50 mg / L) (supervised by Hiroho Fukuda, Mikio Nishimura, Kenzo Nakamura) From expression to intracellular structure / function ", described in Shujunsha, 1997, pp. 187-191), liquid culture was performed while shaking at 27 ° C. Every week, 0.5 ml of cells was subcultured in 50 ml of fresh medium to maintain the cell line. The sucrose concentration in the medium used for subculture was 3%, and sugar was sufficiently present.

(4.3 Confirmation of secretion induction and secretion of GFP)
The transformed BY-2 cells were removed on day 4 of passage by removing the media through a nylon mesh. The removed transformed BY-2 cells were transferred to a liquid BY-2 medium having the same composition except that sucrose was not included, and cultured at 27 ° C. with shaking. Proteins were extracted from the media on the 3rd and 4th days after transplantation to a medium containing no sucrose, and the proteins were fractionated by SDS-PAGE. Later, using an anti-GFP antibody (Roche Diagnostics), an antibody specific to GFP, supervised by Kenzo Nakamura et al., Shujunsha, Cell Engineering Separate Volume, "Protein Protein Experiment Protocol Approaching Genes and Tissues" Protein Blotting and Structure ”Western blotting was performed according to the method described on pages 164-172. The results are shown in FIG. In this example, the growth of transformed BY-2 cells was measured by optical density (OD ₆₀₀ ) at ₆₀₀ nm. In the graph of FIG. 18, OD ₆₀₀ is shown on the vertical axis, and the number of days of culture with the passage time in the sucrose-containing medium as day 0 is shown on the horizontal axis. When continuing to culture in sucrose-containing medium, the cells continued to grow until day 7. When passaged to medium without sucrose on day 4 of culture, cells hardly proliferated but secreted GFP protein. The inset in the graph of FIG. 18 shows the detection of GFP protein by Western blotting. The GFP protein detected from the medium on the third day after transplantation to a medium not containing sucrose is indicated by an arrow on the left side. The GFP protein detected from the medium on the fourth day after transplantation to a medium containing no sucrose is indicated by an arrow on the right side. As a result, it was confirmed that GFP protein was secreted into the medium due to sugar deficiency, and the secreted GFP was accumulated in the medium.

  Therefore, it can be seen that, even in tobacco cells that are different from Arabidopsis thaliana, Gal-1 is induced in a glucose deficiency and GFP is secreted into the culture medium. From this, it can be seen that by using a sugar deficiency inducible promoter and a signal peptide sequence, a heterologous gene sequence can be efficiently expressed and secreted.

(Example 5 Expression of heterologous gene sequence by promoter of β-xylosidase gene)
A secretory β-xylosidase gene promoter was isolated and a vector linked to β-glucuronidase (GUS) as a reporter gene was prepared. This vector was introduced into the Arabidopsis cultured cells prepared above and the tobacco BY-2 cultured cells distributed by Professor Kazuyuki Hiratsuka, Yokohama National University, by the Agrobacterium-mediated transformation method in the same manner as in 3.1 above.

  As a result, GUS protein was remarkably induced by sugar deficiency like the original β-xylosidase. That is, by using the β-xylosidase promoter, it was possible to induce the expression of the target protein in plant cultured cells by sugar deficiency.

  By using this expression system, efficient production of useful proteins in plant cells becomes possible.

(Example 6: Experiment to secrete GFP outside of Arabidopsis cells (medium) by control of Arabidopsis β-galactosidase promoter (Gal-P) and signal peptide (SP))
The construct prepared in Example 4 (construct for plant introduction; pBI-Gal-P-SP-GFP) was prepared in accordance with Shujunsha, Cell Engineering Supplement, “Experiment Protocol for Model Plants”, pages 109 to 113). It was introduced into a plant body to obtain transformed Arabidopsis seeds. The seeds were germinated, grown, and leaves were cut from fully grown transformed plants, floated in water (sugar-deficient conditions) or 1% sucrose aqueous solution (sugar-existing conditions), and placed in the dark overnight. The leaves were ground and protein was extracted, and Western blotting was performed in the same manner as in Example 4. As a result, GFP gene expression and GFP protein accumulation were confirmed only for leaves floating in water. From this, it was confirmed that the expression of the GFP gene and the accumulation of the GFP protein occur specifically in sugar deficiency in the leaves of this transformed Arabidopsis plant.

(Example 7: Experiment to secrete mouse antibody outside of Arabidopsis cells (medium) by control of Arabidopsis β-galactosidase promoter (Gal-P) and signal peptide (SP))
A mouse antibody expression construct is prepared in the same manner as in Example 4 except that the mouse antibody gene is used instead of the GFP gene. This expression construct is introduced into Arabidopsis cultured cells in the same manner as in Example 6 to obtain transformed Arabidopsis cells. By confirming by Western blotting in the same manner as in Example 4, it is confirmed that in this transformed Arabidopsis cell, the expression of the mouse antibody gene and the accumulation of the protein occur specifically in glucose deficiency. It is also possible to confirm that the expressed mouse antibody functions as an antibody by purifying the mouse antibody expressed in the medium and conducting an antibody specificity test.

(Example 8: Experiment to secrete interferon outside of Arabidopsis cells (medium) by controlling Arabidopsis β-galactosidase promoter (Gal-P) and signal peptide (SP))
An expression construct for interferon α is prepared in the same manner as in Example 4 except that the interferon α gene is used instead of the GFP gene. This expression construct is introduced into cultured Arabidopsis thaliana cells in the same manner as in Example 6 to obtain transformed Arabidopsis cells. By confirming by Western blotting in the same manner as in Example 4, it is confirmed that the expression of interferon α gene and the accumulation of protein occur specifically in glucose deficiency in the transformed Arabidopsis cells. Further, by purifying interferon α expressed in the medium and administering it to mice, it can be confirmed that the protein expressed in the plant (interferon α) has the desired function.

  As mentioned above, although this invention has been illustrated using preferable embodiment of this invention, this invention should not be limited and limited to this embodiment. It is understood that the scope of the present invention should be construed only by the claims. It is understood that those skilled in the art can implement an equivalent range based on the description of the present invention and the common general technical knowledge from the description of specific preferred embodiments of the present invention. Patents, patent applications, and documents cited herein should be incorporated by reference in their entirety, as if the contents themselves were specifically described herein. Understood.

  The present invention provides an expression system that can easily control expression by controlling sugar deficiency.

  By using the present invention, activation of industries related to the production of pharmaceuticals such as interferons, antibodies, vaccines and the like that have not been developed due to low productivity due to plant cells can be expected.

(Explanation of sequence listing)
SEQ ID NO: 1: nucleotide sequence encoding Arabidopsis thaliana β-galactosidase (including promoter region and signal coding region);
SEQ ID NO: 2: amino acid sequence of Arabidopsis β-galactosidase;
SEQ ID NO: 3: nucleotide sequence encoding Arabidopsis β-xylosidase (including promoter region and signal coding region);
SEQ ID NO: 4: amino acid sequence of Arabidopsis β-xylosidase;
SEQ ID NO: 5: nucleotide sequence encoding Arabidopsis β-glucosidase (including promoter region and signal coding region);
SEQ ID NO: 6: amino acid sequence of Arabidopsis β-glucosidase;
SEQ ID NO: 7: nucleotide sequence of primer 1;
SEQ ID NO: 8: nucleotide sequence of primer 2.

Claims (67)

A nucleic acid molecule comprising a sugar deficiency inducible promoter sequence and a heterologous gene sequence operably linked to the sugar deficiency inducible promoter sequence. The sugar deficiency inducible promoter sequence is selected from the group consisting of a promoter sequence of a gene encoding β-galactosidase, a promoter sequence of a gene encoding β-xylosidase, and a promoter sequence of a gene encoding β-glucosidase. Item 2. The nucleic acid molecule according to Item 1. The sugar deficiency inducible promoter sequence is
(A) a nucleotide sequence represented by positions 643 to 1799 of SEQ ID NO: 1, positions 1 to 1763 of SEQ ID NO: 3, or positions 1 to 2058 of SEQ ID NO: 5;
(B) a nucleotide sequence comprising one or several nucleotide substitutions, deletions or additions compared to the nucleotide sequence of (a), having a sugar deficiency-inducing promoter activity;
(C) a nucleotide sequence that hybridizes with the nucleotide sequence of (a) or (b) under stringent conditions and has sugar deficiency-inducible promoter activity;
(D) a nucleotide sequence having at least 70% identity to the nucleotide sequence of (a) and having a sugar deficiency-inducing promoter activity; and (e) (a) to (d) A shortened sequence of any nucleotide sequence, selected from the group consisting of nucleotide sequences having sugar deficiency inducible promoter activity;
The nucleic acid molecule according to claim 1, which has an activity of promoting sugar deficiency-induced expression of the heterologous gene when the heterologous gene sequence is operably linked to the nucleotide sequence. The nucleic acid molecule of claim 1 further comprising a signal peptide coding sequence. The signal peptide coding sequence is selected from the group consisting of a signal peptide coding sequence of a gene encoding β-galactosidase, a signal peptide coding sequence of a gene encoding β-xylosidase, and a signal peptide coding sequence of a gene encoding β-glucosidase The nucleic acid molecule according to claim 4, wherein The signal peptide coding sequence is
(I) a nucleotide sequence encoding the amino acid sequence represented by positions 1 to 27 of SEQ ID NO: 2, positions 1 to 28 of SEQ ID NO: 4, or positions 1 to 28 of SEQ ID NO: 6;
(Ii) a nucleotide sequence comprising a substitution, deletion or addition of one or several nucleotides compared to the nucleotide sequence of (i), encoding a peptide having extracellular secretion activity;
(Iii) a nucleotide sequence that hybridizes with the nucleotide sequence of (i) or (ii) under stringent conditions and encodes a peptide having extracellular secretion activity; and (iv) against the nucleotide sequence of (i) A nucleotide sequence encoding a peptide having at least 70% identity and having extracellular secretion activity;
Selected from the group consisting of
5. The nucleic acid molecule of claim 4, wherein said heterologous gene sequence operably linked to said nucleotide sequence results in extracellular secretion of the product of said heterologous gene. 2. The nucleic acid molecule of claim 1, wherein the heterologous gene sequence is a cytokine or hormone gene sequence. The nucleic acid molecule according to claim 1, wherein the heterologous gene sequence encodes a protein having a target function when expressed in a plant. The nucleic acid molecule according to claim 1, wherein the heterologous gene sequence is a gene sequence of interferon, antibody, human α-antitrypsin or green fluorescent protein. 2. The nucleic acid molecule according to claim 1, wherein the heterologous gene sequence is a marker gene sequence. 2. The nucleic acid molecule of claim 1 further comprising a regulatory element. 12. The nucleic acid molecule of claim 11, wherein the regulatory element comprises at least one element selected from the group consisting of introns, terminators, and enhancers. A nucleic acid molecule comprising a promoter sequence of a gene encoding an exo-type glycolytic enzyme and a heterologous gene sequence operably linked to the promoter sequence. The promoter sequence is selected from the group consisting of a promoter sequence of a gene encoding β-galactosidase, a promoter sequence of a gene encoding β-xylosidase, and a promoter sequence of a gene encoding β-glucosidase. Nucleic acid molecules. The promoter sequence is
(A) a nucleotide sequence represented by positions 643 to 1799 of SEQ ID NO: 1, positions 1 to 1763 of SEQ ID NO: 3, or positions 1 to 2058 of SEQ ID NO: 5;
(B) a nucleotide sequence comprising one or several nucleotide substitutions, deletions or additions compared to the nucleotide sequence of (a), having a sugar deficiency-inducing promoter activity;
(C) a nucleotide sequence that hybridizes with the nucleotide sequence of (a) or (b) under stringent conditions and has sugar deficiency-inducible promoter activity;
(D) a nucleotide sequence having at least 70% identity to the nucleotide sequence of (a) and having a sugar deficiency-inducing promoter activity; and (e) (a) to (d) A shortened sequence of any nucleotide sequence, selected from the group consisting of nucleotide sequences having sugar deficiency inducible promoter activity;
14. The nucleic acid molecule according to claim 13, which has an activity of promoting sugar deficiency-induced expression of the heterologous gene when the heterologous gene sequence is operably linked to the nucleotide sequence. 14. The nucleic acid molecule of claim 13, further comprising a signal peptide coding sequence. The signal peptide coding sequence is selected from the group consisting of a signal peptide coding sequence of a gene encoding β-galactosidase, a signal peptide coding sequence of a gene encoding β-xylosidase, and a signal peptide coding sequence of a gene encoding β-glucosidase 17. The nucleic acid molecule of claim 16, wherein The signal peptide coding sequence is
(I) a nucleotide sequence encoding the amino acid sequence represented by positions 1 to 27 of SEQ ID NO: 2, positions 1 to 28 of SEQ ID NO: 4, or positions 1 to 28 of SEQ ID NO: 6;
(Ii) a nucleotide sequence comprising a substitution, deletion or addition of one or several nucleotides compared to the nucleotide sequence of (i), encoding a peptide having extracellular secretion activity;
(Iii) a nucleotide sequence that hybridizes with the nucleotide sequence of (i) or (ii) under stringent conditions and encodes a peptide having extracellular secretion activity; and (iv) against the nucleotide sequence of (i) A nucleotide sequence encoding a peptide having at least 70% identity and having extracellular secretion activity;
Selected from the group consisting of
17. A nucleic acid molecule according to claim 16, wherein said heterologous gene sequence operably linked to said nucleotide sequence results in extracellular secretion of the product of said heterologous gene. 14. The nucleic acid molecule of claim 13, wherein the heterologous gene sequence is a cytokine or hormone gene sequence. The nucleic acid molecule according to claim 13, wherein the heterologous gene sequence encodes a protein having a target function when expressed in a plant. The nucleic acid molecule according to claim 13, wherein the heterologous gene sequence is a gene sequence of interferon, antibody, human α-antitrypsin or green fluorescent protein. 14. The nucleic acid molecule according to claim 13, wherein the heterologous gene sequence is a marker gene sequence. 14. The nucleic acid molecule of claim 13, further comprising a regulatory element. 24. The nucleic acid molecule of claim 23, wherein the regulatory element comprises at least one element selected from the group consisting of introns, terminators, and enhancers. A nucleic acid molecule comprising a promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar, and a heterologous gene sequence operably linked to the promoter sequence. The promoter sequence of a gene encoding an enzyme capable of degrading metabolizable sugars is a promoter sequence of a gene encoding β-galactosidase, a promoter sequence of a gene encoding β-xylosidase, and a promoter of a gene encoding β-glucosidase 26. The nucleic acid molecule of claim 25, selected from the group consisting of sequences. A promoter sequence of a gene encoding an enzyme capable of degrading the metabolizable sugar,
(A) a nucleotide sequence represented by positions 643 to 1799 of SEQ ID NO: 1, positions 1 to 1763 of SEQ ID NO: 3, or positions 1 to 2058 of SEQ ID NO: 5;
(B) a nucleotide sequence comprising one or several nucleotide substitutions, deletions or additions compared to the nucleotide sequence of (a), having a sugar deficiency-inducing promoter activity;
(C) a nucleotide sequence that hybridizes with the nucleotide sequence of (a) or (b) under stringent conditions and has sugar deficiency-inducible promoter activity;
(D) a nucleotide sequence having at least 70% identity to the nucleotide sequence of (a) and having a sugar deficiency-inducing promoter activity; and (e) (a) to (d) A shortened sequence of any nucleotide sequence, selected from the group consisting of nucleotide sequences having sugar deficiency inducible promoter activity;
26. The nucleic acid molecule of claim 25, having an activity of promoting sugar deficiency-induced expression of the heterologous gene when the heterologous gene sequence is operably linked to the nucleotide sequence. 26. The nucleic acid molecule of claim 25, further comprising a signal peptide coding sequence. The signal peptide coding sequence is selected from the group consisting of a signal peptide coding sequence of a gene encoding β-galactosidase, a signal peptide coding sequence of a gene encoding β-xylosidase, and a signal peptide coding sequence of a gene encoding β-glucosidase 30. The nucleic acid molecule of claim 28, wherein The signal peptide coding sequence is
(I) a nucleotide sequence encoding the amino acid sequence represented by positions 1 to 27 of SEQ ID NO: 2, positions 1 to 28 of SEQ ID NO: 4, or positions 1 to 28 of SEQ ID NO: 6;
(Ii) a nucleotide sequence comprising a substitution, deletion or addition of one or several nucleotides compared to the nucleotide sequence of (i), encoding a peptide having extracellular secretion activity;
(Iii) a nucleotide sequence that hybridizes with the nucleotide sequence of (i) or (ii) under stringent conditions and encodes a peptide having extracellular secretion activity; and (iv) against the nucleotide sequence of (i) A nucleotide sequence encoding a peptide having at least 70% identity and having extracellular secretion activity;
Selected from the group consisting of
30. The nucleic acid molecule of claim 28, wherein operably linked to the nucleotide sequence results in extracellular secretion of the product of the heterologous gene. 26. The nucleic acid molecule of claim 25, wherein the heterologous gene sequence is a cytokine or hormone gene sequence. 26. The nucleic acid molecule of claim 25, wherein the heterologous gene sequence encodes a protein having a desired function when expressed in a plant. 26. The nucleic acid molecule of claim 25, wherein the heterologous gene sequence is a gene sequence of interferon, antibody, human α-antitrypsin or green fluorescent protein. 26. The nucleic acid molecule of claim 25, wherein the heterologous gene sequence is a marker gene sequence. 26. The nucleic acid molecule of claim 25 further comprising a regulatory element. 36. The nucleic acid molecule of claim 35, wherein the regulatory element comprises at least one element selected from the group consisting of an intron, a terminator, and an enhancer. A nucleic acid molecule comprising a promoter sequence and a heterologous gene sequence operably linked to the promoter sequence, the promoter sequence comprising:
(A) a nucleotide sequence represented by positions 643 to 1799 of SEQ ID NO: 1, positions 1 to 1763 of SEQ ID NO: 3, or positions 1 to 2058 of SEQ ID NO: 5;
(B) a nucleotide sequence comprising one or several nucleotide substitutions, deletions or additions compared to the nucleotide sequence of (a), having a sugar deficiency-inducing promoter activity;
(C) a nucleotide sequence that hybridizes with the nucleotide sequence of (a) or (b) under stringent conditions and has sugar deficiency-inducible promoter activity;
(D) a nucleotide sequence having at least 70% identity to the nucleotide sequence of (a) and having a sugar deficiency-inducing promoter activity; and (e) (a) to (d) A shortened sequence of any nucleotide sequence, selected from the group consisting of nucleotide sequences having sugar deficiency inducible promoter activity;
A nucleic acid molecule having an activity of promoting expression of a heterologous gene when the heterologous gene sequence is operably linked to the nucleotide sequence. 38. The nucleic acid molecule of claim 37, further comprising a signal peptide coding sequence. The signal peptide coding sequence is selected from the group consisting of a signal peptide coding sequence of a gene encoding β-galactosidase, a signal peptide coding sequence of a gene encoding β-xylosidase, and a signal peptide coding sequence of a gene encoding β-glucosidase 40. The nucleic acid molecule of claim 38, wherein The signal peptide coding sequence is
(I) a nucleotide sequence encoding the amino acid sequence represented by positions 1 to 27 of SEQ ID NO: 2, positions 1 to 28 of SEQ ID NO: 4, or positions 1 to 28 of SEQ ID NO: 6;
(Ii) a nucleotide sequence comprising a substitution, deletion or addition of one or several nucleotides compared to the nucleotide sequence of (i), encoding a peptide having extracellular secretion activity;
(Iii) a nucleotide sequence that hybridizes with the nucleotide sequence of (i) or (ii) under stringent conditions and encodes a peptide having extracellular secretion activity; and (iv) against the nucleotide sequence of (i) A nucleotide sequence encoding a peptide having at least 70% identity and having extracellular secretion activity;
Selected from the group consisting of
39. The nucleic acid molecule of claim 38, wherein the heterologous gene sequence is operably linked to the nucleotide sequence, resulting in extracellular secretion of the product of the heterologous gene. 38. The nucleic acid molecule of claim 37, wherein the heterologous gene sequence is a cytokine or hormone gene sequence. 38. The nucleic acid molecule of claim 37, wherein the heterologous gene sequence encodes a protein having a desired function when expressed in a plant. 38. The nucleic acid molecule of claim 37, wherein the heterologous gene sequence is a gene sequence of interferon, antibody, human α-antitrypsin or green fluorescent protein. 38. The nucleic acid molecule of claim 37, wherein the heterologous gene sequence is a marker gene sequence. 38. The nucleic acid molecule of claim 37, further comprising a regulatory element. 46. The nucleic acid molecule of claim 45, wherein the regulatory element comprises at least one element selected from the group consisting of introns, terminators, and enhancers. At least one promoter sequence selected from the group consisting of a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar;
A vector comprising a heterologous gene sequence operably linked to the selected promoter sequence. At least one promoter sequence selected from the group consisting of a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar;
A plant cell comprising a heterologous gene sequence operably linked to the selected promoter sequence. 49. The plant cell of claim 48, which is a dicotyledonous plant cell. 49. The plant cell according to claim 48, which is a cultured cell. The plant cell according to claim 50, which is a cell that can proliferate 50 times or more in one week. A method for producing a protein comprising the following steps:
At least one promoter sequence selected from the group consisting of a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar;
Introducing a nucleic acid molecule comprising said protein coding sequence operably linked to said selected promoter sequence into a cell to obtain a transformed cell;
Culturing the transformed cell in the absence of sugar to secrete the protein; and recovering the protein. 53. The method of claim 52, wherein the cell is a plant cell. 53. The method of claim 52, wherein the cell is a dicot plant cell. 53. The method of claim 52, wherein the cell is a cultured cell. 56. The method of claim 55, wherein the cell is a cell that can proliferate 50 times or more in one week. 53. The method of claim 52, wherein the nucleic acid molecule further comprises a signal peptide coding sequence. The signal peptide coding sequence is selected from the group consisting of a signal peptide coding sequence of a gene encoding β-galactosidase, a signal peptide coding sequence of a gene encoding β-xylosidase, and a signal peptide coding sequence of a gene encoding β-glucosidase 58. The method of claim 57, wherein: The signal peptide coding sequence is
(I) a nucleotide sequence encoding the amino acid sequence represented by positions 1 to 27 of SEQ ID NO: 2, positions 1 to 28 of SEQ ID NO: 4, or positions 1 to 28 of SEQ ID NO: 6;
(Ii) a nucleotide sequence comprising a substitution, deletion or addition of one or several nucleotides compared to the nucleotide sequence of (i), encoding a peptide having extracellular secretion activity;
(Iii) a nucleotide sequence that hybridizes with the nucleotide sequence of (i) or (ii) under stringent conditions and encodes a peptide having extracellular secretion activity; and (iv) against the nucleotide sequence of (i) A nucleotide sequence encoding a peptide having at least 70% identity and having extracellular secretion activity;
Selected from the group consisting of
58. The method of claim 57, wherein the heterologous gene sequence is operably linked to the nucleotide sequence, resulting in extracellular secretion of the product of the heterologous gene. 53. The method of claim 52, wherein the protein is a cytokine or a hormone. 53. The method according to claim 52, wherein the protein is a protein having a target function when expressed in a plant. 53. The method of claim 52, wherein the protein is an interferon, antibody, human α-antitrypsin or green fluorescent protein. 53. The method of claim 52, wherein the sugar is a metabolizable glycolytic sugar or a sugar that can become a glycolytic sugar when metabolized. 53. The method of claim 52, wherein the sugar is selected from the group consisting of glucose, galactose, fructose, sucrose and xylose. A method for producing a protein comprising the following steps:
At least one promoter sequence selected from the group consisting of a sugar deficiency inducible promoter sequence, a promoter sequence of a gene encoding an exo-type glycolytic enzyme, and a promoter sequence of a gene encoding an enzyme capable of degrading a metabolizable sugar;
Introducing a nucleic acid molecule comprising said protein coding sequence operably linked to said selected promoter sequence into a cell to obtain a transformed cell;
Culturing the transformed cell in the presence of sugar;
Culturing the transformed cell in the absence of sugar to secrete the protein; and recovering the protein. 53. A protein obtained by the method of claim 52. Use of the nucleic acid molecule according to claim 1 for sugar deficiency inducible expression of heterologous genes.

Images