WO1994000136A1 - COMBINAISON D'ANTICORPS MONOCLONAUX ANTI-erbB-2 ET PROCEDE POUR SON UTILISATION - Google Patents

COMBINAISON D'ANTICORPS MONOCLONAUX ANTI-erbB-2 ET PROCEDE POUR SON UTILISATION Download PDF

Info

Publication number
WO1994000136A1
WO1994000136A1 PCT/US1992/008545 US9208545W WO9400136A1 WO 1994000136 A1 WO1994000136 A1 WO 1994000136A1 US 9208545 W US9208545 W US 9208545W WO 9400136 A1 WO9400136 A1 WO 9400136A1
Authority
WO
WIPO (PCT)
Prior art keywords
combination
erbb
antibodies
antibody
gpl85
Prior art date
Application number
PCT/US1992/008545
Other languages
English (en)
Inventor
Philip G. Kasprzyk
Charles R. King
Original Assignee
Oncologix, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oncologix, Inc. filed Critical Oncologix, Inc.
Priority to AU37733/93A priority Critical patent/AU687346B2/en
Priority to KR1019940701148A priority patent/KR100269879B1/ko
Priority to EP93906955A priority patent/EP0655924A4/fr
Priority to JP6502307A priority patent/JPH08504172A/ja
Publication of WO1994000136A1 publication Critical patent/WO1994000136A1/fr
Priority to FI941572A priority patent/FI941572A/fi

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/32—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/22—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A61K2039/507—Comprising a combination of two or more separate antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to a combination o monoclonal antibodies capable of preventing and treatin tumors. More specifically, the monoclonal antibodies ar single chain monoclonal antibodies which are capable o treating and preventing tumors.
  • erbB-2 gen also called HER-2 or neu
  • One object of Applicant's invention relates to combination of at least two monoclonal antibodies capable treating or preventing human malignancies wherein t malignant cells overexpress gpl85 ⁇ .
  • the combinati comprises at least a first and second antibody each of whi recognizes the gpl85 extracellular domain of erbB-2.
  • T activity demonstrated by the combination antibody treatme has shown greater activity than expected by the sum of t individual antibodies at the same overall antibo concentration.
  • Another object of the present invention provides f the use of monoclonal antibodies which are single cha monoclonal antibodies.
  • the single chain antibodies can used to form a bispecific antibody.
  • FIG. 1A Specificity of monoclonal antibodies # and #23.
  • Subconfluent SK-Br-3 monolayers were metabolical labeled with 35S-Cys (spec. act. 1000 Ci/m ol).
  • Total cel proteins were immunoprecipitated with 10 ⁇ g of the indicat antibodies.
  • the immune complexes were recovered by Protei G Agarose (Genex, Gaithersburg, MD) and analyzed by SDS-PA on an 8- 16% Tri s-Glycine gel . The gel was exposed to fi l at -70°C overnight with an intensifying screen .
  • Figure IB gpl85 overexpression in the gastri cell line N87 and a tumor from N87 mouse xenografts compare to high and low gpl85erbB—2 overexpressers. Cells or tumo were lysed in sample buffer which contained 0.125
  • Detection of gpl85 was performed with a monoclona antibody to the c-terminal portion of the protein.
  • FIG. lC Southern blot analysis of the erbB-2 gen in N87 (gastric), SK-Br-3 (breast), and SK-OV-3 (ovarian cell lines and human placenta.
  • DNA was extracted from cel lines and human placenta tissue using guanidine thiocyanat and cesium gradient centrifugation.
  • DNA (15 ⁇ g) was cleave with restriction enzyme HinDIII, separated b electrophoresis on a 1% agarose gel, transferred t nitrocellulose, and probed with radioactive erbB-2 cDN probe as previously described (26).
  • the cDNA prob corresponds to the entire erbB-2 protein coding region.
  • Figure 2 Effects of Ab#21 and Ab#23 on the growth o human N87 gastric tumor cells in a monolayer MTT growt assay.
  • PBS, Ab#21, Ab#23 or combination of Ab#21 and Ab#23 at the indicate concentration were then added.
  • the plates were grown a 37°C in a 5% CO. humidified atmosphere.
  • FIG. 3A Effects of treatment with Ab#21 ( ) Ab#23( ), a combination of Ab#21 and Ab#23 ( ) , or PB ( ) on the growth of N87 tumor xenografts in BNX mice
  • Tumor cells (5 X 10 /mouse) were subcutaneously injecte into the flanks of BNX (beige, nude, xid) mice.
  • Treatmen begun on day 1 consisted of four trial groups (3 mice pe group) each given 0.2 ml intraperitoneal injections twice week of either PBS ( ) , 200 ⁇ g purified Ab#21 (0), 200 ⁇ purified Ab#23 ( ) , or a mixture of 100 ⁇ g purified Ab#2 and 100 ⁇ g of purified Ab#23 ( ) for three weeks. Tumo growth is reported as an average relative tumor volume ⁇ .e.m. ⁇ 15%. Two repeats of the experiment gave the sam results.
  • Figure 3B Effect of treatment after the formation o small tumors.
  • Cells were injected using the same treatmen protocol as above except for the fact the treatment wa begun 4 days after cell injection instead of 1 day after Animal care was in accordance with institutional guidelines
  • Figure A Effect of antibody binding on erbB- protein turnover.
  • Subconfluent N87 cell monolayers were pulse-labeled 1 h with 20 ⁇ Ci 35S-Cysteine and then chase with 5 mM Cys in the presence of Ab#21 alone, Ab#23 alone or a 1:1 combination of Ab#21 and Ab#23 (10 ⁇ g/ml)for 24 h
  • Total cellular protein was immunoprecipitated as describe in Figure 1 using a monoclonal antibody directed against th c-terminus of gpl85 coupled to Sepharose and analyzed by SDS-PAGE. The gel was exposed to film at -70°C overnight with an intensifying screen.
  • Figure 4B Measurement of tyrosine phosphorylation of gp!85 ⁇ after incubation with antibody combination.
  • Cells were plated as in Figure 4A. After 1 h cells were processed as in Figure IB.
  • the proteins were electroblotted onto nitrocellulose paper and incubated with anti-phosphotyrosine IgG (polyclonal, Upstate Biotechnology, Inc.) and immunodetected using an ECL western blotting detection system (Amersham) . The film was exposed for 5 min at room temperature.
  • FIG. 5 Effects of Ab#21 and Ab#23 on the growth of human Calu-3 lung adenocarcinoma tumor cells in a monolayer MTT growth assay.
  • a single cell suspension of 10,000 cells/well was plated in a chemically defined medium consisting of RPMI-1640 supplemented with Insulin (5 ⁇ g/ml), human transferrin (10 ⁇ g/ml) , 17- ⁇ -estradiol (10 nM), sodium selenite (5 nM), and 10 mM Hepe ⁇ .
  • PBS, Ab#21, Ab#23 or a combination of Ab#21 and Ab#23 at the indicated concentration were then added.
  • the plates were grown at 37°C in a 5% CO- humidified atmosphere.
  • FIG. 6 Effects of Ab#23 and Ab#94 on the growth of human Calu-3 lung adenocarcinoma tumor cells in a monolayer MTT growth assay.
  • a single cell suspension of 10,000 cells/well was plated in a chemically defined medi consisting of RPMI-1640 supplemented with Insulin (5 ⁇ g/ml human transferrin (10 ⁇ g/ml), 17- ⁇ -estradiol (10 nM), sodi selenite (5 nM), and 10 mM Hepes.
  • PBS, Ab#23, Ab#94 or combination of Ab#21 and Ab#23 at the indicat concentration were then added.
  • the plates were grown 37°C in a 5% C0 2 humidified atmosphere.
  • Figure 7 The cDNA sequence for the *single cha anti-erbB2 antibody, Ab#23.
  • Figure 8 The cDNA sequence for the *single cha anti-erbB2 antibody, Ab#21 (e22).
  • One object of the present invention is a combination at least two monoclonal antibodies, which is capable preventing and treating human malignancies, wherein t malignant cells overexpress gpl85 ⁇ and wherein said least two different antibodies each recognize a differe epitope of the gpl85 expression product of erbB-2, therefo the antibodies do not cross react with each other.
  • embodiment of the present invention provides for t combination to comprise first and second antibodies whi are preferably combined such that the resulting ratio of t first to second is effective for decreasing the expressi product of the erbB-2 gene.
  • a convenient method f measuring the expression product of erbB-2 gene may be found in Figure 4A.
  • the decrease in the expression of the erbB-2 gene product is the result of the combination decreasing the half life of erbB-2 protein in the cell.
  • the combination of the antibodies has the characteristic trait of essentially not increasing the tyrosine phosphorylation of gpl85 expression product.
  • An example of a first to second antibodies ratio having the activity necessary to decrease the expression product of the erbB-2 gene comprises a ratio of from about 1:2 to about 2:1. Preferably, such a ratio is 1:1.
  • the present invention is not intended to be limited to the antibody ratios discussed herein. The fact that other ratios are effective and may yield higher activity than the 1:1 ratio used as an example is recognized and acknowledged by the inventors as being within the scope of this invention.
  • Figures 1A-C, 2 and 3A, B The activity of this combination is exemplified in Figures 1A-C, 2 and 3A, B as follows.
  • Figure 1A-C demonstrate that the N87 cells overexpress the gpl85 erbB-2 protein as a result of erbB-2 gene amplification.
  • Figure 2 shows that a combination of Ab#21 and Ab#23 inhibits the growth of N87 cells dji vitro. Similar results have been demonstrated using the combination of Ab#23 and Ab#94 as well as Ab#23 and Ab#21, on the growth of human Calu-3 lung adenocarcinoma (See Figures 5 and 6).
  • Figure 3A and B show the activity of combinations of Ab#21 and Ab#23 inhibiting and reversing the growth of N87 cells growing as tumors in immunodeficient mice. These results indicate the general nature of the application of combinations of antibodies.
  • the antibodies against the erbB2 gene encoded product used in this invention can be designed as chimeric antibodies.
  • Chimeric antibodies have variable region (antigen binding regions) of nonhuman (e.g., murine) origi and constant regions of human origin. Because they ar predominantly human, chimeric antibodies are les immunogenic in humans, which can help overcome problem associated with administering foreign proteins to humans.
  • the antibodies of the present inventio may be produced through genetic recombination or th Kohler-Milstein hybridoma method for production o antibodies. It is also recognized that fragments, analogue or derivatives of the antibodies themselves can be utilize in this invention in place of the entire antibody.
  • Another object of the present invention provides fo antibodies against erbB-2 gene encoded product which ar designed as single chain antibodies.
  • a single chai antibody is one in which the light and heavy variabl regions of the antibody are linked together to form a singl chain antibody. It is contemplated in this application tha a combination of these antibodies include antibodies whic are combined as an admixture as discussed above an antibodies which are combined to form a bispecific antibody
  • a bispecific antibody is an artificially produce antibody usually comprised of two single chain antibodie each of which is recognizes a different antigen bindin site.
  • huma malignancies which may be treated or prevented using th present invention
  • adenocarcinonas of the breast, ovary lung and stomach are examples of some of the huma malignancies which may be treated or prevented using th present invention.
  • Another embodiment of applicants' invention provides method for preventing and eradicating the human malignancie described above.
  • the method involves administering to patient an effective dose of a combination of anti-erbB- antibodies to achieve an effective concentration of the antibody combination at the tumor site; for example, a concentration of at least l ⁇ g/ml.
  • concentration at the tumor site does not exceed about lO ⁇ g/ml.
  • the combination is administered in a dose from about .1 mg/kg to about 10 mg/kg of body weight.
  • Another embodiment of Applicants' invention provides for the antibody combination to be used in passive tumor therapy, wherein an effective dose of the antibody combination is administered in or with a pharmaceutically acceptable vehicle to a patient afflicted with a human malignancy overexpressing gpl85erbB-2.
  • a pharmaceutically acceptable vehicle examples include non-toxic buffers, physiological saline, etc.
  • Applicants' invention also provides for at least one of the antibodies of the antibody combination to be used as a component of an immunotoxin.
  • at least one antibody of the combination can be linked to an anti-cancer pharmaceutical or a cytotoxin to form an immunotoxin.
  • Various pharmaceutical or cytotoxic agents can be chemically or genetically coupled to the combination.
  • radioactive compounds e.g., isotopes of Boron and Rhenium
  • agents which bind DNA such as alkylating agents or various antibodies (e.g., daunomysin, adriamycin, chlorambucil)
  • anti-metabolites e.g., methotrexate
  • inhibitors of protein synthesis e.g., diphtheria toxin and toxic plant proteins.
  • Administration to a patient of an effective dose of the combination of antibodies described herein may be accomplished via chronic intraveneous administration for period of time sufficient to result in the regression o eradication of the human malignancy being treated
  • Administration of the combination may also be accomplishe in a patient by direct injection or delivery of th combination to the tumor site. Such administration would b of sufficient duration and concentration to result i eradication or reduction of the tumor.
  • tw antibody combination acts by constraining gpl85 er " int an activated conformation thus mimicking an agonist ligand If the two antibody combination mimics the ligand, the treatment using the combination should result in increase gpl85 ⁇ autophosphorylation.
  • Anti-phosphotyrosin immunoblots were used to test this hypothesis. As shown i Figure 4B, no increase in tyrosine phosphorylation o gpl85 er ⁇ from N87 cells was observed 1 or 2 hours afte the addition of the antibody combination or up to 24 h o treatment. This suggests that the antibody combination doe not increase the autophosphorylation of gpl85 an therefore does not act to inhibit the activity of th tyrosine kinase.
  • results demonstrate that a combination o anti-receptor antibodies leads to different and more poten anti-tumor activities than single antibodies.
  • results indicate that the combination antibod therapy is a useful approach to treatment of huma ___ *hR malignancies overexpressing gpl85 This approach may b particularly important in the treatment of gastric cancer, disease which responds poorly to current systemi chemotherapies.
  • a source of human erbB-2 protein we used a NIH/3T cell engineered to express the human erbB-2 protein on it surface (N/erbB-2).
  • Membrane preparations of these cell were prepared by hypotonic lysis in 2mM Hepes pH 7.4, removal of nuclei by centrifugation at 5,000 x g an isolation of membranes by centrifugation at 100,000 x g.
  • Mice were immunized with lOO ⁇ g of N/erbB-2 membran preparation in a 50:50 mix of adjuvant in 200 ⁇ l.
  • Adjuvan was Freund's complete for the first injection followed b Freund' ⁇ incomplete adjuvant. Mice were given intraperitoneal injections over 4 weeks.
  • ELISA reaction was develope using peroxidase coupled goat anti-mouse antibody an standard methods. Hybridoma cultures secreting a anti-erbB-2 antibody were subjected to two rounds of singl cell cloning and identification of positive subclones b ELISA as described above.
  • Monoclonal antibodies directed against th erbB-2 extracellular domain of gpl85 were tested for specifi reaction to N/erbB-2 cell membranes in an ELISA assay. Tw of these designated Ab#21 and Ab#23 after screening i growth assays exhibited the highest biological activity an were used in this study. Antibodies were isolated in larg amounts from ascites fluid and purified by HPLC with
  • N87 tumor xenografts The efficacy of combination antibody therapy was teste on the growth of N87 tumor xenografts.
  • One inoculation o five million N87 cells were injected subcutaneou ⁇ ly int nude mice produce rapidly growing tumors, with a shor latency. Tumor growth at the injection site was easil quantitated.
  • the N87 cells did no form tumors in the animals treated twice a week for thre weeks with a total of 200 ⁇ g of antibodies per injectio with the combination of Ab#21 and Ab#23. In sharp contras they were potently tumorigenic in animals treated with th
  • each monoclonal antibody alone may hav limited activity to partially restrict the rate of tumo growth.
  • the activity exhibited by the combinatio far exceeded the cumulative effect expected from th combination.
  • Th activation of the murine neu oncogene is accomplished b point mutation as evidenced by qualitative interference i the structure and function of the neu gene, whereas th human erbB-2 oncogene is activated by overexpres ⁇ ion o erbB-2, a quantitative interference of the apparently norma protein which results in tumor formation.
  • Antibodies #21; Ab#23; and Ab#94 have been deposited at the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md. 20852, USA. Ab#21 was deposited on and given ATCC # . Ab#23 was deposited on and given ATCC # . Ab#94 was deposited on and given ATCC # .
  • cDNA was prepared using random primer (N & ) (Boerhinger Mannheim).
  • the immunoglobulin light and heavy chain clones were isolated using PCR and the primers: light chain, 5' CAC GTC GAC ATT CAG CTG ACC CAC TCT CCA and GAT GGA TCC AGT TGG TGC AGC ATC3*; heavy chain 5'C GGA ATT TCA GGT TCT GCA GIA GTC WGG3' and 5' AGC GGA TCC AGG GGC CAG TGG ATA GAC3' [G,A,C, stand for standard nucleotides; I for inosine, W for A
  • the light and heavy chain coding regions were joined by synthetic linker GSTSGSGKSSEGKG specified by overlappin oligonucleotides as described.
  • the intact scFv codin region was inserted in frame with an E.coli OMPA leade sequence under direction of the lambda P_ promoter
  • cDNA wa prepared using random primer (N ⁇ ) (Boerhinger Mannheim) The immunoglobulin light and heavy chain clones were isolated using PCR and the primers: light chain, 5' CAC GT GAC ATT CAG CTG ACC CAC TCT CCA and GAT GGA TCC AGT TGG TG AGC ATC3'; heavy chain 5'C GGA ATT TCA GGT TCT GCA GIA GT WGG3' and 5' AGC GGA TCC AGG GGC CAG TGG ATA GAC3* [G,A,C, stand for standard nucleotides; I for inosine, W for A o T] .
  • the products of the PCR reaction wre cloned into PUC18 Linkage into a scFv was by PCR giving the individual ligh and heavy cDNA clones and 4 oligonucleotides 5' - cgagatgagtccagctgacccagtctc 5' - gaagatttaccagaaccagaggtagaaccttttatttccagcttgga 5' - ctggttctggtaaatcttctgaaggtaaggtgtgcagctgcaggag 5' - cgagtgcaagcttaggagacggtgaccgt.
  • the light and heavy chain coding regions were joined by synthetic linker GSTSGSGKSSEGKG specified by overlappi oligonucleotides as described.
  • the intact scFv codi region was inserted in frame with an E.coli OMPA lead sequence under direction of the lambda P. L_ promote

Abstract

La présente invention concerne une combinaison d'au moins deux anticorps monoclonaux agissant à titre préventif et curatif sur les tumeurs malignes chez l'homme, caractérisées par une expression excessive de gp185erbB-2. Les anticorps monoclonaux de la combinaison reconnaissent différents épitopes du produit d'expression gp185 de erbB-2. De ce fait il n'y a pas de réaction croisée des anticorps. De préférence, la combinaison diminue le produit d'expression du gène erbB-2. Dans une autre forme d'exécution, la combinaison n'augmente pas fondamentalement la phosphorylation de la tyrosine du produit d'expression gp185.
PCT/US1992/008545 1991-10-07 1992-10-21 COMBINAISON D'ANTICORPS MONOCLONAUX ANTI-erbB-2 ET PROCEDE POUR SON UTILISATION WO1994000136A1 (fr)

Priority Applications (5)

Application Number Priority Date Filing Date Title
AU37733/93A AU687346B2 (en) 1992-06-30 1992-10-21 A combination of anti-erbB-2 monoclonal antibodies and method of using
KR1019940701148A KR100269879B1 (ko) 1992-06-30 1992-10-21 항-이알비비-2모노클로날항체의 조합물 및 그 사용방법
EP93906955A EP0655924A4 (fr) 1992-06-30 1992-10-21 COMBINAISON D'ANTICORPS MONOCLONAUX ANTI-erbB-2 ET PROCEDE POUR SON UTILISATION.
JP6502307A JPH08504172A (ja) 1992-06-30 1992-10-21 抗−ｅｒｂＢ−２モノクロナール抗体の組み合わせ物及び使用方法
FI941572A FI941572A (fi) 1991-10-07 1994-04-06 Anti-erbB-2-monoklonaalisten vasta-aineiden yhdistelmä ja käyttömenetelmä

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US90655592A 1992-06-30 1992-06-30
US07/906,555 1992-06-30

Publications (1)

Publication Number Publication Date
WO1994000136A1 true WO1994000136A1 (fr) 1994-01-06

Family

ID=25422648

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1992/008545 WO1994000136A1 (fr) 1991-10-07 1992-10-21 COMBINAISON D'ANTICORPS MONOCLONAUX ANTI-erbB-2 ET PROCEDE POUR SON UTILISATION

Country Status (6)

Country Link
EP (1) EP0655924A4 (fr)
JP (1) JPH08504172A (fr)
KR (1) KR100269879B1 (fr)
AU (1) AU687346B2 (fr)
CA (1) CA2120745A1 (fr)
WO (1) WO1994000136A1 (fr)

Cited By (64)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997020858A1 (fr) * 1995-12-05 1997-06-12 Amgen Inc. Apoptose provoquee par l'anticorps monoclonal anti-her2
US5759776A (en) * 1995-06-05 1998-06-02 California Pacific Medical Center Targets for breast cancer diagnosis and treatment
WO2001076630A1 (fr) * 2000-04-06 2001-10-18 Kyowa Hakko Kogyo Co., Ltd. Diagnostics et remedes contre la polyarthrite rhumatoide
US6627196B1 (en) 1999-08-27 2003-09-30 Genentech, Inc. Dosages for treatment with anti-ErbB2 antibodies
US6632979B2 (en) 2000-03-16 2003-10-14 Genentech, Inc. Rodent HER2 tumor model
WO2004032961A1 (fr) * 2002-10-10 2004-04-22 Merck Patent Gmbh Anticorps bispecifiques contre erb utilises en therapie antitumorale
US6733752B1 (en) 1994-03-30 2004-05-11 The Trustees Of The University Of Pennsylvania Prevention of tumors with monoclonal antibodies against neu
EP1941905A1 (fr) 1998-03-27 2008-07-09 Genentech, Inc. Synergie d'anticorps APO-2 ligand-anti-her-2
EP1947119A2 (fr) 1997-12-12 2008-07-23 Genentech, Inc. Traitement du cancer avec un anticorps Anti-ERBB2 combiné à une chimiothérapie
CN100408097C (zh) * 2002-10-10 2008-08-06 默克专利有限公司 双特异性抗erb-b抗体及其在肿瘤治疗中的用途
US7435797B2 (en) 2002-04-10 2008-10-14 Genentech, Inc. Anti-HER2 antibody variants
US7560111B2 (en) 2004-07-22 2009-07-14 Genentech, Inc. HER2 antibody composition
US7575748B1 (en) 2000-03-16 2009-08-18 Genentech, Inc. Methods of treatment using anti-ErbB antibody-maytansinoid conjugates
EP2112167A2 (fr) 1999-06-25 2009-10-28 Genentech, Inc. Anticorps anti-ERBB2 humanisés et traitement avec les anticorps anti-ERBB2
EP2116262A2 (fr) 2000-05-19 2009-11-11 Genentech, Inc. Analyse de détection génique permettant d'améliorer la probabilité d'une réponse efficace à une thérapie du cancer basée sur un antagoniste d'ErbB
US7682609B2 (en) 1995-07-27 2010-03-23 Genentech, Inc. Protein formulation
WO2010108127A1 (fr) 2009-03-20 2010-09-23 Genentech, Inc. Anticorps anti-her di-spécifiques
WO2010136569A1 (fr) 2009-05-29 2010-12-02 F. Hoffmann-La Roche Ag Modulateurs de la signalisation her2 chez des patients exprimant her2 souffrant d'un cancer de l'estomac
EP2260858A2 (fr) 2003-11-06 2010-12-15 Seattle Genetics, Inc. Composés de monométhylvaline capable de conjugaison aux lignads.
EP2263691A1 (fr) 2002-07-15 2010-12-22 Genentech, Inc. Traitement de cancer avec l'anti-erbb2 anticorps recombinant humanisé monoclonal (rhuMAb 2C4)
WO2011012637A2 (fr) 2009-07-31 2011-02-03 F. Hoffmann-La Roche Ag Formulation sous-cutanée d'anticorps anti-her2
US7887805B2 (en) 2007-03-01 2011-02-15 Symphogen A/S Recombinant anti-epidermal growth factor receptor antibody compositions
EP2283867A2 (fr) 1999-06-25 2011-02-16 Genentech, Inc. Procédés de traitement utilisant des conjugués maytansinoïdes-anticorps anti-erbb
WO2011019619A1 (fr) 2009-08-11 2011-02-17 Genentech, Inc. Production de protéines dans des milieux de culture cellulaire sans glutamine
EP2286844A2 (fr) 2004-06-01 2011-02-23 Genentech, Inc. Conjugués anticorps-médicament et procédés
US7981418B2 (en) 2007-03-02 2011-07-19 Genentech, Inc. Predicting response to a HER inhibitor
EP2371388A2 (fr) 2004-10-20 2011-10-05 Genentech, Inc. Formulations d'anticorps
WO2011130580A1 (fr) 2010-04-15 2011-10-20 Alper Biotech, Llc Anticorps monoclonaux contre antigènes her2 et leurs utilisations
WO2011146568A1 (fr) 2010-05-19 2011-11-24 Genentech, Inc. Prédiction de réponses à un inhibiteur de her
US8075892B2 (en) 1997-12-12 2011-12-13 Genentech, Inc. Treatment with anti-ErbB2 antibodies
EP2399605A1 (fr) 2005-02-23 2011-12-28 Genentech, Inc. Extension du laps de temps avant progression de la maladie ou de la survie chez les patients atteints de cancer
WO2012069466A1 (fr) 2010-11-24 2012-05-31 Novartis Ag Molécules multi-spécifiques
WO2012084829A1 (fr) 2010-12-21 2012-06-28 F. Hoffmann-La Roche Ag Préparation d'anticorps enrichie en isoformes et son procédé d'obtention
WO2012085111A1 (fr) 2010-12-23 2012-06-28 F. Hoffmann-La Roche Ag Complexe polypeptide-polynucléotide et son utilisation dans l'administration d'une fraction effectrice ciblée
EP2511301A2 (fr) 2006-08-04 2012-10-17 Medimmune Limited Anticorps humains pour ERBB2
US8333964B2 (en) 2004-04-08 2012-12-18 Genentech, Inc. ErbB antagonists for pain therapy
USRE43899E1 (en) 1999-10-01 2013-01-01 Immunogen Inc. Compositions and methods for treating cancer using immunoconjugates and chemotherapeutic agents
WO2013033380A1 (fr) 2011-08-31 2013-03-07 Genentech, Inc. Marqueurs de diagnostic
US8404234B2 (en) 2005-01-21 2013-03-26 Genentech, Inc. Fixed dosing of HER antibodies
EP2586788A1 (fr) 2007-07-09 2013-05-01 Genentech, Inc. Prévention de la réduction des liaisons de disulfure pendant la production recombinante de polypeptides
EP2592156A2 (fr) 2007-06-08 2013-05-15 Genentech, Inc. Marqueurs d'expression de gène de résistance tumorale à un traitement par inhibiteur HER2
WO2013083810A1 (fr) 2011-12-09 2013-06-13 F. Hoffmann-La Roche Ag Identification de non-répondeurs aux inhibiteurs de her2
US8663640B2 (en) 2008-08-29 2014-03-04 Symphogen A/S Methods using recombinant anti-epidermal growth factor receptor antibody compositions
WO2014070957A1 (fr) 2012-10-30 2014-05-08 Esperance Pharmaceuticals, Inc. Conjugués anticorps/médicament et leurs procédés d'utilisation
US8722859B2 (en) 2000-04-11 2014-05-13 Genentech, Inc. Multivalent antibodies and uses therefor
WO2014083178A1 (fr) 2012-11-30 2014-06-05 F. Hoffmann-La Roche Ag Identification de patients ayant besoin d'une cothérapie par un inhibiteur de pd-l1
WO2014185704A1 (fr) 2013-05-16 2014-11-20 앱클론(주) Anticorps se liant spécifiquement à her2
US8895266B2 (en) 2000-10-06 2014-11-25 Kyowa Hakko Kirin Co., Ltd Antibody composition-producing cell
WO2015157592A1 (fr) 2014-04-11 2015-10-15 Medimmune, Llc Anticorps anti-her2 bispécifiques
WO2015159254A1 (fr) 2014-04-16 2015-10-22 Biocon Ltd. Formulations de protéines stables comprenant un excès molaire de sorbitol
US9181346B2 (en) 2008-01-30 2015-11-10 Genentech, Inc. Composition comprising antibody that binds to domain II of HER2 and acidic variants thereof
US9327023B2 (en) 2011-10-25 2016-05-03 The Regents Of The University Of Michigan HER2 targeting agent treatment in non-HER2-amplified cancers having HER2 expressing cancer stem cells
WO2016196344A1 (fr) 2015-05-30 2016-12-08 Molecular Templates, Inc. Supports de sous-unité a de toxine de shiga, déimmunisés, et molécules de ciblage de cellule les comprenant
WO2016205531A2 (fr) 2015-06-17 2016-12-22 Genentech, Inc. Anticorps anti-her2 et leurs procédés d'utilisation
US9551033B2 (en) 2007-06-08 2017-01-24 Genentech, Inc. Gene expression markers of tumor resistance to HER2 inhibitor treatment
US10233247B2 (en) 1999-04-09 2019-03-19 Kyowa Hakko Kirin Co., Ltd Method of modulating the activity of functional immune molecules
US10280227B2 (en) 2009-09-11 2019-05-07 Genentech, Inc. Highly concentrated pharmaceutical formulations
WO2019098682A1 (fr) 2017-11-14 2019-05-23 앱클론(주) Anticorps anti-her2 ou fragment de liaison à l'antigène de celui-ci, et récepteur antigénique chimérique le comprenant
WO2019204272A1 (fr) 2018-04-17 2019-10-24 Molecular Templates, Inc. Molécules ciblant her2 comprenant des matrices de la sous-unité a, rendue non immunogène, de la shigatoxine
WO2019207021A1 (fr) 2018-04-27 2019-10-31 F. Hoffmann-La Roche Ag Procédés de purification de polypeptides à l'aide de polysorbates
US10689457B2 (en) 2008-06-16 2020-06-23 Genentech, Inc. Treatment of metastatic breast cancer
US10844135B2 (en) 2003-10-10 2020-11-24 Immunogen, Inc. Method of targeting specific cell populations using cell-binding agent maytansinoid conjugates linked via a non-cleavable linker, said conjugates and methods of making said
WO2023044483A2 (fr) 2021-09-20 2023-03-23 Voyager Therapeutics, Inc. Compositions et procédés pour le traitement du cancer positif her2
US11649294B2 (en) 2017-11-14 2023-05-16 GC Cell Corporation Anti-HER2 antibody or antigen-binding fragment thereof, and chimeric antigen receptor comprising same

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2022532812A (ja) * 2018-08-16 2022-07-20 カンタージア アクチエボラーグ 抗ｉｌ１ｒａｐ抗体組成物

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4867962A (en) * 1988-02-26 1989-09-19 Neorx Corporation Functionally specific antibodies
EP0494135B1 (fr) * 1989-09-29 1996-04-10 Oncogene Science, Inc. Protéine humaine "neu" p100 et son utilisation pour la détection de cellules prénéoplasiques ou néoplasiques chez l'homme

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Cancer Research, Vol. 50, issued 01 March 1990, FENDLY et al., "Characterization of Murine Monoclonal Antibodies Reactive to Either the Human Epidermal Growth Factor Receptor or HER2/neu Gene Product", pages 1550-1558, see entire document. *
Science, Vol. 252, issued 21 June 1991, WALDMANN, "Monoclonal Antibodies in Diagnosis and Therapy", pages 1657-1661, see entire document (Provided to Question the Method of Treatment Claims, Since use of Monoclonal Antibodies in Vivo is Taught to be Unpredictable). *
See also references of EP0655924A4 *

Cited By (133)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6733752B1 (en) 1994-03-30 2004-05-11 The Trustees Of The University Of Pennsylvania Prevention of tumors with monoclonal antibodies against neu
US5759776A (en) * 1995-06-05 1998-06-02 California Pacific Medical Center Targets for breast cancer diagnosis and treatment
US7682609B2 (en) 1995-07-27 2010-03-23 Genentech, Inc. Protein formulation
US9180189B2 (en) 1995-07-27 2015-11-10 Genentech, Inc. Treating a mammal with a formulation comprising an antibody which binds IgE
US9283273B2 (en) 1995-07-27 2016-03-15 Genentech, Inc. Protein formulation
US7354583B2 (en) 1995-12-05 2008-04-08 Amgen, Inc. Antibody-induced apoptosis
US5783186A (en) * 1995-12-05 1998-07-21 Amgen Inc. Antibody-induced apoptosis
US6458356B1 (en) 1995-12-05 2002-10-01 Amgen Inc. Antibody-induced apoptosis
US7811566B2 (en) 1995-12-05 2010-10-12 Amgen, Inc. Antibody-induced apoptosis
EP1375520A1 (fr) * 1995-12-05 2004-01-02 Amgen Inc. Apoptose induite par un anticorps monoclonal contre Her2
WO1997020858A1 (fr) * 1995-12-05 1997-06-12 Amgen Inc. Apoptose provoquee par l'anticorps monoclonal anti-her2
US8444990B2 (en) 1995-12-05 2013-05-21 Amgen Inc. Antibody-induced apoptosis
EP1947119A2 (fr) 1997-12-12 2008-07-23 Genentech, Inc. Traitement du cancer avec un anticorps Anti-ERBB2 combiné à une chimiothérapie
US8425908B2 (en) 1997-12-12 2013-04-23 Genentech, Inc. Treatment with anti-ErbB2 antibodies
US8309087B2 (en) 1997-12-12 2012-11-13 Genentech, Inc. Treatment with anti-ErbB2 antibodies
US8075892B2 (en) 1997-12-12 2011-12-13 Genentech, Inc. Treatment with anti-ErbB2 antibodies
EP1941905A1 (fr) 1998-03-27 2008-07-09 Genentech, Inc. Synergie d'anticorps APO-2 ligand-anti-her-2
US10233247B2 (en) 1999-04-09 2019-03-19 Kyowa Hakko Kirin Co., Ltd Method of modulating the activity of functional immune molecules
EP2803367A1 (fr) 1999-06-25 2014-11-19 ImmunoGen, Inc. Procédés de traitement utilisant des conjugués maytansinoïdes-anticorps anti-erbb
EP2283867A2 (fr) 1999-06-25 2011-02-16 Genentech, Inc. Procédés de traitement utilisant des conjugués maytansinoïdes-anticorps anti-erbb
EP2283866A2 (fr) 1999-06-25 2011-02-16 Genentech, Inc. Procédés de traitement utilisant des conjugués maytansinoïdes-anticorps anti-ERBB
EP2977063A1 (fr) 1999-06-25 2016-01-27 Genentech, Inc. Procédés de traitement utilisant des conjugués maytansinoïdes-anticorps anti-ErbB
EP2112167A2 (fr) 1999-06-25 2009-10-28 Genentech, Inc. Anticorps anti-ERBB2 humanisés et traitement avec les anticorps anti-ERBB2
EP2110138A1 (fr) 1999-08-27 2009-10-21 Genentech, Inc. Dosages pour le traitement des anticorps anti-erbB2
US7371379B2 (en) 1999-08-27 2008-05-13 Genentech, Inc. Dosages for treatment with anti-ErbB2 antibodies
EP2111870A1 (fr) 1999-08-27 2009-10-28 Genentech, Inc. Dosages pour le traitement avec des anticorps anti-erbB2
US10280228B2 (en) 1999-08-27 2019-05-07 Genentech, Inc. Treatment with anti-ErbB2 antibodies
US10160811B2 (en) 1999-08-27 2018-12-25 Genentech, Inc. Treatment with anti-ErbB2 antibodies
US6627196B1 (en) 1999-08-27 2003-09-30 Genentech, Inc. Dosages for treatment with anti-ErbB2 antibodies
USRE43899E1 (en) 1999-10-01 2013-01-01 Immunogen Inc. Compositions and methods for treating cancer using immunoconjugates and chemotherapeutic agents
USRE44704E1 (en) 1999-10-01 2014-01-14 Immunogen Inc. Compositions and methods for treating cancer using immunoconjugates and chemotherapeutic agents
US6632979B2 (en) 2000-03-16 2003-10-14 Genentech, Inc. Rodent HER2 tumor model
US7575748B1 (en) 2000-03-16 2009-08-18 Genentech, Inc. Methods of treatment using anti-ErbB antibody-maytansinoid conjugates
WO2001076630A1 (fr) * 2000-04-06 2001-10-18 Kyowa Hakko Kogyo Co., Ltd. Diagnostics et remedes contre la polyarthrite rhumatoide
EP2857516A1 (fr) 2000-04-11 2015-04-08 Genentech, Inc. Anticorps multivalents et leurs utilisations
US8722859B2 (en) 2000-04-11 2014-05-13 Genentech, Inc. Multivalent antibodies and uses therefor
US9493579B2 (en) 2000-04-11 2016-11-15 Genentech, Inc. Multivalent antibodies and uses therefor
US8076066B2 (en) 2000-05-19 2011-12-13 Genentech, Inc. Gene detection assay for improving the likelihood of an effective response to a HER2 antibody cancer therapy
EP2116262A2 (fr) 2000-05-19 2009-11-11 Genentech, Inc. Analyse de détection génique permettant d'améliorer la probabilité d'une réponse efficace à une thérapie du cancer basée sur un antagoniste d'ErbB
US7993834B2 (en) 2000-05-19 2011-08-09 Genentech, Inc. Detection of ErbB2 gene amplification to increase the likelihood of the effectiveness of ErbB2 antibody breast cancer therapy
US9409982B2 (en) 2000-10-06 2016-08-09 Kyowa Hakko Kirin Co., Ltd Antibody composition-producing cell
US8895266B2 (en) 2000-10-06 2014-11-25 Kyowa Hakko Kirin Co., Ltd Antibody composition-producing cell
US10233475B2 (en) 2000-10-06 2019-03-19 Kyowa Hakko Kirin Co., Ltd Antibody composition-producing cell
US7435797B2 (en) 2002-04-10 2008-10-14 Genentech, Inc. Anti-HER2 antibody variants
EP2289942A2 (fr) 2002-04-10 2011-03-02 Genentech, Inc. Variantes d'anticorps anti-her2
US8840896B2 (en) 2002-04-10 2014-09-23 Genentech, Inc. Anti-HER2 antibody variants
US7850966B2 (en) 2002-04-10 2010-12-14 Genentech, Inc. Method of treating breast cancer using anti-HER2 antibody variants
EP2263691A1 (fr) 2002-07-15 2010-12-22 Genentech, Inc. Traitement de cancer avec l'anti-erbb2 anticorps recombinant humanisé monoclonal (rhuMAb 2C4)
KR101088661B1 (ko) * 2002-10-10 2011-12-01 메르크 파텐트 게엠베하 Ｅｒｂ－ｂ１ 수용체를 표적으로 하는 약학적 조성물
WO2004032961A1 (fr) * 2002-10-10 2004-04-22 Merck Patent Gmbh Anticorps bispecifiques contre erb utilises en therapie antitumorale
WO2004032960A1 (fr) * 2002-10-10 2004-04-22 Merck Patent Gmbh Compositions pharmaceutiques relatives a des recepteurs de erb-b1
US7226592B2 (en) 2002-10-10 2007-06-05 Merck Patent Gmbh Bispecific anti-Erb-B antibodies and their use in tumor therapy
CN100408097C (zh) * 2002-10-10 2008-08-06 默克专利有限公司 双特异性抗erb-b抗体及其在肿瘤治疗中的用途
US7638125B2 (en) 2002-10-10 2009-12-29 Merck Patent Gmbh Pharmaceutical compositions directed to Erb-B1 receptors
US10844135B2 (en) 2003-10-10 2020-11-24 Immunogen, Inc. Method of targeting specific cell populations using cell-binding agent maytansinoid conjugates linked via a non-cleavable linker, said conjugates and methods of making said
EP3120861A1 (fr) 2003-11-06 2017-01-25 Seattle Genetics, Inc. Composés intermédiaires pour la préparation de conjugués d'auristatin avec des éléments de liaison
EP3434275A1 (fr) 2003-11-06 2019-01-30 Seattle Genetics, Inc. Méthode de dépistage de cellules cancéreuses basé sur l'utilisation de conjugués d'auristatin avec anticorps
EP2260858A2 (fr) 2003-11-06 2010-12-15 Seattle Genetics, Inc. Composés de monométhylvaline capable de conjugaison aux lignads.
EP2489364A1 (fr) 2003-11-06 2012-08-22 Seattle Genetics, Inc. Composés de monométhylvaline conjuguös avec des anticorps
EP2486933A1 (fr) 2003-11-06 2012-08-15 Seattle Genetics, Inc. Composés de monométhylvaline conjugués avec des anticorps
EP3858387A1 (fr) 2003-11-06 2021-08-04 Seagen Inc. Composés de monométhylvaline capables de conjugaison aux ligands
EP2478912A1 (fr) 2003-11-06 2012-07-25 Seattle Genetics, Inc. Conjugués d'auristatin avec des anticorps dirigés contre le HER2 ou le CD22 et leur usage thérapeutique
US8333964B2 (en) 2004-04-08 2012-12-18 Genentech, Inc. ErbB antagonists for pain therapy
EP2286844A2 (fr) 2004-06-01 2011-02-23 Genentech, Inc. Conjugués anticorps-médicament et procédés
US7560111B2 (en) 2004-07-22 2009-07-14 Genentech, Inc. HER2 antibody composition
US7879325B2 (en) 2004-07-22 2011-02-01 Genentech, Inc. HER2 antibody composition
US9017671B2 (en) 2004-10-20 2015-04-28 Genentech, Inc. Method of treating cancer with a pharmaceutical formulation comprising a HER2 antibody
EP2371388A2 (fr) 2004-10-20 2011-10-05 Genentech, Inc. Formulations d'anticorps
EP3498294A1 (fr) 2004-10-20 2019-06-19 Genentech, Inc. Formulations d'anticorps
EP3698807A1 (fr) 2005-01-21 2020-08-26 Genentech, Inc. Dosage fixe d'anticorps anti-her
US8404234B2 (en) 2005-01-21 2013-03-26 Genentech, Inc. Fixed dosing of HER antibodies
US8691232B2 (en) 2005-02-23 2014-04-08 Genentech, Inc. Extending time to disease progression or survival in cancer patients
EP2399605A1 (fr) 2005-02-23 2011-12-28 Genentech, Inc. Extension du laps de temps avant progression de la maladie ou de la survie chez les patients atteints de cancer
EP2511301A2 (fr) 2006-08-04 2012-10-17 Medimmune Limited Anticorps humains pour ERBB2
US7887805B2 (en) 2007-03-01 2011-02-15 Symphogen A/S Recombinant anti-epidermal growth factor receptor antibody compositions
US8414896B2 (en) 2007-03-01 2013-04-09 Symphogen A/S Recombinant anti-epidermal growth factor receptor antibody compositions
US7981418B2 (en) 2007-03-02 2011-07-19 Genentech, Inc. Predicting response to a HER inhibitor
US8940302B2 (en) 2007-03-02 2015-01-27 Genentech, Inc. Predicting response to a HER inhibitor
EP2899541A1 (fr) 2007-03-02 2015-07-29 Genentech, Inc. Elément de prévision de la réponse à un inhibiteur de HER
EP2592156A2 (fr) 2007-06-08 2013-05-15 Genentech, Inc. Marqueurs d'expression de gène de résistance tumorale à un traitement par inhibiteur HER2
US9551033B2 (en) 2007-06-08 2017-01-24 Genentech, Inc. Gene expression markers of tumor resistance to HER2 inhibitor treatment
US10385405B2 (en) 2007-06-08 2019-08-20 Genentech, Inc. Gene expression markers of tumor resistance to HER2 inhibitor treatment
EP4219522A2 (fr) 2007-07-09 2023-08-02 Genentech, Inc. Prévention de la réduction de liaisons disulfures pendant la production recombinante de polypeptides
EP4245766A2 (fr) 2007-07-09 2023-09-20 Genentech, Inc. Prévention de la réduction de liaisons disulfures pendant la production recombinante de polypeptides
EP2586788A1 (fr) 2007-07-09 2013-05-01 Genentech, Inc. Prévention de la réduction des liaisons de disulfure pendant la production recombinante de polypeptides
EP3327026A1 (fr) 2007-07-09 2018-05-30 Genentech, Inc. Prévention de la réduction des liaisons de disulfure pendant la production recombinante de polypeptides
EP4335863A2 (fr) 2007-07-09 2024-03-13 Genentech, Inc. Prévention de la réduction de liaisons disulfures pendant la production recombinante de polypeptides
US9181346B2 (en) 2008-01-30 2015-11-10 Genentech, Inc. Composition comprising antibody that binds to domain II of HER2 and acidic variants thereof
EP4119583A1 (fr) 2008-01-30 2023-01-18 Genentech, Inc. Composition comprenant un anticorps se liant au domaine ii de her2 et variantes acides de celle-ci
US11414498B2 (en) 2008-01-30 2022-08-16 Genentech, Inc. Composition comprising antibody that binds to domain II of HER2 and acidic variants thereof
US11597776B2 (en) 2008-01-30 2023-03-07 Genentech, Inc. Composition comprising antibody that binds to domain II of HER2 and acidic variants thereof
EP3401335A1 (fr) 2008-01-30 2018-11-14 Genentech, Inc. Composition comprenant un anticorps se liant au domaine ii de her2 et variantes acides de celle-ci
US11655305B2 (en) 2008-06-16 2023-05-23 Genentech, Inc. Treatment of metastatic breast cancer
US10689457B2 (en) 2008-06-16 2020-06-23 Genentech, Inc. Treatment of metastatic breast cancer
US8663640B2 (en) 2008-08-29 2014-03-04 Symphogen A/S Methods using recombinant anti-epidermal growth factor receptor antibody compositions
WO2010108127A1 (fr) 2009-03-20 2010-09-23 Genentech, Inc. Anticorps anti-her di-spécifiques
EP3088420A1 (fr) 2009-03-20 2016-11-02 F. Hoffmann-La Roche AG Anticorps anti-her bispécifiques
WO2010136569A1 (fr) 2009-05-29 2010-12-02 F. Hoffmann-La Roche Ag Modulateurs de la signalisation her2 chez des patients exprimant her2 souffrant d'un cancer de l'estomac
WO2011012637A2 (fr) 2009-07-31 2011-02-03 F. Hoffmann-La Roche Ag Formulation sous-cutanée d'anticorps anti-her2
EP4339212A2 (fr) 2009-07-31 2024-03-20 F. Hoffmann-La Roche AG Formulation d'anticorps anti-her2 sous-cutané
US9345661B2 (en) 2009-07-31 2016-05-24 Genentech, Inc. Subcutaneous anti-HER2 antibody formulations and uses thereof
US9968676B2 (en) 2009-07-31 2018-05-15 Genentech, Inc. Subcutaneous anti-HER2 antibody formulations and uses thereof
EP2687202A1 (fr) 2009-07-31 2014-01-22 F. Hoffmann-La Roche AG Formulation d'anticorps anti-her2 sous-cutané
EP3760712A1 (fr) 2009-08-11 2021-01-06 F. Hoffmann-La Roche AG Production de protéines dans des milieux de culture cellulaire sans glutamine
WO2011019619A1 (fr) 2009-08-11 2011-02-17 Genentech, Inc. Production de protéines dans des milieux de culture cellulaire sans glutamine
US10752696B2 (en) 2009-09-11 2020-08-25 Genentech, Inc. Highly concentrated pharmaceutical formulations
US10280227B2 (en) 2009-09-11 2019-05-07 Genentech, Inc. Highly concentrated pharmaceutical formulations
US10377831B2 (en) 2009-09-11 2019-08-13 Genentech, Inc. Highly concentrated pharmaceutical formulations
WO2011130580A1 (fr) 2010-04-15 2011-10-20 Alper Biotech, Llc Anticorps monoclonaux contre antigènes her2 et leurs utilisations
WO2011146568A1 (fr) 2010-05-19 2011-11-24 Genentech, Inc. Prédiction de réponses à un inhibiteur de her
WO2012069466A1 (fr) 2010-11-24 2012-05-31 Novartis Ag Molécules multi-spécifiques
WO2012084829A1 (fr) 2010-12-21 2012-06-28 F. Hoffmann-La Roche Ag Préparation d'anticorps enrichie en isoformes et son procédé d'obtention
WO2012085111A1 (fr) 2010-12-23 2012-06-28 F. Hoffmann-La Roche Ag Complexe polypeptide-polynucléotide et son utilisation dans l'administration d'une fraction effectrice ciblée
WO2013033380A1 (fr) 2011-08-31 2013-03-07 Genentech, Inc. Marqueurs de diagnostic
US9327023B2 (en) 2011-10-25 2016-05-03 The Regents Of The University Of Michigan HER2 targeting agent treatment in non-HER2-amplified cancers having HER2 expressing cancer stem cells
WO2013083810A1 (fr) 2011-12-09 2013-06-13 F. Hoffmann-La Roche Ag Identification de non-répondeurs aux inhibiteurs de her2
EP4035685A1 (fr) 2012-10-30 2022-08-03 Esperance Pharmaceuticals, Inc. Conjugués anticorps-médicament et procédés d'utilisation
WO2014070957A1 (fr) 2012-10-30 2014-05-08 Esperance Pharmaceuticals, Inc. Conjugués anticorps/médicament et leurs procédés d'utilisation
WO2014083178A1 (fr) 2012-11-30 2014-06-05 F. Hoffmann-La Roche Ag Identification de patients ayant besoin d'une cothérapie par un inhibiteur de pd-l1
EP3511718A1 (fr) 2012-11-30 2019-07-17 F. Hoffmann-La Roche AG Inhibiteur de pd-l1
WO2014185704A1 (fr) 2013-05-16 2014-11-20 앱클론(주) Anticorps se liant spécifiquement à her2
WO2015157592A1 (fr) 2014-04-11 2015-10-15 Medimmune, Llc Anticorps anti-her2 bispécifiques
US10160812B2 (en) 2014-04-11 2018-12-25 Medimmune, Llc Bispecific HER2 antibodies
WO2015159254A1 (fr) 2014-04-16 2015-10-22 Biocon Ltd. Formulations de protéines stables comprenant un excès molaire de sorbitol
EP3660035A1 (fr) 2015-05-30 2020-06-03 Molecular Templates, Inc. Supports de sous-unité a de toxine de shiga, déimmunisés, et molécules de ciblage de cellule les comprenant
WO2016196344A1 (fr) 2015-05-30 2016-12-08 Molecular Templates, Inc. Supports de sous-unité a de toxine de shiga, déimmunisés, et molécules de ciblage de cellule les comprenant
EP3636660A1 (fr) 2015-05-30 2020-04-15 Molecular Templates, Inc. Échafaudages à sous-unités a de shiga-toxines désimmunisés et molécules de ciblage de cellules les comprenant
WO2016205531A2 (fr) 2015-06-17 2016-12-22 Genentech, Inc. Anticorps anti-her2 et leurs procédés d'utilisation
US11649294B2 (en) 2017-11-14 2023-05-16 GC Cell Corporation Anti-HER2 antibody or antigen-binding fragment thereof, and chimeric antigen receptor comprising same
WO2019098682A1 (fr) 2017-11-14 2019-05-23 앱클론(주) Anticorps anti-her2 ou fragment de liaison à l'antigène de celui-ci, et récepteur antigénique chimérique le comprenant
WO2019204272A1 (fr) 2018-04-17 2019-10-24 Molecular Templates, Inc. Molécules ciblant her2 comprenant des matrices de la sous-unité a, rendue non immunogène, de la shigatoxine
WO2019207021A1 (fr) 2018-04-27 2019-10-31 F. Hoffmann-La Roche Ag Procédés de purification de polypeptides à l'aide de polysorbates
WO2023044483A2 (fr) 2021-09-20 2023-03-23 Voyager Therapeutics, Inc. Compositions et procédés pour le traitement du cancer positif her2

Also Published As

Publication number Publication date
AU687346B2 (en) 1998-02-26
CA2120745A1 (fr) 1994-01-06
EP0655924A1 (fr) 1995-06-07
AU3773393A (en) 1994-01-24
KR100269879B1 (ko) 2000-10-16
JPH08504172A (ja) 1996-05-07
EP0655924A4 (fr) 1996-09-11
KR950700075A (ko) 1995-01-16

Similar Documents

Publication Publication Date Title
WO1994000136A1 (fr) COMBINAISON D'ANTICORPS MONOCLONAUX ANTI-erbB-2 ET PROCEDE POUR SON UTILISATION
AU2001239913B2 (en) Method of treating cancer with anti-neurotrophin agents
US6224868B1 (en) Reagent and processes for targeting mutant epidermal growth factor receptors
EP2635605B1 (fr) Anticorps anti-her3 et compositions
US9522956B2 (en) Combination therapy using anti-EGFR and anti-HER2 antibodies
Tokuda et al. Dose escalation and pharmacokinetic study of a humanized anti-HER2 monoclonal antibody in patients with HER2/neu-overexpressing metastatic breast cancer
CN108424454B (zh) 靶向egf受体的单克隆抗体175及其衍生物和用途
AU2001295002B2 (en) Treatment of hyperproliferative diseases with epidermal growth factor receptor antagonists
AU782994C (en) Treatment of refractory human tumors with epidermal growth factor receptor antagonists
US7811566B2 (en) Antibody-induced apoptosis
AU2001239913A1 (en) Method of treating cancer with anti-neurotrophin agents
KR20010071271A (ko) 방사선 및 성장 인자 수용체 티로신 키나아제 억제제에의한 사람 종양의 치료법
KR20020069104A (ko) 항-ＥｒｂＢ２ 항체를 사용한 전립선암의 치료방법
KR20100135337A (ko) 항-ＥｒｂＢ２ 항체를 이용한 치료 방법
MXPA02002037A (es) Dosificaciones para el tratamiento con anticuerpos anti-erb2.
EA018717B1 (ru) Антитело или фрагмент антитела, которое связывается с белком ron человека, и его применение
US20030202973A1 (en) Treatment of refractory human tumors with epidermal growth factor receptor and HER1 mitogenic ligand (EGFRML) antagonists
Ohnishi et al. Prolonged survival of mice with human gastric cancer treated with an anti-c-ErbB-2 monoclonal antibody
CN115814104A (zh) 抗体药物偶联物制剂及其用途
IL300388A (en) Treatment with drug-conjugated antibodies specific for the HER2 site
BR112013010764A2 (pt) composição de anticorpos anti-her3, molécula de ligação biespecífica, molécula de ácido nucleico, vetor de expressão, linhagem celular policlonal, método para produção da referida composição, composição farmacêutica e uso da referida composição

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA FI JP KR NO RU

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 941572

Country of ref document: FI

WWE Wipo information: entry into national phase

Ref document number: 2120745

Country of ref document: CA

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 1993906955

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1993906955

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1993906955

Country of ref document: EP