AU687346B2 - A combination of anti-erbB-2 monoclonal antibodies and method of using - Google Patents

Description

OPI DATE 24/01/94 AOJP DATE 14/04/94 APL.ID 37733/93 DI11111 1( 11 11 PCT NUMBER PCT/US92/08545 ll 11 11li!NI AU9337733 7 (51) International Patent Classification 5 (11) International Publication Number: WVO 94/00136 C07K 3510, 139/00, 15 1 /0 0A (43) International Publication Date: 6 January 1994 (06.01.94) C07K 17/001 (21) International Application Number: PCT/US92/08545 (81) D~esignated States: AU, CA, Fl, JP, KR, NO, RU, European patent (AT, BE, CH, DE, DK, ES, FR, GB, GR, (22) International Filing Date: 21 October 1992 (21.10.92) IT, LU, MC, NL, SE).

Priority data: Published 07/906,555 30 J une 1992 (30.06.92) us 07Mit ernational search report.

;4-ppcant.-M-01Eel Ne&LGY1&W [0dS -19Fmld dia esbu B8- 8-(US (72) Inventors: KASPRZYK, Philip, G. KING, Charles, R.

1130 Park Road, Washington, DC 20010 (US).

(74) Agent: OLSTEIN, Elliot, Carella, Byrne, Bain, Gilfil- 8J' 4&i Ian, Cecchi and Stewart, 6 Becker Farm Road, Roseland,6 or' .NT 04; (54)Title: A COMBINATION OF ANTI-erhB-2 MONOCLONAL ANTIBODIES AND METH-OD) OF USING (57) Abstract The present invention relates to a combination of at least twvo monolconal antibodies which are capable of preventing and treating human malignancies wherein the malignant cells overexprcss gplIsserbil- 2 The monoclonal antibodies of the combination recognize different epitopes of the gp1 85 expression product of erhB-2, therefore, the antibodies do not cross react with each other. Preferably, the combination decreases the expression product of the erbB-2 gene. In another embodiment, the combination does not essentially increase tyrosine phosphorylation of the gp 185 expression product.

PCT/US 92/ 0 545 RO/ US 2 1 5: 1992 A COMBINATION OF ANTI-erbB-2 MONOCLONAL ANTIBODIES AND METHOD OF USING The present invention relates to a combination of monoclonal antibodies capable of preventing and treating tumors. More specifically, the monoclonal antibodies are single chain monoclonal antibodies which are capable of treating and preventing tumors.

Amplification and/or o-erexpression of the erbB-2 gene (also called HER-2 or neu) results in overexpression of erbB-2 mRNA and proteins and has been demonstrated in 20-30% of adenocarcinomas of the breast ovary lung (6) and stomach Two lines of evidence implicate erbB-2 overexpression in the pathogenesis of human neoplasia.

First, overexpression has been linked with poor prognosis in breast ovarian stomach and lu.ig cancer indicating that overexpression alters the cancer cell.

Second, artificial ovarexpression of erbB-2 induces a transformed phenotype in NIH/3T3 fibroblasts (15, 16) as well as in mammary epithelial cells (17) suggesting that overexpression can contribute directly to the development of the malignant phenotype.

erbB-2 Due to the extensive homology between gp185 and the epidermal growth factor receptor (EGFR), it is widely assumed that their activation might proceed through similar mechanisms. One such mechanism involves receptor dimerization/oligomerization which is thought to be an important step in the activation of the EGFR intrinsic tyrosine kinase function (18, 19). Interfering with receptor-receptor interactions has been evaluated as a *potential therapeutic approach to treatment of cancers with erbB-2 overexpression. Previous studies have evaluated the use of single monoclonal antibodies directed against erbB-2 PCT/US 92/08545 RO/US 2 1 00 1992 and the related Epidermal Growth Factor Receptor (EGFR) protein (21) as potential therapeutic agents for the treatment of cancer.

Use of single monoclonal antibodies directed against erbB-2 which have been evaluated as potential therapeutic agents have resulted in increased gp 185 erbB-2 autophosphorylation, resulting from increases in the activity of tyrosine kinase. Single antibody agents have shown promise as potential anticancer therapies (20, 27).

SUMMARY OF THE INVENTION One object of Applicant's invention relates to a combination of at least two monoclonal antibodies capable of treating or preventing human malignancies wherein the malignant cells overexpress qp 185 er bB 2 The combination comprises at least a first and second antibody each of which recognizes the gp185 extracellular domain of erbB-2. The activity demonstrated by the combination antibody treatment has shown greater activity than expected by the sum of the individual antibodies at the same overall antibody concentration.

Another object of the present invention provides for the use of monocl.nal antibodies which are single chain monoclonal antibodies. The single chain antibodies can be used to form a bispecific antibody.

DETAILED DESCRIPTION OF THE DRAWINGS Figure 1A. Specificity of monoclonal antibodies #21 and #23. Subconfluent SK-Br-3 monolayers were metabolically labeled with 35S-Cys (spec. act. 1000 Ci/mmol). Total cell proteins were immunoprecipitated with 10 pg of the indicated antibodies. The immune complexes were recovered by Protein G Agarose (Genex, Gaithersburg, MD) and analyzed by SDS-PAGE PCT/US 9 2 0 8 RO/US 21 OCT 1992 on an 8-16% Tris-Glycine gel. The gel was exposed to film at -70°C overnight with an intensifying screen.

Figure 1B. gp 185 erbB2 overexpression in the gastric cell line N87 and a tumor from N87 mouse xenografts compared to high and low gp85 er bB 2 overexpressers. Cells or tumor were lysed in sample buffer which contained 0.125 M Tris-HCl, 4% SDS, 0.002% bromophenol blue, and 15% glycerol.

8-mercaptoethanol was added after the protein concentration was determined. 'Samples (10 pg total protein) were boiled for 3 min, fractionated by SDS-PAGE on 8-16% Tris-Glycine gel and transferred to nitrocellulose.

Detection of gp 185 erbB-2 was performed with a monoclonal antibody to the c-terminal portion of the protein.

Figure 1C. Southern blot analysis of the erbB-2 gene in N87 (gastric), SK-Br-3 (breast), and SK-OV-3 (ovarian) cell lines and human placenta. DNA was extracted from cell lines and human placenta tissue using guanidine thiocyanate and cesium gradient centrifugation. DNA (15 pg) was cleaved with restriction enzyme HinDIII, separated by electrophoresis on a 1% agarose gel, transferred to nitrocellulose, and probed with radioactive erbB-2 cDNA probe as previously described The cDNA probe corresponds to the entire erbB-2 protein coding region.

Figure 2. Effects of Ab#21 and Ab#23 on the growth of human N87 gastric tumor cells in a monolayer MTT growth assay. A single cell suspension of 10,000 cells/well was plated in a chemically defined medium consisting of RPMI-1640 supplemented with Insulin (5 pg/ml) human transferrin (10 pg/ml) 17-8-estradiol (10 nM), sodium selenite (5 nM), and 10 mM Hepes. PBS, Ab#21, Ab#23 or a combination of Ab#21 and Ab#23 at the indicated concentration were then added. The plates were grown at 37 0 C in a 5% C02 humidified atmosphere. After 7 days, 50 pl -3of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (0.1 mg) were added and allowed to incubate for 4 hours at 37°C. 90% of the media was then removed and the crystals solubilized in 0.175 ml DMSO. Optical densities were measured at 540 nm in a Molecular Devices Vmax kinetic microplate reader. Results are the average of eight wells with standard deviations noted. Under the conditions used, the cell number is directly proportional to MTT reduction.

Figure 3A. Effects of treatment with Ab#21 Ab#23( a combination of Ab#21 and Ab#23 IM or PBS on the growth of N87 tumor xenografts in BNX mice.

Tumor cells (5 X 106 /mouse) were subcutaneously injected into the flanks of BNX (beige, nude, xid) mice. Treatment' begun on day 1 consisted of four trial groups (3 mice per group) each given 0.2 ml intraperitoneal injections twice a week of either PBS 200 pg purified Ab#21 200 pg purified Ab#23 or a mixture of 100 Vg purified Ab#21 and 100 pg of purified Ab#23 i for three weeks. Tumor growth is reported as an average relative tumor volume, s.e.m. Two repeats of the experiment gave the same results.

Figure 3B. Effect of treatment after the formation of small tumors. Cells were injected using the same treatment protocol as above except for the fact the treatment was begun 4 days after cell injection instead of 1 day after.

Animal care was in accordance with institutional guidelines.

Figure 4A. Effect of antibody binding on erbB-2 protein turnover. Subconfluent N87 cell monolayers were pulse-labeled 1 h with 20 pCi 35S-Cysteine and then chased with 5 mM Cys in the presence of Ab#21 alone, Ab#23 alone, or a 1:1 combination of Ab#21 and Ab#23 (10 pg/ml)for 24 h.

Total cellular protein was immunoprecipitated as described in Figure 1 using a monoclonal antibody directed against the -4- CvK4" V^ PCT/US 92/08545 RO/US 21 OCT 1992 c-terminus of gp185 e r b 2 coupled to Sepharose and analyzed by SDS-PAGE. The gel was exposed to film at -70 0 C overnighz with an intensifying screen.

Figure 4B. Measurement of tyrosine phosphorylation of gp85erbB-2 after incubation with antibody combination.

Cells were plated as in Figure 4A. After 1 h cells were processed as in Figure B1. The proteins were electroblotted onto nitrocellulose paper and incubated with anti-phosphotyrosine IgG (polyclonal, Upstate Biotechnology, Inc.) and immunodetected using an ECL western blotting detection system (Amersham). The film was exposed for 5 min at room temperature.

Figure 5. Effects of Ab#21 and Ab#23 on the growth of human Calu-3 lung adenocarcinoma tumor cells in a monolayer MTT growth assay. A single cell suspension of 10,000 cells/well was plated in a chemically defined medium consisting of RPMI-1640 supplemented with Insulin (5 pg/ml), human transferrin (10 pg/ml) 17-B-estradiol (10 nM), sodium selenite (5 nM), and 10 mM Hepes. PBS, Ab#21, Ab#23 or a combination of Ab#21 and Ab#23 at the indicated concentration were then added. The plates were grown at 37 0 C in a 5% C02 humidified atmosphere. After 7 days, 50 1p of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (0.1 mg) were added and allowed to incubate for 4 hours at 37°C. 90% of the media was then removed and the crystals solubilized in 0.175 ml DMSO. Optical densities were measured at 540 nm in a Molecular Devices Vmax kinetic microplate reader. Results are the average of eight wells with standard deviations noted. Under the conditions used, the cell number is directly proportional to MTT reduction.

Figure 6. Effects of Ab#23 and Ab#94 on the growth of human Calu-3 lung adenocarcinoma tumor cells in a monolayer MTT growth assay. A single cell suspension of 10,000 PCT/US 92/08545 RO/US 2 1 OCT 1992 cells/well was plated in a chemically defined medium consisting of RPMI-1640 supplemented with Insulin (5 pg/ml), human transferrin (10 pg/ml), 17-8-estradiol (10 nM), sodium selenite (5 nM), and 10 mM Hepes. PBS, Ab#23, Ab#94 or a combination of Ab#21 and Ab#23 at the indicated concentration were then added. The plates were grown at 37 0 C in a 5% CO 2 humidified atmosphere. After 7 days, 50 pl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (0.1 mg) were added and allowed to incubate for 4 hours at 37°C. 90% of the media was then removed and the crystals solubilized in 0.175 ml DMSO. Optical densities were measured at 540 nm in a Molecular Devices Vmax kinetic microplate reader. Results are the average of eight wells with standard deviations noted. Under the conditions used, the cell number is directly proportional to MTT reduction.

Figure 7. The cDNA sequence for the *single chain anti-erbB2 antibody, Ab#23.

Figure 8. The cDNA sequence for the *single chain anti-erbB2 antibody, Ab#21 (e22).

DETAILED DESCRIPTION OF THE INVENTION One object of the present invention is a combination of at least two monoclonal antibodies, which is capable of preventing and treating human malignancies, wherein the erbB-2 malignant cells overexpress qp185e 2 and wherein said at least two different antibodies each recognize a different epitope of the gp185 expression product of erbB-2, therefore the antibodies do not cross react with each other. An embodiment of the present invention provides for the combination to comprise first and second antibodies whi',h are preferably combined such that the resulting ratio of the first to second is effective for decreasing the expression product of the erbB-2 gene. A convenient method for PCT/US 92/08545 RO/US 21 OT 1992 measuring the expression product of erbB-2 gene may be found -in Figure 4A. The decrease in the expression of the erbB-2 gene product is the result of the combination decreasing the half life of erbB-2 protein in the cell. In another embodiment of the present invention, the combination of the antibodies has the characteristic trait of essentially not increasing the tyrosine phosphorylation of gp185 expression product.

An example of a first to second antibodies ratio having the activity necessary to decrease the expression product of the erbB-2 gene comprises a ratio of from about 1:2 to about 2:1. Preferably, such a ratio is 1:1. The present invention, however, is not intended to be limited to the antibody ratios discussed herein. The fact that other ratios are effective and may yield higher activity than the 1:1 ratio used as an example is recognized and acknowledged by the inventors as being within the scope of this invention.

The activity of this combination is exemplified in Figures lA-C, 2 and 3A, B as follows. Figure IA-C demonstrate that the N87 cells overexpress the gp185 erbB-2 protein as a result of erbB-2 gene amplification. Figure 2 shows that a combination of Ab#21 and Ab#23 inhibits the growth of N87 cells in vitro. Similar results have been demonstrated using the combination of Ab#23 and Ab#94 as well as Ab#23 and Ab#21, on the growth of human Calu-3 lung adenocarcinoma (See Figures 5 and Figure 3A and B show the activity of combinations of Ab#21 and Ab#23 inhibiting and reversing the growth of N87 cells growing as tumors in immunodeficient mice. These results indicate the general nature of the application of combinations of antibodies.

The antibodies against the erbB2 gene encoded product used in this invention can be designed as chimeric PCT/US 92/08545 RO/US 21 OCT 1992 antibodies. Chimeric antibodies have variable regions (antigen binding regions) of nonhuman murine) origin and constant regions of human origin. Because they are predominantly human, chimeric antibodies are less immunogenic in humans, which can help overcome problems associated with administering foreign proteins to humans.

In addition, the antibodies of the present invention may be produced through genetic recombination or the Kohler-Milstein hybridoma method for production of antibodies. It is also recognized that fragments, analogues or derivatives of the antibodies themselves can be utilized in this invention in place of the entire antibody.

Another object of the present invention provides for antibodies against erbB-2 gene encoded product which are designed as single chain antibodies. A single chain antibody it one in which the light and heavy variable regions of the antibody are linked together to form a single chain antibody. It is contemplated in this application that a combination of these antibodies include antibodies which are combined as an admixture as discussed above and antibodies which are combined to form a bispecific antibody.

A bispecific antibody is an artificially produced antibody usually comprised of two single chain antibodies each of which is recognizes a different antigen binding site.

The following are examples of some of the human malignancies which may be treated or prevented using the present invention; adenocarcinonas of the breast, ovary, lung and stomach.

Another embodiment of applicants' invention provides a method for preventing and eradicating the human malignancies described above. The method involves administering to a patient an effective dose of a combination of anti-erbB-2 PCT/US 92/08545 RO/US 21 OCT 1992 antibodies to achieve an effective concentration of tha antibody combination at the tumor site; for example, a concentration of at least lpg/ml. Preferably the concentration at the tumor site does not exceed about lOpg/ml. In general, in order to achieve the desired concentration of the combination at the tumor site the combination is administered in a dose from about .1 mg/kg to about 10 mg/kg of body weight.

Another embodiment of Applicants' invention provides for the antibody combination to be used in passive tumor therapy, wherein an effective dose of the antibody combination is administered in or with a pharmaceutically acceptable vehicle to a patient afflicted with a human erbaB-2 malignancy overexpressing gp 1 85 erbB2 Examples of vehicles are non-toxic buffers, physiological saline, etc.

Applicants' invention also provides for at least one of the antibodies of the antibody combination to be used as a component of an immunotoxin. For immunotoxin therapy, at least one antibody of the combination can be linked to an anti-cancer pharmaceutical or a cytotoxin to form an immunotoxin. Various pharmaceutical or cytotoxic agents can be chemically or genetically co' 'led to the combination.

Examples of some useful therapeutic agents include: radioactive compounds isotopes of Boron and Rhenium); agents which bind DNA, such as alkylating agents or various antibodies daunomysin, adriamycin, chlorambucil); antl-metabolites methotrexate); and inhibitors of protein synthesis diphtheria toxin and toxic plant proteins). The use of the combination, wherein at least one of the antibodies in the combination is coupled to an immunotoxin will increase the efficacy of the therapy.

Administration to a npcent of an effective dose of the combination of antibodies described herein may be PCT/US 92/08545 RO /US 2 1 OCT 1992 accomplished via chronic intraveneous administration for a period of time sufficient to result in the regression or eradication of the human malignancy being treated.

Administration of the combination may also be accomplished in a patient by direct injection or delivery of the combination to the tumor site. Such administration would be of sufficient duration and concentration to result in eradication or reduction of the tumor.

Although the scope of the present invention is not intended to be limited to any theoretical reasoning, the following theories may explain a mechanism by which down regulation and protection from human malignant cells overexpressing gplS 5 erbB 2 is achieved by the two antibody combination.

One mechanism which has been postulated is that the two antibody combination acts by constraining gp 185 erbB2 into an activated conformation thus mimicking an agonist ligand.

If the two antibody combination mimics the ligand, then treatment using the combination should result in increased gp 185 erbB-2 autophosphorylation. Anti-phosphotyrosine immunoblots were used to test this hypothesis. As shown in Figure 4B, no increase in tyrosine phosphorylation of gp 185 erbB-2 from N87 cells was observed 1 or 2 hours after the addition of the antibody combination or up to 24 h of treatment. This suggests that the antibody combination does not increase the autophosphorylation of gp 185 erb

B

-2 and therefore does not act to inhibit the a-tivity of the tyrosine kinase.

The results demonstrate that a combination of anti-receptor antibodies leads to different and more potent anti-tumor activities than single antibodies. More specifically, results indicate that the combination antibody therapy is a useful approach to treatment of human PCT/US 92/08545 R 0/ US 2 1 OCT 1992.

malignancies overexpressing gpl 85 erbB. This approach may be particularly important in the treatment of gastric cancer, a disease which responds poorly to current systemic chemotherapies.

The present invention is further illustrated by the following Examples which are not intended to limit the scope of the invention.

EXAMPLE 1 Preparation of Antibodies As a source of human erbB-2 protein we used a NIH/3T3 cell engineered to express the human erbB-2 protein on its surface (N/erbB-2). Membrane preparations of these cells were prepared by hypotonic lysis in 2mM Hepes pH 7.4, removal of nuclei by centrifugation at 5,000 x g and isolation of membranes by centrifugation at 100,000 x g.

Mice were immunized with 100gg of N/erbB-2 membrane preparation in a 50:50 mix of adjuvant in 200pl. Adju,'ant was Freund's complete for the first injection followed by Freund's incomplete adjuvant. Mice were given 4 intraperitoneal injections over 4 weeks. One week following the last boost sera was obtained and an anti-erbB-2 immune response was determined to exist by immunoprecipition analysis of gpl85 erbB-2 protein from metabolically labeled cells. An immune mouse was then selected and boosted with of N/erbB-2 membrane preparation and fusion with Ag8.653 myelomea cells conducted according to standard methods. Selection of hybrid clones was by resistence to hypoxanthine, aminopterin, and thymine (HAT) containing media again according to standard methods. Identification of hybridomas secreting an anti-erbB-2 monoclonal antibody was by ELISA using as antigen N/erbB-2 membrane protein attached to 96 well dishes. ELISA reaction was developed -11- PCT/US 92/08545 RO/US 21 OCT 1992 using peroxidase coupled goat anti-mouse antibody and standard methods. Hybridoma cultures secreting an anti-erbB-2 antibody were subjected to two rounds of single cell cloning and identification of positive subclones by ELISA as described above.

The above procedure is used to produce three monoclonal antibodies designated as Ab#21; Ab#23; and Ab#94.

Monoclonal antibodies directed against the extracellular domain of gp85 erbB 2 were tested for specific reaction to N/erbB-2 cell membranes in an ELISA assay. Two of these designated Ab#21 and Ab#23 after screening in growth assays exhibited the highest biological activity and were used in this study. Antibodies were isolated in large amounts from ascites fluid and purified by HPLC with a Gammabind Ultra column (Genex, Gaithersburg, MD). Standard SDS-PAGE gel electrophoresis was run under non-reducing conditions using Coomassie blue staining with a single band of 130 kd observed indicating a >98% purified preparation (data not shown).

Both antibodies specifically immunoprecipitated a single 35 S-labeled protein of MW 185,000 from SK-Br-3 cells (a breast cancer cell line which overexpresses gp 1 85 erB-2 protein) (22) as shown in Figure 1A. No immunoprecipitation was detected in cells which do not overexpress the gp 185 erbB- 2 protein MDA-MB-468, data not shown).

The effect of these antibodies on cell proliferation wea studied on a gastric cell line, N87, which overexpresses gp 1 85 erbB-2 at levels commensurate with SK-Br-3. An immunoblot of the N87 cell line and a nude mouse tumor xenograft from N87 is shown in Figure 1B compared to the erbl-2 breast cell lines SK-Br-3 (high level of gp 85 rbB 2 overexpression) and MDA-MB-231 (low level of gp 185 erbB overexpression) The levels of erbB-2 gene amplification in -12- PCT/US 92/08545 RO US 2 1 OCT 1992 N87 as shown in Figure 1C surpassed those found in the well characterized SK-Br-3 and SK-OV-3 cell lines (22).

EXAMPLE 2 Effect of Antibodies on Tumor Growth In Vitro The effect of these antibodies on growth was first studied in vitro using a semiautomated colorimetric MTT assay. A single cell suspension of 10,000 cells/well was plated in a chemically defined media consisting of RPMI-1640 supplemented with insulin, human transferrin, 17 -estradiol, sodium selemite and Hepes buffer. PBS, Ab#21, Ab#23 or a combination of Ab#21 and Ab#23 were then added. The cells were allowed to grow at 37°C in a 5% CO 2 humidified atomospheri. After 7 days, 3- dimethylthiazol-2-y)-2,5-diphenyl tetrazolium bromide (MTT reagent) was added and allowed to incubate for 4 hours at 37 0 C, 90% of the media was then removed and the crystals solubilized in DMSO. Optical densities were measured at 540 nm in a molecular devices Vmax kinetic microplate reader. A dose response analysis of the effects of the antibodies on N87 cell proliferation is shown in Figure 2. Antibodies Ab#21 or Ab#23 administered individually had no effect on the monolayer growth of cells up to a concentration of pg/ml (6 gM). Administration of a 1:1 combination of Ab#21 and Ab#23, however, markedly affected cell proliferation at doses as low as 1 pg/ml. Fab fragments prepared from both antibodies also had no effect on cell growth alone or in combination (data not shown). In analogous experiments with three other gastric cell lines displaying little or no overexpression by immunoblot analysis, no inhibition of growth even at the highest dose was observed with the antibody combination or the antibodies alone.

-13- POT/US 92/08545 RO/US 210OCT 1992 EXAMPLE 3 Preventive Combinati on Antibody Therapy The efficacy of combination antibody therapy was tested on the growth of N87 tumor xenografts. One inoculation of five million N87 cells were injected subcutaneous ly into nude mice produce rapidly growing tumors. with a short latency. Tumor growth at the injection site was easily quantitated. As shown in Figure 3A, the N87 cells did not form tumors in the animals treated twice a week for three weeks with a total of 200 pg of antibodies .per injection with the combination of Ab#21 and Ab#23. In sharp contrast they were potently tumorigenic in animals treated with the single antibodies or PBS and the tumor grew to over 1 cm 3 in tumor volume over the period measured. In contrast to in vitro experimcnts, each monoclonal antibody alone may have limited activity to partially restrict the rate of tumor growth. However, the activity exhibited by the combination far exceeded the cumulative effect expected from the combination.

To determine if the combined therapy with Ab#21 and Ab*23 was able to eradicate established tumors, an experiment was performed in which tumors were allowed to grow to measurable sizes prior to antibody treatment, The results are illustrated in Figure 3B. In animal groups randomized so that the starting size of 'the tumors was near the same volume (100 mm 3 the tumors continued to grow when the animals were given single antibody treatment of Ab#21 or Ab#23 (200 pg/injection, 2 injection/week, 3 weeks, 6 mice).

In contrast, in the animals given two antibody combination treatment of Ab#21 and Ab#23, results shown are the average of 6 animals, tumors completely regressed after 11 days (4 treatments of 200 pg of total antibody) This is the first reported observation of tumor xenograft regression induced -14- PCT/US 92/0 8 5 4 RO/US 21 OCT 1992 by a combination of anti-erbB-2 monoclonal antibodies.

Previous studies have shown that two anti-neu antibodies can inhibit the growth of tumors by murine cells transformed by the mutationally activated neu oncogene The activation of the murine neu oncogene is accomplished by point mutation as evidenced by qualitative interference in the structure and function of the neu gene, whereas the human erbB-2 oncogene is activated by overexpression of erbB-2, a quantitative interference of the apparently normal protein which results in tumor formation.

Since the mechanisms for tumor growth are so different between murine and human, it is totally unexpected that similar mechanisms of neutralization of the genes involved would be effective. This effect is also seen with the inhibition of leukemic tumor cell growth using anti-transferrin monoclonal antibodies (24).

EXAMPLE 4 Antiproliferative Effects of Antibody Combination To investigate the molecular basis for the antiproliferative effects of Ab#21 and Ab#23, we measured the rate of gp 185 erbB- 2 turnover in the presence or absence 35 of antibodies. N87 cells were pulse-labeled with S-Cys and then chased for various times in the presence of single antibody or the Ab#21/#23 combination. The results of a 24 h chase are shown in Figure 4A. The antibody gp185 erbB 2 combination induced rapid degradation of gpl 8 5 erbB-2 while the individual antibody treatment had little or no effect. Thus, the antiproliferative effect of Ab#21/Ab#23 treatment might likely be explained by their erbB-2 ability to increase the turnover of gp1 8 EXAMPLE PCT/US 92/08545 RO/US 21 OCT 1992 Combination Antibody Treatment Effects the Growth of Calu-3 Cells In order to demonstrate that the effect of combination of anti-erbB-2 antibodies Ab #21 and Ab #23 is not limited to effect on the N87 gastric cancer cell line, we investigated the human lung adenocarcinoma cell line Calu-3.

This cell overexpresses the gp185 erbB-2 protein as determined by immunoblot analysis (data not shown). In experiments very similar to that described above, the combination of Ab #21 and Ab #23 show dramatic inhibition of cell growth as measured in an MTT assay (figure In this experiment, a single cell suspension of 10,000 cells/well was plated in a chemically defined media consisting of RPMI-1640 supplemented with insulin, human transferrin, 17estradiol. sodium selenite, and Hepes buffer. PBS, Ab#21, Ab#23 or a combination of Ab#21 and Ab#23 were then added.

The cells were allowed to grow at 37°C in a 5% CO 2 humidified atmosphere. After 7 days, MTT reagent was added and allowed to incubate for 4 hours at 37 0 C. 90% of the media was then removed and the crystals solubilized in DMSO.

Optical densities were measured at 540 nm in a Molecular Devices Vmax kinetic microplate reader. A dose response analysis of the effects of antibody treatment is shown in figure 5. This result indicates that combination antibody therapy is not limited in effectiveness to N87 cells or gastric cancer cells. It also indicates that combination antibody therapy may have effectiveness in the treatment oi adenocarcinoma of the lung.

EXAMPLE 6 Effectiveness of Other Combinations of Antibodies in Inhibiting Cell Growth -16- In order to determine if Ab#21 and Ab#23 are unique in their ability to combine to cause growth inhibition, we investigated the combination of Ab#94 and Ab#23 on the growth of Calu-3 cells in vita. An MTT assay of cell growth was conducted as described in EXAMPLE 5. As shown in figure 6, the combination of antibodies inhibits cell growth and the individual antibodies do not. This indicates that the ability to combine antibodies to produce a more profound growth inhibition is not limited to a particular antibody combination.

Antibodies #21 and Ab#23 have been deposited at the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md. 20852, USA. Ab#21 was deposited on 4 April, 1994 and given ATCC #HB11601. Ab#23 was deposited on 4 April, 1994 and given ATCC #HB11602.

While the present invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art in view of the foregoing description. Accordingly, the invention is intended to embrace all such alternatives, modifications and variations in following within the broadest scope and spirit of the following claims.

Example 7 Generation of a single chain (Fv) from mAb e23 Poly A RNA was extracted from hybridoma cells using oligo dT affinity chromatography (In vitrogen). cDNA was prepared using random primer (Ns) (Boerhinger Mannheim). The immunoglobulin light and heavy chain clones were isolated using PCR and the primers: light chain, 5' CAC GTC GAC ATT r: CAG CTG ACC CAC TCT CCA and GAT GGA TCC AGT TGG TGC AGC ATC3'; heavy chain 5'C GGA ATT TCA GGT TCT GCA GIA GTC R 17

SEC

104 *iI *o POT/US 92/08545 RO/US 210OCr 1992 WGG3' and S' AGC GOA TCC AGO GGC CAG TGG ATA GAC3' AC, T stand for standard nucleotides; I for inosine, W for A or TI. The products of the PCR reaction wre cloned into PUC18.

Linkage into a SC(Fv) was by PCR giving the individual light and heavy cDNA clones and 4 oligonucleotides S' cgagatgagtccagctgacccagtctc gaagatttaccagaaccagaggtagaaccttttatttccagcttgga ctggttctggtaaatcttctgaaggtaaaggtgtgcagctgcagga' cgagtgcaagcttaggagacggtgaccgt.

The light and heavy chain coding regions were joined by a synthetic linker GSTSGSGKSSEGKG specified by overlapping oligonucleotides as described. The intact scFv coding region was inserted in frame with an E.coli OMPA leader sequence under direction of the lambda P L promoter.

Induction of protein and bacterial lysis and refolding was as previuosly described sc~v was purified as a single peak from CM chromatography and judged to be >70% by SDS gel electrophoresis.

Examp~le 8 Generation of a scFv from mAb e21 Poly A RNA was extracted from hybridoma cells using oligo dT affinity chromatography (In vitrogen). cDNA was prepared using random primer (Boerhinger Mannheim).

The inizunoglobulin light and heavy chain clones were isolated using PCR and the primers: light Chain, 5' CAC OTC GAC ATT CAG CTG ACC CAC TCT CCA and GAT GOA TCC AGT TGG TGC AGC ATC3'; heavy chain 5'C OA ATT TCA GOT TCT GCA GIA GTC W003' and 5' AGC OA TCC AGO GGC CAG TGG ATA GAC3' (G,A,C,T stand for stakadard nucleotides; I for inosine, W for A or The products of the PCR reaction wre cloned into PUC18.

Linkage into a scFv was by PCR giving the individual light and heavy cDNA clones and 4 oligonucleotides S' cgagatgagtccagctgacccagtctc -IspCTlUS 92108545 RO/US 2 1O0CT 1992 S' gaagatttaccagaaccagaggtagaaccttttatttccagcttgga ctggttctggtaaatcttctgaaggtaaaggtgtgcagctgcaggag cgagtgcaagcttaggagacggtgaccgt.

The light and heavy chain coding regions were joined by a synthetic linker GSTSGSCKSSEGKG specified by overlapping oligonucleotides as described. The intact scFv coding region was inserted in frame with an E.coli OMPA leader under direction of the lambda PL promoter.

_r -,tion of protein and bacterial lysis and refolding was do previuosly described scFv was purified as a single peak from- CM chromatography and judged to be by SDS gel elect2ropLoresis.

19- PCT/US 92/0854 RO/US 2 1 CT 1992

REFERENCES

1. C.R. King, M.H, Kraus, S.A. Aaronson, Science 229, 974 (1985).

2. D.J. Slamon, et al., Science 235, 177 (1987).

3. D.J. Slamon, et al., Science 244, 707 (1989).

4. J. Yokota, et al., Lancet 1, 765 (1986).

C.R. King, et al., Cancer Res. 49, 4185 (1989).

6. P.M. Schneider, et al., Cancer Res. 49, 4968 (1989).

7. J. Park, et al., Cancer Res. 49, 6605 (1989).

8. C. Wright, et al., Cancex- Res. 49: 2087 (1989).

9. A.K. Tandon, et al., J. Clin. Oncol. 7, 1120 (1989).

S. Paik, et al., J. Clin. Oncol. 8, 103 (1990).

11. A. Borg, et al., Cancer Res. 50, 4332 (1990).

12. A. Berchuck, et al., Cancer Res, 50, 4087 (1990).

13. Y. Yonemura, et al., Cancer Res. 51, 1034 (1991).

14. J.A. Kern, et al., Cancer Res. 50, 5184 (1990).

P.P. Di Fiore, et al., Science 237, 178 (1986).

16. R.M. Hudziak, J. Schlessinger, A. Ullrich, Pro. Natl.

Acad. Sci. U.S.A. 84, 7159 (1987).

17. Pierce, et al., oncogene, in press.

18. Y. Yarden, A. Ullrich, Biochem. 27, 3114 (19.88).

19. J. Schlessinger, Biocham. 27, 3119 (1988).

R.M. Hudziak, et al., Mol. Cell. Biol. 9, 1165 (1989).

21. C.R. Divgi, et al., JNCI 83, 97 (1991).

22. M. H. Kraus, N. C. Popescu, S. C. Amsbaugh, C. R. King, EMBO J. 6, 605 (1987).

23. J.A. Drebin, V.C. Link, M.I. Greene, Oncogene 2, 273 (1988).

24. S. White, et al., Cancer Res. 50, 6295 (1990).

R. Kumar, H.M. Shepard, J. Mendelsohn, Mol. Cell.

Biol. 11, 979 (1991).

PCTUS 9 gO/US 2/08545 0 C 1992 26.

27.

28.

C.R. King, et al., Cancer Res. 49,4185 (1989).

M.C. Hancock, et al., Cancer Res. 51,4575-4580 (1991).

M.W. Pantaliano, et al., Biochemistry 30, 117-125 (1991).

-21-

Claims (14)

1. A combination of at least two different antibodies which are directed against the erbB-2 gene product, wherein at least two of the antibodies recognize a different epitope of the erbB-2 gene product and wherein the antibody combination provides for greater antitumor activity than would be "xpected for the sum of the individual antibodies at the same overall antibody concentration.

2. A combination of at least two different antibodies which are directed against the erbB-2 gene product, wherein at least two of these antibodies recognize a different epitope of the erbB-2 gene product and wherein the antibody combination provides for a greater decrease of the expression of the erbB-2 gene product than would be expected for the sum of the individual antibodies at the same overall antibody combination.

3. The antibody combination of claim 1, wherein said antibodies comprise monoclonal antibodies.

4. The antibody combination of claim 2, wherein said antibodies comprise monoclonal antibodies. The antibody combination of claim 3, wherein at least one of said monoclonal antibodies is linked to an toxin molecule.

6. The antibody combination of claim 4, wherein at least one of said monoclonal antibodies is linked to an toxin molecule. ansUOwa= -I

7. The antibody combination of claim 1, wherein at least one of said antibodies comprises a single chain antibody.

8. The antibody con.bination of claim 2, wherein at least one of said antibodies comprises a single chain antibody.

9. The antibody combination of claim 7, or claim 8 wherein said single chain antibody is e21 or e23. A combination of at least two different monoclonal antibodies which are directed against the erbB-2 gene product, wherein said antibody combination comprises at least one monoclonal antibody selected from Ab#21, Ab#23 and Ab#94. :11. The monoclonal antibody combination of claim 10 wherein the antibody combination comprises Ab#21 and Ab#23 or Ab#23 and Ab#94.

12. The antibody combination of claim 1 wherein said antibodies comprise a single chain antibody. 4* -13. Tho single chain antibdy -eeim-1-2-wheh is e21er-e28. 4. 4 A pharmaceutical composition for treating or preventing human tumors associated by malignant cells which overexpress the erbB-2 gene product which comprises: an effective amount of at least two different antibodies which are directed against the erbB-2 gene product, wherein at least two nf said 23 4% J PT/US92/08 5 4 SIPEAMS 0 OCT 1993 -23 antibodies recognize different epitopes of the erbB-2 gene product, wherein the antibody combination provides for greater antitumor activity than would be expected for the sum of the individual antibodies at the same overall antibody concentration; and (ii) a pharmaceutically acceptable carrier. SThe pharmaceutical composition of claim 14, wherein said antibodies comprise monoclonal antibodies. The pharmaceutical wherein at least one of said a toxin molecule. ii. The pharmaceutical wherein at least one of said chain antibody. SThe pharmaceutical wherein at least one of said Ab#23 or Ab#94. y. The pharmaceutical composition of claim antibodies is linked to composition of claim 14, antibodies is a single composition of claim antibodies is Ab#21, composition of claim 17 wherein said single chain antibody is e21 or e23. A method of treating or preventing human malignancies characterized by the overexpression of the erbB-2 gene product comprising ,'Iministering to a patient having a malignancy characterized by overexpression of the erbB-2 gene product an effective amount of at least two different antibodies which recognize different epitopes of the erbB-2 gene product and which antibodies exhibit greater S ".l;i ;r 11 j ~f4i I d :ilB pa ~rl i SJBS1TManteplS r B t8;1EEFI P OT/U8 92/085 4 SPE S 0 OCT 1 993 2 antitumor activity than would be expected for the sum of the individual antibodies at the same overall antibody concentration. The method of claim 20, wherein said antibodies comprise at least one monoclonal antibody selected from the group consisting of Ab#21, Ab#23 and Ab#94. The method of claim 20, wherein said two different antibodies are Ab#21 and Ab#23 or Ab#23 and Ab#94.

22- The method of claim 20, wherein at least one of said antibodies is linked to an toxin molecule. The method of claim 20, wherein at least one of said antibodies is a single chain antibody. 2. The method of claim 24, wherein said single chain antibody is e21 or e23.

26. A DM-sequence which prov-ides-for expression of a single chain antibody w4 l 7 reee".se--o the-er-bB- 2 gene -pr-duet,.

27. The DNA sequence of claim which encodes for a polypeptide having the ami acid sequence set forth in Figure 7 or Figure 8

28. A transformed h cell which provides for the expression of theD A sequence of claim 26 or 27.

29. The tran ormed host cell of claim 28 wherein said h cell comprises E. coli. ethod for producing a single chain antibod which recognizes the erbB-2 gene product comp ising culturing the transformed host cell of -a p oduee- a singe-ehai-n-antibody- i. SUSSTITUTE SHEET