WO1993006859A1 - Sperm surface protein - Google Patents

Sperm surface protein Download PDF

Info

Publication number
WO1993006859A1
WO1993006859A1 PCT/US1992/008457 US9208457W WO9306859A1 WO 1993006859 A1 WO1993006859 A1 WO 1993006859A1 US 9208457 W US9208457 W US 9208457W WO 9306859 A1 WO9306859 A1 WO 9306859A1
Authority
WO
WIPO (PCT)
Prior art keywords
tcte
protein
sperm
subject
nucleic acid
Prior art date
Application number
PCT/US1992/008457
Other languages
English (en)
French (fr)
Inventor
Lee M. Silver
Jen-Yue Tsai
Original Assignee
The Trustees Of Princeton University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Trustees Of Princeton University filed Critical The Trustees Of Princeton University
Priority to EP92921970A priority Critical patent/EP0608334A4/en
Priority to JP5507112A priority patent/JPH07502886A/ja
Publication of WO1993006859A1 publication Critical patent/WO1993006859A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/02—Animal zootechnically ameliorated
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies

Definitions

  • the present invention relates to a protein, termed t-complex associated testes expressed-1 (tcte- 1) , that is found on the surface of mature sperm and is responsible for the binding of sperm to egg during mammalian fertilization. It is based, at least in part, on the cloning and characterization of human and mouse cDNAs that encode tcte-1 protein.
  • the process of fertilization comprises a number of steps which occur in a compulsory order (Wassarman, 1987, Science 235:553-560) . These steps, performed in the proper sequence, provide for species specific recognition between an egg and a single sperm, thereby avoiding the pitfalls of interspecies hybrids and polyploidy.
  • the first step toward fertilization occurs when free swimming sperm form a relatively loose, nonspecific association with an ovulated egg at the surface of the egg's thick extracellular coat, called the zona pellucida.
  • binding is mediated by receptors present in the zona pellucida which interact with complementary egg-binding proteins present in sperm plasma membrane.
  • a sperm After binding to the egg, a sperm releases a number of enzymes that enable it to tunnel through the zona pellucida to reach the plasma membrane of the egg.
  • enzymes which include proteinases, glycosidases, phosphatases, arylsulfatases, and phospholipases, are stored in a membrane-bound, lysosome-like organelle called the acrosome that occupies the anterior region of the sperm head.
  • the release of enzymes called the acrosome reaction, involves fusion of the outer acrosomal membrane and sperm plasma membrane at many sites, and results in the release of small, hybrid vesicles from the anterior region of the sperm head.
  • Acrosome-reacted sperm are then able to penetrat the zona pellucida, burrowing at a rate of about one micrometer per minute and creating a tunnel little wider than the sperm head.
  • sperm Once a sperm reaches the space between the zona pellucida and the egg plasma membrane, it is able to fuse with the egg, thereby achieving fertilization.sperm that subsequently reach the egg plasma membrane are prevented from fusing with the egg by rapid depolarization of the egg membrane. Fertilization by additional sperm ("polyspermy") is further avoided by changes in the zona pellucida which render it impenetrable to bound sperm and prevent other sperm from binding. These changes in the zona pellucida, generally referred to as the zona reaction, are effected by the release of enzymes from cortical granules located just beneath the egg plasma membrane in a process called the cortical reaction.
  • a number of mammalian sperm surface proteins are currently being considered as possible analogs of bindin in the egg-binding process. These include the following:
  • PH-20 is an approximately 60,000 dalton guinea pig sperm membrane protein which appears to exist in two distinct populations (Carron and Saling, in "Elements of Mammalian Fertilization", Volume II, Wassarman, ed. , CRC Press, Boston, pp. 147-176). In cauda epididymal sperm, PH-20 expression was found to be confined to the surface of the post-acrosomal segment and the luminal surface of the inner acrosomal membrane (Phelps and Myles, 1987, Dev. Biol. 123:63) .
  • Fertilization Antigen 1 is a sperm specific glycoprotein that has been found in both human and mouse germ cells that was defined, originally, by the MA24 monoclonal antibody (Carron and Saling, in "Elements of Mammalian Fertilization,” Volume II, assarman, ed., CRC Press, Boston, pp. 147- 176; Naz et al. , 1984, Science 225:342) .
  • the MA24 monoclonal antibody was found to recognize a 23,000 dalton monomer which may dimerize to a 46,000 dalton form and to localize at the post-acrosomal region of the sperm head and at the midpiece and principal piece of the tail (Id.).
  • MA24 was observed to inhibit human sperm penetration of zona pellucida-free hamster eggs as well as mouse sperm penetration through mouse zona pellucida (Id.).
  • the M42 antigen is a high molecular weight (approximately 220,000 dalton) protein localized at the acrosomal crest of mouse sperm (Carron and Saling, in "Elements of Mammalian Fertilization,” Volume II, Wassarman, ed. , CRC Press, Boston, pp. 147-176; Saling and Lakoski, 1985, Biol. Reprod. 12:527). M42 monoclonal antibody appears to inhibit induction of the acrosome reaction without interfering with sperm binding to or penetration through the zona pellucida (Saling, 1986, Dev. Biol. 13_2:174).
  • PH-30 monoclonal antibody was found to bind to a target antigen localized in the post-acrosomal region of guinea pig sperm and to inhibit the fertilization of zona pellucida-free guinea pig eggs in a concentration dependent manner.
  • PH-30 antibody appears to bind to two polypeptides having molecular weights of 60,000 and 44,000 daltons (Carron and Saling, in "Elements of Mammalian Fertilization,” Volume II, Wassarman, ed. , CRC Press, Boston, pp. 147- 176; Primakoff and Myles, 1983, Dev. Biol. 98:417; Primakoff et al., 1987, J. Cell. Biol. 104:141) .
  • M29 monoclonal antibody has been found to bind to a target antigen having a molecular weight of about 40,000-60,000 daltons localized in the equatorial segment of the mouse sperm head; M29 antibody cross reacts with sperm of various species (Carron and Saling, in "Elements of Mammalian Fertilization,” Volume II, Wassarman, ed. , CRC Press, Boston, pp. 147- 176; Saling et al., 1985, Biol. Reprod. .33:515; Saling, 1986, Dev. Biol. 117:511-519) .
  • YWK II has been identified in human sperm by immunoaffinity chromatography using the corresponding YWK II monoclonal antibody (Carron and Saling, in "Elements of Mammalian Fertilization,” Volume II, Wassarman, ed. , CRC Press, Boston, pp. 147-176; Yan et al., 1987, Arch. Androl. 18.:245).
  • the YWK II antigen appears to have a molecular weight of 60,000 and/or 72,000 dalton and may be related to lactoferrin (Id.).
  • APz a boar sperm plasma membrane integral protein, has been observed to be involved in the adhesion of sperm to eggs via the porcine equivalent of ZP3 (Peterson and Hunt, 1989, Gamete Res. 23:103; Peterson and Hunt, 1989, J. Cell Biol. 109:125a abstract no. 673) .
  • IMMUNOCONTRACEPTION The immune systems of both males and females recognize sperm as foreign (Carron and Saling, in "Elements of Mammalian Fertilization,” Volume II, Wassarman, ed. , CRC Press, Boston, pp. 147-176) . Therefore, sperm components that participate in the fertilization process may serve as immunologic targets in methods of contraception (Naz, 1990, Curr. Opinion Immunol. 2.:748-75l; Primakoff et al. , 1988, Nature 335:543-546; Isojima, 1990, Curr. Opinion Immunol.
  • An antibody-mediated immune response to sperm could interfere with fertilization at any one of a number of sites because the immune system potentially gains access to sperm in a variety of locations in both the male and female genital tracts (Id.).
  • sperm could be eliminated from the functional population via nonspecific mechanisms such as agglutination or immobilization (Id.).
  • a specific cellular event that is part of the fertilization process could be prevented (Id.).
  • Guinea pig antigen PH-20, FA-1 antigen of mouse and human germ cells, and LDH-C4, a sperm specific mitochondrial antigen found on the sperm surface represent three antigens that are known targets of neutralizing antibodies as demonstrated by inhibition of fertilization in vitro and induction of infertility in active immunization protocols (Id. and Goldberg et al., 1981, in "Human Reproduction", Sem and Mettler, eds., Elsevier-North Holland, Amsterdam, p. 360; Shelton et al., 1983, J. Reprod. Immunol. Suppl. 2:26; Shelton and Goldberg, 1986, Biol. Reprod. 15:873) .
  • the T-COMPLEX AND TESTIS-SPECIFIC GENES The t complex, a cluster of genes located on the proximal third of mouse chromosome 17, is associated with embryonic development and fertility, and expresses phenotypes that are caused either by single gene mutations or through complex interactions of multiple loci.
  • homozygosity for a single t-lethal gene results in the arrest of the developing embryo at a specific stage, while mutations in multiple loci cause transmission ratio distortion in heterozygous t haplotype-bearing males(t/+) or sterility in males that are doubly heterozygous for t haplotypes (t x /t y ) (Klein, 1986, in "Natural History of the Major Histocompatibility Complex,” John Wiley & Sons, New York; Silver, 1985, Ann. Rev. Genet. 19:179- 208, and see infra) .
  • spermatogonia the stem cells that form sperm, give rise to undifferentiated spermatogenic cells called spermatocytes. Each spermatocyte undergoes two meiotic divisions to generate four haploid sperms. The haploid sperms then differentiate into mature sperm. This entire process, called spermatogenesis, takes place in the seminiferous tubules of the testis.
  • spermatogenesis takes place in the seminiferous tubules of the testis.
  • a number of genes associated with the t-complex or that otherwise map to chromosome 17 have been shown to exert significant effects -on murine spermatogenesis. They are categorized here according to the phenotypes they exhibit.
  • TRD transmission ratio distortion
  • the third type of gene affecting spermatogenesis was discovered through interspecies hybrids, i.e., by breeding certain strains of Mus musculus and Mus domesticus. Mus laboratorius (mixed strains between Mus musculus and Mus domesticus) and Mus spretus. and t-haplotype-bearing Mus laboratorius and Mus spretus. These loci are called hybrid sterility (Hst) loci, because they result in sterility in the Fl male of these crosses. To date, at least two Hst genes are mapped in the t complex (Forejt and Ivanyi, 1975. Genet. Res. 2.4:189-206) .
  • This class of genes like those genes involved in TRD, manifest their effects only when the animal is either heterozygous for a locus or homozygous for that locus in the context of a different genetic background.
  • the last two types of genes expressed during spermatogenesis are quaking (qk) (Bennett et al. , 1971, Biol. Reprod. 5_:30-58), which is a simple recessive unifactorial mutation, and phosphoglycerate kinase 2 (Pgk-2 ) (Kramer and Erickson, 1981, Dev. Biol. 22:37-45) , which is expressed in the stage of spermatogenesis known as the round sperm.
  • qk quaking
  • Pgk-2 phosphoglycerate kinase 2
  • Northern blot hybridization confirmed the testis-specific expression of transcripts corresponding to 15 of these clones.
  • pNS2 was found to contain a portion of a larger gene, D17Sill. Sequence analysis of this gene demonstrated (i) complementary sets of alternating purine and pyrimidine residues within the corresponding RNA transcript that could form double-stranded, hairpin ⁇ like secondary structures; and (ii) a hypothetical long open reading frame complementary to the testis transcripts that appeared to be three times the size of the longest potential open reading frame present in - li ⁇
  • testis transcript itself.
  • the testis transcript based on sequence analysis, was estimated to encode a polypeptide that was at most 187 amino acid residues in length (corresponding to a molecular weight of about 21,000 daltons). It was later found (Sarvetnick et al., 1990, Immunogenetics 21:283-284) that the transcript in fact contained an open reading frame encoding 506 amino acids (corresponding to a molecular weight of 57,000); the underestimate in the earlier publication was due to sequencing errors.
  • the present invention relates to a protein, termed t-complex associated testes expressed-1 (tcte- 1) , that is found on the surface of mature sperm and is responsible for the binding of sperm to egg during mammalian fertilization. It is based, at least in part, on the cloning and characterization of human and mouse cDNAs that encode tcte-1 protein.
  • the present invention provides for substantially purified nucleic acid sequences encoding tcte-1, including human TCTE-1 sequence.
  • Such nucleic acid sequences may be linked to a promoter sequence or to at least a portion of a second gene and may be comprised in a nucleic acid vector or may exist as a transgene in a transgenic animal.
  • the present invention further provides for substantially purified tcte-1 protein, including human TCTE-1 protein, as well as for immunogenic fragments and derivatives thereof.
  • the present invention provides for vaccines comprising a tcte-1 protein, or an immunogenic fragment or derivative thereof.
  • the present invention provides for vaccines comprising a nonpathogenic virus which carries a gene that encodes a tcte-1 protein or an immunogenic fragment thereof.
  • the present invention further provides for a method of contraception comprising administering to a subject in need of such treatment an immunogenic formulation comprising (i) a tcte-l protein or a fragment or derivative thereof or (ii) a virus that carries a gene encoding tcte-1 or an immunogenic fragment thereof.
  • the present invention also provides for antibodies, including monoclonal antibodies, directed toward tcte-1, and for methods of contraception comprising administering an effective amount of such antibodies to a subject.
  • the present invention further provides for methods of identifying and/or diagnosing infertility that comprise detecting an abnormality in the expression and/or function of a tcte-l protein, and for kits that may be used in such methods.
  • the present invention provides for methods of treating infertility that comprise correcting an abnormality in the expression and/or function of a tcte-l protein.
  • FIGURE 1 Restriction maps of Tcte-1 and TCTE-1 genomic clones.
  • the mouse Tcte-1 locus was cloned in two overlapping cosmids from a t wLubl /t w5 mouse cosmid library (A) .
  • the human TCTE-1 locus was cloned in two overlapping phage clones from a human genomic library (B) .
  • the filled boxes represent regions that hybridize to cDNA, but exact junctions of the introns and exons have not been determined.
  • the locations of restriction sites observed with the enzymes EcoRI, Ba Hl, Xhol, Sail, Clal, HindlU and Xbal are indicated by the symbols shown in the rectangle on the bottom.
  • the expanded regions were further analyzed with the rare cutting restriction enzymes Nrul, BssHll, SacII, and Xhol by the abbreviations shown in the square box.
  • the direction of transcription is from left to right.
  • FIGURE 2 Schematic presentation of three classes of human TCTE-1 cDNA.
  • Human TCTE-1 cDNAs were obtained by screening a human testis library using a mouse Tcte-1 cDNA clone as a probe. Three classes of clones were obtained. Boxes filled with the same pattern indicate that different clones shared the same sequence. DNA sequences flanking the alternative regions of the TCTE-1 clones are underlined, and sequences that could be alternative polyA addition signals are boxed. The scale is indicated by a bar.
  • FIGURE 3 Nucleotide sequence and deduced amino acid sequence of TCTE-1 cDNA.
  • the phTCTE-1 sequence is shown above the pHl sequence. Identity of sequence is indicated by a dash. Since the pHl sequence encodes a much smaller protein than phTCTE-1, the amino acid sequence (SEQ. ID NO:3) of phTCTE-1 is shown. Numbering of nucleotide sequence is shown on the right with those of phTCTE-1 underlined. Numbering of amino acid residues is shown on the left.
  • the palindromic sequences in the coding region and the (CA/GT) repeating motifs in the 3 ' untranslated region are underlined.
  • FIGURE 4 Comparison of human TCTE-1 and mouse Tcte-1 (Sarvetnick et al. , 1990, Immunogenetics 21:283-284) nucleotide sequences by dot matrix analysis .
  • FIGURE 5 Homology between human TCTE-1 (SEQ. ID NO:4) and mouse Tcte-1 (SEQ. ID NO:5) protein sequences.
  • Human phTCTE-1 (SEQ. ID NO:2) encodes the largest open reading frame among all the isolates. The translated open reading frame is shown on the upper line. For comparison, the mouse protein sequence is shown below the human sequence. A line indicates identity, and one dot represents a conserved change.
  • FIGURE 6 Hydropathy profile of Tcte-1 and TCTE-1 proteins.
  • FIGURE 7 Duplicated amino acid motif of Tcte-1 and TCTE-1 proteins.
  • polypeptide sequences from residues 337 to 436 (SEQ. ID NO:6) of the Tcte-1 gene and residues 334 to 433 (SEQ. ID NO:7) of the TCTE-1 gene are shown in A and B, respectively. Identical residues are underlined. The duplicated motifs are boxed.
  • FIGURE 8 Generation of fusion proteins of TCTE-1 and Tcte-1 and antibodies recognizing the fusion proteins.
  • FIGURE 9 Evidence that p56 from testis is the Tcte-1 protein.
  • FIGURE 10 Tissue and subcellular distribution of Tcte-1 proteins determined by Western analysis.
  • Western blotting analysis was performed on protein lysates from a variety of tissues and different subcellular fractions of testicular cells and sperm of a male 129 mouse with either affinity purified anti-Tcte-1 antibodies (right panel) or preimmune rabbit IgG (left panel) .
  • B brain; K, kidney; L, liver; S, spleen; T, total testicular cells; SP, sperm SDS soluble fraction; TM, TC and TN are abbreviations for mitochondrial, cytoplasmic and nuclear fractions of testicular cells, respectively.
  • FIGURE 11 Localization of Tcte-1 RNA in testis by in situ hybridization.
  • a Bluescript based plasmid, pj26.l, containing the Pstl-EcoRI fragment of the 3' untranslated region of Tcte-1 cDNA was linearized and transcribed with T3 and T7 polymerase to generate antisense (AS) and sense (S) probes, respectively.
  • AS antisense
  • S sense
  • PS pachytene spermatocyte
  • RS round spermatocyte.
  • FIGURE 12 Localization of Tcte-1 proteins on testicular sections by immunofluorescence.
  • Omni-fixed mouse testicular sections were first stained with 5 micrograms of preimmune rabbit IgG (control) and affinity purified rabbit anti-Tcte-l antibodies (alpha-Tcte-1) , and then treated with biotin conjugated goat antirabbit IgG. Antigen-antibody complexes were detected with FITC labelled streptavidin. Nuclei were revealed by DAPI. Photographs were taken with a Zeiss-phase contrast fluorescence.microscope. 1. Phase contrast photograph of a cross section of a seminiferous tubule. 2. DAPI staining pattern of the same field. 3. FITC staining pattern of the same field.
  • FIGURE 13 Localization of Tcte-1 proteins on sperm by immunofluorescence.
  • FIGURE 14 Tcte-1 protein is present on the plasma membrane of the intact acrosome.
  • FIGURE 15 Analysis of Tcte-1-LT transgenic mice.
  • A. The scheme of Tcte-1-LT transgene construction.
  • a Tcte-1-LT fusion gene was constructed by cloning the 2.3 Kb Hindlll-Kpnl fragment of pUCT into Kpnl, HindlU linearized pj59.1 plasmid containing the 5.8 Kb upstream region of mouse Tcte-1 gene.
  • the 3' Kpnl site of the resulting plasmid, pj66.1 was converted to a BamHl site to form the plasmid pj66.2.
  • the 8.1 Kb BamHl fragment was used to produce transgenic mice.
  • RNA samples 10 micrograms of total RNA from 6 tissues were used for Northern analysis.
  • B brain; K, kidney; L, liver; S, spleen; T, testis; Lg, lung.
  • FIGURE 16 Southern blot of DNA form various species hybridized to labelled mouse Tcte-l probe. DNA's in lanes 1-12 (from left to right) are respectively, cow, pig (lanes 2 and 3), dog, rabbit, guinea pig, human, monkey, chicken, Xenopus laevis, zebra fish, and molecular markers.
  • FIGURE 17 Western Blot analysis showing the binding of monoclonal antibody 4F7 to human TCTE-1 fusion protein (lane 2) but not control (protein expressed by vector lacking TCTE-1-encoding sequences.
  • FIGURE 18 Immunofluorescent staining of human sperm with polyclonal antisera directed toward TCTE-1.
  • NUCLEIC ACIDS The present invention provides for substantially purified nucleic acid molecules encoding tcte-1, including nucleic acid molecules encoding human TCTE-1.
  • the present invention provides for substantially purified nucleic acid molecules having either: i) a sequence substantially as depicted in Fig. 3 for human TCTE-1 (SEQ. ID N0:2); ii) a sequence substantially as depicted in Fig. 3 for the portion extending between about nucleotide 149 to about nucleotide 328 (SEQ. ID NO:2), encoding the N-terminal 60 amino acid residues of TCTE-1 protein; iii) a sequence substantially as depicted in Fig. 3 for TCTE-1 (SEQ.
  • nucleic acid molecules of the invention may be comprised in a nucleic acid vector including, but not limited to, a plasmid, cosmid, bacteriophage, or virus, or may be comprised in a foreign genome, as when the nucleic acid molecule of the invention is used to create a transgene in a non-human transgenic animal.
  • nucleic acid molecules of the invention may differ in sequence from the sequence depicted in the figures at a number of residues that do not exceed five percent of the total sequence.
  • nucleic acid molecule of the invention may be inserted into an expression vector, so as to enable recombinant expression of tcte-1.
  • a vector may preferably also contain a promoter element that may be used to control expression of tcte-1.
  • the present invention provides for substantially pure tcte-l nucleic acid molecules linked to a promoter element, which may, or may not, be comprised in a vector.
  • Suitable promoter elements include, but are not limited to, sperm or testis specific promoters such as phosphoglycerate kinase 2 promoter as well as the following promoters that are not sperm or testis- specific: the CMV promoter, the SV40 early promoter region (Bernoist and Chambon, 1981, Nature 290:304- 310), the promoter contained in the 3 1 long terminal repeat of Rous sarcoma virus (Yamamoto, et al., 1980, Cell 2 .
  • herpes thymidine kinase promoter (Wagner et al. , 1981, Proc. Natl. Acad. Sci. U.S.A. 28_:1440-1445) , the regulatory sequences of the metallothionine gene (Brinster et al. , 1982, Nature 296:39-42) ; prokaryotic expression vectors such as the ⁇ -lactamase promoter (Villa-Kamaroff, et al., 1978, Proc. Natl. Acad. Sci. U.S.A. 25:3727-3731), or the tac promoter (DeBoer, et al., 1983, Proc. Natl. Acad.
  • mouse mammary tumor virus control region which is active in testicular, breast, lymphoid and mast cells (Leder et al., 1986, Cell 45_:485-495)
  • albumin gene control region which is active in liver (Pinkert et al., 1987, Genes and Devel. .1:268-276), alpha- fetoprotein gene control region which is active in liver (Krumlauf et al., 1985, Mol. Cell. Biol.
  • beta-globin gene control region which is active in myeloid cells (Mogram et al., 1985, Nature 315:338-340; Kollias et al., 1986, Cell 46:89-94) ; myelin basic protein gene control region which is active in oligodendrocyte cells in the brain (Readhead et al., 1987, Cell 42:703-712); myosin light chain-2 gene control region which is active in skeletal muscle (Sani, 1985, Nature 24. 83-286) , and gonadotropic releasing hormone gene control region which is active in the hypothalamus (Mason et al., 1986, Science 221:1372-1378) .
  • nucleic acid molecules that encode tcte-1 linked to a promoter also provides for nucleic acid molecules that encode tcte-1 and are linked to at least a portion of another gene, which may, for example, encode a fusion protein.
  • Such constucts may, or may not, be comprised in a vector molecule.
  • a tcte-1 gene, or a portion thereof may be linked to a nucleic acid encoding an immunoglobulin molecule, or a portion thereof.
  • the present invention also provides for substantially purified nucleic acid molecules that are at least about ten base pairs in length and that (i) correspond to a portion of the nucleic acid sequence (SEQ. ID NO:2) for TCTE-1 substantially as depicted in Fig. 3 or (ii) encode a portion of the amino acid sequence (SEQ. ID NO:4) for TCTE-1 substantially as depicted in Fig. 5.
  • Such molecules may be linked to a promoter and/or at least a portion of another gene and may be comprised in a nucleic acid vector.
  • the present invention further provides for a microorganism, genetically engineered cell, or transgenic animal into which has been introduced a nucleic acid molecule of the invention.
  • the nucleic acid molecule may have been introduced into the microorganism, cell, or transgenic animal by any method known in the art, including, but not limited to, microinjection, transfection, transduction, electroporation, etc. or it may have been inherited from a parent microorganism, cell, or transgenic animal that had received a nucleic acid molecule of the invention through such techniques.
  • the present invention also provides for substantially purified nucleic acid molecules corresponding to tcte-1 encoding sequences of other species that encode proteins that are at least eighty percent homologous to the c-terminal half of TCTE-1 or Tcte-l (Sarvetnick et al., 1990, Immunogenetics 21:283-284) .
  • the present invention provides for substantially purified tcte-1 protein and peptide molecules, as well as derivatives and functional equivalents of such molecules. All of the proteins described in this section may be referred to as tcte-l proteins.
  • the present invention provides for the following:
  • an immunogenic fragment of substantially purified protein having a sequence substantially as depicted in Fig. 5 for human TCTE-1 (SEQ. ID NO:4) , including a fragment of such protein that has been rendered immunogenic by chemical modification or coadministration with adjuvant.
  • a protein fragment, according to the invention is at least five amino acids in length.
  • the present invention further provides for such proteins and protein fragments that are comprised in a larger protein molecule.
  • proteins and protein fragments may be comprised within a fusion protein.
  • the present invention also provides for functional equivalents of the proteins and protein fragments as described supra.
  • the amino acid sequence is substantially as depicted in Fig. 5 except that functionally equivalent amino acid residues are substituted for residues within the sequence, resulting in a silent change.
  • one or more amino acid residues within the sequence can be substituted by another amino acid of a similar polarity which acts as a functional equivalent, resulting in a silent alteration.
  • Substitutes for an amino acid within the sequence may be selected from other members of the class to which the amino acid belongs.
  • the nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine.
  • the polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine.
  • the positively charged (basic) amino acids include arginine, lysine, and histidine.
  • the negatively charged (acidic) amino acids include aspartic acid and glutamic acid.
  • derivatives of such proteins or fragments thereof including derivatives formed by glycosylation, proteolytic cleavage, phosphorylation, linkage to an antibody molecule or other cellular ligand, etc.
  • proteins and protein fragments of the invention may be prepared by any method known in the art, including purification from a natural source (including purification by polyacrylamide gel electrophoresis, immunoprecipitation or affinity chromatography) , chemical synthesis, and recombinant DNA technology expression systems.
  • the present invention further provides for a substantially purified protein having a homology of at least eighty percent to a corresponding length of tcte-1 sequence, which is substantially identical to a protein found in sperm lysates.
  • this protein has a molecular weight of about 50kD.
  • the present invention also provides for a substantially purified protein having a region of homology of at least 20 amino acids that are at least seventy-five percent homologous to a corresponding length of tcte-1 sequence, which is substantially identical to a protein found in liver and brain extracts. In preferred embodiments, this protein has a molecular weight of about 35 kD.
  • the present invention further provides for tcte-1 proteins of other species that are at least eighty percent homologous to TCTE-1 or Tcte-1 in the c- terminal half of the molecule.
  • the present invention further provides for fusion proteins that comprise all or a portion of a tcte-1 protein, such as human TCTE-1 protein.
  • a tcte-1 protein such as human TCTE-1 protein.
  • the present invention provides for fusion proteins that comprise all or a portion of TCTE-1 as well as all or a portion of an immunoglobulin protein.
  • a fusion protein may be constructed in which a BamHl fragment containing 430 amino acids of TCTE-1 protein may be ligated into a suitable expression vector.
  • the tcte-1 proteins, protein fragments, and derivatives of the invention may be used as immunogens to generate antibodies which may be polyclonal or monoclonal.
  • the amino acid sequence of a protein of the invention may be analyzed in order to identify portions of the molecule which may be associated with increased immunogenicity.
  • the amino acid sequence may be subjected to computer analysis to identify surface epitopes, as illustrated in Fig. 6, which presents Kyte-Doolittle hydropathy profiles of mouse Tcte-l and human TCTE-1. Hydrophilic regions are more likely to be exposed to the cell surface than are hydrophobic regions, and hence are more likely to be immunogenic.
  • the deduced amino acid sequences of tcte-1 from different species could be compared. and relatively non-homologous regions be identified. These non-homologous regions would be more likely to be immunogenic across various species. For example, the amino terminal 60 amino acid residues of mouse and human tcte-l appear to have divergent sequences. These portions of tcte-1 may prove to be immunogenic across species.
  • any technique which provides for the production of antibody molecules may be used.
  • the trioma technique the human B-cell hydridoma technique
  • the EBV-hybridoma technique to produce monoclonal antibodies Colde et al., 1985, in "Monoclonal Antibodies and Cancer Therapy," Alan R. Liss, Inc., pp. 77-96) and the like are within the scope of the present invention.
  • the monoclonal antibodies for therapeutic use may be human monoclonal antibodies or chimeric human-mouse (or other species) monoclonal antibodies.
  • Human monoclonal antibodies may be made by any of numerous techniques known in the art (e.g.. Teng et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:7308-7312; Kozbor et al., 1983, Immunology Today 4:72-79; Olsson et al., 1983, Meth. Enzymol. 92:3-16).
  • Chimeric antibody molecules may be prepared containing a mouse antigen- binding domain with human constant regions (Morrison et al., 1984, Proc. Natl. Acad. Sci. U.S.A. 81:6851, Takeda et al., 1985, Nature 314:452).
  • tcte-1 Various procedures known in the art may be used for the production of polyclonal antibodies to epitopes of tcte-1.
  • various host animals can be immunized by injection with tcte-l protein, or fragment or derivative thereof, including but not limited to rabbits, mice, rats, etc.
  • adjuvants may be used to increase the immunological response, depending on the host species, and including but not limited to Freund's (complete and incomplete) , mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, MPL + TDM + CWS (RIBI Biochem.) and potentially useful human adjuvants such as BCG (Bacille Calmette-Guerin) and, Corynebacterium parvum.
  • Freund's complete and incomplete
  • mineral gels such as aluminum hydroxide
  • surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, MPL + TDM + CWS (RIBI Biochem.)
  • BCG Bacille Calmette-Guerin
  • a molecular clone of an antibody to a tcte-1 epitope can be prepared by known techniques. Recombinant DNA methodology (see e.g., Maniatis et al., 1982, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York) may be used to construct nucleic acid sequences which encode a monoclonal antibody molecule, or antigen binding region thereof.
  • Antibody molecules may be purified by known techniques, e.g.. immunoabsorption or immunoaffinity chromatography, chromatographic methods such as HPLC (high performance liquid chromatography) , or a combination thereof, etc.
  • Antibody fragments which contain the idiotype of the molecule can be generated by known techniques.
  • such fragments include but are not limited to: the F(ab') 2 fragment which can be produced by pepsin digestion of the antibody molecule; the Fab 1 fragments which can be generated by reducing the disulfide bridges of the F(ab') 2 fragment, and the 2 Fab or Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent.
  • infra rabbit polyclonal antiserum to a Tcte-1 fusion protein was produced.
  • monoclonal antibody 4F7 directed toward TCTE-1, was produced. Accordingly, the present invention provides for monoclonal antibody 4F7 as well as any other antibody that is capable of competing with monoclonal antibody 4F7 for binding to its target epitope.
  • the present invention provides for vaccines comprising either (i) a tcte-1 protein or a fragment thereof or (ii) a nonpathogenic virus which carries a gene that encodes a tcte-1 protein or an immunogenic fragment thereof.
  • a vaccine comprising a tcte-1 protein or a fragment or derivative thereof as set forth in Section 5.2, supra, may further comprise an adjuvant, such as, but not limited to, Freund's adjuvant or Bacille Calmette-Guerin (BCG) , and may also comprise a suitable pharmaceutical carrier, including but not limited to saline, dextrose or other aqueous solutions.
  • An effective amount should be administered, in which "effective amount” is defined as an amount of tcte-1 protein or a fragment or derivative thereof that is capable of producing an immune response in a subject.
  • an effective amount of vaccine may produce an elevation of anti-tcte 1 antibody titer to at least three times the antibody titer prior to vaccination.
  • approximately 50 ⁇ g to lmg and preferably 50 ⁇ g to 200 mg of TCTE-1 may be administered to a human subject.
  • the present invention further provides for vaccines comprising a nonpathogenic virus which carries a gene that encodes a tcte-1 protein or an immunogenic fragment thereof, in which the virus may be either a live virus or may be inactivated.
  • the virus is nonpathogenic in that it does not exert a sustained deleterious effect on a vaccinated subject, although it may produce mild, transient discomfort shortly after vaccination.
  • Suitable viruses which may be utilized include, but are not limited to, vaccinia, adeno associated virus, retrovirus, and other DNA viruses.
  • the gene that encodes a tcte-1 protein or an immunogenic fragment thereof may encode the tcte-l protein or fragment exclusively or may encode tcte-1 protein or fragment comprised in a fusion protein.
  • the gene encoding tcte-l protein or fragment may be inserted into the viral genome using standard molecular biology technology.
  • the gene may comprise a nucleic acid according to Section 5.1, supra.
  • An inactivated virus according to the invention is a virus that is incapable of replication and/or infection.
  • the virus may lack the enzymes necessary for replication, although it may still be capable of entering a cell.
  • the virus may be chemically inactivated, or inactivated by a physical agent such as heat or irradiation, so that it is rendered incapable of replication and/or infection.
  • the present invention provides for methods of immunocontraception.
  • immunocontraception refers to contraception, i.e., the inhibition of fertilization, that is mediated by an immune response which may be effected by antibodies and/or cells. The extent of inhibition should be at least about fifty percent relative to untreated controls.
  • the present invention provides for a method of immunocontraception comprising administering to a subject in need of such treatment an effective amount of a vaccine as described in Section 5.4., supra.
  • a vaccine may comprise either a tcte-1 protein or a fragment or derivative thereof or a nonpathogenic virus which carries a gene that encodes a tcte-1 protein or an immunogenic fragment thereof.
  • the present invention provides for a method of immunocontraception comprising administering to a subject in need of such treatment an effective amount of antibody directed toward tcte- 1, as described in Section 5.3, supra.
  • An effective amount of antibody is an amount that will inhibit fertilization by about fifty percent and, preferably, by about seventy-five percent.
  • Subjects which may be treated by the methods of the invention include any organism that produces a tcte-1 protein, such as, but not limited to, humans, non-human primates, dogs, cats, rodents, livestock, etc. Either sex may be treated, but it is preferable that females be used as subjects because infertility produced by the invention may be circumvented (for example, by in vitro fertilization or antibody titration) more easily in females compared to males.
  • Vaccine or antibody may be administered locally or systemically by any method known in the art, including, but not limited to, intravenous, subcutaneous, intramuscular, intravaginal, or oral routes.
  • Vaccine or antibody may be administered in a suitable, nontoxic pharmaceutical carrier, may be comprised in microcapsules, and/or may be comprised in a sustained release implant.
  • Vaccine may desirably be administered at serial intervals in order to sustain antibody levels.
  • Vaccine or antibody of the invention may be used in conjunction with other contraceptive methods.
  • anti-tcte-1 antibody was observed to inhibit the binding of sperm to egg.
  • the present invention may also be used in methods for (i) selecting sperm of a particular genotype; (ii) identifying and/or detecting infertility;
  • the present invention provides for methods for selecting sperm of a particular genotype comprising (i) producing a transgenic non-human animal of one species that carries a transgene encoding a tcte-1 protein with endogenous or an alternative promoter derived from a second species of animal in which the transgene is located on the same chromosome as a gene of interest, such that a diploid cell of the transgenic animal contains only one copy of the chromosome that carries the transgene and the gene of interest in its karyotype (i.e., is heterozygous for the gene of interest and for the tcte-1 transgene) ; (ii) collecting sperm from the transgenic animal; (iii) exposing the sperm to protein that binds to tcte-1 protein and is bound to a support that renders the protein retrievable, under conditions that promote the binding of tcte-1 to the protein; (iv) retrieving the protein bound to sperm
  • the protein may be any protein that specifically binds to tcte-1, such as, for example, and not by way of limitation, an antibody or an oocyte protein.
  • the protein may be bound to a support, including, but not limited to, an egg (as in the case of natural oocyte protein) , plastic, glass, magnetic beads, resin, latex, etc. and may be bound via a molecule bound to the protein.
  • a support including, but not limited to, an egg (as in the case of natural oocyte protein) , plastic, glass, magnetic beads, resin, latex, etc. and may be bound via a molecule bound to the protein.
  • the protein may be retrieved by collecting the support.
  • protein bound to an a piece of plastic or glass may be exposed to sperm that express tcte-l (tcte-l(+)) or do not express tcte-l (tcte-1(- ) ) under conditions that permit binding of tcte-1 to protein.
  • Tcte-1(-) sperm may then be washed away, leaving behind from tcte-l(+) sperm that are bound to protein on the plastic or glass.
  • the beads may be exposed to tcte-1(+) and tcte-1(-) sperm under conditions that permit binding of tcte-1 to protein, and then the beads, which have bound to tcte-1(+) sperm, may be collected by a magnet. Similar embodiments may be deduced by one skilled in the art. Conditions that promote the binding of tcte-1 to protein include, but are not limited to, conditions that are similar to those encountered in vivo, or those typically used for antibody antigen binding.
  • Sperm may be released from the protein by standard methods, e.g. those used to release proteins from immuno-affinity columns.
  • the sperm of the transgenic animal consists of two populations, only one of which carries the chromosome bearing the tcte-1 transgene and the gene of interest
  • this method may be used to select sperm that carry the gene of interest.
  • the selected sperm may then be used to fertilize an oocyte that may develop into an animal that carries the gene of interest.
  • the transgene may be inserted into the X or Y chromosome of a transgenic animal.
  • the foregoing method may then be used to select sperm that carries the X or the Y chromosome.
  • the transgene may be inserted into a particular chromosome by any method known in the art. For example, a number of transgenic animals may be produced, and then animals that carry the transgene on the desired chromosome may be selected, e.g. by in situ hybridization of nucleotide probes to chromosomes, by somatic cell hybrid analysis, or by classical genetics.
  • the methods of the invention may be used to improve the efficiency of inheritance of a gene of interest that is a transgene. It may be desirable to express the product of gene "A” in a transgenic animal, and to produce offspring of that transgenic animal that also express the product of gene "A". A difficulty has been that a transgenic animal heterozygous for gene "A” may only pass gene "A” to half of its offspring. According to the invention, by "tagging" gene A with tcte-1, sperm carrying gene "A” may be selected and used to produce embryos, thus ensuring that virtually all of the animal's offspring may carry gene "A".
  • the gene of interest may be tagged by inserting tcte-1 on the same chromosome that bears gene "A", as outlined above.
  • gene A may be linked to a gene encoding tcte-1 and then used to produce a transgenic animal that carries both genes in tandem.
  • Transgenic animals may be produced by any method known in the art, including but not limited to microinjection, e.g. according to the method set forth in U.S. Patent No. 4,873,191 by Wagner and Hoppe, issued October 10, 1989, transfection, transduction, electroporation, embryonic stem cells, etc. Any non- human transgenic animal species may be utilized, including but not limited to rodents, pigs, cows, horses, goats, sheep, non-human primates, etc.
  • Virtually any gene of interest may be utilized, including, but not limited to, globin, factor VIII, growth hormone, insulin, LDL receptor, etc.
  • the present invention provides for methods of identifying and/or diagnosing infertility in males or females.
  • the condition of infertility may be identified in a subject and/or the cause of infertility may be diagnosed.
  • a subject may be a human or a non-human subject.
  • the present invention provides for a method of identifying and/or diagnosing infertility in a test male subject comprising detecting the presence of a tcte-l protein on the surface of sperm obtained from the subject, quantifying the amount of tcte-1 protein (by standard techniques including, but not limited to, immunofluorescence, flow sorting, histochemistry, Western blot, etc.) either in terms of presence or absence of the protein on a single sperm or in a population of sperms or in terms of the absolute amount of tcte-1 expressed by a single sperm or in a population of sperms, and then comparing the amount of tcte-l quantified with the amount of tcte-l protein expressed in a comparable sample of sperm from a normal male subject, in which an aberrancy in the test subject relative to the normal subject may indicate that the test subject is infertile, and may positively correlate with infertility. Because tcte
  • Tcte-1 may be detected using, for example, tcte-1 ligand, including polyclonal or monoclonal antibody or the egg protein that binds to tcte-1; binding of ligand may be detected by directly or indirectly (e.g. via secondary antibody) labeling the ligand.
  • tcte-1 ligand including polyclonal or monoclonal antibody or the egg protein that binds to tcte-1
  • binding of ligand may be detected by directly or indirectly (e.g. via secondary antibody) labeling the ligand.
  • tcte-1 protein is not expressed on the surface of any sperms obtained from the test subject, this indicates that the test subject is infertile.
  • the absence of a tcte-1 protein on greater than 30 percent, preferably greater than 50 percent, and most preferably greater than 75 percent of sperms supports a diagnosis of infertility.
  • the absence of tcte-1 protein on greater than 30 percent, preferably greater than 50 percent, and most preferably greater than 75 percent of sperms of a subject may identify the subject as being infertile.
  • an amount of tcte-1 protein that is less than 70 percent, preferably less than 50 percent, and most preferably less than 25 percent of the amount found in a normal subject supports a diagnosis of infertility and may identify the test subject as being infertile.
  • the present invention provides for methods of identifying abnormal function of tcte-1 protein of a test subject comprising measuring the ability of tcte-1 of the test subject (either bound to sperm or otherwise) to compete with tcte-1 from a normal subject for binding to a ligand.
  • Suitable ligands include the natural ligand for tcte- 1, as is expressed by the oocyte, as well as antibody, monoclonal or polyclonal, directed toward tcte-1.
  • the ligand is monoclonal antibody 4F7.
  • the ability of "x" amount of unlabeled tcte-1 from a test subject to bind to ligand may be measured in the presence or absence of labeled tcte-1 from a "y" amount of normal subject, and then compared with the ability of "x" amount of unlabeled tcte-1 from a normal subject to bind to ligand in the presence or absence of "y" amount of labeled tcte-1 from a normal subject.
  • tcte-1 from the test subject competes with labeled tcte-1 differently from tcte-1 from the normal subject, particularly if tcte-1 from the test subject competes poorly for ligand binding, this supports a diagnosis of infertility and may identify the test subject as being infertile.
  • the ability of tcte-1 protein to bind to natural ligand from a female test subject may be used to diagnose and/or identify infertility in the female subject. For example, if ligand from the female test subject competes inefficiently with ligand from a normal subject for tcte-1 binding, this would support a diagnosis of infertility and may indicate that the subject be identified as infertile.
  • the present invention further provides for a diagnostic kit that may be used to diagnose and/or identify male infertility.
  • the kit may preferably comprise polyclonal or monoclonal primary anti-tcte-l antibody together with detectably labeled secondary antibody.
  • the secondary antibody may be fluorescently labeled, or may be labeled with an enzyme, such as horseradish peroxidase.
  • the kit may further comprise normal tcte-1, to be used as a standard of reference and/or a positive control.
  • the present invention also provides for methods for improving fertility comprising augmenting the amount of tcte-1 expressed by sperm.
  • An increased amount of tcte-1 expressed at the sperm surface may result in increased adhesion of sperm to egg.
  • a nonhuman transgenic animal may be produced that carries, as a transgene, a gene encoding tcte-1 that (i) is under the control of a relatively strong promoter (which may be an inducible promoter) ; (ii) is engineered to encode a tcte-1 that has an increased binding affinity for the egg; and/or (iii) is present in multiple copies.
  • the present invention provides for a method of improving fertility comprising selecting, from a population of sperm in which certain sperm are deficient in tcte-1, those sperm that express tcte-1.
  • tcte-1- bearing sperm may be selected via directly or indirectly fluorescently labeled anti-tcte-l antibody followed by fluorescence activated cell sorting.
  • the population of sperm enriched for tcte-1 expression may then be used for in vitro fertilization or artificial insemination.
  • sperm deficient in normal tcte-1 may be artificially coupled to normal tcte-1, thereby rendering the sperm capable of egg binding.
  • tcte-1 protein (or a portion thereof that participates in egg binding) , may be coupled to an anti-sperm antibody, for example, as part of a fusion protein, or via other chemical coupling (covalent or noncovalent) .
  • the anti-sperm antibody may be directed toward any antigen on the sperm surface, including tissue specific as well as tissue non-specific antigens (e.g. PH-20, PH- 30, acrosin, SP10, etc.).
  • tissue specific as well as tissue non-specific antigens e.g. PH-20, PH- 30, acrosin, SP10, etc.
  • the present invention further provides for methods for producing an interspecies hybrid comprising mating a non-human animal of a first species to a non-human transgenic animal of a second species which carries, as a transgene, a gene that encodes a protein having the characteristics of tcte-1 protein derived from the first species which is expressed by the sperm of the transgenic animal.
  • Biochem 137:266-267 was used to generate 32 P labelled probes.
  • DNA sequencing was performed by the dideoxy chain termination method (Sanger et al., 1977, Proc.
  • COSMID MAPPING A mouse cosmid library, produced from a t w5 /t lubI double heterozygote mouse, was provided by John Schimenti.
  • the DNA sample was size-fractionated on a 0.5%(w/v) TBE (90mM Tris base, 90mM Boric acid and 2mM EDTA pH 8.3 ) agarose gel and blotted sequentially to two nylon membranes.
  • the blotted DNAs were probed with fragments from isolated vector DNA that represent the two arms of the linearized clone.
  • the sizes of bands that were resolved on each autoradiograph correspond to the distance between one end of the cosmid clone and sites of the restriction enzyme being used.
  • the maps generated by this method were confirmed by electrophoretical analysis of complete digests of each clone with individual restriction enzymes or a combination of enzymes.
  • Testicular cells were isolated and labelled in culture with [ 35 S]methionine as described in Silver et al. (1979, Cell 12:275-284).
  • 2 to 6 testes were pooled in a 50ml tube containing 25 ml of lmg/ml collagenase solution and incubated for 10 to 20 minutes at 33°C until the seminiferous tubules were dissociated.
  • the tubules were then washed twice with medium and resuspended in 25 ml of trypsin/DNAasel solution. The tube was placed in a 33°C water bath for 5-10 minutes.
  • the cell mixture was pipetted up and down 50 times with a cut disposable pipet tip, layered over a 10 ml cushion of 1% BSA, and centrifuged at 1000 RPM for 10 minutes at 10°C.
  • the resulting cell pellet was resuspended in PBS, and the cell density was adjusted to 1 x 10 7 cells/ml.
  • 200 microcuries of [ 35 S]methionine was added and the cells were incubated at 32 ° Cf 5% C0 2 for 6 hours. Labeled cells were washed with PBS three times and stored at -80°C.
  • the recombinant plasmids were transfected into E. coii BL21(DE3), which carries a copy of the T7 RNA polymerase gene under control of the LacUV5 promoter.
  • the resulting strain was grown with shaking at 37°C in 100 ml TB medium supplemented with 150ug/mL ampicillin.
  • lysis buffer 50 mM Tris-HCl pH 8,2 mM EDTA and 20 mM NaCl.
  • the cells were lysed overnight on ice with the addition of lysozyme to a final concentration of lmg/ml and sodium deoxycholate to a final concentration of 0.04%.
  • the lysate was sonicated and centrifuged at 10,000 RPM for 15 minutes in a Sorvall SS-34 rotor. The pellet was washed with lysis buffer twice and resuspended in 2 ml of lysis buffer. Lysate was subjected to preparative SDS-polyacrylamide gel electrophoresis. The fusion protein was visualized by staining part of the gel with Coomassie blue and then collected by electroelution with TAE-SDS buffer.
  • the supernatant contained the cytosolic fraction.
  • the beads were prepared by incubating either 5-10 microliters of rabbit antiserum or 1 ml hybridoma supernatant with 100 microliters of a 10% suspension of Staph A beads for one hour; the unbound antibodies were then washed away with RIPA buffer. This procedure was repeated twice and the pelleted beads were resuspended in 100 microliters of borate coupling buffer consisting of 0.1M borate and 0.15 M NACl.
  • Membranes were blocked for nonspecific binding with 3% gelatin and 5% nonfat milk in TBS (20mM Tris, pH 7.5; 0.5M NaCL) , and specific proteins hybridized with 5 micrograms of affinity purified antiserum in 6 ml antibody solution( 1% Tween 20, 1% gelatin, and TBS) . Bound antibodies were visualized by immunoperoxidase staining using a Vectastain ABC kit (Vector Laboratory Burlingame,CA) .
  • V8 protease 200 fold dilutions of lmg/ml of the stock enzyme with 25% buffer A in 10% glycerol
  • the gels were run at 4V/cm.
  • 4B beads (Pharmacia) according to the recommendations of the manufacturer. 15 ml of rabbit anti-Tcte-1 serum was passed through a column containing the beads. The bound antibodies were eluted with 0.1 M glycine, pH2.5 and neutralized with 0.1M Tris-Cl, pH 8.
  • Tcte-l protein was visualized by a procedure described in Antibodies (Harlow and Lane, 1988, supra) .
  • adult B6D2 Fl mouse testis tissue was fixed with OmniFix2.0 (An-Con Genetics, Inc) .
  • IgG was reacted with a biotinylated, goat anti-rabbit
  • Mouse Tcte-1 cDNA clone pNS2 was used to screen a cosmid library produced from a t w5 /t lul double heterozygote mouse. Three independent clones were obtained. Restriction sites detected with 6 enzymes
  • Fig. l.A The orientation of the gene was determined by hybridizing the restriction digested cosmid DNA with different fragments of the cDNA clone. The size of the transcriptional unit appeared to be about 10
  • the first class consisted of one clone, pHl, which contained a 2.6 Kb insert and hybridized strongly to both the 5• and 3 ' ends of the mouse sequence.
  • the second class termed the pH7 class, contained four clones, pH2, pH5, phTCTE-1 (originally named pH7) and pH8, which were found to have a 1.6Kb insert and to hybridize very strongly with the 5' mouse probe but weakly with the 3' probe.
  • the third class consisted of clone pH6, which contained a 1.6Kb insert and hybridized strongly with the 3 ' probe but weakly with the 5• probe.
  • pH6 is not just a partial clone of pHl, since the 5' end sequence of pH6 is not present anywhere in clone pHl, but is present in the phTCTE-1 clone (Fig. 2) .
  • the nucleotide sequence of pHl is highly homologous to its mouse counterpart even in the 3' untranslated region as shown by dot matrix analysis (Fig. 4) .
  • the complimentary CA/GT motifs in the TCTE -1 gene are similar in location and orientation to its mouse homologue. As shown in Fig. 3, the CA motif is 5' to the GT motif with about 840 bps between them.
  • Another interesting feature of the Tcte-1 gene is the existence of palindromic sequences TCCTCCACrGGAGGA and ATCCGTCGGATGCGCCGGAT from nucleotides 218 to 232 and 319 to 339, respectively, in phTCTE-1 (SEQ. ID NO:2) (Fig. 3) .
  • the second sequence is highly conserved between human and mouse.
  • the phTCTE-1 clone (SEQ. ID NO:2) contained the longest open reading frame, which starts at nt 149 and ends at nt 1652 (Fig. 3) .
  • the ATG codon at nts 149-151 is probably the initiating codon because it is embedded in a sequence (GCCTCCAGCAUGG) which is highly similar to the Kozak consensus for initiation of translation in higher eukaryotes (Kozak, 1987, Nucleic Acids Res. 15.:8125-8148) .
  • This hypothetical open reading frame could potentially encode a 501 amino acid polypeptide, which is similar in size to its mouse counterpart.
  • the predicted protein sequences were compared with the sequences in the Genbank database, but no homologous sequences were found.
  • the hydropathy profiles of these two sequences were plotted with the Kyte and Doolittle program (Fig. 6) , and were found to be quite similar.
  • the mouse Tcte-1 and human TCTE-1 proteins appear to be predominantly hydrophilic except for certain regions, such as amino acid residues 68-78 and 408-428 in Tcte-1, and residues 70-90, 262-288 and 403-423 in TCTE-1. It is these residues that could potentially form transmembrane helices.
  • the BamHl fragment containing 430 amino acids of TCTE-1 protein was ligated into a BamHl linearized pAR3039 vector.
  • Recombinant plasmids (p77.2 and p77.4) carrying both orientations were obtained, and p77.2 was shown to have the right orientation by an Sphl digestion.
  • the bacteria carrying these plasmids were then grown and induced with IPTG as described in Materials and Methods. Total protein lysates were then subjected to SDS-PAGE analysis.
  • rabbit antiserum was raised against the Tcte-1 fusion protein enriched in the insoluble fraction of total bacteria protein lysates (Fig. 8B) . This antiserum was able to specifically recognize both human and mouse fusion proteins.
  • the 5' part of the Tcte-1 cDNA (which covers the entire open reading frame but not the 3 ' untranslated region) was cloned into the Bluescript vector (Stratagene) .
  • the Bluescript vector (Stratagene)
  • both sense and antisense transcripts were generated and subjected to in vitro translation reaction with rabbit reticulocyte lysates.
  • a portion of the product from the translational reaction was immunoprecipitated with anti-Tcte-1 IgG and preimmune IgG (as control) .
  • TISSUE DISTRIBUTION OF TCTE-1 PROTEIN To determine whether the 56 KD Tcte-1 protein was testis specific, Western blot analyses with affinity-purified antibodies were performed on protein extracts from mouse brain, liver, kidney, spleen, testes and sperm fractionated by SDS-PAGE. The result is shown in Fig. 10, which clearly demonstrates the presence of a 56Kd band in the testes and sperm extracts. Interestingly, a 50 Kd protein was also identified in sperm lysates, which may be a modified form of the 56 Kd protein. Surprisingly, a prominent 35 Kd protein band was present in brain, liver and kidney lanes. Since Tcte-1 RNA expression has not been detected in liver, the 35 Kd band could result from cross-reactivity with a protein bearing partial homology to Tcte-1.
  • Tcte-1 transcript was first detected in the testis of 14 day old mice (Sarvetnick et al. , 1989, Immunogenetics 20.34-41), which suggested that Tcte-1 was most likely turned on in pachytene-stage spermatocytes.
  • In situ hybridization with [ 35 S]-UTP labelled sense or antisense Tcte-1 probes was performed on frozen testicular sections to further address this question. The results demonstrate that Tcte-1 expression is indeed first observed in pachytene spermatocytes and continues to be present in haploid sperms (Fig. 11) .
  • Tcte-1 protein products To localize Tcte-1 protein products, indirect immunofluorescence techniques with the affinity-purified Tcte-1 antibody were employed on total testicular sections and isolated sperm. As is shown in Fig. 12, antibody to Tcte-1 protein stained the pachytene spermatocytes and round sperms in the testicular section. A crescent region on the sperm head, typical of the acrosome, was strongly stained (Fig. 13) . The Tcte-1 staining pattern of the spermatocyte seems to colocalize with that of DAPI, which suggests Tcte-1 protein might be a nuclear protein. However, the staining is punctate and diffused, which may also represent Golgi staining.
  • TCTE-1 IS A CANDIDATE GENE FOR A ZP3-BINDING PROTEIN
  • Tcte-1 protein The molecular weight and localization of Tcte-1 protein is similar to a recently identified 56Kd ZP3 binding protein (Bleil and Wasserman, 1990, Proc. Natl. Acad. Sci. U.S.A. 22:5563-5567). In order to evaluate whether Tcte-1 is the ZP3 binding protein, a number of experiments were performed.
  • Tcte-1 protein on sperm were evaluated by immunofluorescence.
  • tact unpermeabilized sperm were exposed to anti- Tcte-l antibody under conditions that promote antibody binding.
  • Anti-Tcte-1 antibody bound to the sperm surface were then visualized with fluorescently labeled anti-mouse IgG antibody. As shown in Figure 13, immunofluorescence was observed in the acrosome portion of the sperm.
  • Tcte-1 protein was studied using gold-labeled anti-Tcte-1 antibody.
  • anti-Tcte-1 IgG specifically stained the plasma membrane overlying the acrosome region of intact sperm, while the preimmune serum failed to do so.
  • the average numbers of binding sites for anti-Tcte-1 IgG on the intact sperm was 65 particles/square micrometer, which was significantly higher than the background number of preimmune IgG(5-6 particles/square micrometer).
  • the effect of the anti-Tcte-1 IgG on the sperm-egg interaction was determined in a competitive sperm binding assay.
  • the extent of inhibition was similar to that of ZP3 (5 sperm per egg) , but higher than that of preimmune IgG(15 sperm per egg) .
  • Tcte-1 3 • untranslated region (UTR) of Tcte-1 is highly conserved between human and mice, including the presence of complementary repeating motifs, the 3'
  • UTR may have an important function.
  • CA/GT CA/GT
  • n repeats in this region, which, despite widespread distribution in eukaryotic genomes, are very rare in exons.
  • two copies of this repeat were identified in a single exon in both the mouse and human tcte-1 genes. These repeats may be able to form
  • the 3' UTR may participate in forming secondary structures that are used to achieve translational control or RNA stability.
  • translational control during spermatogenesis may be achieved in two ways. First, translation of certain genes may be prevented despite the presence of abundant transcripts. Second, all transcripts made for later use may be stored safely until spermiogenesis, the last phase of sperm differentiation, since transcription is shut off in the cells of this stage. This type of translational regulation has been well documented during gametogenesis in general (Gold et al. , 1983, Develop. Biol. £ : 392-399; Kleene et al., 1984, Dev. Biol. 105: 71-79; Zakeri et al. , 1988, Dev. Biol. 125.: 417-422) .
  • Tcte-1 protein is not involved in preventing the translation.
  • Tcte-1 protein is present in the acrosome of mature sperm would suggest that the 3 'UTR may function to prevent degradation of the Tcte-1 mRNA.
  • CpG islands have been found to be associated with the 5' flanking region of genes in vertebrates. Methylation of these islands has been suggested as the switch mechanism to turn off transcription, implying that CpG islands could play an important role in regulating transcription (Antequera et al., 1990, Cell 62: 503-514; Bird, 1986, Nature 321: 209-213).
  • the transcriptional control elements of several testis genes have been identified using transgenic mice (Robinson et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86: 8437-8441; Steward et al., 1988, Mol. Cell. Biol. 1748-1755) , but these elements do not seem to carry CpG islands.
  • Tcte-1 contains CpG islands in the 3' end of the gene. This could mean that either (i) 3' CpG islands do not play a role in the regulation of Tcte-1 expression; (ii) the CpG island represents the controlling elements for another gene downstream; or (iii) the island is required for the proper expression of Tcte-1.
  • mouse Tcte-1 and human TCTE-1 appear to be more heterogeneous than the mouse transcripts.
  • Northern analysis of both human and mouse polyadenylated RNA revealed a single 2.9 Kb band in mouse RNA whereas there were many bands of different sizes in human RNA.
  • cDNA cloning of human TCTE-1 also demonstrated that there are at least three classes of transcripts from this locus.
  • Clone pH6 represents a truncated transcript that could be the consequence of cDNA cloning.
  • phTCTE-1 apparently utilizes a different poly(A) addition signal from the other two classes, which results in the deletion of most of the 3* UTR.
  • Tcte-1 protein is present during spermatogenesis and is localized on the surface of the acrosome indicates that Tcte-1 may function in germ cell differentiation and fertilization.
  • sperm surface proteins have been identified by either immunological or biochemical criteria including a mouse M42 antigen (200/220 Kd) (Saling and Lakoski, 1985, Biol. Reprod. 3_3: 527-536), a mouse phosphotyrosine-containing protein (95 Kd) (Leyton and Saling, 1989, Cell 57: 1123-1130), a mouse sperm surface galactosyl transferase (60 Kd), a mouse ZP3 binding protein (56Kd) (Bleil and Wasserman, 1990, Proc. Natl.
  • Tcte-1 is related to M42 or the 95 Kd protein because of the considerable difference in sizes.
  • sequences of Tcte-1 are entirely different from those of the galactosyl transferase gene (Sharper et al., 1990, Proc. Natl. Acad. Sci.
  • the rat 54 Kd galactose receptor is not present exclusively in sperm, which is in contrast to the 56 Kd protein encoded by Tcte-1.
  • Tcte-1 is a candidate gene for the mouse 56 Kd ZP3 binding protein.
  • their molecular weights are similar.
  • the anti-Tcte-1 antibody reacts similarly to ZP3 in both quantitative and qualitative assays from the immunogold staining data; that is, the numbers of the binding sites for ZP3 and Tcte-1 antibody per sperm are similar and they both stained the plasma membrane of the acrosome on the intact sperm but not the acrosome reacted sperm.
  • both anti-Tcte-1 IgG and ZP3 inhibited the binding of sperm to egg in vitro.
  • Genomic DNA from cow, pig, dog, rabbit, guinea pig, human, monkey, chicken, Xenopus laevis. and zebra fish was digested with TaqI restriction enzyme and subjected to Southern blot analysis using [ 32 P]-labeled mouse Tcte-1 whole cDNA as a probe. Hybridization conditions were at 65°C, and washing was performed at
  • Tcte-1 probe hybridized to distinct bands in DNA lanes corresponding to every species tested, indicating that tcte-protein is expressed by a variety of diverse species.
  • mice were immunized with 50 ⁇ g of TCTE-1 fusion protein as described in Section 6 supra, then were boosted after 4 weeks with lOO ⁇ g TCTE-1 and, after another four weeks, with 25 ⁇ g of TCTE-1. one week later, fusion to generate hybridomas was performed using standard techniques. Hybridoma supernatants were tested for the presence of anti-TCTE-1 antibody by Western blot. As shown in Figure 17, the supernatant from hybridoma 4F7 bound selectively to the human TCTE-1 fusion protein.
  • FIG. 18 is a photograph of human sperm, showing immunofluorescent labelling of TCTE-1 protein.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Environmental Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Veterinary Medicine (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US1992/008457 1991-10-04 1992-10-05 Sperm surface protein WO1993006859A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP92921970A EP0608334A4 (en) 1991-10-04 1992-10-05 SPERMATOZOID SURFACE PROTEIN.
JP5507112A JPH07502886A (ja) 1991-10-04 1992-10-05 精子表面タンパク質

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US77159291A 1991-10-04 1991-10-04
US771,592 1991-10-04
US93163092A 1992-08-18 1992-08-18
US931,630 1992-08-18

Publications (1)

Publication Number Publication Date
WO1993006859A1 true WO1993006859A1 (en) 1993-04-15

Family

ID=27118491

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1992/008457 WO1993006859A1 (en) 1991-10-04 1992-10-05 Sperm surface protein

Country Status (5)

Country Link
EP (1) EP0608334A4 (ja)
JP (1) JPH07502886A (ja)
AU (1) AU2780992A (ja)
CA (1) CA2120601A1 (ja)
WO (1) WO1993006859A1 (ja)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0646015B1 (en) * 1992-06-12 1999-01-07 The University Of Connecticut Contraceptive vaccine
WO1999025815A3 (en) * 1997-11-18 1999-08-19 Max Planck Gesellschaft Nucleic acids involved in the responder phenotype and applications thereof
EP0986398A1 (en) * 1997-02-25 2000-03-22 University Of Virginia Patents Foundation Method for the production of vaccines against cell surface proteins
WO2000031260A1 (en) * 1998-11-20 2000-06-02 Zymogenetics, Inc. Testis specific glycoprotein zpep10
EP1257167A1 (en) * 2000-02-24 2002-11-20 University of Massachusetts, a Public Institution of Higher Education of The Commonwealth of Massachusetts, Production of mammals which produce progeny of a single sex

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4870009A (en) * 1982-11-22 1989-09-26 The Salk Institute For Biological Studies Method of obtaining gene product through the generation of transgenic animals

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4870009A (en) * 1982-11-22 1989-09-26 The Salk Institute For Biological Studies Method of obtaining gene product through the generation of transgenic animals

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Genomics, Volume 5, issued June 1989, K.B. BIBBINS et al., "Human homologs of two testes-expressed loci on mouse chromosome 17 map to opposite arms of chromosome 6", pages 139-143, see entire document. *
Immunogenetics, Volume 30, issued June 1989, N. SARVETNICK et al., "A mouse chromosome 17 gene encodes a testes-specific transcript with unusual properties", pages 34-41, see entire document. *
Nature, Volume 335, issued 06 October 1988, P. PRIMAKOFF et al., "Fully effective contraception in male and female guinea pigs immunized with the sperm protein PH-20", pages 543-546, see entire document. *
See also references of EP0608334A4 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0646015B1 (en) * 1992-06-12 1999-01-07 The University Of Connecticut Contraceptive vaccine
EP0986398A1 (en) * 1997-02-25 2000-03-22 University Of Virginia Patents Foundation Method for the production of vaccines against cell surface proteins
EP0986398A4 (en) * 1997-02-25 2002-10-02 Univ Virginia METHOD FOR THE PRODUCTION OF VACCINALS AGAINST CELL SURFACE PROTEINS
WO1999025815A3 (en) * 1997-11-18 1999-08-19 Max Planck Gesellschaft Nucleic acids involved in the responder phenotype and applications thereof
US6642369B1 (en) 1997-11-18 2003-11-04 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E. V. Nucleic acids involved in the responder phenotype and applications thereof
WO2000031260A1 (en) * 1998-11-20 2000-06-02 Zymogenetics, Inc. Testis specific glycoprotein zpep10
EP1257167A1 (en) * 2000-02-24 2002-11-20 University of Massachusetts, a Public Institution of Higher Education of The Commonwealth of Massachusetts, Production of mammals which produce progeny of a single sex
EP1257167A4 (en) * 2000-02-24 2005-01-26 Univ Massachusetts GENERATION OF SASUGETIANS, WHICH PRODUCE A SOCIETY WITH A SINGLE SEX
AU2001241720B2 (en) * 2000-02-24 2006-08-03 University Of Massachusetts, A Public Institution Of Higher Education Of The Commonwealth Of Massachusetts, As Represented By Its Amherst Campus Production of mammals which produce progeny of a single sex

Also Published As

Publication number Publication date
EP0608334A4 (en) 1995-03-15
CA2120601A1 (en) 1993-04-15
EP0608334A1 (en) 1994-08-03
JPH07502886A (ja) 1995-03-30
AU2780992A (en) 1993-05-03

Similar Documents

Publication Publication Date Title
US7531635B2 (en) MATER-protein specific antibodies and methods of use
JP3479080B2 (ja) 体重のモジュレーター、対応する核酸およびタンパク質、ならびにそれらの診断および治療用途
US7063958B1 (en) Nucleic acids db, the receptor for leptin
US5672488A (en) Contraceptive vaccine based on alloimmunization with zona pellucida polypeptides
PT777732E (pt) Moduladores de peso de corpo, ácidos nucleicos e proteínas correspondentes e usos diagnóstico e terapêutico dos mesmos
EP1053315A1 (en) Human hairless gene, protein and uses thereof
AU2001249852A1 (en) Human gene critical to fertility
WO1993006859A1 (en) Sperm surface protein
US6350730B1 (en) OB polypeptides and modified forms as modulators of body weight
US7312050B2 (en) Nucleic acids encoding interphotoreceptor matrix proteins
US20040161825A1 (en) Sperm specific proteins
JP2004533229A (ja) 生殖能力に不可欠なヒト遺伝子
EP1367123A1 (en) Neurotonin and use thereof
Li et al. Molecular cloning and assessment of the immunocontraceptive potential of the zona pellucida subunit 3 from Brandt’s vole (Microtus brandti)
US7084252B1 (en) DB, the receptor for leptin
US6821945B1 (en) Modulators of body weight, corresponding nucleic acids and proteins, and diagnostic and therapeutic uses thereof
Dean et al. Molecular genetics of the mouse zona pellucida: Implications for fertilization and early development
DE DK et al. MENSCHLICHES GEN ZUR FRUCHTBARKEIT ENTSCHEIDEND GENE HUMAIN INDISPENSABLE A LA FERTILITE
Liu Studies of a sperm acrosomal antigen recognized by HS-63 monoclonal antibody
AU2002254442A1 (en) Human gene critical to fertility

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU BB BG BR CA CS FI HU JP KR LK MG MN MW NO PL RO RU SD US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL SE BF BJ CF CG CI CM GA GN ML MR SN TD TG

COP Corrected version of pamphlet

Free format text: PAGES 1/18-18/18,DRAWINGS,REPLACED BY NEW PAGES 1/22-22/22;DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2120601

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1992921970

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1992921970

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1992921970

Country of ref document: EP