WO1992011360A1 - Analogues du facteur de croissance acide des fibroblastes presentant une stabilite et une activite biologique ameliorees - Google Patents

Analogues du facteur de croissance acide des fibroblastes presentant une stabilite et une activite biologique ameliorees Download PDF

Info

Publication number
WO1992011360A1
WO1992011360A1 PCT/US1991/009441 US9109441W WO9211360A1 WO 1992011360 A1 WO1992011360 A1 WO 1992011360A1 US 9109441 W US9109441 W US 9109441W WO 9211360 A1 WO9211360 A1 WO 9211360A1
Authority
WO
WIPO (PCT)
Prior art keywords
analog
amino acid
growth factor
fibroblast growth
afgf
Prior art date
Application number
PCT/US1991/009441
Other languages
English (en)
Inventor
Tsutomu Arakawa
Gary Michael Fox
Original Assignee
Amgen Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Amgen Inc. filed Critical Amgen Inc.
Priority to JP4503720A priority Critical patent/JPH06503962A/ja
Priority to AU91524/91A priority patent/AU663067B2/en
Publication of WO1992011360A1 publication Critical patent/WO1992011360A1/fr
Priority to KR1019930701853A priority patent/KR930703439A/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/50—Fibroblast growth factors [FGF]
    • C07K14/501—Fibroblast growth factors [FGF] acidic FGF [aFGF]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • FGFs fibroblast growth factors
  • the FGFs are mitogenic and chemotactic for a variety of cells of epithelial, mesenchymal, and neural origins.
  • FGFs are angiogenic, that is they are able to stimulate the formation of blood vessels.
  • Acidic FGF (aFGF) and basic FGF (bFGF) are considered to be two "original" members of the FGF family. Both aFGF and bFGF are believed to be derived from the same ancestral gene, with both molecules having approximately 55% sequence identity in addition to the same intron/exon structure. Acidic FGF and bFGF are also known to bind to the same receptor, although the existence of specific aFGF and bFGF receptors has not been ruled out. Several molecular weight forms of aFGF and bFGF are found in different tissues. However, Southern blotting experiments suggest that there is only one gene each for aFGF and bFGF, with differences between these molecules probably being due to post- translational processing.
  • Both acidic and basic FGF are mitogens for a wide variety of cell types of mesodermal and neuroectoder al origin, and are able to induce angiogenesis both in vitro and in vivo . See, e.g., Gospodarowicz et al, Exp. Eye Res. , 28, 501-514 (1979).
  • the range of biological activities of the two classes is nearly identical, although bFGF is about ten times more potent than aFGF in most bioassay systems.
  • a shared distinguishing feature of aFGF and bFGF is the propensity of these factors to bind tightly to heparin.
  • the affinity of aFGF for heparin appears to be weaker than for bFGF, with aFGF having an anionic isoelectric point. Thomas et al, Proc. Nat . Acad. Sci . USA, 82, 6409-6413 (1984) .
  • the unique heparin binding property of aFGF and bFGF has greatly facilitated purification of these factors.
  • FGF proteins are believed to be effective in promoting the healing of tissue subjected to trauma.
  • the unique angiogenic property of FGFs makes these factors especially valuable in the healing of deep wounds.
  • the bFGF native proteins have been alleged to be useful in the treatment of myocardial infarction.
  • U.S. Patents No. 4,296,100 and 4,378,347 have been found to increase neuronal survival and neurite extension in fetal rat hippocampal neurons, suggesting that this factor may also be useful in the treatment of degenerative neurological disorders, such as Alzheimer's disease and Parkinson's disease.
  • heparin a highly sulphated glycosaminoglycan of heterogeneous structure, is known to be an anticoagulant which functions by accelerating the rate at which antithrombin III inactivates the proteases of homeostasis. Jacques, Pharmacol Rev, 31, 99-166 (1980) . It is not known whether it might be deleterious to use heparin in a pharmaceutical preparation for the treatment of deep wounds, where some degree of coagulation may be desired to achieve proper healing.
  • heparin is incorporated into a pharmaceutical preparation for wound healing.
  • Drug delivery concerns include the matter of controlling the composition of the pharmaceutical preparation (containing the combination of aFGF and heparin) upon entry into the patient's body.
  • the present invention provides novel analogs of aFGF which are more stable and exhibit greater biological activity in the absence of heparin than naturally occurring aFGF.
  • Enhanced stability is achieved by substituting at least one amino acid having higher loop-forming potential for an amino acid residue of lower loop-forming potential in the naturally occurring aFGF molecule in the area of about amino acids 90 to 97.
  • a preferred analog of the present invention incorporates the substitution of an amino acid having higher loop-forming potential for the histidine residue at amino acid position 93 in naturally occurring aFGF.
  • FIG. 1 shows the nucleic acid and amino acid sequences of recombinant bovine [Ala47,Gly93] aFGF.
  • FIG. 2 shows the amino acid sequence of recombinant human [Alal6,Gly93] aFGF.
  • FIG. 3 demonstrates the elution profiles for bovine [Ala-47] and [Ala47 f Gly93] aFGF analogs using hydrophobic interaction chromatography.
  • FIGS. 4A and 4B shows the circular dichroic spectra for bovine [Ala ⁇ 7] a nd [Ala47,ciy93] aFGF analogs.
  • FIG. 6 is a graph showing a plot of the log of the concentration of bovine [Ala*47] and [Ala*47,Gly93] a FGF analogs and human [Ser70,ser88] bFGF versus the percentage of maximal stimulation.
  • FIG. 7 is a graph showing the loss of activity over time of bovine [Ala47] and [Ala47,Gly93] a FGF analogs in the absence of heparin as compared with human [Ser70,ser88] bFGF.
  • FIG. 8 shows the structure of the bovine [Ala*47 f Gly93] aFGF analog of the present invention, as determined by X-ray crystallography.
  • Novel analogs of aFGF are provided in accordance with the present invention. These analogs exhibit improved stability and enhanced biological activity, as compared with naturally occurring aFGF, in the absence of heparin.
  • the aFGF analogs of the present invention have at least one different amino acid residue from naturally occurring aFGF in the area of about amino acid residues 90 to 97 (based on the numbering of the known amino acid sequence for bovine aFGF, as shown in
  • the different amino acid(s) is selected for its higher loop-forming potential in order to stabilize this area of the aFGF molecule.
  • Amino acids having relatively high loop-forming potential include glycine, proline, tyrosine, aspartic acid, asparagine, and serine. Leszcynski et al, Science, 234, 849-855 (1986) (relative values of loop-forming potential assigned on the basis of frequency of appearance in loop structures of naturally occurring molecules) .
  • a different amino acid having higher loop-forming potential replaces the histidine residue at amino acid position 93 of naturally occurring aFGF. Still more preferably, the histidine residue at amino acid position 93 is replaced with a glycine residue.
  • the aFGF analog of the present invention may also optionally include an amino acid substitution for non-conserved cysteine residues (i.e., the cysteine residue at position 47 of the bovine aFGF molecule and the cysteine residue at position 16 of the human aFGF molecule) .
  • the aFGF analogs of the present invention which are expressed from E. coli host cells may include an initial methionine amino acid residue (i.e., at position -1, as shown in Fig. 1) .
  • one or more of the terminal amino acid residues may be deleted from the DNA sequence, as is known to those skilled in the art, while substantially retaining the enhanced biological activity of the aFGF analog.
  • DNA sequences coding for all or part of aFGF analogs are also provided according to the present invention. Such sequences preferably may include the incorporation of codons "preferred" for expression by selected E. coli host strains ("_7. coli expression codons") , the provision of sites of cleavage by restriction endonuclease enzymes, and/or the provision of additional initial, terminal, or intermediate DNA sequences which facilitate construction of readily expressed vectors.
  • These novel DNA sequences include sequences useful in securing the expression of the aFGF analogs of the present invention in both eucaryotic and procaryotic host cells, such as E. coli .
  • the DNA sequences of the present invention may comprise the DNA sequence set forth in Fig. 1, wherein at least one codon encoding an amino acid residue in the area of about amino acids 90 to 97 is replaced by a codon encoding a different amino acid residue having a higher loop-forming potential (hereinafter “analog sequence(s) ”) , as well as a DNA sequence which hybridizes to one of the analog sequences or to fragments thereof, and, a DNA sequence which, but for the degeneracy of the genetic code, would hybridize to one of the analog sequences.
  • the aFGF analogs of the present invention can be encoded, expressed, and purified by any one of a number of recombinant technology methods known to those skilled in the art.
  • the preferred production method will vary depending upon many factors and considerations, including the cost and availability of materials and other economic considerations. The optimum production procedure for a given situation will be apparent to those skilled in the art through minimal experimentation.
  • the analogs of the present invention can be expressed at particularly high levels using E. coli host cells, with the resulting expression product being subsequently purified to near homogeneity using procedures known in the art.
  • a typical purification procedure involves first solubilizing the inclusion bodies containing the aFGF analogs, followed by ion exchange chromatography, then refolding of the protein, and, finally, hydrophobic interaction chromatography.
  • the aFGF analogs of the present invention exhibit a surprising degree of enhanced biological activity in the absence of heparin. While it is known that more stable bFGF analogs can be obtained through the substitution of serine or other neutral amino acids in place of certain cysteine residues (for example, as disclosed in published PCT Patent Application No. 88/04189), substitution for the non-conserved cysteine residue at position 47 of naturally occurring bovine aFGF alone is not believed to be significant in enhancing the biological activity and/or stability of an aFGF analog.
  • bovine [Ala 7 ,Gly93] aFGF analog of the present invention unlike the bovine [Ala 47 ] analog, exhibited enhanced stability, maintaining its original itogenic activity in the absence of heparin over the course of 250 hours, while the bovine [Ala 47 ] analog rapidly lost activity.
  • the bovine [Ala 47 ,Gly93] aFGF analog was crystallized, and the resulting crystals examined by X-ray crystallography.
  • the X-ray crystallographic data obtained from examination of these crystals supports the suggestion from the hydrophobic interaction chromatography data that residue 93 is exposed to solvent; i.e., that the glycine for histidine substitution at position 93 makes the molecule less hydrophilic.
  • Detailed examination of the bovine [Ala 47 ,Gly93] aFGF analog sequence around residue 93 revealed a clustering of approximately 8 amino acids with high loop-forming potentials in the region from about the glutamic acid residue at position 90 to about the tyrosine residue at position 97.
  • aFGF analogs in addition to the preferred [Gly93] analog specifically set forth herein, are contemplated by the present invention. These other analogs could easily be made by one skilled in the art by following the teachings provided herein. For example, there are no fewer than fifteen amino acids reported to have higher loop-forming potential than histidine. Leszcynski et al . These amino acids are, in descending order of loop-forming potential, glycine, proline or tyrosine, aspartic acid or asparagine, serine, cysteine, glutamic acid, threonine, lysine, cystine, gluta ine, arginine, phenylalanine, and tryptophan.
  • amino acid substitutions at position 93 are seen to include proline, tyrosine, aspartic acid, asparagine, serine, glutamic acid, threonine, lysine, glutamine, arginine, phenylalanine, and tryptophan.
  • the present invention also contemplates the substitution of an amino acid having high loop-forming potential for other amino acid residues within the amino acid 90 to 97 region of naturally occurring aFGF (i.e., amino acids 90-92 and 94-97) .
  • the aFGF analogs of the present invention include, for example, aFGF analogs having the threonine residue at position 96 of naturally occurring aFGF replaced with glycine, proline or tyrosine, aspartic acid or asparagine, serine, or glutamic acid, in order of preference, although minimal enhancement of stability and/or biological activity would be expected with the substitution of glutamic acid for threonine, due the similarity of loop-forming potential of these two amino acids.
  • the glutamic acid residues at positions 90 and 91 could be replaced with glycine, proline or tyrosine, aspartic acid or asparagine, or serine, again in order of preference.
  • amino acid residues at positions 92, 94, 95, and 97 (asparagine, tyrosine, asparagine, and tyrosine, respectively) of naturally occurring aFGF have sufficiently high loop-forming potential that minimal benefits are envisioned to arise from substitution for these particular residues.
  • aFGF analogs of the present invention are seen to encompass analogs of both human and bovine aFGF, as well as all forms of aFGF having the following amino acid sequence from amino acids 90 to 97 :
  • Both the human and bovine forms of aFGF are known, and have been identified as having the identical amino acid sequence (shown above) at positions 90 to 97. Moreover, there is approximately 92% sequence identity between human and bovine aFGF, and a 97% "similarity" (i.e., 5% of the total 8% changes between the two aFGF forms are "conservative") . Both the human and bovine forms of naturally occurring aFGF exhibit substantially the same in vitro mitogenic activity.
  • novel biologically active aFGF analogs of the present invention are particularly well suited for use in pharmaceutical formulations for the treatment by physicians and/or veterinarians of many types of wounds of mammalian species.
  • the amount biologically active aFGF analog used in such treatments will, of course, depend upon the severity of the wound being treated, the route of administration chosen, and the specific activity or purity of the aFGF analog, and will be determined by the attending physician or veterinarian.
  • the term "aFGF analog therapeutically effective" amount refers to the amount of aFGF analog determined to produce a therapeutic response in a mammal. Such therapeutically effective amounts are readily ascertained by one of ordinary skill in the art.
  • the aFGF analogs of the present invention may be administered by any route appropriate to the wound or condition being treated.
  • Conditions which may be beneficially treated with therapeutic application(s) of the aFGF analog of the present invention include but are not limited to, the healing of surface wounds, bone healing, angiogenesis, nerve regeneration, and organ generation and/or regeneration.
  • the formulations of the present invention comprise a therapeutically effective amount of aFGF analog together with one or more pharmaceutically acceptable carriers therefore and optionally other therapeutic ingredients.
  • the carrier(s) must be "acceptable” in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof.
  • the formulations may be conveniently presented in unit dosage form and may be prepared by any of the methods well known in the art. All methods include the step of bringing into association the active ingredient with the carrier which constitutes one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association the aFGF with liquid carriers or finely divided solid carriers or both.
  • a bovine aFGF analog according to the present invention was prepared and examined in the following examples.
  • This analog bovine [Ala 47 ,Gly93] aFGF, was constructed to contain both a desired amino acid substitution (glycine for histidine at position 93) in the residue 90 to 97 region of the aFGF molecule and an additional amino acid substitution of alanine for the non-conserved cysteine residue at position 47, as shown in Fig. 1.
  • a bovine [Ala 47 ] aFGF analog, having only the amino acid substitution of alanine for cysteine was also prepared for use as a control for the desired bovine [Ala 7,Gly93] a FGF analog.
  • a synthetic gene coding for the [Ala 7,Gly93] analog of bovine aFGF was assembled in two sections from a total of 28 component oligonucleotides.
  • the amino acid sequence of Gimenez-Gallego et al was used as the basis for this gene, with codon choices selected to optimize expression of the analog in E. coli .
  • Gimenez- Gallego et al Science, 230, 1385-1388 (1985) .
  • Section I was assembled from 16 oligonucleotides to yield a 287 nucleotide fragment which could be inserted into a plasmid vector at Xba I and Xho I restriction endonuclease sites.
  • Section II was assembled from 12 oligonucleotides to give a 170 nucleotide fragment bounded by Xho I and Bam HI compatible ends. The two sections were inserted into the expression plasmid pCFM1156, which had been previously digested with Xba I and Bam HI in a 3-component ligation, yielding the complete aFGF gene under the control of the lambda pL promoter.
  • the plasmid pCFM1156 is prepared from the known plasmid pCFM836.
  • the preparation of plasmid pCFM836 is described in U.S. Patent No. 4,710,473, the relevant portions of the specification, particularly examples 1 to 7, are hereby incorporated by reference.
  • the resulting plasmid is then digested with Cla I and Kpn I and the excised DNA fragment is replaced with a DNA oligonucleotide of the following sequence:
  • E. coli cells transformed with this plasmid were grown in a 16-liter fermentation vessel as described in Fox et al, J. Biol . Chem. , 263, 18452-18458 (1988).
  • the gene coding for the bovine [Gly93 ; ,Ala 4 7] aFGF was converted to the [Ala 47 ] form using oligo site- directed mutagenesis.
  • the aFGF gene was first transferred into the phage vector M13mpl8 and single- stranded DNA to serve as a template for the mutagenesis reaction was prepared. Approximately 0.5 ⁇ g of this DNA was mixed with 5 picomoles each of the mutagenic primer (5' GAAGAAAACCATTACAACAC 3') and the Ml3 universal primer used for DNA sequencing, heated to 65°C for 3 minutes, and allowed to slow cool.
  • the annealed template-primer was mixed with ATP, a dNTP mixture, DNA polymerase I large fragment, and T4 DNA ligase, then incubated at 15°C for 4 hours. Aliquots of this reaction mixture were added to competent E. coli JMlOl cells and plated in 0.7% L-agar. The resulting plaques were replicated onto nitrocellulose filters, and the filters were hybridized with 32p- ⁇ a beled mutagenic primer. DNA prepared from phage which hybridized was sequenced to verify successful completion of the desired mutagenesis event. The resultant gene was then transferred back to the pCFM1156 vector for expression of the recombinant protein. Purification
  • E. coli cells expressing the recombinant protein The pellet fraction was solubilized in 8 M urea, 0.1 M glycine, pH 2,5, and centrifuged to remove insoluble materials. The supernatant was loaded onto an S- Sepharose® (Pharmacia, Uppsala, Sweden) column equilibrated with 6 M urea, 10 mM glycine, pH 3.0, and washed with 6 M urea, 20 mM sodium citrate, pH 6.5. Proteins which bound to the column were eluted with a linear 0 to 0.5 M sodium chloride gradient in 20 mM sodium citrate, pH 6.5.
  • the fractions containing the aFGF were pooled, diluted 20-fold with 20 mM sodium citrate,0.1 M ammonium sulfate, and centrifuged to remove any precipitate.
  • the supernatant was mixed with one volume of 20 mM sodium citrate, 2 M ammonium sulfate, and loaded onto a phenyl-Sepharose® column equilibrated with 20 M sodium citrate, 1 M ammonium sulfate, pH 6.5.
  • the bound proteins were eluted from the column with a linear descending gradient (1 M to 0 M) of ammonium sulfate.
  • the aFGF-containing fractions were pooled and dialyzed against 20 mM sodium citrate, pH 6.5. This product was essentially homogeneous, as demonstrated by fact that no other bands in Coomassie blue appeared in the SDS gel, as shown in Fig. 4.
  • Hydrophobic interaction chromatography was performed at room temperature using a phenyl-Superose® column on a Pharmacia FPLC system.
  • the sample in 2 M ammonium sulfate, 20 mM sodium citrate, pH 6.5, was loaded onto the column which had been equilibrated with 2 M ammonium sulfate. After a 2 M sodium chloride wash, the remaining protein was eluted with an ammonium sulfate gradient descending from 2 M to 0 M, followed by a final wash with 20 mM sodium citrate, pH 6.5.
  • Fig. 3 presents the elution profiles for the bovine [Ala 47 ] and [Ala 47 ,Gly93] aFGF analogs.
  • the [Ala *47 ] aFGF showed a major peak eluting at 0.25 M ammonium sulfate, while the [Ala 47 ,Gly93] aFGF analog showed a single peak at 0.13 M ammonium sulfate, suggesting that both proteins exist primarily in a single distinct conformation.
  • Circular dichroic spectra were determined at room temperature on a Jasco Model J-500C spectrophotometer (Jasco, Tokyo, Japan) equipped with an Oki If 800 Model 30 computer (Oki, Tokyo, Japan) . Measurements were carried out at a band width of 1 nm using cuvettes of 1 and 0.02 cm for the near and far ultraviolet ranges, respectively. The data were expressed as the mean residue ellipticity, [ ⁇ ] , calculated using the mean residue weight of 113 for both forms of aFGF.
  • Circular dichroism (CD) spectra of the bovine [Ala 47 ,Gly93] and [Ala 47 ] aFGF analogs were nearly identical in both the far and near ultraviolet regions, as shown in Figs. 4A and 4B, respectively.
  • the CD of the analogs were also very similar to the spectrum reported for human bFGF. (Arakawa, et al, BBRC, 161, 335-341 (1989) .
  • the similarity of the spectra in the near ultraviolet region is consistent with similar tertiary structures for the FGFs.
  • the thermal transition of proteins was determined on a Response II spectrophotometer (Gilford, Medfield, Massachusetts) equipped with thermal programming and a thermal cuvette holder. Samples were heated at an increment of 0.l°C/min or 0.5°C/min and their absorbance monitored at 287 nm. Protein concentrations were determined spectrophotometrically using an extinction coefficient of 0.98 for bFGF and 1.04 for both bovine aFGF analogs at 280 nm for 0.1% protein.
  • FTIR Fourier-transform infrared
  • Second derivative spectra were calculated as described in in Susi et al, Bioche . Biophy ⁇ . Res . Comm. , 115, 391-397 (1983) .
  • a 9 point smoothing function was applied to the water vapor-subtracted spectra.
  • the frequencies of the component bands in this region are related to secondary structure content.
  • Surewicz et al Biochem . Biophys . Acta, 952, 115-130 (1988) .
  • the spectra show strong bands at 1630 and 1685 cm ⁇ l which are indicative of a significant amount of ⁇ -structures in the two proteins.
  • a strong band near 1647 cm _ l is indicative of the presence of irregular or disordered structures.
  • Heparin-Sepharose® (Pharmacia) was packed into a 1 x 8 cm column and equilibrated with 10 mM Tris-HCl, pH 7.2. The column was loaded, washed with 10 mM Tris-HCl, pH 7.2 and eluted with a linear gradient from 0 to 2.8 M sodium chloride in the same buffer at a flow rate of 0.5 ml/min using a Pharmacia FPLC system.
  • Acidic and basic FGF are distinguished by their avid binding to heparin and heparin-like molecules. Both the bovine [Ala 4 7,Gly93] and [Ala 4 7] aFGF analogs showed a single peak eluting at 1.54 M sodium chloride in 10 mM Tris-HCl, pH 7.2.
  • NIH 3T3 cells were obtained from ATCC. The cells were grown in DME supplemented with 10% calf serum, 10 units/ml penicillin, 2 mM glutamine and 10 units/ml streptomycin. Cells were passaged at a ratio of 1:40 two times per week. On day 1 of the assay, subconfluent cultures were trypsin dispersed and plated into 24-well plates at a concentration of 20,000 cells/ml, 1 ml per well in the above media. On day 5, the media was replaced with 1 ml/well DMEM without serum but containing penicillin, streptomycin, and glutamine at the above concentrations. On day 6, experimental samples were added to the media in volumes no greater than 100 ⁇ l.
  • cells were pulsed for 1 hour with 1 ml of the above media containing 2 10 ⁇ Ci of tritiated thymidine at 37°C. After the pulse, cells were washed once with media, then 250 mM sucrose, 10 mM sodium phosphate, 1 mM EDTA, pH 8 was added and the plates incubated at 37°C for 10 minutes to release the cells. Cells were harvested on a Skatron harvester. (Skatron, Inc., Sterling, Virginia.) Filters were dried, placed in scintillation fluid, and counted in a Beckman scintillation counter. (Beckman Instruments, Inc., Fullerton, California.)
  • the mitogenic activity of the bovine [Ala 47 ,Gly93] and [Ala 47 ] aFGF analogs on NIH 3T3 cells was examined as shown in Fig. 6.
  • the [Ala 47 ] aFGF analog produced a dose dependent stimulation of 3 ⁇ -thymidine uptake in the range of 1 to 100 ng/ml, with half-maximal stimulation of 25 ng/ml.
  • the [Ala 7 ,Gly93] aFGF analog was able to produce the same mitogenic effect at a much lower protein concentration, the half-maximal dose being about 1 ng/ml.
  • Recombinant bFGF was 4-5 times more potent than the [Ala 47 ,Gly93] aFGF, with a half-maximal dose of 220 pg/ l.
  • aFGF analog remaining more potent.
  • the activities were enhanced such that the dose response of all three molecules were nearly identical, with a half- maximal dose of 90 pg/ml.
  • aFGF analogs The stability of the aFGF analogs, as determined by retention of their respective mitogenic activity, was examined by incubation of a 0.1 mg/ml solution of each FGF analog in 20 mM sodium citrate, pH 7 at 37°C, both in the presence and absence of 1 mg/ml heparin.
  • bovine [Ala 47 ] aFGF analog rapidly lost activity, with a half-life of about 13 hours, as shown in Fig. 7.
  • bovine [Ala 47 ] aFGF lost no biological activity over the 250 hour course of the experiment.
  • bovine [Ala 47 ,Gly 3] aFGF analog nor the human [Ser 7 0,Ser88] bFGF analog exhibited any loss of activity over the 250 hours, whether or not heparin was present.
  • Crystals of bovine [Ala 47 ,Gly93] aFGF analog were grown by vapor diffusion against 0.2 M NH4SO4, 2 M NaCl, 0.099 M sodium citrate, and 0.02 M sodium potassium phosphate, pH 5.6.
  • the protein droplet contained equal volumes of the reservoir solution and a 10 mg/ml protein solution.
  • the crystals were trigonal (space group

Abstract

Sont décrits de nouveaux analogues du aFGF. Ces analogues sont plus stables et présentent, en l'absence d'héparine, une activité biologique accrue par rapport au aFGF existant à l'état naturel. Cette stabilité améliorée peut être obtenue par substitution d'au moins un acide aminé ayant un potentiel supérieur de bouclage à un résidu aminoacide ayant un potentiel inférieur de bouclage dans la molécule d'aFGF, existant à l'état naturel, dans la région des acides aminés 90 à 97. Ces nouveaux analogues sont particulièrement utiles dans des applications thérapeutiques.
PCT/US1991/009441 1990-12-18 1991-12-17 Analogues du facteur de croissance acide des fibroblastes presentant une stabilite et une activite biologique ameliorees WO1992011360A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP4503720A JPH06503962A (ja) 1990-12-18 1991-12-17 増強された安定性及び生物学的活性を有する酸性線維芽細胞成長因子の類似体
AU91524/91A AU663067B2 (en) 1990-12-18 1991-12-17 Analogs of acidic fibroblast growth factor having enhanced stability and biological activity
KR1019930701853A KR930703439A (ko) 1990-12-18 1993-06-17 산성 섬유아세포 성장인자(aFGF)의 동족체 및 이를 이용한 창상 치료 방법

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US63245690A 1990-12-18 1990-12-18
US632,456 1990-12-18

Publications (1)

Publication Number Publication Date
WO1992011360A1 true WO1992011360A1 (fr) 1992-07-09

Family

ID=24535601

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1991/009441 WO1992011360A1 (fr) 1990-12-18 1991-12-17 Analogues du facteur de croissance acide des fibroblastes presentant une stabilite et une activite biologique ameliorees

Country Status (9)

Country Link
EP (1) EP0575339A4 (fr)
JP (1) JPH06503962A (fr)
KR (1) KR930703439A (fr)
AU (1) AU663067B2 (fr)
CA (1) CA2098484A1 (fr)
IE (1) IE914393A1 (fr)
IL (1) IL100418A0 (fr)
NZ (1) NZ241021A (fr)
WO (1) WO1992011360A1 (fr)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2717495A1 (fr) * 1994-03-18 1995-09-22 Rhone Poulenc Rorer Sa Virus recombinants, préparation et utilisation en thérapie génique.
WO1996022369A1 (fr) * 1994-10-13 1996-07-25 Amgen Inc. Analogues de facteur de croissance du fibroblaste acide a stabilite et activite biologique renforcees
EP1334981A3 (fr) * 1994-10-13 2004-05-06 Amgen Inc. Méthode de purification de facteurs de croissance des kératinocytes
US6743422B1 (en) 1996-10-15 2004-06-01 Amgen, Inc. Keratinocyte growth factor-2 products
AU782819B2 (en) * 1999-04-15 2005-09-01 Caritas St. Elizabeth's Medical Center Of Boston, Inc. Angiogenic growth factors for treatment of peripheral neuropathy
US7125856B1 (en) 1999-04-15 2006-10-24 St. Elizabeth's Medical Center Of Boston, Inc. Angiogenic growth factors for treatment of peripheral neuropathy
EP1825862A1 (fr) * 2005-12-09 2007-08-29 Henrich Cheng Méthode de traitement et vecteur pour le traitement d'une lésion nerveuse
WO2009048119A1 (fr) * 2007-10-12 2009-04-16 National Institute Of Advanced Industrial Science And Technology Composition médicinale contenant une protéine chimère extrêmement fonctionnalisée

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2733207B2 (ja) * 1995-05-18 1998-03-30 工業技術院長 繊維芽細胞成長因子キメラ蛋白質を含有する医薬組成物

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0241136A2 (fr) * 1986-03-07 1987-10-14 The President And Fellows Of Harvard College Facteur de croissance humaine classe 1, liant l'héparine
EP0319052A2 (fr) * 1987-10-22 1989-06-07 Merck & Co. Inc. Mutéine de facteur de croissance de fibroblaste

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1989000198A1 (fr) * 1987-07-07 1989-01-12 Biotechnology Research Associates, J.V. Facteurs de croissance de fibroblastes recombinants
DE3909009A1 (de) * 1989-03-18 1990-09-20 Schloemann Siemag Ag Stranggiessanlage zum giessen von vorprofilen

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0241136A2 (fr) * 1986-03-07 1987-10-14 The President And Fellows Of Harvard College Facteur de croissance humaine classe 1, liant l'héparine
EP0319052A2 (fr) * 1987-10-22 1989-06-07 Merck & Co. Inc. Mutéine de facteur de croissance de fibroblaste

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
Biochem. Biophys. Res. Commun., Vol. 164, No. 3, issued 15 November 1989, MERGIA et al., "Structural analysis of the gene for human acidic fibroblast growth factor", pages 1121-1129, see entire document. *
Biochemistry, Vol. 25, No. 5, issued 11 March 1986, STRYDOM et al., "Amino acid sequence of bovine brain derived class 1 heparin binding growth factor", pages 945-951, see entire document. *
Proc. Natl. Acad. Sci., Vol. 83, issued October 1986, BURGESS et al., "Structural evidence that endothelial cell growth factor beta is the precursor of both endothelial cell growth factor alpha and acidic fibroblast growth factor", pages 7216-7220, see entire document. *
Science, Vol. 230, issued 20 December 1985, GIMENEZ-GALLEGO et al., "Brain-derived acidic fibroblast growth factor: Complete amino acid sequence and homologies", pages 1385-1388, see entire document. *
See also references of EP0575339A4 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2717495A1 (fr) * 1994-03-18 1995-09-22 Rhone Poulenc Rorer Sa Virus recombinants, préparation et utilisation en thérapie génique.
WO1995025803A1 (fr) * 1994-03-18 1995-09-28 Rhone-Poulenc Rorer S.A. ADENOVIRUS RECOMBINANTS CODANT POUR LE FACTEUR DE CROISSANCE DES FIBROBLASTES ACIDES (aFGF)
WO1996022369A1 (fr) * 1994-10-13 1996-07-25 Amgen Inc. Analogues de facteur de croissance du fibroblaste acide a stabilite et activite biologique renforcees
EP1334981A3 (fr) * 1994-10-13 2004-05-06 Amgen Inc. Méthode de purification de facteurs de croissance des kératinocytes
US6743422B1 (en) 1996-10-15 2004-06-01 Amgen, Inc. Keratinocyte growth factor-2 products
AU782819B2 (en) * 1999-04-15 2005-09-01 Caritas St. Elizabeth's Medical Center Of Boston, Inc. Angiogenic growth factors for treatment of peripheral neuropathy
US7125856B1 (en) 1999-04-15 2006-10-24 St. Elizabeth's Medical Center Of Boston, Inc. Angiogenic growth factors for treatment of peripheral neuropathy
EP1825862A1 (fr) * 2005-12-09 2007-08-29 Henrich Cheng Méthode de traitement et vecteur pour le traitement d'une lésion nerveuse
WO2009048119A1 (fr) * 2007-10-12 2009-04-16 National Institute Of Advanced Industrial Science And Technology Composition médicinale contenant une protéine chimère extrêmement fonctionnalisée

Also Published As

Publication number Publication date
EP0575339A4 (fr) 1995-04-05
NZ241021A (en) 1993-12-23
CA2098484A1 (fr) 1992-06-19
AU663067B2 (en) 1995-09-28
EP0575339A1 (fr) 1993-12-29
IL100418A0 (en) 1992-09-06
AU9152491A (en) 1992-07-22
JPH06503962A (ja) 1994-05-12
KR930703439A (ko) 1993-11-30
IE914393A1 (en) 1992-07-01

Similar Documents

Publication Publication Date Title
AU638402B2 (en) Analogs of fibroblast growth factor
AU663298B2 (en) Heparin binding mitogen with homology to epidermal growth factor (EGF)
US5461034A (en) Osteogenic growth polypeptides identified from regenerating bone marrow
CZ297329B6 (cs) Analog nativního keratinocytového rustového faktoru kovalentne pripojený k polyethylenglykolu nebo príbuznému vodorozpustnému organickému polymeru, jeho pouzití a in vitro zpusob stimulace produkce nefibroblastových epithelových bunek
US5223483A (en) Cysteine-modified acidic fibroblast growth factor
CA2201944C (fr) Analogues du facteur de croissance des keratinocytes ayant une stabilite de temperature amelioree
AU663067B2 (en) Analogs of acidic fibroblast growth factor having enhanced stability and biological activity
EP0319052B1 (fr) Mutéine de facteur de croissance de fibroblaste
Arakawa et al. Production and characterization of an analog of acidic fibroblast growth factor with enhanced stability and biological activity
CN1323167C (zh) 1型胎盘生长因子的突变蛋白及其制备方法和应用
EP0384731B1 (fr) Facteurs de croissance ostéogéniques identifiés à partir de moelle osseuse régénératrice
US5409897A (en) Cysteine-modified acidic fibroblast growth factor and methods of use
MXPA97002475A (en) Analogues of the fibroblast acid growth factor that have stability and biological acticity improves
EP0494664A1 (fr) Dérivés du bFGF humain, leurs analogues et procédé pour leur production
CA1340639C (fr) Facteur de croissance acide mutant des fibroblastes
CA2079291A1 (fr) Activite du facteur de croissance des fibroblastes
JPH07267992A (ja) 新規なタンパク質ｐｈｂｐ−７０

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP KR

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IT LU MC NL SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2098484

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1992902895

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1992902895

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1992902895

Country of ref document: EP