NZ241021A

NZ241021A - Analogues of acidic fibroblast growth factor and pharmaceutical

Info

Publication number: NZ241021A
Application number: NZ241021A
Authority: NZ
Inventors: Arakawa Tsutomu; Gary Michael Fox
Original assignee: Amgen Inc
Priority date: 1990-12-18
Filing date: 1991-12-17
Publication date: 1993-12-23
Also published as: AU9152491A; JPH06503962A; KR930703439A; IE914393A1; CA2098484A1; EP0575339A4; WO1992011360A1; EP0575339A1; IL100418A0; AU663067B2

Description

<div class="application article clearfix" id="description"> 24 1 0 2 1 Prior ty LI' :• . ; r." ?■.' :: . Class: S.f<?C^ .Ofc,; . Awwmiioz. ! Publica'.io:; Sc*: ..? S .?« W j P.O. Jcjrnw!, No: ... .IS^S I NEW ZEALAND PATENTS ACT. 1953 r =i? -.v - No.: f " "' " Date: COMPLETE SPECIFICATION analogs of acidic fibroblast growth factor having enhanced stability and biological activity 17We, amgen inc., a corporation of the State of Delaware, United States of America of 1840 Dehavilland Drive, Thousand Oaks, California 91320-1789, United States of America hereby declare the invention for which •£ / we pray that a patent may be granted to me/us, and the method by which it is to be performed, to be particularly described in and by the following statement:- - 1 - (followed by page la) 24 1 02 - lQ- ANALOGS OF ACIDIC FIBROBLAST GROWTH FACTOR HAVING ENHANCED STABILITY AND BIOLOGICAL ACTIVITY Background 5 The complex process of healing which follows injury to tissue, such as by wounding or burning, is mediated by a number of protein factors, sometimes referred to as soft tissue growth factors. These factors are required 10 for the growth and differentiation of new cells to replace the destroyed tissue. Included within this group of soft tissue growth factors is a protein family of fibroblast growth factors (FGFs). The FGFs are mitogenic and chemotactic for a variety of cells of 15 epithelial, mesenchymal, and neural origins. In addition, FGFs are angiogenic, that is they are able to stimulate the formation of blood vessels. Acidic FGF (aFGF) and basic FGF (bFGF) are 20 considered to be two "original" members of the FGF family. Both aFGF and bFGF are believed to be derived from the same ancestral gene, with both molecules having approximately 55% sequence identity in addition to the same intron/exon structure. Acidic FGF and bFGF are 25 also known to bind to the same receptor, although the existence of specific aFGF and bFGF receptors has not been ruled out. Several molecular weight forms of aFGF and bFGF are found in different tissues. However, Southern blotting experiments suggest that there is only 30 one gene each for aFGF and bFGF, with differences between these molecules probably being due to post-translational processing. Both acidic and basic FGF are mitogens for a wide variety of cell types of mesodermal and neuroectodermal origin, and are able to induce 35 angiogenesis both in vitro and in vivo. See, e.g., 24 1 0 2 1 - 2 - Gospodarowicz et al, Exp. Eye Res., 28, 501-514 (1979). The range of biological activities of the two classes is nearly identical, although bFGF is about ten times more potent than aFGF in most bioassay systems. 5 A shared distinguishing feature of aFGF and bFGF is the propensity of these factors to bind tightly to heparin. The affinity of aFGF for heparin appears to be weaker than for bFGF, with aFGF having an anionic 10 isoelectric point. Thomas et al, Proc. Nat. Acad. Sci. USA, 82, 6409-6413 (1984). The unique heparin binding property of aFGF and bFGF has greatly facilitated purification of these factors. 15 The discovery that FGFs have strong affinity for immobilized heparin has also spurred investigation into the regulatory role of heparin-like molecules in the in vivo biology of FGFs. Although the full spectrum of functions for heparin has yet to be determined, it is 20 known that heparin can regulate FGF function in several ways. Lobb, Eur. J. Clin. Invest., 18, 321-326 (1988). For example, heparin-like molecules can play a direct role in FGF function, including the activation, or potentiation, of aFGFs. Uhlrich et al, Biochem. 25 Biophys. Res. Comm., 137, 1205-1213 (1986). There is, however, no direct correlation between the affinity of the FGF for immobilized heparin and its ability to be potentiated by soluble heparin. In this 30 respect, the potentiating power of heparin appears to be selective for aFGF. For example, Uhlrich et al, ibid, found the degree of potentiation of pure aFGF to be about ten times greater than that of pure bFGF, raising the potency of the aFGF to approximately the same level 35 as that of bFGF. However, in the presence of fetal calf - 3 - 24 1021 serum, the potentiating effect of heparin was found to decrease significantly. Uhlrich et al, ibid. The use of FGF proteins is believed to be effective 5 in promoting the healing of tissue subjected to trauma. The unique angiogenic property of FGFs makes these factors especially valuable in the healing of deep wounds. The bFGF native proteins have been alleged to be useful in the treatment of myocardial infarction. 10 U.S. Patents No. 4,296,100 and 4,378,347. In addition, human bFGF has been found to increase neuronal survival and neurite extension in fetal rat hippocampal neurons, suggesting that this factor may also be useful in the treatment of degenerative neurological disorders, such 15 as Alzheimer's disease and Parkinson's disease. Wallicke et al, Proc. Natl. Acad. Sci. USA, 83, 3012-3016 (1986). A major stumbling block to the effective use of 20 aFGF in therapeutic applications appears to be related to its significantly lower biological activity, as compared with bFGF. Although studies with heparin suggest that the observed difference in potency between aFGF and bFGF can be substantially diminished by using 25 heparin to boost the activity of aFGF to a level comparable to that of bFGF, the use of heparin in pharmaceutical preparations may not always be desirable. In this regard, it is important to note that heparin, a highly sulphated glycosaminoglycan of heterogeneous 30 structure, is known to be an anticoagulant which functions by accelerating the rate at which antithrombin III inactivates the proteases of homeostasis. Jacques, Pharmacol Rev, 31, 99-166 (1980). It is not known whether it might be deleterious to use heparin in a 35 pharmaceutical preparation for the treatment of deep 241021 - 4 - wounds, where some degree of coagulation may be desired to achieve proper healing. In addition, practical considerations can be 5 expected to arise where heparin is incorporated into a pharmaceutical preparation for wound healing. Drug delivery concerns include the matter of controlling the composition of the pharmaceutical preparation (containing the combination of aFGF and heparin) upon 10 entry into the patient's body. Moreover# the negative effect of fetal calf serum on the potentiating effect of heparin on aFGF, observed by Uhlrich et al, suggest that any advantage obtained by including heparin in the pharmaceutical preparation as an activating or 15 potentiating factor for aFGF could be completely negated or lost once it made contact with the patient's own serum. It is an object of the present invention to provide 20 an analog of aFGF which exhibits enhanced stability and biological activity in the absence of heparin. It is a further object of the present invention to provide an aFGF analog for therapeutic use. 25 Summary of the Invention The present invention provides novel analogs of aFGF which are more stable and exhibit enhanced biological activity of at least substantially ten times that of naturally occurring aFGF in the absence of heparin. Enhanced stability is achieved by substituting at least one amino acid having higher loop-forming potential for an amino acid residue of lower loop-forming potential in the naturally occurring aFGF molecule in the area of about amino acids 35 90 to 97. A preferred analog of the present invention 23 MOV 1993 - 5 - 24 1 0 2 1 incorporates the substitution of an amino acid having higher loop-forming potential for the histidine residue at amino acid position 93 in naturally occurring aFGF. 5 Brief Desrrintion of t-he> nravHnoa FIG. 1 shows the nucleic acid and amino acid sequences of recombinant bovine [Ala47,Gly93] aFGF. 10 FIG. 2 shows the amino acid sequence of recombinant human [Ala16,Gly93] aFGF. FIG. 3 demonstrates the elution profiles for bovine [Ala47] and [Ala47,Gly93] aFGF analogs using hydrophobic 15 interaction chromatography. FIGS. 4A and 4B shows the circular dichroic spectra for bovine [Ala47] and [Ala47,Gly93] aFGF analogs. 20 FIG. 5 shows the second derivative FTIR spectra of bovine [Ala47] and [Ala47,Gly93] aFGF analogs in the amide I* (OO stretch in deuterated proteins) region. FIG. 6 is a graph showing a plot of the log of the 25 concentration of bovine [Ala47] and [Ala47,Gly93] aFGF analogs and human [Ser70/Ser88] bFGF versus the percentage of maximal stimulation. FIG. 7 is a graph showing the loss of activity over 30 time of bovine [Ala47] and [Ala47,Gly93] aFGF analogs in the absence of heparin as compared with human [Ser70,ser88] bFGF. 24 1 0 2 1 - 6 - FIG. 8 shows the structure of the bovine [Ala47,Gly93] aFGF analog of the present invention, as determined by X-ray crystallography. 5 Detailed Description of the Invention Novel analogs of aFGF are provided in accordance with the present invention. These analogs exhibit improved stability and enhanced biological activity, as 10 compared with naturally occurring aFGF, in the absence of heparin. The aFGF analogs of the present invention have at least one different amino acid residue from naturally occurring aFGF in the area of about amino acid residues 90 to 97 (based on the numbering of the known 15 amino acid sequence for bovine aFGF, as shown in Fig. 1). The different amino acid(s) is selected for its higher loop-forming potential in order to stabilize this area of the aFGF molecule. Amino acids having relatively high loop-forming potential include glycine, 20 proline, tyrosine, aspartic acid, asparagine, and serine. Leszcynski et al, Science, 234, 849-855 (1986) (relative values of loop-forming potential assigned on the basis of frequency of appearance in loop structures of naturally occurring molecules). Preferably, a 25 different amino acid having higher loop-forming potential replaces the histidine residue at amino acid position 93 of naturally occurring aFGF. Still more preferably, the histidine residue at amino acid position 93 is replaced with a glycine residue. 30 Other additions, substitutions, and/or deletions may be made to the aFGF analog of the present invention. For example, the aFGF analog may also optionally include an amino acid substitution for non-conserved cysteine 35 residues (i.e., the cysteine residue at position 47 of 24 1 0 2 1 - 7 - the bovine aFGF molecule and the cysteine residue at position 16 of the human aFGF molecule). In addition, the aFGF analogs of the present invention which are expressed from E. coli host cells may include an initial 5 methionine amino acid residue (i.e., at position -1, as shown in Fig. 1). Alternatively, one or more of the terminal amino acid residues may be deleted from the DNA sequence, as is known to those skilled in the art, while substantially retaining the enhanced biological activity 10 of the aFGF analog. DNA sequences coding for all or part of aFGF analogs are also provided according to the present invention. Such sequences preferably may include the 15 incorporation of codons "preferred" for expression by selected E. coli host strains ("E. coli expression codons"), the provision of sites of cleavage by restriction endonuclease enzymes, and/or the provision of additional initial, terminal, or intermediate DNA 20 sequences which facilitate construction of readily expressed vectors. These novel DNA sequences include sequences useful in securing the expression of the aFGF analogs of the present invention in both eucaryotic and procaryotic host cells, such as E. coli. 25 More specifically, the DNA sequences of the present invention may comprise the DNA sequence set forth in Fig. 1, wherein at least one codon encoding an amino acid residue in the area of about amino acids 90 to 97 30 is replaced by a codon encoding a different amino acid residue having a higher loop-forming potential (hereinafter "analog sequence(s)"), as well as a DNA sequence which hybridizes to one of the analog sequences or to fragments thereof, and, a DNA sequence which, but - 8 - 24 102 1 for the degeneracy of the genetic code, would hybridize to one of the analog sequences. The aFGF analogs of the present invention can be 5 encoded/ expressed, and purified by any one of a number of recombinant technology methods known to those skilled in the art. The preferred production method will vary depending upon many factors and considerations, including the cost and availability of materials and 10 other economic considerations. The optimum production procedure for a given situation will be apparent to those skilled in the art through minimal experimentation. The analogs of the present invention can be expressed at particularly high levels using 15 E. coli host cells, with the resulting expression product being subsequently purified to near homogeneity using procedures known in the art. A typical purification procedure involves first solubilizing the inclusion bodies containing the aFGF analogs, followed 20 by ion exchange chromatography, then refolding of the protein, and, finally, hydrophobic interaction chromatography. The aFGF analogs of the present invention exhibit a 25 surprising degree of enhanced biological activity in the absence of heparin. While it is known that more stable bFGF analogs can be obtained through the substitution of serine or other neutral amino acids in place of certain cysteine residues (for example, as disclosed in 30 published PCT Patent Application No. 88/04189), substitution for the non-conserved cysteine residue at position 47 of naturally occurring bovine aFGF alone is not believed to be significant in enhancing the biological activity and/or stability of an aFGF analog. 35 This is demonstrated by the lower activity exhibited by - 9 - 24 1 0 2 1 a bovine [Ala47] aFGF analog (cysteine substituted) compared with a bovine [Ala47,Gly93] aFGF analog (having the desired amino acid substitution in the residue 90 to 97 region of the aFGF molecule), as set forth in the 5 examples which follow. Specifically, the bovine [Ala47,Gly93] analog, although still less potent compared with the bFGF, was found to be approximately ten times more potent than the bovine [Ala47] aFGF analog. Upon the addition of 45 jig/ntl heparin, 10 bioactivity of all three forms of FGF was enhanced, with the bovine [Ala47,Gly93] analog, the bovine [Ala47,Gly93] analog, and human [Ser70,Ser88] bFGF analog having substantially identical potency. 15 The reason for the enhanced mitogenic activity and stability of the bovine [Ala47,Gly93] aFGF analog relative to bovine [Ala47] aFGF in the absence of heparin was not immediately clear. The substitution of glycine for the histidine residue at position 93 20 appeared to make the aFGF molecule somewhat more hydrophobic, but did not appear to drastically alter its tertiary structure, as determined by circular dichroism and FTIR spectroscopy. However, the relative differences in the activities observed in the in vitro 25 bioassays for the bovine [Ala47,Gly93] aFGF analog and for the bovine [Ala47] aFGF analog (with substitution at only position 47) suggested that the glycine-substituted amino acid 93 position of the bovine [Ala47,Gly93] aFGF analog might be within or near the region responsible 30 for receptor binding. Although the receptor binding region in aFGF has not been determined, position 93 in aFGF corresponds to a region in bFGF which is reported to be within or near the receptor binding domain. Baird et al, Proc. Nat. Acad. Sci. USA, 85, 2324-2328 (1988). 35 24 1 0 2 1 - 10 - In addition, the bovine [Ala47,Gly93] aFGF analog of the present invention, unlike the bovine [Ala47] analog, exhibited enhanced stability, maintaining its original mitogenic activity in the absence of heparin 5 over the course of 250 hours, while the bovine [Ala47] analog rapidly lost activity. The bovine [Ala47,Gly93] aFGF analog was crystallized, and the resulting crystals examined by 10 X-ray crystallography. The X-ray crystallographic data obtained from examination of these crystals supports the suggestion from the hydrophobic interaction chromatography data that residue 93 is exposed to solvent; i.e., that the glycine for histidine 15 substitution at position 93 makes the molecule less hydrophilic. Detailed examination of the bovine [Ala47,Gly93] aFGF analog sequence around residue 93 revealed a clustering of approximately 8 amino acids with high loop-forming potentials in the region from 20 about the glutamic acid residue at position 90 to about the tyrosine residue at position 97. The relative loop-forming potentials of amino acids have been reported, with glycine being identified as the amino acid residue having the highest loop-forming potential among all 25 amino acids. Leszcynski et al. Thus, the glycine for histidine substitution is believed to stabilize the presumed loop, due to the much higher loop-forming potential of the glycine residue, compared with histidine. 30 Other aFGF analogs, in addition to the preferred [Gly93] analog specifically set forth herein, are contemplated by the present invention. These other analogs could easily be made by one skilled in the art 35 by following the teachings provided herein. For - 11 - Ik 10; example, there are no fewer than fifteen amino acids reported to have higher loop-forming potential than histidine. Leszcynski et al. These amino acids are, in descending order of loop-forming potential, glycine, 5 proline or tyrosine, aspartic acid or asparagine, serine, cysteine, glutamic acid, threonine, lysine, cystine, glutamine, arginine, phenylalanine, and tryptophan. Substitution of any of these residues for the histidine residue at position 93 of naturally 10 occurring aFGF could be expected to result in an aFGF analog of the present invention having an enhanced biological activity. Of course, it will be preferred to replace the histidine residue at position 93 with amino acids having the highest possible loop-forming 15 potential, without creating any potential negative effects, such as the formation of undesired disulfide bonds through the insertion of additional cysteine or cystine residues. Thus other preferred amino acid substitutions at position 93 (i.e., in addition to 20 glycine) are seen to include proline, tyrosine, aspartic acid, asparagine, serine, glutamic acid, threonine, lysine, glutamine, arginine, phenylalanine, and tryptophan. 25 The present invention also contemplates the substitution of an amino acid having high loop-forming potential for other amino acid residues within the amino acid 90 to 97 region of naturally occurring aFGF (i.e., amino acids 90-92 and 94-97) . The aFGF analogs of the 30 present invention include, for example, aFGF analogs having the threonine residue at position 96 of naturally occurring aFGF replaced with glycine, proline or tyrosine, aspartic acid or asparagine, serine, or glutamic acid, in order of preference, although minimal 35 enhancement of stability and/or biological activity - 12 - 24 1 0 2 1 would be expected with for threonine, due the potential of these two glutamic acid residues 5 replaced with glycine, acid or asparagine, or preference. The amino acid residues at positions 92, 94, 95, 10 and 97 (asparagine, tyrosine, asparagine, and tyrosine, respectively) of naturally occurring aFGF have sufficiently high loop-forming potential that minimal benefits are envisioned to arise from substitution for these particular residues. 15 The aFGF analogs of the present invention are seen to encompass analogs of both human and bovine aFGF, as well as all forms of aFGF having the following amino acid sequence from amino acids 90 to 97: 20 90 91 92 93 94 95 96 97 -Glu-Glu-Asn-His-Tyr-Asn-Thr-Tyr- Both the human and bovine forms of aFGF are known, 25 and have been identified as having the identical amino acid sequence (shown above) at positions 90 to 97. Moreover, there is approximately 92% sequence identity between human and bovine aFGF, and a 97% "similarity" (i.e., 5% of the total 8% changes between the two aFGF 30 forms are "conservative"). Both the human and bovine forms of naturally occurring aFGF exhibit substantially the same in vitro mitogenic activity. Because of their enhanced stability and biological 35 activity in the absence of heparin, the novel the substitution of glutamic acid similarity of loop-forming amino acids. Likewise, the at positions 90 and 91 could be proline or tyrosine, aspartic serine, again in order of 24 1 0 - 13 - biologically active aFGF analogs of the present invention are particularly well suited for use in pharmaceutical formulations for the treatment by physicians and/or veterinarians of many types of wounds 5 of mammalian species. The amount biologically active aFGF analog used in such treatments will, of course, depend upon the severity of the wound being treated, the route of administration chosen, and the specific activity or purity of the aFGF analog, and will be 10 determined by the attending physician or veterinarian. The term "aFGF analog therapeutically effective" amount refers to the amount of aFGF analog determined to produce a therapeutic response in a mammal. Such therapeutically effective amounts are readily 15 ascertained by one of ordinary skill in the art. The aFGF analogs of the present invention may be administered by any route appropriate to the wound or condition being treated. Conditions which may be 20 beneficially treated with therapeutic application(s) of the aFGF analog of the present invention include but are not limited to, the healing of surface wounds, bone healing, angiogenesis, nerve regeneration, and organ generation and/or regeneration. 25 The formulations of the present invention, both for veterinary and for human use, comprise a therapeutically effective amount of aFGF analog together with one or more pharmaceutically acceptable carriers therefore and 30 optionally other therapeutic ingredients. The carrier(s) must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof. The formulations may be conveniently presented in unit 35 dosage form and may be prepared by any of the methods - 14 - 24 1 02 1 well known In the art. All methods include the step of bringing Into association the active ingredient with the carrier which constitutes one or more accessory ingredients. In general, the formulations are prepared 5 by uniformly and intimately bringing into association the aFGF with liquid carriers or finely divided solid carriers or both. The following examples are provided to aid in the 10 understanding of the present invention, the true scope of which is set forth in the appended claims. It is understood that modifications can be made in the procedures set forth, without departing from the spirit of the invention. 15 Example 1 Production of the aFGF Analogs 20 Synthesis A bovine aFGF analog according to the present invention was prepared and examined in the following examples. This analog, bovine [Ala47,Gly93] aFGF, was 25 constructed to contain both a desired amino acid substitution (glycine for histidine at position 93) in the residue 90 to 97 region of the aFGF molecule and an additional amino acid substitution of alanine for the non-conserved cysteine residue at position 47, as shown 30 in Fig. 1. A bovine [Ala47] aFGF analog, having only the amino acid substitution of alanine for cysteine was also prepared for use as a control for the desired bovine [Ala47,Gly93] aFGF analog. Although these examples demonstrate a bovine aFGF analog of the present 35 invention, the same results can be achieved for the Ik 102 1 - 15 - highly homologous human aFGF analogs. For example, the amino acid sequence of the corresponding human [Alal6fGly93] aFGF analog of the present invention is displayed in Fig. 2. 5 A synthetic gene coding for the [Ala47,Gly93] analog of bovine aFGF was assembled in two sections from a total of 28 component oligonucleotides. The amino acid sequence of Gimenez-Gallego et al was used as the 10 basis for this gene, with codon choices selected to optimize expression of the analog in E. coll. Gimenez-Gallego et al, Science, 230, 1385-1388 (1985). Section I was assembled from 16 oligonucleotides to yield a 287 nucleotide fragment which could be inserted into a 15 plasmid vector at Xba I and Xho I restriction endonuclease sites. Section II was assembled from 12 oligonucleotides to give a 170 nucleotide fragment bounded by Xho I and Bam HI compatible ends. The two sections were inserted into the expression plasmid 20 pCFM1156, which had been previously digested with Xba I and Bam HI in a 3-component ligation, yielding the complete aFGF gene under the control of the lambda pL promoter. 25 The plasmid pCFM1156 is prepared from the known plasmid pCFM836. The preparation of plasmid pCFM836 is described in U.S. Patent No. 4,710,473, the relevant portions of the specification, particularly examples 1 to 7, are hereby incorporated by reference. To prepare 30 pCFM1156 from pCFM836, the two endogenous Nde I restriction sites are cut, the exposed ends are filled with T4 polymerase, and the filled ends are blunt-end ligated. - 16 - 24 1 0 2 1 The resulting plasmid is then digested with Cla I and Kpn I and the excised DNA fragment is replaced with a DNA oligonucleotide of the following sequence: 5 5' cgatttgattctagaaggaggaataacatatggttaacgcgttggaattcggtac 3' 3' taaactaagatcttcctccttattgtataccaattgcgcaaccttaagc 5 • E. coll cells transformed with this plasmid were grown in a 16-liter fermentation vessel as described in 10 Fox et al, J. Biol. Chem., 263, 18452-18458 (1988). The gene coding for the bovine [Gly93,Ala47] aFGF was converted to the [Ala47] form using oligo site-directed mutagenesis. The aFGF gene was first 15 transferred into the phage vector M13mpl8 and single-stranded DNA to serve as a template for the mutagenesis reaction was prepared. Approximately 0.5 jig of this DNA was mixed with 5 picomoles each of the mutagenic primer (51 GAAGAAAACCATTACAACAC 3') and the M13 universal 20 primer used for DNA sequencing, heated to 65°C for 3 minutes, and allowed to slow cool. The annealed template-primer was mixed with ATP, a dNTP mixture, DNA polymerase I large fragment, and T4 DNA ligase, then incubated at 15°C for 4 hours. Aliquots of this 25 reaction mixture were added to competent E. coll JM101 cells and plated in 0.7% L-agar. The resulting plaques were replicated onto nitrocellulose filters, and the filters were hybridized with 32p-iabeled mutagenic primer. DNA prepared from phage which hybridized was 30 sequenced to verify successful completion of the desired mutagenesis event. The resultant gene was then transferred back to the pCFM1156 vector for expression of the recombinant protein. 35 24 1 0 Purification Both the bovine [Gly93,Ala47] and [Ala47] aFGF analogs were purified from the insoluble fraction 5 obtained from centrifugation of mechanically lysed E. coli cells expressing the recombinant protein. The pellet fraction was solubilized in 8 M urea, 0.1 M glycine, pH 2,5, and centrifuged to remove insoluble materials. The supernatant was loaded onto an S-10 Sepharose® (Pharmacia, Uppsala, Sweden) column equilibrated with 6 M urea, 10 mM glycine, pH 3.0, and washed with 6 M urea, 20 mM sodium citrate, pH 6.5. Proteins which bound to the column were eluted with a linear 0 to 0.5 M sodium chloride gradient in 20 mM 15 sodium citrate, pH 6.5. The fractions containing the aFGF were pooled, diluted 20-fold with 20 mM sodium citrate,0.1 M ammonium sulfate, and centrifuged to remove any precipitate. The supernatant was mixed with one volume of 20 mM sodium citrate, 2 M ammonium 20 sulfate, and loaded onto a phenyl-Sepharose® column equilibrated with 20 mM sodium citrate, 1 M ammonium sulfate, pH 6.5. The bound proteins were eluted from the column with a linear descending gradient (1 M to 0 M) of ammonium sulfate. The aFGF-containing fractions 25 were pooled and dialyzed against 20 mM sodium citrate, pH 6.5. This product was essentially homogeneous, as demonstrated by fact that no other bands in Coomassie blue appeared in the SDS gel, as shown in Fig. 4. 30 Example 2 Gel Filtration Chromatography Gel filtration was performed at room temperature 35 using a Superose®-12 column on a Pharmacia FPLC system 24 1 0 - 18 - (Pharmacia, Uppsala, Sweden). The column was run at 0.5 ml/min in 20 mM sodium citrate, 0.2 M sodium chloride, pH 6.5. 5 Gel filtration chromatography showed that the purified bovine [Ala47] and [Ala47,Gly93] aFGF analogs eluted as single peaks at an elution position identical to that of ribonuclease A (Mr =» 13,700) . This indicated that both proteins are monomeric and have the same 10 hydrodynamic radius, although there is a possibility that both forms of the protein interact with the column matrix and give a retarded elution from the column. 15 Example 3 Hydrophobic Interaction Chromatography Hydrophobic interaction chromatography was performed at room temperature using a phenyl-Superose® 20 column on a Pharmacia FPLC system. The sample, in 2 M ammonium sulfate, 20 mM sodium citrate, pH 6.5, was loaded onto the column which had been equilibrated with 2 M ammonium sulfate. After a 2 M sodium chloride wash, the remaining protein was eluted with an ammonium 25 sulfate gradient descending from 2 M to 0 M, followed by a final wash with 20 mM sodium citrate, pH 6.5. Because the elution position of a protein in hydrophobic interaction chromatography (HIC) is strongly 30 dependent upon the exposure of hydrophobic regions in the folded state, this technique provides a sensitive probe of the conformational homogeneity of similar proteins. Fig. 3 presents the elution profiles for the bovine [Ala47] and [Ala47,Gly93] aFGF analogs. The 35 [Ala47] aFGF showed a major peak eluting at 0.25 M - 19 - 24 1 0 2 1 ammonium sulfate, while the [Ala47,Gly93] aFGF analog showed a single peak at 0.13 M ammonium sulfate, suggesting that both proteins exist primarily in a single distinct conformation. The elution at lower salt 5 concentration by the [Ala47,Gly93] aFGF indicates that it is slightly more hydrophobic than the [Ala47] form. This observation is consistent with the replacement of the histidine residue at position 93 by glycine if the confozonation of the protein is such that this residue is 10 exposed to the solvent. Alternatively, the change in this residue could induce an overall change in the conformation of the molecule to produce a more hydrophobic structure. Spent roscopv Circular Dichroism 20 Circular dichroic spectra were determined at room temperature on a Jasco Model J-500C spectrophotometer (Jasco, Tokyo, Japan) equipped with an Oki If 800 Model 30 computer (Oki, Tokyo, Japan). Measurements were 25 carried out at a band width of 1 nm using cuvettes of 1 and 0.02 cm for the near and far ultraviolet ranges, respectively. The data were expressed as the mean residue ellipticity, [0], calculated using the mean residue weight of 113 for both forms of aFGF. 30 Circular dichroism (CD) spectra of the bovine [Ala47,Gly93] and [Ala47] aFGF analogs were nearly identical in both the far and near ultraviolet regions, as shown in Figs. 4A and 4B, respectively. The CD of 35 the analogs were also very similar to the spectrum - 20 - 24 102 1 reported for human bFGF. (Arakawa, et al, BBRC, 161, 335-341 (1989). The similarity of the spectra in the near ultraviolet region is consistent with similar tertiary structures for the FGFs. 5 Thermal Transition The thermal transition of proteins was determined on a Response II spectrophotometer (Gilford, Medfield, 10 Massachusetts) equipped with thermal programming and a thermal cuvette holder. Samples were heated at an increment of 0.1°C/min or 0.5°C/min and their absorbance monitored at 287 nm. Protein concentrations were determined spectrophotometrically using an extinction 15 coefficient of 0.98 for bFGF and 1.04 for both bovine aFGF analogs at 280 nm for 0.1% protein. Thermal denaturation of the aFGF analogs was examined in the presence and absence of heparin at both 20 pH 6.5 and 7.0, 20 mM sodium citrate. In all cases, the proteins precipitated as the temperature was increased. The temperature at which the abrupt absorbance increase occurred was taken as the denaturation temperature. In the absence of heparin, this temperature was about 10°C 25 higher for the bovine [Ala47,Gly93] aFGF analog than for the bovine [Ala47] aFGF analog. Addition of either 1.4-fold or 8-fold (w/w) excess of heparin increased the denaturation temperature for both forms by 14-20°C, depending upon the rate of temperature increase used. 30 The difference between the denaturation temperature of the two forms remained at about 10°C. There was no apparent effect of 1.4-fold or 8-fold (w/w) excess heparin on the CD spectra of either protein in the 240 to 340 nm range, although in the case of 8-fold excess 24 1 0 2 1 - 21 - heparin, the aFGF spectrum in the 240-260 nm region was masked by the absorbance of the heparin itself. Fourier-transform Infrared tFTTR1 Spectroscopy 5 Fourier-transform infrared (FTIR) spectra were determined to further examine the similarity in conformation of both aFGFs. For FTIR spectroscopy, the proteins were thoroughly dialyzed against water. Each 10 protein was prepared as a 2% solution in a 20 mM imidizole buffer made in D2O (Sigma Chemical Co., 99.9% isotopic purity). Solutions were placed in IR cells with CaF2 windows and 100 pm spacers. For each spectrum, 1500 interferograms were collected and coded 15 on a Nicolet 800 FTIR system equipped with a germanium-coated KBr beam splitter and a DTGS detector. The optical bench was continuously purged with dry nitrogen gas. Second derivative spectra were calculated as described in in Susi et al, Biochem. Biophys. Res. 20 Comm., 115, 391-397 (1983) . A 9 point smoothing function was applied to the water vapor-subtracted spectra. Fig. 5 shows the second derivative spectra of the 25 [Ala47] and [Ala47,Gly93] bovine aFGF analogs in the amide I' (C=0 stretch in deuterated proteins) region. For polypeptides and proteins, the frequencies of the component bands in this region are related to secondary structure content. Surewicz et al, Biochem. Biophys. 30 Acta, 952, 115-130 (1988) . The spectra show strong bands at 1630 and 1685 cm~l which are indicative of a significant amount of p-structures in the two proteins. A strong band near 1647 cm~l is indicative of the presence of irregular or disordered structures. The 35 weaker peaks near 1666 and 1673 cm~l arise from turn - 22 - 24 1 0 2 1 structures. A small peak is present near 1651 cm~l in the spectra of both proteins. Amide I' components near this frequency are typically assigned to o-helices. However, it was recently shown that this band may arise 5 from loop structures. Wilder et al, Abstracts of the Fourth Symposium of the Protein Society, San Diego (1990) . As shown in Fig. 5, the highly resolved FTIR spectra, unlike CD, clearly demonstrate the presence of p-structures and turns, and the spectra for bovine 10 [Ala47] aFGF analog and bovine [Ala47,Gly93] aFGF analog are nearly superimposable, again suggesting that these two proteins have similar conformation. The second derivative spectra showed apparently no 15 difference in conformation between the two aFGF analogs. However, it was evident that deuteration of exchangeable protons occurred faster for the bovine [Ala47] aFGF analog than for the [Ala47,Gly93] analog during equilibration of lyophilized protein with D2O solution. 20 Since the two proteins have a similar conformation, the observed difference in H-D exchange rate cannot be explained from differences in the extent of exposure of exchangeable protons between them. It is more likely that the [Ala47] aFGF analog has a more flexible 25 structure, which render amide protons more accessible to the solvent. Example 5 30 Heparin Chromatography Heparin-Sepharose® (Pharmacia) was packed into a 1 x 8 cm column and equilibrated with 10 mM Tris-HCl, pH 7.2. The column was loaded, washed with 10 mM Tris*HCl, 35 pH 7.2 and eluted with a linear gradient from 0 to 2.8 M 241021 - 23 - sodium chloride in the same buffer at a flow rate of 0.5 ml/min using a Pharmacia FPLC system. Acidic and basic FGF are distinguished by their 5 avid binding to heparin and heparin-like molecules. Both the bovine [Ala47,Gly93] and [Ala47] aFGF analogs showed a single peak eluting at 1.54 M sodium chloride in 10 mM Tris-HCl, pH 7.2. Biological Activity of aFGF Analogs Tn Vitro Bioassavs 15 The mitogenic activity on NIH 3T3 cells of the aFGF analogs from the previous examples was determined as described below. In addition, a human [Ser70,ser88] bFGF analog, prepared as described in published PCT 20 Patent Application No. 88/04189, was also examined in the bioactivity assays, alongside the aFGF analogs. NIH 3T3 cells were obtained from atcc ccl92. The cells were grown in DME supplemented with 10% calf serum, 10 25 units/ml penicillin, 2 mM glutamine and 10 units/ml streptomycin. Cells were passaged at a ratio of 1:40 two times per week. On day 1 of the assay, subconfluent cultures were trypsin dispersed and plated into 24-well plates at a concentration of 20,000 cells/ml, 1 ml per 30 well in the above media. On day 5, the media was replaced with 1 ml/well DMEM without serum but containing penicillin, streptomycin, and glutamine at the above concentrations. On day 6, experimental samples were added to the media in volumes no greater 35 than 100 p.1. Eighteen hours later, cells were pulsed ( \*X i r f 23 NOV 1993 - 24 - 24 1 0 2 1 for 1 hour with 1 ml of the above media containing 2 10 jiCi of tritiated thymidine at 37°C. After the pulse, cells were washed once with media, then 250 mM sucrose, 10 mM sodium phosphate, 1 mM EDTA, pH 8 was added and 5 the plates incubated at 37°c for 10 minutes to release the cells. Cells were harvested on a Skatron harvester. (Skatron, Inc., Sterling, Virginia.) Filters were dried, placed in scintillation fluid, and counted in a Beckman scintillation counter. (Beckman Instruments, 10 Inc., Fullerton, California.) The mitogenic activity of the bovine [Ala47/Gly93] and [Ala47] aFGF analogs on NIH 3T3 cells was examined as shown in Fig. 6. In the absence of heparin, the 15 [Ala47] aFGF analog produced a dose dependent stimulation of 3H-thymidine uptake in the range of 1 to 100 ng/ml, with half-maximal stimulation of 25 ng/ml. Under the same assay conditions, the [Ala47/Qly93] aFGF analog was able to produce the same mitogenic effect at 20 a much lower protein concentration, the half-maximal dose being about 1 ng/ml. Recombinant bFGF was 4-5 times more potent than the [Ala47/Gly93] aFGF, with a half-maximal dose of 220 pg/ml. When 4.5 ng/ml heparin was added to both analogs, their in vitro activity was 25 increased with the [Ala47,Gly93] aFGF analog remaining more potent. In the presence of 45 ng/ml heparin, the activities were enhanced such that the dose response of all three molecules were nearly identical, with a half-maximal dose of 90 pg/ml. 30 The stability of the aFGF analogs, as determined by retention of their respective mitogenic activity, was examined by incubation of a 0.1 mg/ml solution of each FGF analog in 20 mM sodium citrate, pH 7 at 37°C, both 35 in the presence and absence of 1 mg/ml heparin. In the 24 1 0 - 25 - absence of heparin, the bovine [Ala4?] aFGF analog rapidly lost activity, with a half-life of about 13 hours, as shown in Fig. 7. However, in the presence of heparin, bovine [Ala47] aFGF lost no biological activity 5 over the 250 hour course of the experiment. In contrast, neither bovine [Ala47,Gly93] arGF analog nor the human [Ser70,Ser88] bFGF analog exhibited any loss of activity over the 250 hours, whether or not heparin was present. 10 Example 7 Crystalloaraphv 15 Crystals of bovine [Ala47,Gly93] aFGF analog were grown by vapor diffusion against 0.2 M NH4SO4, 2 M NaCl, 0.099 M sodium citrate, and 0.02 M sodium potassium phosphate, pH 5.6. The protein droplet contained equal volumes of the reservoir solution and a 10 mg/ml protein 20 solution. The crystals were trigonal (space group P3i21, a = 78.6 A, c = 115.9 A) and diffracted to 2.5 A resolution. Intensity data were collected with a Siemens (Madison, Wisconsin) multiwire area detector mounted on an 18 lew rotating anode generator. The 25 Siemens suite of processing programs was used for data reduction. Multiple isomorphous replacement (mir) phases were calculated to 3 A resolution from two derivatives, with a figure of merit of 0.68. After solvent flattening, regions corresponding to two 30 independent aFGF molecules in the asymmetric unit were identified. The general non-crystallographic symmetry relationships between these molecules were determined from rotation function, real-space translation function, and density correlation studies. A molecular envelope 35 was defined around an averaged aFGF molecule with a 24 1 0 2 1 - 26 - modified B.C. Wang algorithm. The phases were iteratively refined by molecular averaging and solvent flattening. 5 Initial maps revealed extended regions of 0 sheet structure that were truncated at the loops, due to a small molecular envelope, as shown in Fig. 8. The final map for model building was calculated with mir phases (from heavy atom parameters re-refined against averaged 10 phases, as described in Rould et al, Science, 246, 1135-1142 (1989)), and iteratively averaged with a molecular envelope generated by placing 6 A spheres about the atomic positions in the initial model. Averaging at 3 A resolution converged to a final R-factor of 17.8 % 15 between the observed structure factors, and structure factors calculated from the averaged and solvent flattening map. The graphic program TOM/FRODO, implemented for a Silicon Graphics 4D80 by C Cambillau, was used to build residues 10 to 136 of the aFGF 20 sequence into an averaged electron density map. The crystallography results supported our hypothesis that the 90-97 region is involved in a loop structure. If this region is, in fact, involved in 25 receptor binding as suggested by Baird et al, any amino acid substitution which stabilizes the loop may stabilize and/or enhance the biological activity of the molecule. This is presumably the mechanism for the observed activity enhancement attained with the bovine 30 [Ala47,Gly93] aFGF. 35 </div>

Claims

V- " 0 2 - 27 - WHAT //WE CLAl'/i IS: What ij claimod is-:—

1. An analog of acidic fibroblast growth factor wherein at least one amino acid in the region of amino acids 90 to 97 of said naturally occurring acidic fibroblast growth factor is replaced by a residue of a different amino acid having a higher loop forming potential and wherein said analog has an enhanced biological activity of at least substantially ten times that of naturally occurring acidic fibroblast growth factor in the absence of heparin. 15

2. The analog of claim l wherein said replaced amino acid is selected from the group consisting of amino acids 90/ 91/ 93, and 96. 20

3. The analog of claim 2 wherein said replaced amino acid is amino acid 90.

4. The analog of claim 3 wherein said amino acid having a higher loop-forming potential is selected from 25 the group consisting of glycine, proline, tyrosine, aspartic acid, asparagine and serine.

5. The analog of claim 3 wherein said amino acid having a higher loop-forming potential is glycine. 30

6. The analog of claim 2 wherein said replaced amino acid is amino acid 91. 35 I - V - i 23 NOV 1993 1 V 10 2 - 28 -

7. The analog of claim 6 wherein said amino acid having a higher loop-forming potential is selected from the group consisting of glycine, proline, tyrosine, aspartic acid, asparagine and serine. 5

8. The analog of claim 7 wherein said amino acid having a higher loop-forming potential is glycine.

9. The analog of claim 2 wherein said replaced 10 amino acid is amino acid 96.

10. The analog of claim 9 wherein said amino acid., having a higher loop-forming potential is selected from the group consisting of glycine, proline, tyrosine, 15 aspartic acid, asparagine, serine, and glutamic acid.

11. The analog of claim 10 wherein said amino acid having a higher loop-forming potential is glycine. 20

12. The analog of claim 2 wherein said replaced amino acid is amino acid 93.

13. The analog of claim 12 wherein said amino acid having a higher loop-forming potential is selected from 25 the group consisting of glycine, proline, tyrosine, aspartic acid, asparagine, serine, glutamic acid, threonine, lysine, glutamine, arginine, phenylalanine, and tryptophan. 30

14. The analog of claim 13 wherein said amino acid having a higher loop-forming potential is glycine.

15. The analog of claim 14 having the amino acid , sequence set forth in Fig. 1. ! 2 3 NOV 1993 2 ^ 02 - 29 -

16. The analog of claim 14 having the amino acid sequence set forth in Fig. 2.

17. The analog of claim 2 wherein at least one 5 terminal amino acid residue is deleted while said analog substantially retains said enhanced biological activity.

18. The analog of claim 2 wherein at least one cysteine residue of said naturally occurring acidic 10 fibroblast growth factor is replaced by a residue of a neutral amino acid.

19. The analog of claim 18 wherein said analog is an analog of bovine acidic fibroblast growth factor and 15 said cysteine residue is the cysteine residue at position 47 of said naturally occurring acidic fibroblast growth factor.

20. The analog of claim 18 wherein said analog is 20 an analog of human acidic fibroblast growth factor and said cysteine residue is the cysteine residue at position 16 of said naturally occurring acidic fibroblast growth factor. 25

21. A DNA sequence encoding for procaryotic or eucaryotic expression of an analog of an acidic fibroblast growth factor of claim 2.

22. The DNA sequence of claim 21 wherein said 30 analog of an acidic fibroblast growth factor is the analog of claim 14. .

23. The DNA sequence of claim 21 wherein said analog of an acidic fibroblast growth factor is the 35 analog of claim 15. . t<> / j uuv {9/5 241021 - 30 -

24. The DNA sequence of claim 21 wherein said analog of an acidic fibroblast growth factor is the analog of claim 16. 5

25. A pharmaceutical composition comprising a therapeutically effective amount of an acidic fibroblast growth factor analog according to claim 1 and one or more pharmaceutical^ acceptable adjuvants. 10

26. The pharmaceutical composition of claim 25 wherein said acidic fibroblast growth factor analog is the analog of claim 2.

27. The pharmaceutical composition of claim 25 15 wherein said acidic fibroblast growth factor analog is the analog of claim 14.

28. The pharmaceutical composition of claim 25 wherein said acidic fibroblast growth factor analog is 20 the analog of claim 15.

29. A method for treating a wound in a non-human comprising administering to said wound a therapeutically effective amount of an acidic fibroblast growth factor analog 25 according to claim 1.

30. The method of claim 29 wherein said acidic fibroblast growth factor analog is the analog of claim 2. 30

31. The method of claim 29 wherein said acidic fibroblast growth factor analog is the analog of claim 14. \ 23 NOV f993 2*102 31

32. The method of claim 29 wherein said acidic fibroblast growth factor analog is the analog of claim 15. 5

33. An analog of acidic fibroblast growth factor as claimed in claim 1 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings. 10

34. A DNA sequence as defined in claim 21 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

35. A pharmaceutical composition as defined in claim 25 15 substantially as herein described with reference to any example thereof and with or without: reference to the accompanying drawings.

36. A method as defined in claim 29 for treating a wound in a non-human substantially as herein described with reference to 20 any example thereof and with or without reference to the accompanying drawings. firo&rZto "njc . 25 By the authorised agents \ J PARK & SON 30 35