WO1992005760A1 - Method and compositions for diagnosing and treating chronic fatigue immunodysfunction syndrome - Google Patents

Abstract

The present invention provides compositions and methods for diagnosis, treatment and prophylaxis of Chronic Fatigue Immunodysfunction Syndrome (CFIDS) based on the detection of the presence of a novel CFIDS-associated virus, CAV, in the body fluids or tissues of a patient.

Description

METHOD AND COMPOSITIONS FOR DIAGNOSING AND TREATING CHRONIC FATIGUE IMMUNODYSFUNCTION SYNDROME

The invention described herein was made in the course of work under grants or awards from The United

States National Institutes of Health, the Department of Health and Human Services.

Background of this Invention

Chronic Fatigue Immunodysfunction Syndrome (CFIDS) is an illness characterized by a myriad of symptoms including immunologic and neurologic abnormalities. However, because the symptoms of CFIDS are similar to those of a number of other conditions, CFIDS patients are often misdiagnosed as having some other condition, including psychosomatic illness. In fact, the disorder characterized by some or all of the symptoms of CFIDS listed below, has been diagnosed as being chronic active Epstein Barr Virus infection syndrome, chronic mononucleosis, postviral fatigue syndrome, low natural killer cell syndrome, [D. Buchwald and A.L. Komaroff, Rev. Infectious Pis.. 13(Suppl.1) :S12- 8 (1991)], Royal Free disease, 'yuppie disease¹, neurasthenia, and myalgic encephalomyelitis. See, e.g., L. Williams, Time. May 14, 1990, p. 66; W. Boly, Hippocrates. July/August 1987, pg. 31-40; H. Johnson, Rolling Stone, p. 56; and G.P. Holmes et al. Annals Intern. Med.. 108:387-389 (1988).

A working case definition of CFIDS has recently been developed [Holmes et al, cited above]. To fulfill the working case definition of CFIDS, both major criteria and either six or more symptomatic criteria plus two or more physical criteria and eight or more symptomatic criteria must be present. The two major criteria are persistent, relapsing or easy fatigability that does not resolve with bed rest and is severe enough to reduce daily activity by at least half and, the exclusion of other chronic clinical conditions, including preexisting psychiatric diseases. The minor criteria include, mild fever or chills, sore throat, lymph node pain, unexplained generalized muscle weakness, muscle discomfort, myalgia, prolonged (greater than 24 hours) generalized fatigue following normal exercise levels, new generalized headaches, migratory noninflammatory arthralgia, neuropsychological symptoms including photophobia, transient visual scotomata, forgetfulness, excessive irritability, confusion, difficulty thinking, inability to concentrate, and depression, sleep disturbance, and initial onset of symptoms as acute or subacute. The physical criteria include low-grade fever, nonexudative pharyngitis, and palpable or tender anterior or posterior cervical or axillary lymph nodes.

The first documented CFIDS-like epidemic occurred in Los Angeles more than 50 years ago. Serious epidemics struck 1,136 people in Iceland in 1948 and affected as many as 100,000 peoples in the U.S., Canada and New Zealand in 1984. New occurrences of CFIDS-like outbreaks have been reported steadily since then.

Diagnosis of CFIDS is difficult, and expensive, because these symptoms resemble those of other conditions and diagnosis often involves eliminating the presence of other conditions. Currently, no specific tests to pinpoint the syndrome and, although in the past several specific agents including Epstein Barr virus, certain enteroviruses and Human Herpes virus type 6 have been associated with CFIDS-like illnesses, no etiological agent of CFIDS has been definitively identified. Retroviruses are a family of spherical enveloped viruses comprising three sub-families, Oncovirinae , Spumavirinae and Lentivirinae . The viruses are designated as B-type, C-type or D-type, depending on certain structural characteristics of the virions. Among such reported characteristics are the location of the central nucleoid, the presence of low molecular weight gag gene proteins, the DNA sequence of the transfer RNA primer binding site (PBS) in the 5¹ LTR, and the symptoms which the viruses induce in infected hosts.

B-type viruses such as the mammalian virus, mouse mammary tumor virus (MMTV) , have a central nucleoid located acentrically and mature virions can be visualized by electron microscopy both intracellularly and extracellularly.

All known human retroviruses are C-type viruses, both oncoviruses (HTLV I and II) and lentiviruses (HIV 1 and HIV 2) , in which the central nucleoid is located concentrically and mature virions are usually visualized extracellularly. Exogenous oncoviruses and lentiviruses occur widely among vertebrates and are associated with many diseases. C-type oncoviruses include human T-cell lymphotropic viruses (HTLV) including HTLV I and II. These HTLV viruses are linked with certain rare human T- cell malignancies. HTLV-I is linked with a chronic de yelinating disease of the central nervous system called HTLV I-associated myelopathy (HAM) or tropical spastic paraparesis (TSP) [E. DeFreitas et al, AIDS Research and Human Retroviruses . 3.(1):19-31 (1987)]. Both HTLV-I and II have been reported as a coinfection with HIV in many cases of AIDS. Two members of this family, HTLV I and HTLV II, have been cloned and sequenced, and appear to represent evolutionarily divergent viral subgroups. The sequence for HTLV I was published in M. Seiki et al, Proc. Natl. Acad. Sci.. USA, JO:3618-3622 (1983). See, also, G. M. Shaw et al, Proc. Natl. Acad. Sci.. USA. £1:4544-4548 (1984). The nucleotide sequence of HTLV II was published in K. Shimotohno et al, Proc. Natl. Acad. Sci.. USA. 82:3101- 3105 (1985) .

C-type lentiviruses include the human retroviruses, HIV-1 (the causative agent of AIDS) and

HIV-2, as well as equine infectious anemia virus (EIAV) .

To date, other non-C type retroviruses or D type retroviruses have been identified in primates, but not in humans. Mason Pfizer monkey virus (MPMV) is a type D virus which produces depletion of lymphocytes and hind-limb paralysis when innoculated into newborn monkeys [D. Fine et al, Cancer Res.. 3.8.:3123-3139 (1978)]. D type viruses are also characterized by the ability to infect human T and B cells. [See, e.g., M. D. Daniel et al. Science. 223:602-605 (1984); C. S. Barker et al,

Virol.. 153:201-214 (1986); A. A. Lackner et al, Curr. Topics Microbio. Immunol.. 160:77-96 (1990)].

The Spumavirinae sub-family includes the Foamy viruses [J. J. Hooks et al, Bacteriol. Rev.. 39:169-185 (1975) ] . Ten serotypes of foamy viruses have been identified in a variety of Old World and New World monkeys but they appear to be non-pathogenic in all animal species tested.

There exists a need for a diagnostic method to detect the occurrence of CFIDS, permitting patients to be properly diagnosed, as well as therapeutic and vaccinal agents to treat and/or desirably prevent the infection.

Summary of the Invention

The present invention provides a novel, substantially isolated Chronic Fatigue Immunodeficiency Syndrome-associated virus, hereafter referred to by the name CAV. Polynucleotide sequences of CAV and polypeptides of CAV are useful as diagnostic reagents in the diagnosis of CFIDS patients. Polynucleotide sequences of CAV and polypeptide sequences of CAV are useful in therapeutic or vaccinal compositions for the treatment or prevention of CFIDS.

Also disclosed by this invention are methods and assays for diagnosing and/or treating CFIDS patients. Antibodies to CAV antigenic regions and in vitro cells containing CAV polynucleotide sequences or polypeptides are also described.

Other aspects and advantages of the present invention are described further in the following detailed description.

Brief Description of the Figures

Figs. 1A and IB illustrate potential CAV DNA sequence fragments. One strand of the DNA sequence is reported as Fig. 1A; the complementary strand is reported as Fig. IB.

Figs. 2A through 2F illustrate the six potential reading frames of the putative CAV polynucleotide sequences of Figs. 1A and IB. Fig. 3 is an electron photomicrograph of human

H-9 lymphoblastoid T cells infected with CAV, as described in Example 1.

Fig. 4 is another electron photomicrograph of human B-Jab lymphoblastoid B cells infected with CAV, as described in Example 1.

Detailed Description of the Invention

The present invention provides methods and compositions for the detection, treatment and prevention against infection of humans, and possibly other mammals, by a virus which causes, or at least contributes to, the disease termed Chronic Fatigue Immunodysfunction Syndrome. This invention involves the discovery by the inventors and the substantial isolation of the apparently unknown CFIDS-associated virus, CAV.

It is believed that at least a percentage of patients, both human and animal, exhibiting CFIDS symptoms are suffering from infection by CAV. This virus is present in the body fluids of a statistically- significant number of suspected human CFIDS patients, based on the physical symptoms normally associated with this disease, e.g., the presence of a chronic illness with a pattern of clinical symptoms, immunologic abnormalities, activation of herpes viruses and abnormalities of the central nervous system. Suspected CFIDS patients who do not test positive for the presence of this virus are believed to be suffering from a different disease, or to have presently undetectable levels of viral infection in the body fluids assayed. This virus may also be the causative agent of other diseases with symptoms similar to the above-defined CFIDS symptoms, but which diseases are known by other names. CAV and polypeptides thereof, which may be found in cells of body fluids of a human patient with CFIDS symptoms, have been substantially isolated from contaminants with which the virus and its polypeptides occur in natural sources. CAV or a polypeptide thereof may also be obtained substantially isolated from contaminants with which it is associated by means of its production, e.g., by recombinant means or by chemical synthesis. Such natural sources and/or production sources include human cells or cellular components, cells or cellular components of any other animal infected by CAV, host cell expression systems, cell culture supernatants, chemical purification eluates and the like.

The terms "substantially isolated" or "purified" as used herein with reference to CAV or CAV polypeptides is defined as follows. A composition of CAV or a polypeptide thereof is substantially isolated from a natural or production source, as defined above, where the percentage of CAV or its polypeptide relative to the source and without regard to other contaminants is at least 10% on a weight percentage basis. The definition of "substantially isolated" from a natural or production source also encompasses a percentage purification of at least 25% on a weight percentage basis. Similarly a composition of CAV or a polypeptide thereof is substantially isolated from a natural or production source as defined above where the percentage of CAV or its polypeptide relative to the source and without regard to other contaminants is at least 40% on a weight percentage basis. The definition of substantially isolated may include a purification percentage of at least 60% on a weight percentage basis.

This virus may be characterized by one of the following morphological, physical and biological features. The virus may also be characterized by a combination of two or more of these features of the CAV prototype virus of this invention.

The term "CAV", as will be understood by viral taxonomists, includes the entire viral species characterized by the prototype isolate described herein. It is understood that CAV includes both the prototype isolate as well as other isolates, as described below. There are many characteristics of the prototype isolate which a taxonomist could use to identify and classify new CAV isolates. Based on the prototype virus specifically exemplified in the following examples, CAV may be morphologically characterized as a retrovirus, particularly a non-C retrovirus which is capable of infecting humans. Electron microscopy of viral particles formed in infected human cell cultures (see Figs. 3 and 4) suggests that CAV is a non-C-type retrovirus because of its diameter, morphology, formation and location of intracellular virions. More specifically, as described in Example 1 above, CAV-infeσted cells could be characterized by electron-dense circular virions, some with electron-luscent cores and others with electron- dense cores, associated with the rough endoplasmic reticulum and inside large abnormally distended mitochondria in the cells. All particles are the same shape and size, 46-50 ran (460-500A) . No extracellular virus is observed. No forms budding from the cytoplasmic membranes are observed. Thus, CAV-infected cells could also be characterized by the presence of intracytoplasmic particles.

CAV is believed to be specifically distinguishable from the viruses previously identified with CFIDS, namely Epstein-Barr virus, HHV-6 and a variety of enteroviruses. CAV morphology also apparently distinguishes it from the human C-type retroviruses, HTLV I and HTLV II. The apparent location of its virions in the mitochondria distinguishes CAV from HIV.

One characteristics of CAV appears to be its ability to infect both human B and T cells. As described in more detail in Example 1, this virus was apparently propagated in culture by mixing leukocytes from CFIDS patients with two types of human cell lines, H9 lymphoblastoid T cells and B-Jab lymphoblastoid B cells. These cell lines are also permissive for HTLV I and HTLV II, respectively. Both these cell lines are permissive for xenotropic primate D type viruses, e.g., Mason Pfizer monkey virus (MPMV) , and Foamy (Spuma) viruses [see. Fine et al, Daniel et al, Barker et al and Hooks et al, cited above] .

Another possible characterizing feature of CAV is its apparent tRNA primer binding site (PBS) preference. Retroviruses can be categorized with respect to the DNA sequence in the U5 region of their 5' LTR which binds transfer RNA's (tRNA) for certain types of amino acids [see, e.g., F. Harada et al, Jpn. J. Cancer Res. , J3i:232-237 (1990)]. For example, a C type virus, such as HTLV I or II, has a tRNA primer binding site

TGGGGGCTCGTCCGGGAT which binds the tRNA for proline. In fact, all mammalian C-type viruses use the tRNA site for proline except HIV. As described in detail in Example 7, the PCR technique was utilized to amplify the U5 region in CAV to determine its tRNA binding site. The results of this experiment indicated that the primer binding site is for the tRNA of lysine. This result further indicates that CAV is a non-C type retrovirus.

Yet another way a taxonomist may characterize CAV is by the presence of the low molecular weight gag proteins, pll-12, pl3-14, p27-28. As described in detail in Example 8, the apparent CAV gag proteins of these molecular weights were immunoprecipitated from leukocytes of CFIDS patients using a mouse monoclonal antibody (MAb) K-l [described in E. DeFreitas et al, AIDS Research and Human Retroviruses. 2:19-32 (1987), as the HTLV I MAb in Table 2, p. 26] which recognizes an antigenic determinant on the gag protein of HTLV I, II and Simian T cell lymphotropic virus (STLV) . Classes of primate and non- primate animal retroviruses have such characteristically sized gag proteins [J. Leis et al, J. Virol.. 62:1808- 1809 (1988)].

It appears that the virus has the ability to induce the presence of viral gag proteins in the nucleus and cytoplasm of cells which it infects. CAV may also be characterized, therefore, by immunohistochemical staining of the CFIDS leukocytes using Kl Mab as having viral gag proteins located in the nucleus as well as the cytoplasm of infected cells. This characteristic of viral gag protein localization also indicates a non-C type retrovirus. The virus may also be characterized by the presence of a gag gene sequence which differs from the gag gene sequences of HTLV I and HTLV II.

The following Tables I and II illustrate comparative differences between CAV and other known human and other animal retroviruses on the basis of the above- mentioned reported viral characteristics, and the symptomology which known retroviruses induce in infected hosts.

Table I

SUMMARY OF CORRELATIONS OF CFIDS RETROVIRUS

WITH KNOWN TYPES

+

C-type (lentivirus)

HIV + 0 + 0 0

EIAV 0 + + 0 + D-type MPMV + + +

Foamy + +

Plus (+) means reported in literature or, for CFIDS, in this application.

² Zero (0) means not reported in literature to our knowledge.

³ No reports on gag protein characterization in literature although they were deduced by DNA sequencing. Table II

CORRELATIONS OF CFIDS RETROVIRUS

WITH KNOWN TYPES

Reported Symptomatology

Syncytia Immuno Reactiv.

Formation Suppres- Neurologic Fatigue/ of Virus in vitro sion Dysfunction Wasting Herpes

+ + +

0 + 0

+ +

+

Isolated from neural tissue. CAV, or a subtype of the virus, may be characterized by the presence of a polynucleotide sequence, either RNA or DNA, which may be obtained, and its nucleotides identified, by the application of standard sequencing techniques, including polymerase chain reaction techniques (PCR) , to sources containing the substantially isolated virus. It is within the routine skill in the art to obtain polynucleotide sequences of a substantially isolated virus from sources thereof using the techniques and sequences described herein. Such sources are defined above as natural sources or production sources.

Polynucleotide sequences of CAV or of subtype viruses thereof are thus part of this invention. Sequences which contain one or more nucleotide differences from the sequences of CAV but which code for sequences homologous to CAV, are also included in the present invention. Due to the high rate of transcription error in RNA viral replication, it is anticipated that CAV polynucleotide sequences will be characterized by certain variation among isolates, and possibly hypervariable regions or domains. Distinct CAV subtypes may be characterized by sequences which vary from the sequences of the prototype virus described herein, but which share overall genomic organization and large regions of conserved sequences. Particularly, virally encoded enzyme sequences are expected to be similar among subtypes of CAV. Viral homology at the amino acid level among CAV subtypes is expected to be at least 40%. More specifically, such homology is expected to range between about 40% to about 95%. Homology between subtypes may be at least 50%. Other subtypes of CAV may have amino acid ho ologies of at least 60% or more. Some isolates will be at least 70% homologous, while others will be at least 80% or 90% homologous. It is understood that CAV polynucleotide sequences include those sequences which hybridize under stringent or relaxed hybridization conditions [see, T. Maniatis et al. Molecular Cloning (A Laboratory Manual) . Cold Spring Harbor Laboratory (1982), pages 387 to 389] to the native CAV nucleotide (RNA or DNA) sequences. Preferably, high stringency conditions are employed for hybridization of CAV sequences. A polynucleotide sequence of this invention may also be capable of hybridizing under stringent conditions to a polynucleotide sequence encoding an antigenic site of CAV. An example of stringent hybridization condition is hybridization in 4XSSC at 65°C, followed by a washing in 0.1XSSC at 65°C for an hour. Alternatively an exemplary stringent hybridization condition is in 50% formamide, 4XSSC at 50°C.

Polynucleotide sequences may hybridize to native CAV sequences under relaxed hybridization conditions. An example of such non-stringent hybridization conditions are 4XSSC at 50°C or hybridization with 30-40% formamide at 42°C.

A polynucleotide sequence of this invention may also differ from the CAV polynucleotide sequences described above due to the degeneracies of the genetic code. Further, a polynucleotide sequence according to this invention may be a sequence which is the complement of a CAV polynucleotide sequence. Polynucleotide sequences of CAV are expected to contain sequences not found in HTLV I or HTLV II. Allelic variations (naturally-occurring base changes in the species population which may or may not result in an amino acid change) of CAV DNA sequences are also included in the present invention, as well as analogs or derivatives thereof. Similarly, DNA sequences which code for CAV peptides or antigenic sites, but which differ in codon sequence due to the degeneracies of the genetic code or variations in the DNA sequence of CAV which are caused by point mutations or by induced modifications to enhance the activity, half-life or production of the peptides encoded thereby are also encompassed in the invention.

Modifications of interest in the CAV sequences may include the replacement, insertion or deletion of a selected nucleotide(s) or amino acid residue(s) in the coding sequences. For example, a structural gene may be manipulated by varying individual nucleotides, while retaining the correct amino acid(s) , or the nucleotides may be varied, so as to change the amino acids, without loss of biological activity. Mutagenic techniques for such replacement, insertion or deletion, e.g., in vitro mutagenesis and primer repair, are well known to one skilled in the art [See, e.g., United States Patent No. 4,518,584] .

One potential source of polynucleotide sequences of CAV is the DNA obtained from supernatant extracted from tissue culture cells cocultivated with leukocytes from a human CFIDS patient. This DNA was deposited with the American Type Culture Collection (ATCC) , 12301 Parklawn Drive, Rockville, Maryland 20852, U.S.A. pursuant to the Budapest Treaty on the

International Recognition of the Deposit of Microorganism for the Purposes of Patent Procedure on August 28, 1991 and designated ATCC No. .

CAV polynucleotide sequences may be obtained and their nucleotides identified by the application of standard sequencing techniques to the lambda Fix amplified phage library of Sau3A-digested genomic DNA containing integrated CAV, similarly deposited with the

ATCC on August 28, 1991 and designated ATCC No. . Another potential source of CAV polynucleotide sequences obtainable by the application of standard sequencing techniques is the Bluescript plasmid library of BamHI-digested genomic DNA containing integrated CAV in an E. coli strain, similarly deposited with the ATCC on August 28, 1991 and designated ATCC No. .

A CAV polynucleotide sequence may comprise a nucleic acid sequence obtained from one of the ATCC deposits identified above. CAV or a subtype thereof, may also be characterized as comprising all or a portion of a DNA sequence reported in Figs. 1A and IB below. In addition to the above, other CAV sequences may be obtained and/or created from the above deposits or from other animal cell sources. A DNA sequence of this invention may also be capable of hybridizing under stringent conditions to a DNA sequence from one of the above ATCC deposits. A DNA sequence of this invention may also be capable of hybridizing under.stringent conditions to a DNA sequence of Figs. 1A and IB.

CAV is not limited to containing the sequences of Figs. 1 or 2. The final characterization of CAV is within the skill of a viral taxonomist with reference to the prototype isolate described herein. Any one or more of the above-described characteristics may be sufficient to classify a new isolate as CAV. Still another aspect of the invention is a CAV polypeptide in substantially isolated form. Polypeptide sequences of CAV or of subtype viruses thereof are also part of this invention. A CAV polypeptide may be encoded by the CAV polynucleotide sequences described above. Preferably, a CAV polypeptide comprises a sequence of at least 10 amino acids encoded by the genome of CAV. A CAV polypeptide may also comprise all or a fragment of a CAV antigenic determinant. A CAV polypeptide may also comprise all or a fragment of a structural viral protein. A CAV polypeptide may also comprise all or a fragment of a viral non-structural protein.

Polypeptide sequences which contain one or more amino acid differences from the polypeptide sequences of CAV, but which code for sequences sharing homology at the amino acid level to CAV, are also included in the present invention. As described above, transcription error in viral replication may produce CAV polypeptide sequences characterized by certain hypervariable amino acid regions or domains. Distinct CAV subtypes may be characterized by polypeptide sequences which vary from the polypeptide sequences of the prototype virus described herein, but which share overall structural (primary, secondary and tertiary) organization and large regions of conserved sequences with the prototype virus described herein. Particularly, virally encoded enzyme sequences are expected to be similar among subtypes of CAV.

Viral homology at the amino acid level for CAV subtypes is expected to be at least 40%. More specifically, such homology is expected to range between about 40% to about 90%. Homology between subtypes may be at least 50%. Other subtypes of CAV may have amino acid homologies of at least 60% or more; e.g., 70% or 80%. This homology can be evaluated over the entire genome, or discrete fragments thereof, such as particular viral protein coding domains, especially conserved (non- structural) proteins, or any of the sequences disclosed herein.

Other polypeptide sequences of this invention may be sequences capable of hybridizing under stringent conditions to a CAV amino acid sequence. A polypeptide sequence of this invention may also be capable of hybridizing under stringent conditions to an amino acid sequence encoding an antigenic site of CAV. Polypeptide sequences of CAV are expected to contain sequences not found in HTLV I or HTLV II.

Modified CAV polypeptides, analogs or derivatives thereof are also encompassed by this invention. A CAV polypeptide analog may be a mutant or modified protein or polypeptide that has a homology of at least 40% to CAV. More preferably a modified CAV protein may have a homology of about 60%, and most preferably above about 80% to a native CAV polypeptide. Typically, CAV polypeptide analogs differ by only 1, 2, 3, or 4 codon changes. Examples include CAV polypeptides with minor amino acid variations from the amino acid sequences of native CAV polypeptides or any of the above-described CAV polypeptides, in particular, conservative amino acid replacements. Conservative replacements are those that take place within a family of amino acids that are related in their side chains. Genetically encoded amino acids are generally divided into four families: (1) acidic = aspartate, glutamate; (2) basic = lysine, arginine, histidine; (3) non-polar = alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar = glycine, asparagine, glutamine, cystine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids. For example, it is reasonable to expect that an isolated replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar conservative replacement of an amino acid with a structurally related amino acid will not have a major effect on the CAV polypeptide.

The isolation and identification of CAV and polynucleotide and polypeptide sequences also enables the development of diagnostic reagents and probes useful in Western blots, ELISA's or other diagnostic assays, immunogenic or therapeutic compositions and immunogenic compositions for the generation of antibodies and vaccine compositions. These compositions may be useful in diagnosis, treatment and prevention of CFIDS or related diseases.

Thus, as another aspect of this invention, a diagnostic reagent is provided which is useful in the diagnosis of CFIDS or a related disease. As described in more detail below, such a reagent can comprise CAV polynucleotide sequences, including complementary sequences thereto and the other sequences described above. Such a reagent may also comprise a CAV polypeptide sequence as described above. The CAV sequences can be optionally associated with a detectable ligand, a therapeutic or toxic molecule.

The polynucleotide or polypeptide reagent may be capable of binding to a sequence present in the HTLV II ~^~~-^~~ protein and to a sequence present in CAV. The reagent may also comprise a polynucleotide sequence capable of hybridizing to an antibody to CAV. The reagent may be in the form of a hybridization probe for detection of CAV in patients. The reagent may be in the form of a PCR primer to enable the amplification of other sequences of CAV. The reagent may also be an antibody to an epitope or antigenic site on the CAV sequence.

PCR primer sequences employing CAV polynucleotide sequences as reagents of this invention are at least ab t 10 bases in length, with an intervening sequence of at least 100 bases to as large as 1500 bases therebetween, according to conventional PCR technology. Larger sequences, up to about 30 nucleotides, may also be employed as a practical upper limit. However, it is possible that larger or smaller sequence lengths may be useful based upon modifications to the PCR technology. At present the length of the primer is not a limitation upon the disclosure of this invention.

In a similar fashion, hybridization probes of the invention are desirably at least 10 bases in length, based on current technology. Typically, such probe sequences are no larger than about 50 bases in length. Probe lengths may more preferably range between 15 to 30 bases in length. However, it is possible that smaller or larger probe sequences may be useful in the methods and compositions of this invention. Probe length is not a limitation of this invention, as one of skill in the art is presumed to have the knowledge to design probes of suitable length. Hybridization probes of this invention may desirably be associated with detectable labels, as described below.

For use in conventional assays as well as in the assays described below, the primers and probes of this invention may be capable of selective hybridization to a target CAV sequence. "Selective hybridization" as used herein may be defined as the ability of the probe to detectably hybridize at a suitable stringency to a target CAV sequence in a clinical sample from an infected patient and not to detectably hybridize to other sequences in the sample which are unrelated to CAV. Sequences which comply with this requirement may be designed by one of skill in the art based on the functional level of homology between the probe sequence and the desired target CAV sequence. Only probes of sufficient length and homology for the intended use will selectively hybridize, the number of mismatches tolerated increasing with the length of the probe. Typically, probes will be at least 15 nucleotides in length, more preferably at least 20 and typically at least 25 nucleotides in length. It should be understood that all of the polynucleotide sequences and polypeptide sequences described herein, whether for use as diagnostic or therapeutic reagents, for research or otherwise may be prepared by techniques known to one of skill in the art. Such techniques include chemical synthesis (including enzymatic synthesis methods) , recombinant genetic engineering techniques (including PCR) , or various combinations of these known techniques. Conveniently, synthetic production of the polypeptide sequences of the invention may be according to the solid phase synthetic method described by Merrifield in J.A.C.S. 85:2149-2154 (1963). This technique is well understood and is a common method for preparation of peptides. Alternative techniques for peptide synthesis are described in Bodanszky et al, Peptide Synthesis, 2d edition (John Wiley and Sons: 1976) . For example, the peptides of the invention may also be synthesized using standard solution peptide synthesis methodologies, involving either stepwise or block coupling of amino acids or peptide fragments using chemical or enzymatic methods of amide bond formation. [See, e.g. H.D. Jakubke in The Peptides. Analysis. Synthesis. Biology. Academic Press (New York 1987) , p. 103-165; J.D. Glass, ibid.. pp. 176-184; and European

Patent 0324659 A2, describing enzymatic peptide synthesis methods.] These documents are incorporated by reference herein.

All polynucleotide sequences and polypeptide sequences of this invention may also be prepared, and modified if desired, by conventional genetic engineering techniques. Peptides may be prepared by known recombinant DNA techniques, including cloning and expressing within a host microorganism or cell a DNA fragment carrying a coding sequence for the selected peptide. Systems for cloning and expression of a selected polypeptide in various microorganisms and cells, including, for example, bacteria, mammalian cells, yeast, baculoviruses and insect cells, are known and available from private and public laboratories and depositories and from commercial vendors. [See also, Sambrook et al, cited above] .

The CAV DNA obtained as described above or modified as described above may be introduced into a selected expression vector to make a recombinant molecule or vector for use in the method of expressing CAV polypeptides. Numerous types of appropriate expression vectors are known in the art for mammalian (including human) expression, insect cell expression, expression in yeast, expression in fungus and bacterial expression, by standard molecular biology techniques.

These vectors and vector constructs contain the CAV DNA sequences recited herein, which code for CAV polypeptides of the invention, including antigenic or immunogenic fragments thereof. The vector employed in the method also contains selected regulatory sequences in operative association with the CAV DNA coding sequences of the invention. Regulatory sequences preferably present in the selected vector include promoter fragments, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other suitable sequences which direct the expression of the protein in an appropriate host cell. Introns with functional splice donor and acceptor sites, and leader sequences may also be included in an expression construct, if desired. The resulting vector is capable of directing the replication and expression of an CAV in selected host cells. Expression constructs are often maintained in a replicon, such as an extrachromosomal element (e.g., plasmid) capable of stable maintenance in a selected host.

The transformation procedure used depends upon the host to be transformed, and various procedures are known in the art. In order to obtain expression of the CAV protein or polypeptide, recombinant host cells derived from the transformants are incubated under conditions which allow expression of the recombinant CAV protein or polypeptide encoding sequence. These conditions will vary, dependent upon the host cell selected. However, the conditions are readily ascertainable to those of ordinary skill in the art.

The resulting CAV protein or polypeptide product may be purified by such techniques as chromatography, e.g., HPLC, affinity chromatography, ion exchange chromatography, etc.; electrophoresis; density gradient centrifugation; solvent extraction, or the like. As appropriate, the product may be further purified, as required, so as to remove substantially any host cell proteins which are also secreted in the medium or result from lysis of host cells, so as to provide a product which is at least substantially free of host debris, e.g., proteins, lipids and polysaccharides.

For expression of a CAV peptide or protein in mammalian cells, expression vectors may be synthesized by techniques well known to those skilled in this art. The components of the vectors, e.g. replicons, selection genes, enhancers, promoters, marker genes and the like, may be obtained from natural sources or synthesized by known procedures. See, Kaufman et al, J. Mol. Biol. ,

159:511-521 (1982); and Kaufman, Proc. Natl. Acad. Sci.. USA. 82:689-693 (1985). Alternatively, the vector DNA may include all or part of the bovine papilloma virus genome [Lusky et al. Cell, 3.6:391-401 (1984)] and be carried in cell lines such as C127 mouse cells as a stable episomal element.

Selected promoters for mammalian cell expression may include sequences encoding highly expressed mammalian viral genes which have a broad host range, such as the SV40 early promoter, mouse mammary tumor virus LTR promoter, adenovirus major late promoter (Ad MLP) , and herpes simplex virus promoter. Non-viral gene sequences, such as the murine metallothionein gene, also provide useful promoter sequences. Examples of enhancer elements include the SV40 early gene enhancer [Dijkema et al, EMBO J. 4:761 (1985)] and the enhancer/promoters derived from the long terminal repeat (LTR) of the Rous Sarcoma Virus [Gorman et al, Proc. Natl. Acad. Sci.. ^~\^~ -. ^~lll (1982)] and from human cytomegalovirus [Boshart et al, Cell. 4JL:521 (1985)]. [See, also, Sassone-Corsi and Borelli, Trends Genet.. 2:215 (1986); Maniatis et al, Science. 236:1237 (1987); and Alberts et al, Mol. Biol. of the Cell. 2d edit. (1989) ] . Examples of transcription terminator/ polyadenylation signals include those derived from SV40 [Sambrook et al, cited above] .

Mammalian replication systems include those derived from animal viruses, which require trans-acting factors to replicate. Examples of mammalian replicons include those derived from bovine papillomavirus and Epstein-Barr virus, papovaviruses, such as SV40 [Gluzman, Cell. 23.:175 (1981)] or polyomavirus. Examples of such mammalian-bacteria shuttle vectors include pMT2 [Kaufman et al, Mol. Cell. Biol.. 9_.:946 (1989) and pHEBO [Shimizu et al, Mol. Cell. Biol.. 1:1074 (1986)].

Methods for introduction of heterologous polynucleotides into mammalian cells are known in the art and include dextran-mediated transfection, calcium phosphate precipitation, polybrene mediated transfection. protoplast fusion, electroporation, encapsulation of the polynucleotide(s) in liposomes, and direct microinjection of the DNA into nuclei.

Mammalian cell lines available as hosts for expression are known in the art and include many immortalized cell lines available from the ATCC, including but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS) , human hepatocellular carcinoma cells (e.g., Hep G2) , and a number of other cell lines.

The polynucleotide encoding CAV proteins or polypeptide fragments can also be inserted into a suitable insect expression vector, and operably linked to control elements within that vector. Vector construction employs techniques which are known in the art.

Generally, the components of the expression system include a transfer vector, usually a bacterial plasmid, which contains both a fragment of the baculovirus genome, and a convenient restriction site for insertion of the heterologous gene or genes to be expressed; a wild type baculovirus with a sequence homologous to the baculovirus-specific fragment in the transfer vector which allows for the homologous recombination of the heterologous gene into the baculovirus genome; and appropriate insect host cells and growth media.

Materials and methods for baculovirus/insect cell expression systems are commercially available in kit form from, inter alia. Invitrogen, San Diego CA ("MaxBac" kit) . These techniques are generally known to those skilled in the art and fully described in Summers and

Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987) (hereinafter "Summers and Smith") .

An insect cell transfer vector contains preferably a promoter, leader (if desired) , one or more CAV coding sequence, and a transcription termination sequence. The plasmid usually also contains the polyhedrin polyadenylation signal [Miller et al, Ann. Rev. Microbiol.. 12:177 (1988)]) and a procaryotic ampicillin-resistance (amp) gene and origin of replication for selection and propagation in E . coli. Currently, the most commonly used transfer vector for introducing foreign genes into AcNPV is pAc373. Many other vectors, known to those of skill in the art, have also been designed including pVL985 [See, Luckow and Summers, Virology. 12:31 (1989)].

Examples of promoters include sequences derived from the gene encoding the viral polyhedron protein [Friesen et al, "The Regulation of Baculovirus Gene Expression," in: The Molecular Biology of Baculoviruses (ed. Walter Doerfler) (1986); EPO Publ. Nos. 127 839 and 155 476] and the gene encoding the plO protein [Vlak et al, J. Gen. Virol.. 9:765 (1988)].

DNA encoding suitable signal sequences can be derived from genes for secreted insect or baculovirus proteins, such as the baculovirus polyhedrin gene

[Carbonell et al, Gene. 72:409 (1988)]. Alternatively, leaders of non-insect origin, such as those derived from genes encoding human α-interferon [Maeda et al, Nature, 315:592 (1985)]; human gastrin-releasing peptide [Lebacq- Verheyden et al, Molec. Cell. Biol.. 8.:3129 (1988)]; human IL-2 [Smith et al, Proc. Nat'l Acad. Sci. USA. 22:8404 (1985)]; mouse IL-3 [Miyajima et al, Gene. 58:273 (1987)]; and human glucocerebrosidase [Martin et al, DNA. 2:99 (1988)], can also be used to provide for secretion in insects.

Methods for introducing heterologous DNA into the desired site in the baculovirus virus are known in the art [See, Summers and Smith supra; Ju et al. (1987) supra; Smith et al, Mol. Cell. Biol.. 2:2156 (1983); and Luckow and Summers (1989) supra] . After inserting the DNA sequence encoding the CAV polypeptide or protein into the transfer vector, the vector and the wild type viral genome are transfected into an insect host cell where the vector and viral genome are allowed to recombine. The newly formed baculovirus expression vector is subsequently packaged into an infectious recombinant baculovirus. To identify recombinant viruses, a visual screen is performed by plaquing the transfection supernatant onto a monolayer of insect cells by techniques known to those skilled in the art ["Current

Protocols in Microbiology" Vol. 2 (Ausubel et al. eds) at 16.8 (Supp. 10, 1990); Summers and Smith, supra: Miller et al. (1989) supra] . Recombinant viruses are identified by the presence of refractile occlusion bodies. Recombinant baculovirus expression vectors have been developed for infection into several insect cells. For example, recombinant baculoviruses have been developed for, inter alia: Aedes aegypti , Autographa californica, Bombyx ori. Drosophila melanogaster. Spodoptera frugiperda, and Trichoplusia ni [PCT Pub. No. WO 89/046699; Carbonell et al, J. Virol.. 56:153 (1985); Wright, Nature, 321:718 (1986); Smith et al, Mol. Cell. Biol. , 2:2156 (1983); and see generally, Fraser et al, In Vitro Cell. Dev. Biol.. 25:225 (1989)]. Bacterial expression techniques and expression system components are also known in the art. Among the components of a bacterial expression vector or construct include a bacterial promoter, a transcription initiation region, an RNA polymerase binding site, a transcription terminator sequence, a signal sequence and an operator, as well as the desired CAV sequence. Constitutive expression may occur in the absence of negative regulatory elements, such as the operator. In addition, positive regulation may be achieved by a gene activator protein binding sequence. An example of a gene activator protein is the catabolite activator protein (CAP) , which helps initiate transcription of the lac operon in Escherichia coli [Raibaud et al, Ann. Rev. Genet.. 12:173 (1984)]. Regulated expression may therefore be either positive or negative, thereby either enhancing or reducing transcription.

Examples of promoter sequences include sequences derived from sugar metabolizing enzymes, such as galactose, lactose (lac) [Chang et al, Nature, 198:1056 (1977)], and maltose; sequences derived from biosynthetic enzymes such as tryptophan (trp) [Goeddel et al, Nuc. Acids Res.. 2:4057 (1980); Yelverton et al, Nucl. Acids Res.. 9_:731 (1981); U.S. Patent No. 4,738,921; EPO Publ. Nos. 036 776 and 121 775]; the g-lactamase (bla) promoter system [Weissmann, "The cloning of interferon and other mistakes." In Interferon 2 (ed. I. Gresser) (1981)]; bacteriophage lambda PL [Shimatake et al, Nature. 292:128 (1981)] and T5 [U.S. Patent No. 4,689,406]. Synthetic promoters which do not occur in nature are useful, e.g. the hybrid promoter described in U.S. Patent No. 4,551,433, and the tac promoter [Amann et al, Gene. 2_5:167 (1983); de Boer et al, Proc. Natl. Acad. Sci.. 0:21 (1983)]. A bacterial promoter can include naturally occurring promoters of non-bacterial origin, e.g., the bacteriophage T7 RNA polymerase/promoter system [Studier et al, J. Mol. Biol.. 189:113 (1986); Tabor et al, Proc. Natl. Acad. Sci.. 82:1074 (1985); see, also, EPO Publ. No. 267 851]. In addition to a functioning promoter sequence, an efficient ribosome binding site is also useful for the expression of foreign genes in prokaryotes, e.g., the Shine-Delgarno (SD) sequence of E^_ coli [Shine et al, Nature. 254:34 (1975)]. DNA encoding suitable signal sequences that provide for secretion of the foreign protein in bacteria can be derived from genes for secreted bacterial proteins, such as the E. coli outer membrane protein gene (ompA) [Masui et al, in: Experimental Manipulation of Gene Expression (1983); Ghrayeb et al, EMBO J.. 2:2437 (1984) ] and the E. coli alkaline phosphatase signal sequence fphoA) [Oka et al, Proc. Natl. Acad. Sci.. 22:7212 (1985); see, also, U.S. Patent No. 4,336,336]]. As an additional example, the signal sequence of the alpha-a ylase gene from various Bacillus strains can be used to secrete heterologous proteins from B. subtilis [Palva et al, Proc. Natl. Acad. Sci. USA. 21:5582 (1982); EPO Publ. No. 244 042]. The CAV proteins can also be secreted from the cell by creating chimeric DNA molecules that encode a fusion protein with the signal peptide sequence fragment.

Examples of transcription termination sequences are sequences derived from genes with strong promoters, such as the trp gene in E. coli as well as other biosynthetic genes.

Expression constructs may be maintained in a replicon, such as an extrachromosomal element (e.g., a high or low copy number plasmid) capable of stable maintenance in a host cell. Alternatively, the expression constructs can be integrated into the bacterial genome with an integrating vector. Integrating vectors typically contain at least one sequence homologous to the bacterial chromosome that allows the vector to integrate. Integrations appear to result from recombinations between homologous DNA in the vector and the bacterial chromosome [see, e.g., EPO Publ. No. 127 328]. Integrating vectors may also be comprised of bacteriophage or transposon sequences. Alternatively, some of the above described components can be put together in transformation vectors. Transformation vectors are typically comprised of a selectable marker that is either maintained in a replicon or developed into an integrating vector. Selectable markers can be expressed in the bacterial host and may include genes which render bacteria resistant to drugs such as ampicillin, chloramphenicol, erythromycin, kanamycin (neomycin) , and tetracycline [Davies et al, Annu. Rev. Microbiol. , 22:469 (1978)]. Selectable markers may also include biosynthetic genes, such as those in the histidine, tryptophan, and leucine biosynthetic pathways.

Bacterial expression and transformation vectors, either extra-chromosomal replicons or integrating vectors, have been developed for transformation into many bacteria. See, e.g., the vectors described in Palva et al, Proc. Natl. Acad. Sci. USA. 22:5582 (1982); Shimatake et al, Nature. 292:128 (1981); Powell et al, Appl. Environ. Microbiol.. 54:655 (1988); Powell et al, Appl. Environ. Microbiol.. 54:655 (1988) and U.S. Patent No. 4,745,056].

Methods of introducing exogenous DNA into bacterial hosts are well-known in the art, and typically include either the transformation of bacteria treated with CaCl₂ or other agents, such as divalent cations and DMSO. DNA can also be introduced into bacterial cells by electroporation. Transformation procedures usually vary with the bacterial species to be transformed. See e.g., Masson et al, FEMS Microbiol. Lett.. .60:273 (1989); Miller et al, Proc. Natl. Acad. Sci.. 5:856 (1988) ; Chassy et al, FEMS Microbiol. Lett.. 44.:173 (1987); Augustin et al, FEMS Microbiol. Lett.. 6j_:203 (1990) and numerous other references known to the art. Yeast expression systems are also known to one of ordinary skill in the art. Typically, a vector or expression construction for yeast expression includes a promoter, leader (if desired) , a CAV coding sequence and transcription termination sequence. A yeast promoter includes a transcription initiation region, an RNA polymerase binding site (the "TATA Box") , a transcription initiation site, an upstream activator sequence (UAS) , which, permits regulated (inducible) expression. Constitutive expression occurs in the absence of a UAS. Regulated expression may be either positive or negative, thereby either enhancing or reducing transcription.

Particularly useful promoter sequences, include, e.g., alcohol dehydrogenase (ADH) [EPO Publ. No. 284 044], enolase, glucokinase, glucose-6-phosphate isomerase, glyceraldehyde-3-phosphate-dehydrogenase (GAP or GAPDH) , hexokinase, phosphofructokinase, 3- phosphoglycerate utase, and pyruvate kinase (PyK) [EPO Publ. No. 329 203]. The yeast PHQ5 gene, encoding acid phosphatase, also provides useful promoter sequences [Myanohara et al, Proc. Natl. Acad. Sci. USA. 80:1 (1983) ] .

Synthetic hybrid promoters include the ADH regulatory sequence linked to the GAP transcription ac^tivation region [U.S. Patent Nos. 4,876,197 and

4,880,734], the regulatory sequences of either the ADH2. GAL4 , GAL10. or PH05 genes, combined with the transcriptional activation region of a glycolytic enzyme gene such as GAP or PyK [EPO Publ. No. 164 556]. Non- yeast origin sequences may function as promoters [See, e.g., Cohen et al, Proc. Natl. Acad. Sci. USA. 77:1078 (1980); and Henikoff et al, Nat re, 283:835 (1981)].

For intracellular expression in yeast, a promoter sequence may be directly linked with the DNA molecule. For secretion of the expressed protein, DNA encoding suitable signal sequences can be derived from genes for secreted yeast proteins, such as the yeast invertase gene [EPO Publ. No. 012 873; JPO Publ. No. 62,096,086] and the A-factor gene [U.S. Patent No. 4,588,684]. Alternatively, leaders of non-yeast origin, such as an interferon leader, exist that also provide for secretion in yeast [EPO Publ. No. 060 057]. A preferred class of secretion leaders employ a fragment of the yeast alpha-factor gene [See, e.g., U.S. Patent Nos. 4,546,083 and 4,870,008; EPO Publ. No. 324 274; and PCT Publ. No. WO 89/02463] .

Expression constructs are often maintained in a replicon (e.g., a high or low copy number plasmid) which may have two replication systems, allowing it to be maintained in yeast for expression and in a procaryotic host for cloning and amplification. Examples of such yeast-bacteria shuttle vectors include YEp24 [Botstein et al, Gene. 2:17-24 (1979)], pCl/1 [Brake et al, Proc. Natl. Acad. Sci USA. 21:4642-4646 (1984)], and YRpl7 [Stinchcomb et al, J. Mol. Biol.. 158:157 (1982)].

Alternatively, the expression constructs can be integrated into the yeast genome with an integrating vector which typically contain at least one sequence homologous to a yeast chromosome that allows the vector to integrate, and preferably contain two homologous sequences flanking the expression construct [Orr-Weaver et al, Meth. Enzvmol.. 101:228-245 (1983)].

Typically, extrachromosomal and integrating expression constructs may contain selectable markers to allow for the selection of yeast strains that have been transformed including biosynthetic genes that can be expressed in the yeast host, such as ADE2, HIS4, LEU2. TRPl, and ALG7. and the G418 resistance gene. In addition, a suitable selectable marker may also provide yeast with the ability to grow in the presence of toxic compounds, such as metal. For example, the presence of CUPl allows yeast to grow in the presence of copper ions [Butt et al, Microbiol. Rev.. 51:351 (1987)].

Alternatively, some of the above described components can be put together into transformation vectors, which typically comprise a selectable marker that is either maintained in a replicon or developed into an integrating vector, as described above.

Expression and transformation vectors, either extrachromosomal replicons or integrating vectors, have been developed for transformation into many yeast strains. See, e.g., Kurtz et al, Mol. Cell. Biol.. 2 142 (1986); Kunze et al, J. Basic Microbiol.. 25_:141 (1985); Gleeson et al, J. Gen. Microbiol.. 132:3459 (1986); Das et al, J. Bacteriol.. 158:1165 (1984); De Louvencourt et al, J. Bacteriol.. 154:737 (1983) and numerous other references known to the art.

Methods of introducing exogenous DNA into yeast hosts are well-known in the art, and typically include either the transformation of spheroplasts or of intact yeast cells treated with alkali cations. Transformation procedures usually vary with the yeast species to be transformed. See, e.g., Kurtz et al, Mol. Cell. Biol.. 2:142 (1986); Gleeson et al, J. Gen. Microbiol.. 132:3459 (1986); Das et al, J. Bacteriol.. 158:1165 (1984); Cregg et al, Mol. Cell. Biol.. 5_:3376 (1985), among others.

Fusion proteins provide another alternative to direct expression of CAV proteins and polypeptides in yeast, mammalian, baculovirus, and bacterial expression systems. Typically, a DNA sequence encoding the N- terminal portion of an endogenous protein (depending on the host), or other stable protein, is fused to the 5¹ end of heterologous coding sequences. Upon expression, this construct will provide a fusion of the two amino acid sequences. The resulting fusion protein optionally retains a cleavable sequence at the junction of the two amino acid sequences for a processing enzyme to cleave the host cells protein from the CAV gene [See, e.g., Nagai et al, Nature, 209:810 (1984) and EPO Publ. No. 196 056], One example is a ubiquitin fusion protein that preferably retains a site for a processing enzyme to cleave the ubiquitin from the CAV protein. Through this method, native CAV protein can be isolated [See, e.g., Miller et al, Bio/Technology. 2:698 (1989)]. Alternatively, the CAV protein or polypeptide can be secreted from the selected host cell into the growth media by creating chimeric DNA molecules that encode a fusion protein comprised of a leader sequence fragment that provides for secretion of the CAV protein from the selected host cell. The adenovirus triparite leader is an example of a leader sequence that provides for secretion of a foreign protein in mammalian cells [Birnstiel et al, Cell. 41:349 (1985); Proudfoot and Whitelaw, "Termination and 3* end processing of eukaryotic RNA. In Transcription and splicing (ed. B.D. Ha es and D.M. Glover) (1988) ; Proudfoot, Trends Biochem. Sci.. .14.:105 (1989)]. Preferably, there are processing sites encoded between the leader fragment and the foreign gene that can be cleaved either in vivo or in vitro. Such leader sequence fragments are known to one of skill in the art for the various selected host cells described above.

The identification of the CAV polynucleotide sequences and polypeptide sequences and the ultimate sequencing of the entire CAV sequence permit the development of suitable CAV-specific antibodies generated by standard methods. As diagnostic or research reagents, antibodies generated against these CAV sequences may be useful in affinity columns and the like to further purify CAV proteins. The antibodies of the present invention may be utilized for in vivo and in vitro diagnostic purposes, such as by associating the antibodies with detectable labels or label systems. Alternatively these antibodies may be employed for in vivo and in vitro therapeutic purposes, such as by association with certain toxic or therapeutic compounds or moieties known to those of skill in this art, e.g., ricin.

Antibodies to peptides encoded by the CAV sequences, specifically to antigenic sites therein for use in the assays of this invention may include monoclonal and polyclonal antibodies, as well as chimeric antibodies or "recombinant" antibodies generated by known techniques. Additionally synthetically designed MAbs may be made by known genetic engineering techniques [W. D. Huse et al. Science. 246:1275-1281 (1989)] and employed in the methods described herein. For purposes of simplicity the term Mab(s) will be used hereafter throughout this specification; however, it should be understood that certain polyclonal antibodies, particularly high titer polyclonal antibodies and recombinant antibodies, may also be employed in place thereof. It is generally desirable for purposes of increased target specificity to utilize monoclonal antibodies (MAbs) , both in the assays of this invention and as potential therapeutic agents. It may also be preferred to "humanize" a non-human Mab by any of the known techniques [See, e.g., U. S. Patent Nos. 4,634,664 and 4,634,666] .

An anti-CAV antibody composition of this invention preferably comprises an antibody that binds an antigenic determinant of a CAV polypeptide which is (a) a purified preparation of polyclonal antibodies; (b) a monoclonal antibody composition; or (c) a recombinant antibody composition. Preferably the present invention contemplates the development of a MAb to CAV, which does not react with other human retroviruses, e.g., HTLV II. In one embodiment, the antibody is capable of identifying or binding to a CAV antigenic site encoded by an above- identified CAV DNA sequence. Such an antibody may be used in a screening test.

A MAb may be generated by the now well-known Kohler and Milstein techniques and modifications thereof and directed to one or more antigenic sites on a CAV polypeptide. For example, an isolated CAV sequence, or a portion of the viral sequence encoding an antigenic site, which differs sufficiently from that of HTLV I and HTLV II and other viruses, may be presented as an antigen in conventional techniques for developing MAbs. A cell line secreting an antibody which recognizes an epitope on CAV only, not on HTLV I or II or any other retrovirus, may then be identified for this use. Similarly, a cell line secreting an antibody which binds much more strongly to a CAV epitope than to any epitope on another virus to enable the antibody to distinguish between the virus under suitable conditions may also be useful. One of skill in the art may generate any number of Mabs by using a CAV polypeptide sequence as an immunogen and employing the teachings herein.

Antibodies specific for epitopes on CAV may also be used therapeutically as targeting agents to deliver virus-toxic or infected cell-toxic agents to infected cells. Instead of being associated with labels for diagnostic uses, a therapeutic agent employs the antibody linked to an agent or ligand capable of disabling the replicating mechanism of the virus or of destroying the virally-infected cell. Such agents, include, without limitation, ricin, diphtheria toxin or other known toxic agents. The identity of the toxic ligand does not limit the present invention. It is expected that preferred antibodies to peptides encoded by CAV sequences may be screened for the ability to internalize into the infected cell and deliver the ligand itself into the cell, as described in detail in Canadian Patent Application 2,016,830-7, published on November 16, 1990. This document is incorporated by reference for a description of a screening technique known to the art. Both the antibodies and the probes of the present invention may be associated with conventional detectable labels. Detectable labels for attachment to the antibodies (or to the probes referred to above) useful in assays of this invention may also be easily selected by one skilled in the art of diagnostic assays. Where more than one reagent of this invention, e.g. probe or antibody, is employed in a diagnostic method, the labels are desirably interactive to produce a detectable signal. Most desirably the label is detectable visually, e.g., colorimetrically. Detectable labels for attachment to reagents of this invention useful in the diagnostic assays of this invention may also be easily selected by one skilled in the art of diagnostic assays. Labels detectable visually are preferred for use in clinical applications due to the rapidity of the signal and its easy readability. For colorimetric detection, a variety of enzyme systems have been described in the art which will operate appropriately. Colorimetric enzyme systems include, e.g., horseradish peroxidase (HRP) or alkaline phosphatase (AP) . Other such proximal enzyme systems are jnown to those of skill in the art, including hexokinase in conjunction with glucose-6-phosphate dehydrogenase. Also, bioluminescence or chemiluminescence can be detected using, respectively, NAD oxidoreductase with luciferase and substrates NADH and FMN or peroxidase with luminol and substrate peroxide. Other conventional label systems that may be employed include fluorescent compounds, radioactive compounds or elements, or immunoelectrodes. These and other appropriate label systems are known to those of skill in the art.

Similarly for diagnostic uses of the antibody, polynucleotide sequence and polypeptide sequence reagents of the present invention, a wide variety of known and conventional components may be employed to immobilize the reagent, where desired. Such immobilizing agents include conventional solid supports, such as microtiter plates, plastic, cellulose strips, beads, e.g., latex. Any composition known in the art which may be employed for immobilization of an antibody or nucleic acid or peptide sequence may be similarly useful with the antibodies and sequences of the present invention, primarily for diagnostic uses, purification techniques and the like.

CAV polynucleotide sequences and polypeptides, as well as anti-CAV antibodies of the present invention may also be employed in an industrial method for the production of blood and blood products which are free from infection by CAV. The ability to screen blood samples infected by CAV enables producers and distributors of blood products, e.g, the American Red Cross, to identify and discard donated blood samples which are intended for use in transfusions or in the isolation of plasma, therapeutically useful blood proteins and blood cells. If unscreened, the use of such blood and blood-derived products could contribute to the spread of CFIDS.

Thus, another aspect of this invention is a method for preparing blood and blood products free from infection with CAV by screening a blood product for the presence of CAV with a CAV polynucleotide or polypeptide probe, or complement thereof, capable of indicating the presence or absence of CAV. An analogous method involves producing blood or blood products free from infection with CAV by screening a blood sample with anti-CAV antibodies, capable of indicating the presence or absence of CAV.

These CAV sequences and/or anti-CAV antibodies, optionally detectably labeled, may be employed in conventional assay formats substantially identical to those formats described herein for diagnostic purposes to identify blood samples containing CAV. For example, one screening method may employ all or a fragment of a CAV polynucleotide sequence or a complement thereof as a primer in a polymerase chain reaction performed on a blood sample, wherein the amplification of said sequence indicates the presence of the etiologic agent of CFIDS.

Another screening step comprises employing all or a fragment of a CAV polynucleotide sequence as a hybridization probe in a hybridization assay performed on a blood sample, wherein the hybridization of said sequence indicates the presence of the etiologic agent of CFIDS. Still another screening step comprises contacting a blood sample with a CAV polypeptide or protein, wherein said peptide or protein represents an antigenic site capable of forming an antigen-antibody complex with any anti-CAV antibody in the sample. The use of such assays or modifications thereto are within the skill of the art given this disclosure.

A further aspect of the present invention is an in vitro cell culture containing a CAV polynucleotide sequence. Such a cell culture may be a mammalian cell, bacterial cell, yeast or insect cell infected with CAV. Such a cell culture may be a recombinant host cell containing only selected CAV polynucleotide sequences, so that the virus is not capable of replication therein. Also provided by this invention are hybridoma cell lines generated by presenting a CAV polypeptide or a fragment thereof as an antigen to a selected mammal, followed by fusing cells of the animal with certain cancer cells to create immortalized cell lines by known techniques. The methods employed to generate such cell lines and antibodies directed against all or portions of a human CAV protein or recombinant polypeptide of the present invention are also encompassed by this invention. This invention also encompasses permissive cell lines infected with CAV and capable of producing infectious CAV progeny. As described in detail in Example 1, two human cell lines, a T cell lymphoblastoid and a B cell lymphoblastoid cell line, have been developed which produce infectious virus progeny in vitro. Another cell line, Human Macrophage Monocyte Cell Line U937, which is available from the ATCC has also been identified as supporting the growth of CAV. Such cell lines when cultured under suitable conventional conditions are capable of generating large quantities of virus for further research and vaccine development use.

As still a further aspect of the invention, methods for confirming a suspected CFIDS diagnosis may now be based on the presence of such above-described CAV nucleotide sequences, polypeptide sequences and antibodies. The presence of CAV can be detected utilizing a variety of assays and immunological techniques known in the art for detecting viruses, including detecting these viral proteins, nucleic acids, and antibodies directed against the virus. CAV polynucleotide fragments which are sufficiently lacking in homology with comparable gene sequences of other retroviruses may enable the identification of such nucleotide sequences (or peptides encoded thereby) in the body tissues and fluids of suspected CFIDS patients, confirming diagnosis of the infection.

The term "body fluids" as used herein is defined as including, without limitation, the following cell-containing materials: whole blood or fractions thereof, serum, urine, semen, vaginal secretions, saliva, tears, cerebrospinal fluid, and breast milk. Also included in this definition, for completeness, are selected human cell types, including T cells and non-T cells. Preliminary data indicate that the presence of this virus may also be detected in granulocytes, eosinophils or basophils. This virus may also be detectable in muscle and skin tissue samples. While the following description of this invention refers to serum samples and peripheral blood mononuclear cells (PBMC) as body fluids, the application of the methods and compositions of this invention are not limited to these particular fluids.

Preferred embodiments of diagnostic methods useful to detect the presence of CAV, however, utilize particularly the techniques of polymerase chain reaction [Saiki et al, Science. 239:487-491 (1988)] and hybridization assays [see, e.g., Sambrook et al, "Molecular Cloning. A Laboratory Manual.", Cold Spring Harbor Laboratories, Cold Spring Harbor, 2nd edition

(1989) ] . These documents are incorporated by reference herein for descriptions of PCR and assay techniques. Particularly desirable hybridization assays include Southern blot and liquid hybridization, which are known in the art as represented by their descriptions in the latter reference.

The assay formats referred to above are preferably employed in the method of this invention with a CAV polynucleotide sequence-derived PCR primer or hybridization probe according to this invention. One embodiment of a method of this invention involves the PCR technique as well as modifications thereof which are known to those of skill in the art. According to this embodiment, samples of selected patient body fluids are collected. The patients may be desirably selected for such diagnostic testing by having symptoms which are recognized to be associated with CFIDS, although asymptomatic patients may also be tested. DNA is extracted from the selected body fluid, e.g., white blood cells. Techniques for preparing such extracts are well-known in the art [See, for example, Sambrook et al, cited above] . The sample DNA is used as a template and primers derived from CAV sequences are employed in the PCR technique. As an example, it was originally observed that certain HTLV II gag gene sequences appeared to share a high degree of homology with several putative CAV polynucleotide sequences, as described in Example 3. Several desirable sequences which may be useful as PCR primers and hybridization probes are found within the nucleotide sequence spanning nucleotide #813 to #1214 of the HTLV II gag gene. These sequences were first used to amplify CAV sequences and isolate the virus from patient body fluids. For example, as illustrated in Table III below, an HTLV II gag sequence from nucleotide #1214 to #1187 may be useful as a preferred antisense primer for PCR. This primer is known as g-2-1. An HTLV II gag sequence from nucleotide #813 through #838 is useful as a PCR gag sense primer. This primer is called g-2-2. A sequence of HTLV II gag from nucleotide 1080 through 1105 is also useful as a hybridization probe. Table III

HTLV I

1375 1353 gag antisense primer GGTACTGCAGGAGGTCTTGGAGG

841 864 gag sense primer CGACCGCCCCGGGGGCTGGCCGCT

1080 1101 gag probe GATCCCGTCCCGTCCCGCGCCA

7701 7680 tax antisense primer TCTGGAAAAGACAGGGTTGGGA

7575 7596 tax sense primer CAATCACTCATACAACCCCCAA

7652 7677 tax probe TACATGGAACCCACCCTTGGGCAGCA

HTLV II

1214 1187 gag antisense primer, GAAGCTTTGCGTGGTGGTGGGTTCCACG g-2-1

(hinD III site) 813 838 gag sense primer, (TAAGCTT) CAAATCCACGGGCTTTCCCCAACTCC g-2-2

1080 1105 gag probe GTCTCCCCTAGCGCCCCCGCCGCCCC

7920 7900 tax antisense primer ATAGGGGAGAAGTCCTGTACA

7602 7620 tax sense primer CGCCTTCCCCGAACCTGGC

7819 7846 tax probe ACAGTCATAGTCCTCCCGGAGGACGACC It should be noted that the nucleotide numbering of the HTLV II genomic sequence referred to throughout this specification is identical to the numbering system published by K. Shimotohno et al, cited above, for the complete proviral HTLV II genome. The nucleotide sequence of HTLV I referred to in the examples below is numbered according to M. Saiki et al, cited above. The latter two references are incorporated by reference herein as sources of sequence information known and available to one skilled in the art.

Primers or probes based on other retroviruses, e.g., HTLV I-derived probes such as those identified in Fig. 1, or non-hybridizing HTLV II-derived probes, or probes based on sequences of the known non-C type retroviruses, e.g., MPMV, may also be employed as controls. For example, another diagnostic method involving PCR techniques may employ the tRNA lysine primer binding site 5' TGGCGCCCAACGTGGGGC 3 • as a "sense" primer, and an MPMV-derived primer 5' GCTACGGCAGCCATTACTTG 3* as an "antisense" primer. A probe from an MPMV intervening region and having the sequence 5^• GATACTTGTCCTTGGTTTCCGCA 3 ' may then be employed in hybridization.

Such a PCR reaction would also indicate MPMV infection of humans, but it is not presently believed that MPMV can infect humans. An alternative method step would be to perform a hybridization with another MPMV sequence which is not homologous to an CAV sequence under specific hybridization conditions to rule out MPMV infection. If CAV is present in the DNA isolated from the sample, the CAV polynucleotide sequences or fragments thereof, will be amplified, but not the control nucleotide sequences.

However, as above mentioned, use of HTLV II sequences or other retroviral sequences, e.g., MPMV, having some homology to CAV in diagnostic methods is less preferred because a separate method step would have to be employed to distinguish the isolated or identified virus in the body fluids of a suspected CFIDS patient from the other known retrovirus. Other HTLV II sequences different from the above-described HTLV II-derived probe and primer sequences may be employed to rule out the presence of HTLV II infection. The method of the present invention employing PCR may be sequentially performed with HTLV II sequences and HTLV I sequences which do not produce amplified products using the patient's sample DNA, for example, sequences from HTLV II tax which are not homologous with CAV nor detectable in CFIDS patients. These supplemental tests would eliminate the possibility of a co-infecting presence of these HTLV with CAV.

CAV primer sequences which are unique for CAV, and which do not bind to other viruses are preferred in such assays. Such sequences can be identified by a viral taxonomist.

Following PCR amplification, a Southern blot or other hybridization technique may be employed, using a labeled CAV polynucleotide-derived hybridization probe. Probes which are less desirable, as referred to above, may contain a sequence homologous to a nucleotide sequence in the HTLV II gag gene.

Hybridization of the probe with the product of PCR amplification will occur in the presence of CAV nucleotide sequences in the body fluid. No hybridization will occur in the absence of a CAV nucleic acid sequence which is not significantly homologous to other reported retrovirus sequences in available databases. For a positive diagnosis, the hybridization of the above sequence to the patient sample may desirably be above about 90%. The occurrence of hybridization will indicate a confirmed diagnosis of CFIDS. Another embodiment of a diagnostic method of the present invention to determine the presence of a CAV infection is in situ hybridization to screen a patient sample for the presence of CAV RNA sequences. As described in more detail in Example 5 below, cells, typically PBMC, are isolated from a patient. If PBMC are the sample, the cells may be activated as described above. The cells are cultured under conventional conditions and examined for the expression of mRNA of CAV.

Polynucleotide sequences of CAV, or sequences complementary thereto may be used in this method. Probes for this hybridization technique may be generated from transcription of CAV in a plasmid, as described in detail in Example 4, or by other methods, as described herein before. As described above for the hybridization and primer sequences, it is possible that some HTLV II- derived gag gene nucleotide sequences may also prove useful in identifying this CAV viral mRNA according to this embodiment of the present method.

Using high stringency conditions, labelled probes to the CAV sequences are used to probe the sample mRNA. Preferable high stringency conditions include an incubation temperature of 52°C. Conventional labels can also be employed in this embodiment, such as are described above. A presently preferred label is ³⁵S. The embodiment described in detail in Example 5 below employs HTLV II-derived sequences. This jLn situ test may be combined with the other PCR and immunological tests to confirm the positive CFIDS result.

The CAV peptide fragments, as well as the PCR primers produced as described above, may also be employed in diagnostic assays which rely on protein immunogens as targets for sera recognition. For example, the invention provides a method of using CAV peptides of the invention as diagnostic agents useful for identifying CFIDS patients. In one assay format, the reactivity of CAV peptides to biological fluids or cells of CFIDS patients can be assayed by Western blot. The assay is preferably employed on patient sera, but may also be adapted to be performed on other appropriate fluids or cells, for example, macrophages or white blood cells. In the Western blot technique, a CAV peptide, purified and separated by a preparative gel, is transferred to nitrocellulose and cut into multiple strips. The strips are then probed with sera from CFIDS patients or controls. Binding of the CFIDS sera to the protein is detected by incubation with an appropriately labelled antibody, e.g., an alkaline phosphatase tagged goat anti- human IgG followed by the enzyme substrate BCIP/NBT. Color development is stopped by washing the strip in water. Only sera of CFIDS patients would react with the peptide. Healthy humans would not react to the CAV peptide.

In another embodiment the present invention also provides for determining the presence of CAV by examining cell-containing body fluid samples from patients for evidence of exposure to CAV. A CAV peptide may be used in a diagnostic method to detect an antibody to CAV in the body fluids of a CFIDS patient. For example, CAV peptides of this invention may be used in an ELISA based assay. A typical ELISA protocol would involve the adherence of antigen (e.g., CAV peptide) to the well of a tray. The serum to be tested is then added. If the serum contains antibody to the antigen, it will bind. Specificity of the reaction is determined by the antigen absorbed to the plate. Only sera from CFIDS patients would bind to the plate; sera from healthy patients would not bind. Body fluids of CFIDS patients have shown reactivity with antigens of HTLV I by Western blot. Patient body fluid samples, e.g., serum samples or cerebrospinal fluid, can be isolated from patients suspected of having CFIDS. For example, these samples may be used in protein immunoblots, typically called Western blots, with viral proteins of HTLV I and HTLV II. The viral proteins which have been electrophoretically separated are exposed to sample body fluids.

Using conventional techniques known in the art, viral proteins which are immunoreactive or cross-reactive with antibodies in the samples are visualized as bands on a gel. As described below in Example 3, body fluid samples, e.g., blood or serum samples, from CFIDS patients contain antibodies which react with at least three protein bands on the blot which are the products of at least two HTLV genes, gag and env. Moreover, the majority of CFIDS patients have serum antibodies to a P27 protein on the HTLV-I Western blot. P27 is presumably a product of the tax gene.

PBMC can be activated according to means known in the art such a phytohemagglutinin, phorbol myristic acid, concanavalin A and OKT3 MAb. Using standard immunological tests, preferably well-known immunohistochemical tests, the presence of an antigen which reacts with a preferred antibody can be determined. One such suitable antibody is K-l (available from Dr. Fulvia Veronese) [E. DeFreitas et al, AIDS Research and Human Retroviruses, supra] . This K-l monoclonal antibody is capable of reacting with both HTLV I and HTLV II gag gene products.

If the patient's PBMC or other cell type has an antigen which is recognized by an antibody (which is itself known to recognize gag of HTLV I and II) , indicating the possible presence of CAV, further tests employing CAV sequences or antibodies specific for an epitope encoded by those sequences, can be performed to eliminate the possibility that the antigen is the gag gene of HTLV I or HTLV II. For example, to eliminate the presence of HTLV I as the source of the antibody response, a MAb which is specific for HTLV I gag protein and does not cross-react with HTLV II gag may be used in this method. A suitable antibody is 13B12 [See, e.g., T. J. Palker et al, J. Immunol.. 122:2393-2397 (1986)]. This antibody is used to test body fluids, e.g., PBMC, of patients whose sera contains antibodies reactive with at least three HTLV proteins on immunoblots.

Viral proteins in the cells from body fluids of patients who are infected with HTLV I will immunoreact with such specific antibody. In contrast, CFIDS patients who are infected with CAV, do not provide PBMC which immunoreact with an HTLV I specific antibody. This same type of eliminating step may be employed in the method of this invention with an antibody capable of recognizing an epitope on HTLV II, which epitope is not present on HTLV I or CAV. Although such an antibody is not presently available, the development of a suitable antibody, preferably a MAb, is contemplated by this invention and may be employed in the method.

Yet another assay format which may employ the reagents of this invention and be useful in the diagnosis of CFIDS is a particle agglutination (PA) assay, of which there currently exist three (3) specific types. These assays are used for the qualitative detection of antibodies to various antigens when coated to a support. Thus sequences of the invention containing antigenic sites of CAV may be coated to a support. Alternatively antibodies to CAV antigenic sites may be coated to a support. In the former situation, the sample is tested for the existence of antibodies to the CAV antigen. In the latter situation, the clinical sample is tested for the existence of antigen capable of binding to the anti- CAV antibody. The following discussion refers to the former situation. However, one of skill in the art could similarly prepare the assay so that the antibody is immobilized on the support and the existence of the antigen in the sample is detected.

The first and original assay is the hemagglutination assay using red blood cells (RBCs) . In the hemagglutination assay, RBCs are sensitized by passively adsorbing antigen (or antibody) to the RBC. To perform the assay, sensitized RBCs are placed in a 96- well microtiter plate. A small quantity of serum diluent is added to each well, followed by test and control serum in designated wells. When test serum from a patient is added to a well, if specific antigen antibodies are present in the serum, the antigen-antibody interaction will cause the RBCs coated with the purified antigen to agglutinate. Interpretation of the results can be done with the naked eye. A negative result is scored when no reaction occurs between the antigen coated RBC and the added serum sample, as visually observed in the 96-well plate by a solid round dot formed by gravity. A positive result is indicated by a somewhat spread out pattern as the antibody interacts with the antigen coated RBC and binds to one or more antigen coated RBC, thus holding the RBCs at a distance from each other. A strong positive result occurs when there is very strong reactivity and a clear visual pattern of "clumps" or agglutination is observed.

To eliminate potential non-specific reactions, which can occur with sensitized RBCs, two artificial carriers have been developed. The most common of these are latex particles which are available in a variety of sizes and colors, however, they are usually white. The newest technology utilizes a gelatin agglutination method, exemplified in the Serodia-HIV kit for the detection of HIV antibody [Fujirebio Inc.]. The principles involved with both of these artificial carriers are based on passive agglutination utilizing as carriers either the latex or gelatin particles which are coated with purified antigens. The actual assay is run and scored in a similar manner as described above in the RBC based assay.

In a comparison test performed by Kobayashi et al., Clin. Virology. 11:454-458 (1986), the gelatin agglutination method was tested along side an immunofluorescence (IF) assay and a commercially available ELISA. The gelatin agglutination test showed excellent reproducibility in a single assay and good correlation with the IF and ELISA tests having fairly few discrepancies in results. The gelatin agglutination results were achieved without any special instruments or equipment, and a definitive result was obtained in two hours.

In still another aspect, the invention provides a diagnostic method for detecting CAV in a patient sample by a conventional reverse transcriptase assay as described in Example 10 below. This assay may be performed on body fluids of a suspected CFIDS patient, using a polyriboadenylate template primer and the divalent cation Mn⁺⁺. No other known human retrovirus employs this primer or cation in this assay.

The methods, probes, primers and antibodies described herein may be efficiently utilized in the assembly of a diagnostic kit, which may be used by health care providers for the diagnosis and/or treatment of CFIDS. Such a diagnostic kit contains the components necessary to practice one or more of the assays described above for the detection of the CAV nucleic acid in body sample of suspected CFIDS patients. Thus, for example, such a kit may contain primer sequences as described above comprising a CAV sequence or fragments thereof, or sequences of other retroviruses, e.g., MPMV, for performing PCR on sample body fluids. A kit may also contain the hybridization probe sequences described above for the performance of a Southern blot, liquid hybridization or other hybridization technique. Further components of the diagnostic kit of this invention may include nucleotide sequences of other retrovirus genes (HTLV I and II, and MPMV) for use in eliminating the possibility of the presence of those specific viruses.

Still additional components to a diagnostic kit contemplated by the present invention include CAV polypeptides, antibodies specific for an epitope of CAV, antibodies to HTLV I and HTLV II gag, or antibodies specific for other retroviruses which do not bind to CAV epitopes.

Other conventional diagnostic kit reagents such as positive and negative controls, vials and labelling systems for the hybridization assays may also be included, as well as the enzymes and other reagents necessary for the performance of the PCR technique. Where the detectable label present in the kit is designed for non-visual detection, e.g., for radioimmunoassay, the standard components necessary for this assay (controls, standards and the like) are included in the kit.

Another aspect of the present invention involves the detection and isolation of the complete CAV. According to this aspect, an amplified and isolated nucleotide sequence of CAV obtained by the PCR technique as above described is itself employed in the design of additional primers. Example 4 reports the sequencing of a putative CAV fragment which was obtained using primers g-2-1 and g-2-2, identified above. Previously identified CAV viral fragments may be used as primers or probes to obtain and identify additional sequence of CAV.

These primers are used to isolate larger portions of the viral sequence using the inverse PCR technique, such as described in O. Ohara et al, Proc. Natl Acad. Sci.. USA. 22:5673-5677 (1989) and H. Ochman et al, Genetics, 120:621-623 (1988). Employing such techniques which are known and routine to one of skill in the art provided with a substantially isolated virus permits the isolation and characterization of the entire nucleic acid sequence of CAV.

In another aspect the present invention provides a vaccine composition comprising an effective amount of a non-infective CAV DNA or peptide sequence which is capable of eliciting a T cell or B cell response from the host's immune system to CAV infection. This vaccine may also include all or a portion of a CAV DNA sequence or peptides referred to herein. It is expected that at least one of the CAV polypeptide sequences (or fragments thereof) may provide either an antigenic or immunogenic peptide. These peptides, once identified, may be used as vaccine components.

One exemplary system for generating a vaccine is described in European patent application No. 290,246 wherein a peptide encoded by the CAV DNA sequence may be substituted for the peptide in a vaccine composition employing fatty acids, liposomes, and adjuvants. Other vaccine constructs are known to those of skill in the art, and may be prepared using a peptide of CAV to generate a CFIDS vaccine. The above published European patent application is incorporatec herein by reference for disclosure of an exemplary vaccine composition.

Another vaccinal agent of the present invention is an anti-sense RNA sequence generated to a CAV nucleic acid sequence. This sequence may easily be generated synthetically by one of skill in the art. Such an anti¬ sense RNA sequence upon administration to an infected patient should be capable of binding to the RNA of the virus, thereby preventing viral replication in the cell. An alternative vaccine agent includes a synthetic peptide generated to the envelope protein of the virus. These peptides can be easily developed once the entire CAV is sequenced. An additional concept for vaccine development once the virus is completely sequenced includes preparing synthetic peptides which are capable of binding to the host cell's receptor for CAV.

Therefore, also included in the invention is a method of vaccinating humans against infection with CAV by administering an effective amount of a vaccine of this invention to a selected patient. The vaccine preparations including one or more of the peptides described herein are administered in a suitable dose. The vaccine may be administered parenterally or by other conventional means.

The preparation of a pharmaceutically acceptable vaccine, having due regard to pH, isotonicity, stability and the like, is within the skill of the art. Conventional adjuvants may also be employed in the vaccine composition, e.g., aluminum hydroxide gel. The dosage amount and regimen involved in a method for vaccination will be determined considering various hosts and environmental factors, e.g. the age of the patient, time of administration and the geographical location and environment.

The following examples illustrative various aspects of the present invention. Example 1 describes permissive cell cultures producing CAV and the morphometric analysis of CAV in infected cells. Example 2 describes a double-blind screen of antibody to purified HTLV I by Western immunoblot. Example 3 describes detection of retroviral DNA in PBMC of CFIDS patients by PCR using HTLV I and II derived primer sequences. Example 4 describes the purification and sequencing techniques used to obtain a putative partial viral sequence from a CFIDS patient's amplified DNA. Example 5 describes the detection by in situ hybridization of cellular RNA related to HTLV I and II in activated PBMC from CFIDS patients. Example 6 describes the detection in activated PBMC from certain CFIDS patients of an expressed HTLV-specific gag protein in vitro as detected by a MAb and immunohistochemical staining. Example 7 describes the determination of the apparent CAV tRNA RBS. Example 8 describes the possible characteristic gag proteins of CAV, and Example 9 indicates the nuclear location of putative gag proteins of CAV. Example 10 describes a reverse transcriptase assay, suggesting that CAV has the characteristics of a non-C type retrovirus. For performance of these experiments, patient body fluid samples were obtained from clinical practices in North Carolina and New York. The investigators were all blinded by coded samples in each experiment.

Example 1 - Morphometric Analysis of CFIDS Retrovirus

Both H-9 (Fig. 3) lymphoblastoid T cells (obtained from the American Type Culture Collection, Rockville, Maryland) and B-Jab (Fig. 4) lymphoblastoid B cells (obtained from William Hall, M.D., Ph.D. of Cornell University) were cocultured for 21 days at 37°C in 5% C0₂/95% air in RPMI 1640 medium with 10% fetal calf serum with leukocytes of CFIDS patients.

The cultures were examined by transmission electron microscopy after the cells were fixed (see Figs. 3 and 4) . Viral particles were visualized in both types of cocultures. Electron-dense circular virions, some with electron-luscent cores and others with electron- dense cores, were seen associated with the rough endoplasmic reticulum and inside large abnormally distended mitochondria inside the cells. All particles were the same shape and size, 46-50 nm (460-50θA) . No extracellular virus was observed. No forms budding from the cytoplasmic membranes were observed.

These observations suggest that CAV is a non-C- type animal retrovirus for three reasons: First, human C-type viruses like HTLV I and HTLV II do not appear to form intracellular virions. The only human C-type forming intracellular particles is HIV and these are only found intracisternally in conjunction with budding forms. Circular C-type virions are usually formed as the virus buds from the cell's cytoplasmic membrane. Second, neither HTLV I, II, nor HIV virions have ever been found inside mitochondria. Third, the diameter and morphology of these virions suggest that they may be Primate D-type retroviruses or Spuma viruses.

Example 2 - Western Blot Transfers

Proteins of HTLV I from sucrose-banded purified virus are separated by polyaerylamide gel electrophoresis. After electrophoretic separation, proteins are transferred to nitrocellulose paper in a Transblot electrophoresis cell [BioRad Laboratories] at 60 volts, 0.25 amps for 4 hours following manufacturer's instructions. The nitrocellulose sheet is cut in strips, washed to saturate free binding sites with blocking buffer containing 20mM Tris, 500 mM NaCl (pH 7.5) and 3% gelatin. The sheet is reacted overnight at 4°C with anti-virus antibody (13B12) or patient sera or CSF.

After thorough washing with 20 mM Tris, 500 mM NaCl, and 0.05% Tween-20 (TBS), strips are reacted with conjugate (peroxidase-labeled goat anti-mouse or anti- human IgG) for 1 hour at room temperature. Strips are washed again and developed for 10-15 minutes with freshly prepared solution containing 1 part of 4 chloro-1- naphthol in methanol (0.3%), 5 parts of 100 mM Tris (pH7.6) and H₂0₂ to final concentration 1:3000. This system can detect less than 100 ng specific proteins. Strips with molecular weight markers are used to determine molecular weights of viral protein.

Table IV below reports the detection of serum antibodies to HTLV I by this Western Immunoblot in adult CFIDS patients. Positive results occurred in 41% (15/37) of CFIDS patients. Control sera was positive in only 6% (1/16) of individuals. Positivity was determined using the American Red Cross criteria of antibody reactivity for at least two viral gene products. The one positive healthy control was the only non-Caucasian in this study.

_{Table IV}-

Positive Negative

CFIDS patients 15* 22

(37 individuals)

Healthy & other diseases 1 15

(16 individuals)

♦Significant at P ≤.OOl.

Example 3 - CAV Retroviral Sequences Detected in CFIDS Patients bv Polymerase Chain Reaction

Detection of possible CAV retroviral DNA in PBMC of CFIDS patients was performed by polymerase chain reaction using HTLV I- and II- derived primer sequences. HTLV I tax region (7575-7701 bp) and other regions (HTLV I 3__3_/ HTLV II gag and HTLV II tax) were amplified from the blood of CFIDS patients. The sequences of these primers and probes are reported above in Table III. DNA from HTLV I-infected white blood cells from TSP patient number 13-4 was used as positive control. DNA from one HTLV II human T cell line Mo-T and from a retroviral- negative cell line U937 (both available from the American Type Culture Collection, Rockville, Maryland, USA) were employed as negative controls.

DNA was extracted from cell lines by SDS/Proteinase-K digestion of cells followed by phenol- chloroform and ethanol precipitation. DNA concentrations were estimated using the Warburg equation [Warburg, D & Christiemy, W. , Bioche 2 310:384 (1942)] by measuring the absorbance at 260 and 280 nm corrected for the background at 320 nm. Two micrograms of DNA were amplified in 30 repetitive three step cycles, 1 minute incubation at 95°C, 1 minute incubation at 55°C and 2 minute incubation at 72°C. All amplifications were carried out in a Perkin-Elmer Cetus Thermal Cycler. The 100 μl of PCR reaction mixture contained 2 μg of sample DNA, 278 μ~ each dATP, dCTP, dGTP, dTTP, 0.8 μM. of each primer 10 mM Tris (pH 8.3), 50 mM KCl, 1.5 mM MgCl₂, 0.01% (w/v) gelatin and 2.5 units of Thermus Aquaticus polymerase (Taq) enzyme [Perkin Elmer, Cetus] .

The reaction mixture was overlayed with mineral oil to prevent evaporation and was denatured at 94°C for 7 minutes before the Taq polymerase was added. Primer pairs were nucleotide #7575-7696(+) , nucleotide #7701- 7680, and analyzed with nucleotide #7652-7677 oligonucleotide probe (see Table I) .

Amplified DNA was analyzed by electrophoresis on 1.2% agarose gel and transferred to Nytran nylon membrane [S&S Nytran] by blotting. The filter was soaked with 2xSSC for 5 minutes at room temperature, and baked at 80°C for 2 hours under vacuum. The prehybridization buffer consists of 6XSSC, 1.0% SDS, 50% formamide, 5X Denhardt's solution and 150 /g/ml herring sperm DNA. The filter was prehybridized overnight at 37°C and then hybridized overnight with 12xl0⁶cpm of ³²P-labelled oligo probe in prehybridization buffer. Filters were then washed with: 1) 2XSSC and 0.1% SDS (two times for 20 minutes at room temperature), 2) 0.2XSSC and 0.1% SDS (20 minutes at room temperature), and 3) O.IXSSC and 0.1% SDS (30 minutes at 37°C) and autoradiographed for 5-7 days. The results of the same PCR analyses of blood samples from adult CFIDS patients was compared with persons with whom they live or closely associate, e.g., roommates and friends (called Exposure Controls) . Non- exposure controls are healthy persons selected at random who have not come into contact with CFIDS patients nor experienced symptoms associated with CFIDS. Viral controls included the human cell lines Mo-T (HTLV II- infected) and MT-2 (HTLV I-infected) . Both cell lines are available from ATCC. These results are reported in Table V below. Similar PCR analyses were performed on pediatric CFIDS patients as reported in Table VI below. The retroviral DNA was also detected with Southern blotting using labeled oligonucleotides.

This data demonstrates that retroviral sequences related to HTLV II gag, but not HTLV I gag or tax, were detected in the CFIDS patients. Additionally the positive results seen in the Exposure Controls support the possibility that this CAV is capable of casual transmission to non-infected persons, as is the case with many non-human retroviruses. These data also indicate that presence of HTLV II gag sequences does not identify only symptomatic individuals.

Ratio positive 0/14 6/14 (43%) 1/14 (7%) 4/14 (28%) Non-exposure controls

0/10 0/10 0/10 0/10 Viral controls

MT-2 + 0 0 Mo-T 0 + +

Example 4 - DNA Purification and Seguencing

A putative, partial viral DNA sequence was obtained by the procedure described below from CFIDS patient NY1-12 using the HTLV II gag specific primers g- 2-1 and g-2-2 of Table III.

DNA purification is performed upon the PCR amplified DNA obtained as described above in Example 3 using the Gene Clean kit [Bio 101, La Jolla, CA] with minor modifications, as described below. The PCR amplified DNA is run in 3% Nusieve [FMC, Rockland, ME) agarose mini-gel in lxTAE buffer. Using long wave ultraviolet light, the band is visualized and excised. The excised band is then placed in a pre-weighed 1.5 L tube and the weight of the agarose determined.

The liquid contents of the 7 mL screwcap tube from the Gene Clean kit are added to 140 mL distilled, deionized (dd) water and mixed with 155 mL of 100% EtOH to ensure that the water content of the solution is less than 50%. This solution can be stored in a freezer at -20°C between uses.

When ready to be used, 2% - 3 volumes of Nal stock (6M) solution is added to the agarose and the mixture is incubated at 45°C - 55°C for 5 minutes to dissolve the agarose, with mixing after 2 minutes. Glassmilk suspension (5 μL) is added and the mixture is placed on ice for 5 minutes, with mixing every 1-2 minutes to keep the glassmilk suspended. The silica matrix with the bound DNA is pelleted by microfuging for 5 seconds. The Nal supernatant is then transferred to another tube. If any undissolved agarose remains, the pellet may be rewashed with Nal. The pellet is then washed 3 times with ice cold NaCl/EtOH/H₂0 (NEW) (10-50 volumes or 200-700 μl) . The pellet is resuspended by pipetting back and forth while digging with the pipet tip. After the supernatant from the third wash has been removed, the pellet is suspended again and the last of the wash removed with a fine tipped pipette.

The washed, white pellet is then resuspended with the buffer Tris-EDTA (TE) (water or a low salt buffer can be substituted) about equal to the volume of the pellet (usually approximately 7 μl) . The mixture is incubated at 44-55°C for 2 - 3 minutes and centrifuged for 30 seconds to obtain a firm pellet. The supernatant containing the DNA is then removed and steps of resuspending with TE, incubating, centrifuging and removing the supernatant are repeated.

To obtain the annealing template and primer for the sequencing reaction, 1 μl of primer (20 ng/μl) and 8 μl of gene cleaned DNA, obtained as described above, are combined in a centrifuge tube, boiled for 3 minutes and snap chilled in ice water for 60 seconds. 1 μl of 10X reaction buffer is then added to the combined primer and DNA, mixed by flicking and allowed to stand at room temperature for 10 minutes.

In a 96 well plate with columns labelled G, A, T or C, add 2.5 μl of the dd GTP termination mix in the well labelled G. Similar amounts of ATP, TTP, and CTP, respectively are added to the wells labelled A, T, and C, respectively. The plate is then pre-warmed to 37°C for at least one minute.

Labelling mixture is diluted to a concentration of 1:50 and sequenase is diluted to a concentration of 1:8 in ice cold 1XTE. The following ingredients: 1 μl alpha ³²P-ATP, 2 μl of the 1:50 dilution of labelling mixture, 1 μl of 0.1 M DTT, and 2 μl of 1:8 dilution of sequenase are added to the annealed template primer and buffer mixture, mixed well and incubated at room temperature for 5 minutes to complete the labeling reaction. When the labelling reaction is complete, 3.5 μl of the reaction mixture is aliquoted to each of the wells labelled [G, A, T, C] , using separate tips. The incubations are continued for a total of 3-5 minutes, up to a maximum of 30 minutes. The reaction is then stopped by adding 6 μl of 10 mM EDTA and may be stored for 1-2 days (³²P) or 1 week (³⁵S) at -20°C.

On the 96 well lid, 1.5 μl of the reaction is mixed with 2 μL of formamide dyes. The lid is then incubated in an oven on a water bath at 80°C, snap chilled on ice water, and 6% acrylamide gel is loaded.

Using 0.6xTBE as the running buffer, the gel is run for an hour prior to use in order to heat it up to 50°C. This is accomplished by running at 90W constant power (voltage limit = 2900 V, current limit - 50 mA) . Samples are loaded sequentially at 0, 2 and 4.5 hours and run at 90 W constant power. After the last loading, the gel is run for another 90 minutes (total run time = 6 hours) and the gel apparatus is laid flat down on the bench with the front (shorter) glass plate down. The back glass plate is removed and a sheet of Whatman #1 paper is laid on the gel and is wetted by spraying with distilled H₂0. The filter paper with gel attached is removed, covered with Saran Wrap and used to expose Kodak XAR film. Exposure is carried out at -70°C for 12-72 hours as appropriate. The autoradiograph can then be read.

Figs. 1A and IB illustrate the partial putative CAV viral DNA sequences obtained. Upon analysis on GenBank and EMBL, the putative CAV sequences of Figs. 1A and IB have not been found to be significantly similar to the sequences of any known retrovirus. Thus, these sequences suggest that CAV may not be identified as any other known human or animal virus. The sequences of Figs. 1A and IB do, however, share some significant homology with a small portion of HTLV II gag gene sequences, which were originally employed to amplify the virus from patient body tissues and fluids, using the polymerase chain reaction (81.5% homologous) . Because these nucleotide fragments are less than 82% homologous with comparable gag gene sequences of other retroviruses, the identification of such nucleotide sequences (or peptides encoded thereby) in the body tissues and fluids of suspected CFIDS patients, may confirm diagnosis of the infection. The entire sequences of Fig. 1A and Fig. IB are be used in obtaining the PCR primers or hybridization probes according to this invention.

A CAV peptide may be encoded by all or a fragment of a DNA sequence of Figs. 1A or IB. It is anticipated that a nucleotide sequence of Figs. 1A or IB is, in part, a coding sequence for peptides and proteins of CAV. Six putative CAV peptide sequences which appear in Figs. 2A through 2F are determined by translating the nucleotide sequences of Figs. 1A or IB into three reading frames for each sequence, beginning with the 5• nucleotide number 1, 2 or 3, respectively, of Fig. lA and Fig. IB. Fig. 2A illustrates a reading frame beginning with nucleotide 1 of Fig. 1A. Fig. 2B is a reading frame beginning with nucleotide 2 of Fig. 1A. Fig. 2C is a reading frame beginning with nucleotide 3 of Fig. 1A. Fig. 2D illustrates a reading frame beginning with nucleotide 1 of Fig. IB. Fig. 2E illustrates a reading frame beginning with nucleotide 2 of Fig. IB. Fig. 2F is a reading frame beginning with nucleotide 3 of Fig. IB.

In Fig. 2A through F, an asterisk represents a putative STOP codon. It is possible that single base errors in reading the nucleotide sequences of Figs. lA or IB may indicate STOP codons where a codon for a native amino acid should be encoded. Therefore, CAV peptide sequences may comprise fragments of the following encoded sequences which occur between stop codons, as well as smaller fragments thereof.

It is expected that at least one of the peptide sequences (or fragments thereof) encoded by a nucleotide sequence of Figs. 1A or IB may provide either an antigenic or immunogenic peptide. These peptides reported in Figs. 2A through 2F as well as other peptides identified by the complete sequencing of CAV may be used as vaccine components.

Example 5 - In Situ Hybridization

Viral RNA related to HTLV I and II was identified by in situ hybridization in activated PBMC from CFIDS patients, but not controls, as follows.

Freshly isolated PBMC were cultured in cluster plates [Costar] in RPMI 1640 with 10% fetal calf serum (FCS) containing an optimal mitogenic concentration of purified OKT3 MAb [Ortho] and 10 U/ml recombinant IL2 for 3 days. Cell concentrations were adjusted to 2X10⁵ ml-¹ in complete growth media with 50 ng/ml recombinant IL2 [Sandoz, Vienna, Austria] for 7 days then spun onto glass slides fixed with paraformaldehyde, and stored in 100% ethanol.

In situ hybridization was carried out using ³⁵S- labelled RNA probe specific for the 5• region (gag) of HTLV I and II. The sizes of transcribed labelled riboprobes were 506 bp for HTLV I and 400 bp for HTLV II. Probes were hybridized at l-2X10⁸d.p.m. ml"¹ at a temperature of 52°C and autoradiographed for 4-8 days. All cells lines were hybridized using the same conditions in the same laboratory, and cells were examined using a double-blind code. Table VII provides the data on the detection of retroviral RNA in adult CFIDS patients and in exposure controls by this in situ hybridization with the HTLV I gag probe and HTLV II gag probe.

Table VII

Detection of Retroviral gag mRNA by in situ

Hybridization of Activated PBMC from Adult CFIDS*

MT-2 cells (HTLV I) +4 0 0 Mo-T cells (HTLV II) 0 +4 0 HIV-infected H9 cells 0 0 +4

*Scale used to score samples: 4+ = 100-50% positive cells; 3+ = 50-1% positive cells; 2+ = 1-0.1-% positive cells; 1+ = 1- 0.01% positive cells; 0 = < 0.01% positive cells. HTLV mRNA-positive cells were detected in 45% of adult CFIDS patients tested when the HTLV II gag probe was used. Only one of five exposure controls contained these infected cells. PBMC from two of eleven CFIDS patients also contained RNA that reacted with HTLV I gag probe while none of five controls did. These data show that PBMC from a proportion of CFIDS patients are actively transcribing viral gag mRNA in vitro. This RNA appears to be more homologous to HTLV II gag in most patients but also shows homology to HTLV I gag in several patients. Control cells infected with prototypic HTLV I (MT-2) or prototypic HTLV II (Mo-T) show no such gag mRNA cross-reactivity. This indicates that this CAV is not HTLV I or HTLV II.

Example 6 - Detection of HTLV gag Protein via Antibody To detect the CAV nucleotide sequence in the PBMC of suspected CFIDS patients using antibody, the method described in DeFreitas et al, cited above, was performed.

Cytospun cells were air dried for 2 hours and fixed with cold acetone for 10 minutes. They were then incubated for 30 minutes with 20 μl of optimally diluted ascites containing MAbs to HTLV I p24 [from Dr. Fulvia Veronese, Litton Bionetics, Bethesda, MD] , HTLV II p24, or HIV pl5 protein [from Thomas Palker, Duke University, Durham, NC] .

In addition, MAb to HIV p24 was supplied by Dr. Micah Popovic, NCI, Bethesda, MD. Positive control cells included MT2, Mo-T2, and H9-T cells infected with HTLV I, HTLV II, and HIV respectively. Cells were labelled with immune complexes of alkaline-phosphatase and anti- alkaline phosphatase (APAAP) according to the method of J. Cordell et al, J. Histochem. Cytochem.. 32:219-225 (1984) using reagents obtained from Dako, Santa Barbara, CA. Uninfected H9 cells and cerebrospinal fluid-derived T cell lines from healthy donors served as the negative cell controls. Tests for nonspecific binding of the second antibody and the APAAP complex were included.

Tables VIII and IX report the results of this assay.

TABLE VIII

*Scale used to score samples: 4+ = 100-50% positive cells; 1 = 1-0.01% positive cells; 0 = < 0.01% positive cells.

TABLE IX

Expression of Protein Related to HTLV gag In Activated

PBMC from Pediatric CFIDS Patients by Immunohistochemistry*

Presence of a rotein- ositive ce ls

0 0 0 0 0 0 0 0 0 0

+4 +4

+4 0

*Scale used to score samples: 4+ = 100-50% positive cells; 1 = 1-0.01% positive cells; 0 = < 0.01% positive cells.

An HTLV-specific gag protein was detected at low frequency in inactivated PMBC from CFIDS patients by a MAb Kl specific for the gag region of HTLV I and II using immunohistochemical staining. The MAb specific for HTLV I gag (13B12) did not react with any cells from CFIDS patients. This demonstrates that a viral gene product is expressed in at least a subpopulation of CFIDS patients and that this protein is not HTLV I encoded.

Example 7 - tRNA Primer Binding Site

Two primers were designed for use in the PCR technique: the sense primer was the DNA sequence of tRNA site for proline (#766-783) while the antisense was the HTLV II gag region bases (#1187-1214) . Products generated from cell lines MT-2 (HTLV I) , Mo-T (HTLV II) , and more than 20 CFIDS patients were probed by Southern blot hybridization with radiolabeled 18-mer probe which corresponded to a DNA sequence intervening the two primers for both viruses.

The results showed that while MT-2 and Mo-T DNA were amplified via the tRNA binding site for proline, all CAV DNA samples were negative. Thus, CAV is apparently not a known human C-type virus (except for HIV) .

When the same experiment was performed using the tRNA primer binding site for lysine as the "sense" primer strand for PCR (5' TGGCGCCCAACGTGGGGC 3') and the "antisense" strand primer was derived from a prototypic monkey D type retrovirus (MPMV) (5' GCTACGGCAGCCATTACTTG 3 ') , the primers amplified two different sized products from MPMV-infected cells which were visible when probed with an intervening oligonucleotide derived from MPMV (GATACTTGTCCTTGGTTTCCGCA) . The products were 360 bp and 250 bp. Ten of ten CFIDS patient DNA samples amplified and probed using this system showed the same sized products. Thus, the CFIDS retrovirus, CAV, apparently has a primer binding site for the tRNA of lysine. This result suggests that CAV is not HTLV I or II and suggests that it is either a type of lentivirus, primate D-type retrovirus, or Foamy (Spuma) virus, all of which use a tRNA lysine primer.

Example 8 - Characterization of gag Proteins of CAV

Peripheral blood leukocytes were activated in culture with OKT3 Mab [Ortho Pharmaceuticals] and recombinant IL-2 for five days. After replacing complete media with cysteine- and methionine-free media on day six, cells were labeled with ³⁵S-methionine and cysteine for 16-18 hours. After disruption of cells, labeled proteins containing gag antigenic determinants were precipitated with mouse Mab Kl which reacts with gag proteins of HTLV I, II, STLV and Staph A.

Precipitates were boiled in SDS to remove the antigen-antibody complexes from the Staph A, and the protein complexes electrophoresed through 12% and 15% polyacrylamide gels with 0.1% SDS and 2-mercaptoethanol for 16-18 hours at constant amperage. After gels were dried and exposed to X-ray film for 12-15 days, sizes of radiolabeled proteins from CFIDS patients and controls were calculated from standard curves generated using labeled molecular weight markers which were co- electrophoresed.

The results show that the precipitated gag proteins from HTLV I and II infected cell lines in 12% PAGE are 24 kD and 45 kD. On the same gels, ten out of ten CFIDS-derived CAV gag proteins are 27-28 kD, 45 kD, 55-56 kD and 76 kD. No gag proteins were precipitated from healthy controls.

On the 15% PAGE, lower molecular weight gag proteins could be visualized from CFIDS patients. In addition to p27-28, pll-12 (11-12 kD) , and pl3-14 (13-14 kD) were visualized. No such bands were present in MT-2 or Mo-T lysates, or in healthy controls.

These data suggest that the CFIDS retrovirus CAV is not HTLV I or II. Animal retroviruses that have been shown to express gag proteins of these molecular weights are: primate D-type retroviruses; primate C- type, e.g. SSAV, GALV and BaEV; lentiviruses, e.g. EIAV (but not HIV); mouse B-type e.g. MMTV; avian C-type retroviruses, e.g. ASLV, REV; and perhaps Foamy (Spuma) viruses, although the gag proteins of this latter group have not been analyzed directly but only by DNA sequence extrapolation.

Example 9 - Location of gag Proteins in Nucleus

Leukocytes from the above-mentioned CFIDS patient samples are reacted with K-l Mab and immunostained by goat-anti-mouse alkaline phosphatase (APAAP) . More than 50% of patient samples tested (and none of controls) revealed cells staining for gag proteins. Most importantly, the staining is found in both the cytoplasm and nucleus of the positive cells. The only known retroviruses to display nuclear staining for viral proteins are the Foamy virus group.

Example 10 - Reverse Transcriptase Assay

A reverse transcriptase assay was performed as follows. CAV was cultured in cell lines B-Jab H-9 and V- 937 (all positive by PCR for HTLV-II gag region) . The virus was harvested through three cycles of freezing at - 80°C. Culture fluid was subsequently thawed and centrifuged at 1,000 xg for 10 minutes at 4°C to remove intact cells.

The viral particles were pelleted by running at a speed 25,000 rpm for 90 minutes in a Beckman SW28 rotor. The pellet was suspended in 500 μl (to make lOOx concentration) of TNE buffer (10 mM Tris/HCl pH 8.0, 100 mM NaCl, 1 mM EDTA) . The buffer can be tested immediately or stored frozen at -20°C. Either 25 μl or 50 μl of lysate in buffer, as indicated in Table X below, was used in each assay tube.

The reaction mixture of reverse transcriptase activity [I. M. Verma, J. Virol.. 15:843-854 (1975); I. M. Verma, J. Virol.. 15:121-126 (1975)] in 100 μl contained 50 mM Tris/HCl, pH 8.0,. 40 mM KCl, 5 mM dithiothreitol, 0.05% Triton X-100, 0.2% Nomidet P-40, 100 μg/ml bovine serum albumin, 40 μg/ml template-primer complex and varying amounts of divalent cation (Mg⁺⁺ or Mn⁺⁺) to achieve the concentration as indicated in Table IX below.

The exogenous template-primer complex was selected from either polyriboadenylate- oligodeoxythymidylate (poly.rA-oligo.dT) or polyriboσytosylate-oligodeoxyguanidylate (poly.rC- oligo.dG) [Pharmacia, Piscataway, NJ] .

After 5 minutes on ice, 1.5 μM [³H]-labelled deoxythymidine triphosphate (dTTP; 43 Ci/mmole) or 6.6 μM [³H]-labelled deoxyguanosine triphosphate (dGTP; 11 Ci/mmole) [Amersham, United Kingdom] were added^" in the mixture and incubated at 37°C for 60 minutes. The reaction was stopped by the addition of ice cold 10 mM sodium pyrophosphate and 15% trichloracetic acid (TCA) . After 15 minutes at 0°C the precipitated [³H]-labelled polythymidines (poly T) and polyguanidines (poly G) synthesized in this reaction was collected on a glass microfiber filters (Whatmann GF/C, 2.4 cm) presoaked in 5% TCA. The filters were washed ten times with ice cold 5% TCA and dried. ³H-TCA-precipitable material (i.e. double stranded nucleic acid) was counted with Econofluor scintillation fluid by a Packard liquid scintillation counter. The data in the following table is expressed as counts per minute per reaction vial.

Reverse transcriptase (RT) of every retrovirus prefers a unique exogenous template-primer, a divalent cation (either Mg⁺⁺ or Mn⁺⁺) , and a labelled substrate to polymerize DNA from RNA [See, e.g., "RNA Tumor Viruses", second edition, eds. R. Weiss, N. Leich, H. Varmus and J. Coffin, Cold Spring Harbor Lab Press, Cold Spring Harbor, NY (1984)].

The results of the RT study demonstrated that the CFIDS-associated CAV growing in established cultures apparently does not show the characteristics of a C type retrovirus reverse transcriptase, e.g., an RT of HTLV-I or HTLV-II. RT of HTLV-I (as illustrated by the MT-2 cell lysate of the table) and HTLV-II prefer a template- primer of poly 7C-oligo(dG) with Mg⁺⁺ {= 30 mM) . CAV appears to prefer a template-primer of polyγA-oligo-(dT) with Mn^"1"1". Among the retroviruses that show the same RT characteristics as that of CAV (poly 7A-oligo(dT) template-primer and Mn⁺⁺ preferences) are the Spuma (foamy) virus and the monkey D-type retroviruses.

TABLE X

RNA-dependent DNA polymerase (reverse transcriptase; RT) activity

Numerous modifications and variations of the present invention are included in the above-identified specification and are expected to be obvious to one of skill in the art. For example, use of other appropriate CAV genomic sequences as PCR or hybridization primers and probes is contemplated, as well as the use of other assay techniques and antibodies, and the use of other viral peptides for therapeutic agents. Such modifications and alterations to the compositions and processes of the present invention are believed to be encompassed in the scope of the claims appended hereto.

Claims

WHAT IS CLAIMED IS:

1. CFIDS-associated virus, CAV.

2. The virus according to claim 1 substantially isolated from contaminants with which it occurs in natural sources.

3. A CAV polynucleotide sequence.

4. The sequence according to claim 3 comprising a contiguous sequence of nucleotides capable of selectively hybridizing to the genome of CAV or a complement thereof.

5. The sequence according to claim 3 which is a DNA polynucleotide.

6. The sequence according to claim 3 which is an RNA polynucleotide.

7. The sequence according to claim 3 which is associated with a detectable label.

8. The sequence according to claim 3 which is fixed to a solid support.

9. The sequence according to claim 3 which comprises a nucleotide sequence encoding an antigenic determinant of CAV.

10. A substantially isolated polypeptide comprising a CAV amino acid sequence.

11. The polypeptide according to claim 10 comprising an antigenic site of CAV.

12. The polypeptide according to claim 10 prepared by recombinant techniques.

13. The polypeptide according to claim 10 prepared by chemical synthesis.

14. The polypeptide according to claim 10 fixed to a solid support.

15. The polypeptide according to claim 10 for use in a method of making anti-CAV antibodies which comprises administering the polypeptide to a mammal in an amount sufficient to produce an immune response.

16. A recombinant vector comprising a coding sequence which comprises a CAV polynucleotide.

17. A host cell transformed by a recombinant vector according to claim 16, wherein the coding sequence is operably linked to a suitable regulatory control sequence capable of directing the expression of the coding sequence.

18. A composition comprising a CAV polypeptide and a pharmaceutically acceptable carrier.

19. The composition according to claim 18 wherein said polypeptide is capable of generating an immune response.

20. The composition according to claim 19 which is a vaccine composition.

21. An anti-CAV antibody composition comprising an antibody that binds an antigenic determinant of a CAV polypeptide which is (a) a purified preparation of polyclonal antibodies; (b) a monoclonal antibody composition; or (c) a recombinant antibody composition.

22. The antibody composition according to claim 21, optionally associated with a detectable label or a solid support.

23. A method for diagnosing CFIDS comprising detecting the presence of all or a portion of a polynucleotide sequence of CAV in the body fluids of a patient exhibiting the symptoms of CFIDS.

24. The method according to claim 23 wherein said detecting step comprises employing all or a fragment of a CAV polynucleotide sequence or a complement thereof as a primer in a polymerase chain reaction performed on a sample of patient body fluids in vitro, wherein the amplification of said sequence indicates the presence of the etiologic agent of CFIDS.

25. The method according to claim 23 wherein said detecting step comprises employing all or a fragment of a CAV polynucleotide sequence as a hybridization probe in a hybridization assay performed on a sample of patient body fluids in vitro, wherein the hybridization of said sequence indicates the presence of the etiologic agent of CFIDS.

26. A method for diagnosing CFIDS comprising detecting in the body fluids of a patient exhibiting the symptoms of CFIDS the presence of an anti-CAV antibody.

27. The method according to claim 26 wherein said detecting step comprises contacting a body fluid from a CFIDS patient with a CAV polypeptide or protein, wherein said peptide or protein represents an antigenic site capable of forming an antigen-antibody complex with said antibody.

28. The method according to claim 26 wherein said detecting step comprises contacting a body fluid from a CFIDS patient with a peptide or protein from HTLV I or HTLV II, which peptide or protein encodes an antigenic site capable of binding to said antibody and which antigenic site is common between HTLV I and CAV or between HTLV II and CAV.

29. A method for producing blood products free from infection with CAV comprising screening a sample from a large aliquot of blood for a CAV polynucleotide sequence or an anti-CAV antibody, selecting samples testing negative in said screening, and preparing said blood products from said aliquot of blood associated with said selected samples.