PT98812A - PROCESS FOR THE PREPARATION OF A VIRUS ASSOCIATED WITH CHRONIC FAIL IMMUNODISM FUNCTION (CFIDS), PROTEINS, POLYPEPTIDEES AND POLYNUCLERIDES OF THIS VIRUS AND ANTIBODIES, CELL LINES, COMPOSITIONS, RELATED VACCINE COMPONENTS AND DIAGNOSTIC REAGENTS, AS WELL AS THE PROCESS OF DETECTION OF VIRAL SEQUENCES AND ANTIBODIES - Google Patents

Description

Description referring to the patent of invention of The Wistar Institute of Anatomy & Biology, Institute for Research, North American, Home in 36th & Spruce Streets, Philadehphia, Pennsylvania 19104-4268, United States of America, (inventors: Elaine DeFrei-tas and Brendan Hilliard, US residents), " PROCESS FOR THE PREPARATION OF A VIRUS ASSOCIATED WITH THE SYMPTOM OF IMMUNODISFUNCTION OF (CFIDS), proteins, polypeptides and polynucleotides of this virus and of antigens, cell lines, compositions, vaccines components and related diagnostic reagents, as well as a method of detecting viral sequelae and anti-bodies.

The invention described herein was made in the course of a work which had a grant from the United States National Institute of Health, from the Department of Health and Human Services,

BACKGROUND OF THE INVENTION Chronic Fatigue Immunodeficiency Syndrome (CFIDS) is a disease characterized by a set of symptoms that include neurological and neurological abnormalities. However, since the symptoms of CFIDS are similar to N - 1 -

of several other conditions, patients suffering from SIFC are often misdiagnosed and other conditions, including psychosomatic illness, are attributed. In fact, the disease characterized by all or part of the CFIDS symptoms described below was diagnosed as being a chronic active syndrome of Epstein Barr Virus Infection, chronic mononucleosis, post-viral fatigue syndrome, a (Buchwald and AL Komaroff, Rev. Infectious Pis., 13 (Suppl.l): S12-8 (1991)], " Royal Free Disease ", " yuppie dise ase ", neurasthenia, and Myalgic encephalomyelitis, see, for example, D. Williams, Time, May 14, 1990, 66, W. Boly, Hippocrates, July / August 1987, pp. 31-40, H. Johnson, Rolling Stone , p 56, and GP Holmes et al., Annals Intern. Med., 108: 387-389 (1988).

A definition of a case study of CFIDS has recently been developed (Holmes et al., Supra). To match the definition in the case of CFIDS service, either the main criteria or six or more symptom criteria and two or more physical criteria and eight or more symptomatic criteria must be present. The two main criteria are that the easy propensity to fatigue, persistent and "relapsing" which is not resolved by bed rest and is sufficiently severe to reduce daily activity by at least half and exclusion of other chronic clinical conditions including pre-existing psychiatric illnesses. The least important criterion includes moderate fever or cold sensations, sore throat, lymph gland pain, generalized home muscle weakness unexplained, muscle discomfort, miealgia, prolonged generalized fatigue (greater than 24 hours) after normal exercise, new generalized headache, arthralgia not in migratory inflammation, neuropsychological symptoms including photophobia, transient visual scotomata, memory loss, excessive irritability, confusion, impaired thinking, inability to concentrate, and depression, disorders of the nose, and initial establishment of acute or sub- treble Physical criteria include moderate fever, non-exudative pharyngitis, and anterior or posterior lumbar ganglia or palpable or soft axillary. - 2 -

The first documented CFIDS epidemic occurred in Los Angeles more than 50 years ago. Epidemic outbreaks affected 1136 people in Iceland in 1984 and infected around 100,000 people in the United States, Canada and New Zealand in 1984. New occurrences of CFIDS outbreaks have been reported on a regular basis since then. The diagnosis of SFIDS is difficult and costly since these symptoms are similar to those of other conditions and the diagnosis often involves eliminating the presence of other conditions. At present, specific assays to identify malignant syndrome have not been definitively identified, although a number of specific agents have been proposed in the past including the Epstein Barr virus, and some enterovirus and human herpes virus type 6 associated with the disease have been identified. type of SFIDS, the etiological agent of SFIDS has not been definitively identified.

Retroviruses are a family of viruses with a spherical envelope comprising three subfamilies, Onco-virinae, Spumavirinae and Lentivirinae. Viruses are designated as type B, type C or type D viruses, depending on some structural characteristics of the virions. Among these features are the location of the central nucleotide, the presence of low molecular weight gag gene proteins, the DNA sequence of the RNA transfer primer (PBS) at the 5 'LTR, and the symptoms that viruses induce in infected hosts.

Type B viruses such as mammalian viruses, mouse breast tumor virus (MMTV), have a central nucleotide isolated eccentrically and mature virions can be visualized by electron microscopy either intracellularly or extracellularly.

All known human retroviruses are type C viruses, oncoviruses (HTLV I and II) and lentiviruses (HIV 1 and HIV 2), wherein the central nucleotide is located concentrically and mature virions are usually viewed extracellularly. Exogenous oncoviruses and lentiviruses occur widely among vertebrates and are associated with many diseases.

«IMtWBfl

Type C oncoviruses include human T-cell lymphotropic viruses (HTLVs) including HTLVs I and II. These HTLV viruses are linked with some rare malignancies of human T cells. 0 HTLV "! is linked to a chronic central nervous system demyelinating disease called myelopathy associated with HTLV I (HAM) or tropical spastic paresis (TSP) [E. DePreitas et al., AIDS Research Ana Human Retroviruses, 3 (1) s 19-31 (1987)]. Both HTLV-I and II have been reported as a co-infection with IVIV in many AIDS cases. Two members of this family, HTLV I and HTLV II, were cloned and sequenced, and appear to represent divergent, evolving viral subgroups. The sequence for HTLV I was published by Seiki et al., Proc. Natl. Acad. Sci., USA, 80: 3618-3622 (1983). See, also, G. M. Shaw et al., Proc. Natl. Acad. Sci., USA, 81: 4544-4548 (1984). The nucleotide sequence of HTLV II was published in K. Shimotohno et al., Proc. Natl. Acad. Sci., USA, 82: 3101-3105 (1985).

Type-C lentiviruses include human rectroviruses, HIV-1 (the causative agent of AIDS) and HIV-2 as well as infectious equine anemia (EIAV) viruses.

Until now, other non-C or D-type retroviruses have been identified in primate, but they have not been in humans. Mason Pfizer monkey virus (MPMV) is a type D virus that causes lymphocyte depletion and paralyzes the upper limbs when inoculated in newborn monkeys [D. Fine, et al., Cancer Res. 38: 3123-3139 (1978). D-type viruses are also characterized by their ability to infect human T and B cells. [See, e.g., MD Daniel et al. Sci., 223: 602-605 (1984); CS Barker et al., Virol., 153: 201-214 (1986), AA Lackner et al., Curr Tropics Microbio, Immunol., 160: 77-96 (1990 )] The Spumavirinae subfamily includes the Sparkling viruses [JJ Hooks et al., Bacteriol. Rev., 39: 169-185 (1975)]. Ten serotypes of foamy viruses have been identified in several Old World monkeys and Hovo Mundo but they do not appear to be pathogenic in all animal species tested.

There is a need for a process -

to detect the occurrence of CFIDS, allowing patients to be properly diagnosed, as well as therapeutic and vaccine agents to treat and / or desirably prevent infection.

Summary of the Invention The invention provides a novel virus associated with the essentially isolated Chronic Fatigue Immunodeficiency Syndrome, hereinafter referred to as the CAV. The CAV polynucleotide sequences and the CAV polypeptides are useful as diagnostic reagents in the diagnosis of patients with CFIDS. CAV polynucleotide sequences and CAV polypeptide sequences are useful in therapeutic compositions or vaccines for the treatment or prevention of CFIDS. Also disclosed herein are processes and assays for the diagnosis and / or treatment of patients with CFIDS. Antibody is also described for antigenic regions of CAV and in vitro cells containing sequences of polynucleotides or CAV polypeptides.

Other aspects and advantages of the present invention are further described in the following detailed description.

Brief Description of the Figures

Figures 1A and 1B illustrate fragments of potential sequences of CAV MM. A band of the DNA sequence is referred to in FIG. the complementary band is referred to in Fig. 1B.

FIGS. 2A through 2F illustrate the six potential reading frames of the putative CAV nucleotide sequences of Figs. 1A and 1B, Fig. 3 is an electron photomicrograph of human H-9 H-9 lymphoblastoid T cells infected with CAV as described in Example 1.! Fig. 4 is another electrophotomic photomicrograph of B-Jab human B-Jab B lymphoblastoid cells with CAV, as described in Example 1

Detailed Description of the Invention The present invention provides processes and compositions for the detection, treatment and prevention against infection of humans, and possibly of other mammals, by a virus that causes, or at least contributes to, the disease called Immunodeficiency Syndrome of Chronic Fatigue. This invention involves the discovery by the inventors and the substantial isolation of the virus associated with apparently unknown CFIDS, CAV.

It is thought that at least a percentage of patients, both humans and animals, exhibiting CFIDS symptoms suffer from CAV infection. This virus is present in body fluids in a statistically significant number of human patients suspected of having CFIDS, based on the physical symptoms usually associated with this disease, for example the presence of a chronic disease with a pattern of clinical symptoms, immunological abnormalities , herpes virus activation, and central nervous system abnormalities. Patients suspected of having CFIDS that do not show positive assays in the presence of this virus should suffer from a different disease, or have currently undetectable levels of viral infection in the body fluids assayed. This virus may also be the causative agent of other diseases with symptoms similar to the symptoms of CFIDS mentioned above, but these diseases are known by another name. CAV and its polypeptides, which can be found in cells or fluids of the body of a human patient with symptoms of CFIDS, have been substantially isolated from contaminants with which the virus and its polypeptides occur in natural sources. The CAV or a polypeptide thereof may also be obtained substantially isolated from contaminants with which it is associated through its production, for example, by a recombinant process and / or by chemical synthesis. These natural sources and / or sources of production include human cells or cellular components, cells or cell components,

rss of any other CAV-infected animal, host cell pressure systems, soforenad cell cultures, eluted from chemical purification, and the like.

The terms "substantially isolated " or " purified " used herein with reference to CAV and the CAV polypeptides are defined as follows: A CAV composition or a polypeptide thereof is substantially isolated from a natural source or production, as defined above, wherein the percentage of CAV or its polypeptide relative to the source, and without regard to other contaminants, is at least 10% on a percentage by weight basis. The definition of " substantially isolated " from a natural source or from production also comprises a purification percentage of at least 25% based on a percentage by weight. Similarly, a CAV composition or a polypeptide thereof from a natural source or a production, as defined above, is substantially isolated, wherein the percentage of CAV or its polypeptide relative to the source, and without having in consideration of other contaminants, is at least 40% on a percentage by weight basis. The definition of substantially isolated may include a purification percentage of at least 60% on a weight percent basis.

This virus may be characterized by one of the following morphological, physical and biological characteristics. The virus may also be characterized by a combination of two or more of these characteristics of the CAV prototype virus of this invention. and The term " CAV " as it is understood by viral taxonomists includes all viral species characterized by the isolated prototype described herein. It should be understood that the CAV includes either the prototype isolate or other isolates, as described below. There are many characteristics of the prototype isolate that an axonomist can use to identify and classify new CAV isolates. Based on the prototype virus specifically exemplified in the following examples, the CAV can be morphologically characterized as being a retrovirus, particularly a non-C-like retrovirus that is susceptible to infecting humans. The raficrosco-electron sink of viral particles formed in cultures of 7 -

(Figs 3 and 4) suggests that CAV is a non-C-type retrovirus because of its diameter, morphology, formation and location of intra-cellular virions. More specifically, as described in Example 1 above, CAV-infected cells may be characterized by electron-dense, some with electron-dense, electron-dense virions, and others with dense electron-colors associated with the rough endoplasmic reticulum and large interior mitochondria to normally distended cells. All particles have the same shape and size, 46-50 nm (460-500 A). No extra-cellular virus is observed. No stretching forms of the cytoplasmic membranes are observed. Thus, cells infected with CAV could also be characterized by the presence of intracereplasmic particles.

The CAV is believed to be specifically distinguishable from viruses previously identified with CFIDS, Epstein-Barr virus, HHV-6 and various enteroviruses. The CAV morphology also apparently distinguishes it from human type C, HTLV I and HTLV II retroviruses. The apparent location of its virions in mitochondria distinguishes the CAV from HIV.

One of the characteristics of CAV appears to be its ability to infect human B and T cells. As described in more detail in Example 1, this virus was apparently propagated in culture by leukocyte blending of CFIDS patients with two types of cell lines human, H9 lymphoblastoid T cells and B-Jab B lymphoblastoid cells. These cell lines are also perralsible for HTLV I and HTLV II, respectively. Both of these cell lines are permissible for the D-type viruses of the xenophoropic primates, for example the Mason Pfizer monkey virus (MPMV), and Foam virus (Spuma) (see Fine et al., Daniel et al. Bar-ker et al., And Hooks et al, cited above).

Another possible feature of CAV is its apparent tRNA primer binding point (PBS) which it prefers. Retroviruses can be categorized relative to the DNA sequence in the U5 region of their 5 'LTR that binds RNA from. transfer (tRNA) to some types of amino acids (see, for example, F. Harada et al., J. Cancer. Res., 81: 232-237 (1990)). 8

For example, a type C virus, such as HTLV I or II, has a primary binding site tRNA TGGGGGCTCGTCCGGGAT which binds tAEN to proline. In fact, all mammalian type C viruses utilize the tRNA point for proline with the exception of HIV. As described in detail in Example 7, the PCR technique (Polymerase Chain Injection) was used to amplify the U5 region in CAV to determine its tAEN binding site. The results of this experiment indicate that the binding site of the primer is for lysine tASH. This result further indicates that the CAV is a non-C retrovirus.

Yet another way for a taxonomist to characterize CAV is by the presence of gag proteins of molecular weight, molecular weight, pll, pll-12, p3-14, p27-28. Such as & described in detail in Example 8, the apparent gag CAV proteins having this molecular weight were immunoprecipitated from leucocytes obtained from patients with CFIC using a mono-

(Mab) K-1 (described in E. de Freitas et al, AIDS

Research and Human Retroviruses, 3s19-32 (1987), as the Mab of I1TLV I in Table 2, p. 26) which repre- sents an antigenic determinant in the gag protein of HTLV I, II and T-cell lymphocyte virus (STLV). The retrovirus classes of primates and non-primates have these characteristic gag proteins (J. Leis et al., J. Virol., 62, 1808-1805 (1988)).

It appears that the virus has the ability to induce the presence of viral gag proteins in the nucleus and cytoplasm of the cells it infects. The CAV may also be therefore present by immunohistochemical disclosure of the IFC leukocytes using Mab SI as viral gag proteins located in the nucleus as well as in the eytoplasm of the infected cells. This feature of the viral gag protein and its locality. The virus may also be characterized by the presence of a gag gene sequence that differs from the HTLV I and HTLV gag gene sequences

Tables Ϊ and II below illustrate the comparative differences between the CAV and other human and animal retroviruses known on the basis of the above viral characteristics 9

and the symptomatology known to the known retroviruses in infected hosts.

SUMMARY OF RETROVIRUS CORRELATIONS WITH TYPES

KNOWLEDGE "Infecta Vlrus Human Cells T and B Intracytoplasmic particles by EM Uses tRNA lysine primer gag proteins in nucleus gaf proteins pll-12, P13-14, P27-28 (Mr) CAV +1 B-type MMTV 0 ^ + + (Non-human) 0 0 0 0 + 0 + C-type (oncovirus) Birds 0 0 0 0 0 Mammals 0 (non-primate) 0 0 0 0 Primate + 0 0 0 C-type (lentivirus) HIV + 0 + 0 0 EIAV 0 + + 0-D-type MPMV + + + + Sparkling + + + Q3 2 (0) means not referred to in the literature, , ie (+) means referred to in the literature for CFIDS, in this application Ser.

Without reference in the literature on the characterization of gag protein, although they have been reduced by DNA sequencing. - 10 -

TABLE II CORRELATIONS OF RETROVIRUS CFIDS WITH KNOWN TYPES Reported Symptomatology Virus Syncytia Immuno Formation Suppres in vitro sion - Neurolo gic Dys function Fatigue / Wasting Reactivation of Herpes CAV + + + + + B-type * MMTV 0 0 0 0 0 C-type oncovirus) Birds 0 + + + + Mammals (non-primate) 0 + + + + Primate (nonhuman) 0 + + 0 + BUmano (HTLV I and II) 0 + + 0 0 C- + + + + EIAV 0 + 0 + 0 D-type MPMV + + + + ESpumoso + o4 0 + 4 Isolated from neural tissue. - 11

The CAV, or a subtype of the virus, may be characterized by the presence of a polynucleotide sequence of either RNA or DNA that can be obtained and its nucleotides identified by the application of conventional sequencing techniques including techniques of the polymerase chain reaction (PCR), to sources containing the virus substantially isolated. It is known to obtain the polynucleotide sequences of a virus substantially isolated from its sources using the techniques and sequences described herein. These sources are defined above as natural sources or sources of production.

The CAV polynucleotide sequences or their subtype viruses are thus part of this invention. Sequences containing one or more nucleotide differences of the CAV sequences but encoding sequences homologous to CAV are also included in the present invention. Due to the high error rate of transcription in viral replication of RNA, it is believed that the CAV polynucleotide sequences will be characterized by certain variations between possibly isolated, hypervariable regions or domains. Different types of CAV may be characterized by sequences that differ from the prototype virus sequences described herein, but which share the entire genomic organization and large regions of conserved sequences. In particular, virally encoded enzyme sequences are thought to be similar between CAV subtypes. The viral homology of the amino acid level between CAV subtypes should be at least 40%. More specifically, such homology is thought to be in the range of about 40% to about 95%. The homology between subtypes may be at least 50%. Other subtypes of CAV may have amino acid homologies of at least 60% or more. Some isolates will be at least 70% homologous, while others will be at least 80% or 90% homologous.

It should be understood that sequences of CAV polynucleotides include sequences that hybridize under stringent or relaxed hybridization conditions (see T. Mania-tis et al., Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory (1982) pages 387 to 389) for the native CAV nucleotide sequences (RNA or DNA). are used, from 12

A string of polynucleotides of this invention must also be capable of hybridizing under conditions restricted to a polynucleotide sequence that encodes a CAV antigen point. An example of restricted hybridization conditions is hybridization in 4XSSC at 65 ° C, followed by a wash in 0.1XSSC at 65 ° C for one hour. Alternatively an exemplary restricted hybridization condition is that which is carried out in 50% formamide, 4XSSC at 50 ° C.

The polynucleotide sequences can hybridize to native CAV sequences under relaxed hybridization conditions. An example of such unrestricted hybridization conditions are 4XSSC at 500 ° C or hybridization with 30 to 40% formamide at 42 ° C.

A polynucleotide sequence of this invention may also differ from the above-described CAV polynucleotide sequences due to degeneracy of the genetic code. In addition, a polynucleotide sequence according to this invention may be a sequence that is complementary to a CAV polynucleotide sequence. Sequences of CAV polynucleotides are believed to contain sequences that are not found in HTLV I or HTLV II. Also included in the present invention are allelic variations (naturally occurring base changes in populations of species that may or may not result in amino acid alterations) of CAV DNA sequences, as well as their analogs or derivatives. Similarly, DNA sequences encoding CAV peptides or antigenic sites, but differing in codon sequences due to degeneracy of the genetic code or variations in the CAV DNA sequence that are caused by point mutations or by induced modifications to increase the activity, half-life or production of the thus encoded peptides, are also included in the invention.

Modifications of interest in the CAV sequences may include replacement, insertion, or deletion. nucleotide or amino acid residues chosen in the coding sequences. For example, one can manipulate a

structural gene varying individual nucleotides, although the correct amino acids are retained, or may be varied or nucleotide, so as to alter the amino acids without loss of biological activity. Mutation techniques for such substitution, insertion or elimination, for example, in vitro mutagenesis and primer repair, are well known to the skilled person (see, for example, U.S. Patent 4,551,584).

A potential source of CAV polynucleotide sequences is the DNA obtained from the supernatant that is extracted from tissue culture cells co-cultured with leukocytes from an SFIC human patient. This DNA was deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Maryland 20852, United States of America following the Budapest Treaty at the International Recognition of the Deposit of Microorganism for the purposes of the Patent Procedure in August 28, 1991.

CAV polynucleotide sequences can be obtained and their nucleotides identified by the application of conventional sequencing techniques to the amplified phage library Fixed Sau3A digested genomic DNA containing integrated CAV, deposited in a similar manner with ATCC in 28 August 1991 and designated ATCC NQ. 75087.

Another potential source of CAV polynucleotide sequences obtainable by the application of conventional sequencing techniques is the BamHI-digested Bluescript library of BamHI-digested genomic DNAs integrated into a similarly deposited E. coli strain. at ATCC on August 28, 1991 and designated ATCC δδ. 75088.

A CAV polynucleotide sequence may comprise a nucleic acid sequence obtained from one of the above-identified ATCC depots. The CAV or a subtype thereof may also be characterized as comprising all or part of a DNA sequence referred to in Figs. IA and 1B below. In addition, other se- quences can be obtained and / or created. quences of CAV from the aforementioned deposits or from other animal cellular sources. A DNA sequence of 14

of this invention should also be capable of hybridizing under conditions restricted to a DNA sequence from one of the above ATCC depots. A DNA sequence of the invention may also be capable of hybridizing under conditions restricted to a DNA sequence of Figs. 1A and 1B. The CAV is not limited by containing the sequences of Figs. 1 or 2. The final characterization of CAV is within the capability of a viral taxonomist with reference to the prototype isolate described herein. Any one or more of the above characteristics may be sufficient to classify a novel isolate as CAV.

Still another aspect of the invention relates to a CAV polypeptide in substantially isolated form. The CAV polynucleotide sequences or their subtype viruses are also part of this invention. A CAC polypeptide may be encoded by the above-described CAV polynucleotide sequences. A CAV polypeptide preferably comprises a sequence of at least 10 amino acids encoded by the CAV genome. A CAV polypeptide may also comprise all or a fragment of a CAV antigenic determinant. A CAV polypeptide may also comprise all or a fragment of a viral viral protein. A CAV polypeptide may also comprise all or a fragment of a non-structural viral protein.

Polynucleotide sequences which contain one or more amino acid differences of the CAV polypeptide sequences, but which encode a sequence-sharing homology at the amino acid level of CAV, are also included in the present invention. As described above, transcription error in a viral replication can produce CAV polypeptide sequences characterized by certain hypervariable amino acid regions or domains. Different subtypes of CAV can be characterized by polypeptide sequences that differ from the polypeptide sequences of the prototype virus described herein, but which share the overall structural organization (primary, secondary and tertiary) and large regions of conserved sequences with the prototype virus described herein. In particular, it is expected that the virally covalent enzyme sequences

different CAV subtypes. The viral homology of the amino acid level for the CAV subtypes is expected to be at least 40%. More specifically, such homology is expected to range from about 40% to about 90%. The homology between subtypes may be at least 50%. Other subtypes of CAV may have amino acid homologies of at least 60% or more; for example 70% or 80%. This homology may be estimated relative to the total genome, or to discrete fragments thereof, such as for example particular viral protein coding domains, especially conserved (non-structural) proteins or any of the sequences shown herein.

Other polypeptide sequences of this invention may be sequences capable of hybridizing under conditions restricted to a CAV amino acid sequence. A polypeptide sequence of this invention may also be capable of hybridizing under conditions restricted to a sequence of amino acids encoding a CAV antigenic site. The CAV polypeptide sequences should contain sequences not found in ETLV I or HTLVII.

Polypeptides, analogs or modified CAV derivatives thereof are also encompassed by this invention. A CAV polypeptide analog may be a mutated or modified protein or having a homology of at least 40% relative to the CAV. More preferably a modified CAV protein may have a homology of about 60%, and most preferably above about 80% relative to a native CAV polypeptide.

Typically, CAV polypeptide analogs differ from only 1, 2, 3, or 4 alterations of the cancers. Examples include CAV polypeptides with small amino acid variations of the amino acid sequences of the native CAV polypeptides or any of the above described CAV polypeptides, in particular, conservative amino acid substitutions. Conservative substitutions are those that take place within a family of amino acids that are listed in their side chains. Genetically encoded amino acids are generally divided into four families: (1) acidic =

to, glutamate); (2) basic = iisine, arginine, histidine; (3) non-polar = alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar = glycine, asparagine, glutamine, cysteine, serine, threonine, thiria. Phenylalanine, tryptophan, and tyrosine are sometimes combined together as aromatic amino acids. For example, it is reasonable to expect that an isolated substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar conservative substitution of an amino acid with a structurally related amino acid does not have a significant effect on the CAV polypeptide. Isolation and identification of the CAV and polynucleotide and polypeptide sequences also allows the development of diagnostic reagents and probes useful in Western blotting assays, ELISA assays or other diagnostic assays, immunogenic or therapeutic compositions and immunogenic compositions for the production of antibodies and vaccine compositions. These compositions may be useful in the diagnosis, treatment and prevention of FICS or related diseases.

Thus, in another aspect of this invention, there is provided a diagnostic reagent which is useful in the diagnosis of SFIC or related disease. As described in more detail below, such a reagent may comprise CAV polynucleotide sequences, including sequences complementary thereto and the other sequences described above. Such a subject may also comprise a sequence of CAV polypeptides as described above. The CAV sequences may optionally be associated with a detectable linker, a therapeutic or toxic molecule. The polynucleotide or popeptide type reagent may be capable of binding to a sequence present on the HTLV II gag protein and to a sequence present in CAV. The reagent may also comprise a polynucleotide sequence capable of hybridizing to a CAV antibody. . The reagent may be in the form of a hybridization probe for detection of CAV in patients. The reagent may be in the form of a - 17

primer to allow amplification of other CAV sequences. The reagent may also be an antibody to an epitope or an antigenic site in the CAV sequence.

PCR primer sequences using CAV polynucleotide sequences as reagents of this invention are at least about 10 bases in length, with an intervening sequence of at least 100 bases to reach 1500 bases therebetween, in accordance with the conventional PCR. Larger sequences up to about 30 nucleotides may also be used as the practical upper limit. However, it is possible that lengths of larger or smaller sequences may be useful based on modifications of the PCR technology. Currently the length of primer is not a limitation of the disclosure of this invention.

Similarly, the hybridization probes of the invention preferably have at least 10 bases in length, based on the current technology. Such probe sequences are typically no longer than about 50 bases in length. The lengths of the probes may preferably range from 15 to 30 bases in length. However, it is possible that smaller or larger probes sequences may be useful in the processes and compositions of this invention. The length of the probe is not a limitation of this invention, since the skilled person knows how to create probes of adequate length. The hybridization probes of this invention may desirably be associated with detectable labels, as described below.

For use in conventional assays as well as in the assays described below, the primers and probes of this invention must be susceptible to selective hybridization to a target CAV sequence. " Selective Hybridization " as used herein may be defined as the ability of the probe to hybridize to detection under conditions suitable for a target CAV sequence in a clinical sample from an infected patient and not hybridize to detection for other sequences in the sample that are not related to the CAV. Sequences fulfilling this condition may be created by the skilled person on the basis of the functional level of homology between the 13-

nucleotide sequence of the probe and the desired target CAV sequence. Only the probes of sufficient length and homology for the intended use will selectively hybridize, increasing the number of inconsistencies tolerated with the length of the probe. Typically, the probes will be at least 15 nucleotides in length, more preferably at least 20, and typically at least 25 nucleotides in length.

It will be understood that all polynucleotide sequences and polypeptide sequences described herein, either for use as diagnostic or as therapeutic reagents, for investigation or other activity may be prepared by techniques including chemical synthesis (including methods of enzymatic synthesis ), recombinant genetic engineering techniques (including PCR), or various known combinations of these techniques.

Conveniently, the synthetic production of the polypeptide sequences of the invention may be made according to the synthetic solid phase procedure described by Merrifield in J.A.C.S., 85, 219-2154 (1963). This technique is well known and is a standard process for the preparation of peptides. Alternative techniques for peptide synthesis are described in Bodansky et al Peptide Synthesis, Second Edition (John Wiley and Sons: 1976). For example, the peptides of the invention may also be synthesized using standard methods of synthesis of peptides in solution, involving phase or block coupling of amino acids or peptide fragments using chemical or enzymatic amide-forming processes. (See, for example, HD Jakubke in The Peptides, Analysis, Shynthesis, Biology, Academic Press (New York 1987), pp. 103-165, JD Glass, ibid., Pp. 176-184 and European Patent 0324659 A2, describing methods of peptide enzyme synthesis. These documents are hereby incorporated by reference.

All of the polynucleotide sequences and polypeptide sequences of this invention may also be prepared, and modified if desired, by conventional genetic engineering techniques. The peptides may be prepared by known techniques of DNA recombination, including clone 19 -

and expression within a host microorganism or a cell of an ADH fragment containing a coding sequence for the chosen peptide. Systems for cloning and expressing a chosen polypeptide in various microorganisms and cells, including, for example, bacteria, mammalian cells, fungi, baculoviruses and insect cells, are known and available for use in private and public laboratories and and also commercial sellers. (See also, Sambrook et al, supra). The CAV ADM obtained in the manner described above or modified in the manner described above may be introduced into an expression vector selected to prepare a recombination molecule or vector for use in the CAV polypeptide expression process. Various types of expression vectors suitable in the art for expression in mammals (including man), expression in insect cells, expression in fungi, expression in yeast and bacterial expression are known by conventional techniques of molecular biology.

These vectors and constructs of vectors contain the above-mentioned CAV DNA sequences, which encode the CAV polypeptides of the invention, including their antigenic or immunogenic fragments. The vector used in the process also contains selected regulatory sequences in operative association with the CAV & DW coding sequences of the invention. The regulatory sequences preferably present on the selected vector include promoter fragments, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other suitable sequences that direct the expression of the protein in a suitable host cell. Expression constructs, if desired, donor and receptor functional region dot introns, and leader sequences may also be included in an expression construct. The resulting vector is capable of directing the replication and expression of a CAV in selected host cells. Expression constructs are often maintained in a replicon, such as an extrachromosomal (e.g., a plasmid) suscept. stable maintenance in a selected host. 1 The processing procedure used

depends on the host to be transformed, and several procedures are known. To obtain expression of the CAV protein or polypeptide, recombinant host cells derived from transformants are incubated under conditions that allow the expression of the sentence encoding the recombinant CAV polypeptide or protein. These conditions will vary, depending on the host cell chosen. However, such conditions are readily determined by those skilled in the art. The resulting CAV protein or polypeptide product can be purified by techniques such as chromatography, for example CIAS (high performance liquid chromatography), affinity chromatography, eromatography ion exchange, etc., electrophoresis, density gradient centrifugation; solvent extraction; or similar techniques. If appropriate, the product may be further purified as necessary in order to essentially remove any host cell proteins, which are also secreted in the medium or resulting from lysis of host cells, so as to provide a product which is at least essentially free of host residues, for example, proteins, lipids and polysaccharides.

For the expression of a CAV peptide or protein in mammalian cells, expression vectors can be synthesized by techniques well known to those skilled in the art. The components of the vectors, for example replicons, like product genes, may be obtained from natural sources or be synthesized by known procedures. see, Kaufman et al., M. * M01 * Biol., 159; 511-521 <1502); and Kaufman, Proc. Natl. Acad. Sci., USA, 02; 689-693 (1985). Alternatively, the vector DNA may include all or part of the bovine papilloma virus genome (Lus & Cell, 36: 391-401 (1984) )) and be contained in cell lines such as C127 mouse cells as a stable episomal element.

Promoters selected for mammalian cell expression may include sequences which co-express highly expressed mammalian viral genes having a broad host range, such as an SV40 anti-go promoter, the mouse breast tumor virus promoter i > TS, or 21-

(fid MLP) promoter and the herpes simplex virus promoter: Non-viral gene sequences, such as the murine metallothionein gene, also provide useful sequences of pre-engineered tem- plates of enhancers include the old SV40 gene enhancer (Dijke-ma et al., EMBO £ 4, 761 < 1985)) and the enhancer / promoter is derived from the Rous sarcoma virus longus repeat (LPR) [Gorman et al. Broc # Natl. Action. Sci., 79, 6777 (1982)] and cytomegalovirus ISoshart et al., Cell, 41, 511 (1985), 3, [See also Sassone-Corsi and Borelli Trends Genet., 21152 (1986); Maniatis et al., Science, 236; 1237 (1987); and Alberts et al., Mol. Biol of the Cell, Second Edition (1989). Examples of terminator / polyadenylation transcription signals include the SV40 derivatives [Sambrook et al., supra.

Mammalian replication systems include those derived from animal viruses which require trans-activating factors to replicate. Examples of mammalian replicons include those derived from bovine papillomavirus and Epstein-Barr virus, papopaviruses, such as SV40 (Gluzman, Cell, 23, 175 (1981), or polyomavirus). Examples of such vectors for transporting bacteria of mammals include pMT2 [Kaufman et al., Mol. Cell. Biol., 9, 946 (1989) and ρΗΕΒΘ [Shimizu et al., Mol. Cell. Biol., 6, 1874 (1986).

Methods for introducing heterologous polypeptides into mammalian cells are known and include dextran-mediated transfection, calcium phosphate precipitation, polybrene-mediated transfection, liposome fusion, and direct microinjection of DNA into the nuclei Mammalian cell lines available as hosts for expression and included in many immortalized cell lines available from AICC, including but not limited to Chinese hamster ovary (CEO) cells, Beba cells, baby hamster kidney (BHK), monkey kidney (COS) cells, human hepatocellular carcinoma cells (for example, Hep G2), and several other cell lines. 22

or CAV polypeptides may also be inserted into an insect expression vector and operably linked to control elements within that vector. The construction of vectors uses techniques which are known. Generally, the components of the expression system include a transfer vector, generally a bacterial plasmid, which contains a fragment of the baculovirus genome, and a convenient reassortment site for the insertion of the heterologous gene (s) to be expressed? a naturally occurring baculovirus or a homologous sequence of the specific fragment of the baculovirus in the transfer vector which allows the homologous recombination of the gene and the appropriate growth media and growth media to the materials and processes for the baculovirus / insects are commercially available in the form of a set of # Nitros inter alia invotrogen, San Diego GA (" MaxBac Kit *). These techniques are generally known to those skilled in the art and are fully described in Summers and Smith, Texas Acrylic Experiment Station Bulletin RQ * 1555 (198?)

Hereinafter referred to as " Summers and Smith ")

The insect cell transfer vector preferably contains a promoter sequence, a leader (if desired), one or more of the CAV coding sequences and a transcription termination sequence. The plasmid contains [Miller et al., Ann. Rev. Microbiol., 42: 177 (1988), and a prokaryotic ampicillin resistance gene (master) and the origin of replication for selection and propagation in E. coli. Also, the vector transfer vector commonly used for the introduction of foreign genes into AcNPV is pAc373. Many other vectors known to those skilled in the art have also been devised, including pVi * 985 (See # EucKow and Summers # Virology, 17:31 1989) 3.

Examples of promoters include sequences derived from the gene coding for viral polyhedrin protein (Friesen et al., "The Regulation of Baculovirus Gene Ex-pression," The Molecular Biology of Baculoviruses (ed. Wal-ter Doerfler, 1988) EPO Publ. Res., 127, 839 and 155476) and the ge-

coding for the appropriate signal sequences can be derived from genes for the segregation of insect or baculovirus proteins, such as the coding region, which encodes the p10 (Vlak et al., Gen. Virol, 69: 765-988) for example the baculovirus polyhedrin gene [Carbonell et al. Gene, 73, 409 < 1988] 1. Alternatively, they may also be used to provide segregation in insects, leaders of non-species origin, such as those derived from genes encoding the human interferon fMaeda et al., Mature, 315-592 (1985)]? human gastrin release peptide Aebacq-Verheyden et al., Molec. Cell. Blol., 8, 3129 (1988)]; 11-21 [Smith et al., Proc. Natl Acad. Sci. USA, 82; 8404 (1985) 3 ' XL-3 mouse Miya jima et al. Gene, 58, 273 (1987), and human glucocerebrosity (Martin et al., J. Immunol.

The methods for introducing heterologous Mm at the desired point of the baculovirus virus are known (See, Sumers and Smith supra-3u et al (1987) supra-Smith et al, MQ1, Cell Biol., 3, 2156 (1983) Luckow and Summers (1989) supra]. After inserting the DNA sequence encoding the peptide or CAV protein into the transfer vector, the vector and the wild type viral genome are transfected into an insect host cell in that the vector and the viral genome are allowed to combine.The freshly formed baculovirus expression vector is subsequently packaged in an infectious recombinant baculovirus. To identify the recombinant virus, a visual scrutiny is performed by scoring the transfection supernatant in a monolayer of insect cells by known techniques (Ausubel et al., 16,8 (Supp.18, 1990) Summers and Smith, supra Miller et al., supra). identified by the presence of occluded bodies The recombinant baculovirus expression vectors have been developed for infection in various insect cultures. For example, recombinant baculoviruses have been developed for, among others, Aedes aegypti, Autographa cali-giperda, and Trichoplusia ni (PCT Pub. * N9. W 89 89/046699? Carbonell 24

et al., Virol. 153 (1985), Wriglit, Nature, 321: 718 (1986), Smith et al., Mol. Gell. Mol., 3, 2156 (1983); see Fraser et al., In Vitro Celi. Dev. Biol., 25, 225 (1989).

Bacterial expression techniques and components of the expression system are well known. Among the components of the construct or construct in bacteria are a bacterial promoter, a transcription initiation region, at the RNA polymerase binding site, a terminated sequence transcription, a signal sequence and an operator, as well as the desired sequence of CAV. The constitutive expression may occur in the absence of negative regulatory elements, such as the operator. In addition, a positive regulation can be achieved by an active protein binding sequence. gene. an example of a gene activator protein is the catabolic activator protein (CAp), which assists the initiation transcription of the lac operon in Escherichia coli (Raibaud et al, Ann * Rev Genet, 18, 173 (1984)). The regulated expression may therefore be positive or negative, thereby increasing or reducing transcription in sequences derived from sugar metabolizing enzymes such as galactose, lactose (lac) (Chang et al., Nature 198, 1956 (1977) and maltose sequences derived from biosynthetic enzymes such as tryptophan (trp) (Gaeddel et al, Hue, Aclds Res., 9, 791 (1881), U.S. Patent No. 4,738,921, EPO Publ., Nos. 036 776 and 121 In the Interferon3 (ed * I * Gresser) (1981), the bacteriophage lambda FE rshimatake et al., Nature, et al., J. Immunol. 292; 128 (1981) 1 and $ 5 (U.S. Patent No. 4,689,463.

Synthetic non-naturally occurring promoters are useful, for example the hybrid promoter described in U.S. Patent No. 4,551,433 and the tac promoter (Amann et al., 25: 167 (1983)) of soer et al, A bacterial promoter can include naturally occurring promoters of non-bacterial origin, for example, a bacterial porimerase / promoter system, Gtudier et al., Mol. Chem., 80, 21 (1983). Biol., 189: 113 (1986) Tabor et al., 25

Proc. JIATL. Acad. Sci., 82, 1074 (1985). see also, PUbl. EPO Ne. 267-8511.

In addition to an operative promoter sequence, an effective ribosome binding site for the expression of foreign genes in prokaryotes, for example the Shine-Belgarno (SD) sequence of E. Coli (Shine et al., Nature ABH encoding the appropriate signal sequences that provide foreign protein secretion in bacteria can be derived from genes for bacterial proteins in the secreted ones, such as the outer membrane protein gene of E. (1983) Ghrayeb et al., EMBO J., 3, 2437 (1984)] and the E. coli alkaline phosphatase signal sequence (Fig. (1985), see also U.S. Patent 4,656,361. As a further example, the signal sequence of the alpha-amylase gene of several Baeillus strains can be used to secrete the heterologous proteins of B. suntilis (P aiva et al, Proc. Know. USA, 79, 5382 (1982) EPO Publ. HS. 244 042J.

CAV proteins can also be secreted from the cell by creating chimeric ADE molecules that encode a fusion protein < x > the signal peptide sequence fragment.

Examples of transcription termination sequences are sequences derived from genes with strong pro-motors, such as, for example, trp gene in E. coli as well as other biosynthetic genes *

Expression constructs can not be maintained in a replicate, such as an extra-chromosomal (e.g., high or low copy number) plasmid capable of stable maintenance in a cell to be integrated into the bacterial genome with an integrating vector. The integrating vectors typically contain at least one homologous sequence of the bacterial chromosome which allows the vector to integrate. Integrations appear to result from recombination between homologous DNA in the vector and on the bacterial chromosome (see, for example, EPO Bebi MS 127 328) The integrating vectors po - 26 -

also be composed of bacteriophage or transposition sequences. Alternatively, some of the components described above are required to be put together in transform vectors. Transformation vectors are typically comprised of a selectable marker that is maintained in a replicate or is grown in an integrating vector. Selectable markers may be expressed in the bacterial host and may include genes that take the bacteria resistant to medications such as ampicillin, chloramamphenicol, erythromycin, kanamycin (neomycin), and tetracycline. Kev * Microbiol., 32, 469 (1978)}. Selectable markers may also include Mossynthetic genes, for example those of the biosynthetic pathways of histidine, tripfcophan, and leucine.

Vectors of baccar- bonian expression and transformation, either extrachromosomal replicas or integrant vectors, have been developed for transformation in many bacteria. " See, for example, the vectors described in Paiva et al., trpc. Hatl. Ãcad. Know. USA, 79, 3582, 1982), Shimatake et al., Nature, 292, 128 (1981) Powell et al., Appl. Environ, Microbiol., 54, 655 (1988) Powell et al., Environ. , 54, 655 (1988) and U.S. Patent 4,745,053 *

Methods for introducing the exogenous DNA into baeterian hosts are well known and include the transformation of CaCl2-treated bacteria or other agents, for example divalent and SODM {dimethyl sulfoxide) bacteria. ABH can also be introduced into cells bacterial cells by electroporation. Transformation procedures generally vary with the bacterial species to be transformed. See, for example, M & Sson et al., Microbiol. Lett., 60: 273 (1969) Miller et al., Eroc. Matl. Ãcad. Sci., 85: 856 (1988) | Chassf et al, FEHS Microbiol. Lett., 44: 173 (1987). Augustin et al., FEMS Microbiol., Lett., 66: 203 (1990) and other known references.

Yeast expression systems are also known to those skilled in the art. Typically, a vector or expression construct for expression in a yeast

A promoter comprising a CAV sequence and a yeast transcription termination includes a transcription initiation region, the ARK polymerase binding site (is the " TATA Box "), a transcription initiation site, an upstream activating sequence (UAS), which allows regulated expression (inducible). The constitutive expression occurs in the absence of a UAS. Regulated expression may be positive or negative, thereby increasing or reducing transcription.

Particularly useful promoter sequences include, for example, dehydrogenase alcohol (ADH) (EPO Publ. NO 284 044), enolase, glucokinase, glucose-6-phosphate isomerase, glyceraldehyde-3-phosphate-desirogenases (GAP or GAPDH ), hexokinase, phosphofructokinase, 3-phosphoglycerate mutates, and pyruvate kinase (Pyk) [EPO Publ., 32, 203]. The yeast PH05 gene encoding acid phosphatase also provides useful promoter sequences [Myanofaara et al., Proc. Natl. Acad Sci., USA, 801 (1583).

Synthetic hybrid promoters include the binding sequence & GAP transcription activation region (U.S. Patent Nos. 4,876,137 and 4,880,734), ADH2, GAL4, GALI, or PH05 gene regulatory sequences, combined with the transcription activation region of an enzyme gene The sequences of non-yeast origin may function as promoters [See, for example, Cohen et al., Proc. Natl. Acad. Sci. USA, 77, 1878 ( 1988; ie Henikoff et al., Nature, 283, 833 (1981)].

For intracellular expression in yeast, a promoter sequence may be linked directly to the DNA molecule. For secretion of the expressed protein, the DNA encoding the appropriate signal sequences may be derived from genes for secreted yeast proteins, such as the yeast invert gene (EPO Publ. No. 012,863, UPO Publ. * 62,096,886} and the factor A gene (U.S. Patent No. 4,588,543). Alternatively, there are non-yeast source leaders, such as a leader interbody, which also provides secretion in yeasts [EPO Publ. No. 060 0573 * Uma-28

a preferred class of secretory leaders utilizes a fragment of the yeast alpha-alpha gene (See, for example, U.S. Patent 4,465,083, 4,870,808, EPO Puhl. AT THE. $ 324,234 and PG3? Publ. 180 89/024631 *

Expression constructs are often maintained in a replicon (e.g., a high or low copy number plasmid) which can have two replication systems, allowing it to be maintained in the yeast for expression in a prokaryotic host for cation and amplification. Examples of such yeast-bacterial transport sectors include Ep24 (Botstein et al., Gene, 17-24 (1979) 3, pCl / 1 CBreake et al., Groc. Acad. Sci. USA, 81: 4642-4646 (1984) 3, and YRpl7 [Stinchomb et al., J. Mol. Biol., 158, 157 (1982)].

Alternatively, the expression constructs may be integrated into the yeast genome with an integrating carrier which typically contains at least one homologous yeast chromosome sequence which allows the vector to be integrated and preferably contains two homologous sequences flanking the expression construct [Grr-Weaver et al., Meth. Enzymol., 101: 228-245 (1983) J *

Typically, extrachromosomal and integrator expression constructs may contain selectable markers to allow selection of yeast strains that have been transformed including biosynthetic genes that can be expressed in host yeast, such as APB2, BIS4, Eu2, TRP1 , and SSJS1, and the resistance gene 0418. In addition, a suitable selection marker may also give the yeast the ability to grow in the presence of toxic compounds, such as a metal. For example, the presence of C0P1 allows the yeast to grow in the presence of copper ions [Butt et al., Microbiol, Rev., 51, 351 (1987)

Alternatively, some of the components described above may be co-located in transformation vectors, which typically comprise a selection label which is either maintained in a replicate or is developed for a particular purpose. vector as described above.

Expression and transformation cectors, as well as extra-chromosomal replicates, are vectors of interest.

were developed for transformation into many strains of yeast, see, for example, Kurtz et al., Mol. Cell. Biol., 6, 142 (1986); Eunse et al. (1985) Gleeson et al., J. Gen. Microbiol., 32, 33459 (1986) Das et al., S. Bacteriol., 158, 1165 (1984). col., Bacteriol., 154; 73; (1983), and several other known references *

Processes for introducing the exogenous DNA into host yeasts are known, and typically include the transformation of spheroplasts or alkaline cured yeast cells. Transformation procedures generally vary with yeast species which are intended to transform, for example, Kurtz et al., Hol, Cell Biol. 6: 142 (1986) | Gleeson et al., Gen. Microbiol., 132, 3459 (1986), et al., J. Bacteriol., 158, 1165 (1984) J. Cregg et al., Mol. Cell Biol., 5, 3376 (1983) , among others.

Fusion proteins provide another alternative for expression of CAV proteins and polypeptides in yeast, mammalian, baculovirus, and bacterial expression systems. typically, an ADK sequence encoding the N-terminal part of an endogenous protein (depending on the host), or another stable protein, is fused to the 5 'end of the heterologous coding sequences. After expression, this construct will provide a fusion of the two amino acid sequences. The resulting fusion protein optically retains a cleavable sequence at the linkage of the two amino acid sequences for a cleavage enzyme to cleave the host cell protein of the CAV genes (see , by way of example, Sagai et al, Paturé, 309: 910 (1984) and EB Publication No. 196 056). The example is a ubiquitin fusion protein which preferably retains a point for a processing enzyme to cleave ubiquitin of the CAV protein. Through this process, the native CAV protein can be isolated (See, for example, Miller et al., Bio / Technology, 7, 698 (1983)

Alternatively, the CAV protein or polypeptide can be secreted from the host cell chosen for the growth medium by creating chimeric ABN molecules encoding a fusion protein consisting of a fragment

to a leader sequence which provides secretion of the CAV protein of the chosen host cell. The adenovirus leader is an example of a leader sequence that provides secretion of a foreign protein into mammalian cells [Birnstiel et al., Cell 41: 349 (1985); Proudfoot and Whitelaw, " Termination and 3 'end processing of eukaryotic ABN ". In Transcription and Splicing (ed B.B. Hames and D. M. Glover) (1988); Proufoot,

Trends Biochem, Sci., 14: 105 (1985)]. Preferably, there are encoded processing sites between the leader fragment and the foreign genes can be cleaved either in vivo or in vitro. Such leader sequence fragments are known to the skilled person for the various host cells chosen above described. Identification of polynucleotides and sequences of CAV polypeptides and the final sequencing of the entire CAV sequence allows the development of appropriate CAV specific antibodies produced by standard procedures. As diagnostic or investigational reagents, the antibodies raised against these CAV sequences on affinity columns and the like may be useful to further purify the CAV proteins. The antibodies of the present invention may be used for in vivo and in vitro diagnostic purposes, such as by association of the antibodies with detectable markers or labeling systems. Alternatively these antibodies may be used for in vivo and in vitro therapeutic purposes, for example by association with some toxic or therapeutic compounds or radicals known to those skilled in the art, for example, ricin.

Antibodies to peptides encoded by the CAV sequences, specifically for antigenic spots for use in the assays of this invention may include monoclonal and polyclonal antibodies, as well as chimeric antibodies or " recombinant " antibodies. created by known techniques. MAb can be obtained synthetically by known genetic engineering techniques [W.D. Huse et al., Sience, 246: 1275-1282 (1989)] and used in the processes described herein. For simplicity purposes the term Mab (s) will now be used throughout this specification; however, it must be in - 31

It is understood that some polyclonal antibodies, particularly with high titer polyclonal antibodies and high titer recombinant antibodies, may also be used instead. It is generally desirable for higher specificity targets for the use of monoclonal antibodies (MAbs), either in assays of this invention or as potential therapeutic agents. It may also be preferred " humanize " a non-human Mab by any of the known techniques [See, for example. U.S. Pat. 4 634 664 and 4 634 666].

An anti-CAV antibody composition of this invention preferably comprises an antibody which binds to an antigenic determinant of a CAV polypeptide which is (a) a purified preparation of polyclonal antibodies; (b) a composition of monoclonal antibodies; or (c) a composition of recombinant antibodies. The present invention preferably contemplates the development of a MAb for CAV, which does not react with other human retroviruses, for example, HTLV II. In one embodiment, the antibody is capable of identifying or binding to an antigenic site of the CAV encoded by a CAV DNA sequence identified above. Such antibody may be used in a screening assay.

A MAb can be created by the well known techniques of Kohler and Milstein and their modifications directed to one or more antigenic spots on a CAV polypeptide. For example, one may present as an antigen in conventional techniques for the development of MAbs, an isolated CAV sequence, or a part of the viral sequence encoding an antigenic point, which differs sufficiently from HTLV I and HTLV II and other viruses. A cell line secreting an antibody recognizing an epi-top only in CAV, not HTLV I or II or any other retrovirus, can then be identified for this purpose. Similarly, a cell line secreting an antibody that binds much more strongly to a CAV epitope than any epitope on other viruses may also be useful to enable the antibody to distinguish the virus under conditions. tions. The skilled person can create any number of 1 MAbs using a CAV polypeptide sequence such as immuno-

genius and using the teachings expressed herein *

Antibodies specific for CAV epitopes may also be used therapeutically as targeting agents for delivering virus or toxic agents to infected cells. Rather than associating with labeling for diagnostic purposes, a therapeutic agent uses the antibody attached to an agent or linker capable of acting the mechanism of virus replication or destroying the virally infected cell. Such agents include, without limitation, ricin, diphtheria toxin or known toxic agents. The identity of the toxic linker does not limit the present invention. It is expected that preferred antibodies to peptides encoded by CAV sequences can be screened to determine the ability to internalize within infected cells and release the ligand itself into the cell as described in detail in Canadian Patent Application 2,016,830- 7, published November 16, 1990 This document is incorporated by reference for the description of a known scrutiny technique.

Antibodies and probes of the present invention may be associated with conventional detection markers. Detection markers for antibody binding (or to the above-mentioned probes) useful in the assays of this invention may also be readily chosen by the diagnostic test specialist. When more than one reagent of this invention, for example probe or antibody, is used in a diagnostic assay, the tags are desirably interactive to produce a detectable signal. More desirably the label is visually detectable, for example colorimetrically. The detectable reagent-binding markers of this invention useful in the diagnostic assays of this invention may also be readily chosen by those skilled in the art. Visually detectable markers are preferred for use in clinical applications because of the rapidity of the signal and its easy reading. For colorimetric detection, a number of properly operating top-set systems have been described. Colorimetric enzyme systems include, for example, horseradish peroxidase (POR) or alkaline phosphatase (FA). Other nearby enzyme systems are those known to those skilled in the art.

including hexokinase in connection with glucose-6-phosphate dehydrogenase. In addition, bioluminescence or chemiluminescence can be detected using, respectively, NAD oxide reductase with luciferase and substrates of NADPH and FMN or peroxidase with luminol and peroxide substrate.

Other conventional labeling systems which may be used include fluorescent compounds, radioactive elements or compounds, or immunoelectrodes. These and other suitable labeling systems are known to those skilled in the art.

As for diagnostic uses of the antibody, the polynucleotide sequence and the polypeptide sequence as reagents of the present invention may be used, a wide variety of conventional components known to immobilize the reagent when desired. Such immobilization agents include conventional solid supports, such as microtiter plates, plastic and cellulose strips, beads, for example, latex. Any known composition that can be used to immobilize an antibody or a nucleic acid or a peptide sequence may also be useful with the antibodies and sequences of the present invention, especially for diagnostic uses, purification techniques and the like.

The CAV polynucleotide and polypeptide sequences, such as the CAV antibodies of the present invention may also be used in an industrial process for the production of blood and blood products which are free of CAV infection. The ability to screen for CAV-infected blood samples allows producers and distributors of blood products, for example the American Red Cross, to identify and dispose of donor blood samples for transfusion or plasma isolation , blood proteins and therapeutically useful blood cells. If not scrutinized, the use of such blood and blood products may contribute to the dissemination of CFIDS,

Thus, another aspect of this invention is! a process for preparing blood and blood products free from infection with CAV by scrutiny of a blood product for

determining the presence of CAV with a probe of CAV polynucleotides or polypeptides, or a component thereof, capable of indicating the presence or absence of CAV. The analogous process involves the production of blood or blood products free of inbred with CAV by scrutinizing a blood sample with anti-CAV antibodies, which may indicate the presence or absence of CAV.

These CAV sequences and / or anti-CAV antibodies, optionally detectable by labeling, can be used in conventional assays essentially essentially the same as those described herein for the purposes of diagnotics in order to identify blood samples containing CAV. For example, a screening process may use all or part of a fragment of a CAV polynucleotide sequence or a complement thereof as primer in a polymerase chain reaction performed on a blood sample, wherein the amplification of said sequence indicates the presence of the etiologic agent of CPIDS.

Another screening portion comprises the use of all or a fragment of a CAV poly-nucleotide sequence as a hybridization probe in a hybridization assay performed on a blood sample, wherein hybridization of said sequence indicates the presence of the etiologic agent of CFIDS. Still another portion of the screening comprises contacting the blood sample with a CAV polypeptide or protein, wherein said peptide or protein represents an antigenic point susceptible to forming an antigen-antibody-po complex with any anti-CAV antibody on sample. The use of such assays or modifications thereof is within the skill of the skilled person with the teachings of this presentation.

A further aspect of the present invention relates to an in vitro cell culture containing a CAV polynucleotide sequence. Such cell culture may be mammalian cells, bacterial cells, yeast or insect cells infected with CAV. This cell culture may be a recombinant host cell containing only selected CAV polynucleotide sequences so that the virus is not susceptible to replicate therein. - 35

Hybridoma cell lines created by presenting a CAV polypeptide or fragment thereof as antigen to a chosen mammal are also provided by the present invention, and fusion of the animal cells with some cancer cells to create immortalized cell lines by techniques known. The methods used to create such cell lines and antibodies directed against all or part of a human CAV protein or a recombinant polypeptide of the present invention are also included within this invention.

This invention also encompasses permissible CAV infected cell lines and capable of producing infectious CAV progeny. As described in detail in Example 1, two human cell lines were developed, a T cell lymphoblastoid cell line and a B cell lymphoblastoid cell line, which produce the virus genome of in vitro infections. Another cell line, the U973 Human Macrophages Monocyte Cell Line, which is available from ATCC was also identified as supporting CAV growth. Such cell lines when cultured under suitable conventional conditions are capable of producing large amounts of virus for further investigation and use in vaccines.

In yet another aspect of the invention, methods for confirming a suspected CFIDS diagnosis can now be based on the presence of such CAV nucleotide sequences, polypeptide sequences and CAV antibodies, above. critas The presence of CAV can be detected using various assays and immunological techniques known to detect viruses, including the detection of such viral proteins, nucleic acids, and antibodies directed against a virus. The CAV polynucleotide fragments fail sufficiently in homology to sequences of comparable genes from other retroviruses and may allow the identification of such nucleotide sequences (or peptides encoded by it) in the tissues and body fluids of patients suspected of having CPIDS, confirming the diagnosis of infection. The term " body fluids " such as here - 36

used is defined as including, without limitation, the following materials containing cells: whole blood or fractions thereof, serum, urine, semen, vaginal secretions, saliva, tears, cerebrospinal fluid, and breast milk. Also included in this definition in the general sense are human cell types, including T cells and non-T cells. Preliminary data indicate that the presence of this virus can also be detected in granulocytes, eosinophils or basophils. This virus may also be detectable in samples of muscle tissue and skin. Although the following description of this invention relates to serum and peripheral blood mononuclear cells (PBMC) samples as body fluids, the application of the methods and compositions of this invention is not limited to these particular fluids. Preferred embodiments of the diagnostic methods useful for detecting the presence of CAVs, however, particularly use the polymerase chain reaction techniques [Saiki et al., Science, 239: 487491 (1988)] and hybridization assays [see, for example, For example, Sambrook et al., "Molecular Clo-ning. A Laboratory Manual., &Quot; Cold Spring Harbor Laboratories, Cold Spring Harbor, Second Edition (1389)]. These documents are incorporated by reference for the PCR descriptions and assay techniques. Particularly desirable hybridization assays include Southern blotting and liquid hybridization, which are known as depicted in the following references.

The above test procedures are preferably used in the methods of this invention with a PCR primer derived from a CAV polynucleotide sequence or a hybridization probe according to this invention.

One of the embodiments of a process of this invention involves the PCR technique as well as modifications thereof which are known to those skilled in the art. According to this embodiment, fluid samples are collected from the body of a chosen patient. Patients may be desirably chosen by diagnostic assays as having symptoms that are recognized as being associated with CFIDS, although patients with no symptoms may also be assayed. The DNA is extracted from the - 37

fluid of the chosen body, for example, white blood cells of the blood. Techniques for preparing such extracts are well known (See, for example, Sambrook et al, supra). 0 mm of the sample is used as template and the CAV sequence primers are used in the PCR technique.

As an example, it was originally noted that some sequences of the HTLV II gag gene appear to share a high degree of homology with various putative CAV polynucleotide sequences as described in Example 3. A number of desirable sequences are found which may be useful as and PCR primers and hybridization probes within the nucleotide sequence ranging from nucleotide # 813 'to. # 1214 of the HTLV II gag gene. These sequences were first used to amplify CAV sequences and isolate the virus from body fluids of patients. For example, as shown in Table III below, a HTLV II gag sequence from nucleotide # 1214 to # 1187 as the preferred antisense primer for PCR may be useful. This primer is known as g-2 -1. An HTLV II gag sequence from nucleotide # 838 is useful as a primer for the gag sense of PCR. This primer is designated g-2-2. Also useful as a hybridization probe is an HTLV II gag sequence from nucleotide 1080 to 1105.

TABLE III

HTLV I primary antisense gag primary sense gag probe gag primary antisense tax primary sense tax probe tax 1375 1353

GGTACTGCAGGAGGTCTTGGAGG 841 864 CGACCGCCCCGGGGCTGGCCGCT 1080 1101 TCTGGAAAAGACAGGGTTGGGA 7701 7680 TCTGGAAAACAGGGTTGGGA 7575 7596 CAATCACTCATACAACCCCCAA 7652 7677

TACATGGAACCCACCCTTGGGCAGCA

HTLV II 1214 1187

primary antisense gag, g-2-1 GAAGCTTTGCGTGGTGGTGGGTTCCACG (hinD III) 813 838 primary sense gag, (TAAGCTT) CAAATCCACGGGCTTTCCCCAACTCC g-2-2 1080 1105 primary antisense gag probe. tax primary sense tax probe tax GTCTCCCCTAGCGCCCCCGCCGCCCC 7920 7900 ATAGGGGAGAAGTCCTGTACA 7602 7620 CGCCTTCCCCGAACCTGGC 7819 7846

ACAGTCATAGTCCTCCCGGAGGACGACC-39 -

It should be noted that the numbering of the nucleotides of the HTLV II genomic sequence referred to throughout this specification is identical to the numbering system published by K. Shimitohno et al, cited above, for the complete proviral genome of HTLV II. The HTLV I nucleotide sequence referred to in the following examples is numbered according to M. Saiki et al, cited above. The latter two references are hereby incorporated by reference as known and available sources of sequence information available to the skilled person.

Primers or probes based on other retroviruses, for example, HTLV I derived probes such as those identified in Pig. 1, or non-hybridizing HTLV-II derived probes, or probes based on known non-C-type retrovirus sequences, for example, MPMV, may also be used as controls. For example, another diagnostic method involving PCR techniques can utilize the binding site of the 5 'tRNA lysine primer TGGCGCCCAACG-TGGGGC 3' as the primer, and a primer derived from MPMV 5 'GCTACGGCAGCCATTACTTG 3 'as the primary of " antisense ". A probe from a region of MPMV and having the sequence 5'GATACTTGTCCTTGGTTT-CCGCA 3 'may be used for hybridization.

This PCR reaction would also indicate infection of humans with MPMV, but it is not currently thought that MPMV can infect humans. One phase of the alternative process would be to perform a hybridization with another MPMV sequence which is not homologous to a CAV sequence under specific hybridization conditions to prevent MPMV infection. If the CAV is present in the DNA isolated from the sample, the polynucleotide or CAV sequences or fragments thereof will be amplified but not the control nucleotide sequences.

However, as mentioned above, the use of the HTLV II sequences or other retroviral sequences, for example, MPMV having some homology with CAV in diagnostic procedures is less preferred since a separate process step would have to be used to distinguish virus isolated or identified in the body fluids of a patient - 40

Other known retroviruses are suspected to be CFIDS. Other HTLV II sequences other than the HTLV II-derived probe sequences and primer sequences described above may be used to indicate the presence of the HTLV II infection. present invention using PCR can be performed sequentially with HTLV II sequences and if HTLV I kills that do not use the patient's amestra DNA, for example, HTLV II tax sequences which are neither CAV homolog nor detectable in CFIDS patients, These additional assays would eliminate the possibility of an intracellular presence of these HTLVs with CAV *

CAV primer sequences which are unique to CAV, and which do not bind to other viruses are preferable in such assays. Such sequences can be identified by a viral taxonomist *

Following PCR amplification, a Southern blot technique or other hybridization technique may be used using a hybridization probe derived from labeled CAV polynucleotides. Probes which are less desirable as mentioned above may contain a homologous sequence to a nucleotide sequence in the HTLV II gaq gene. Hybridization of the probe with the PCR amplification product will occur in the presence of CAV nucleotide sequences in the body fluid. Hybridization will not occur in the absence of a CAV nucleic acid sequence that is not significantly homologous to other retroviral sequences Referred to in available databases For a diagnosis and positive, the above-mentioned sequence hybridization in the patient sample should desirably be greater than about 90%. The occurrence of hybridization will indicate a confirmed diagnosis of SFIC »

Another embodiment of a diagnostic process of the present invention for determining the presence of a CAV infection is the local hybridization to screen a patient sample for the presence of CAV AKN sequelae. As described in more detail in Example 1. Next, cells are isolated from a patient, typically pbmc.

If the PBMCs are the sample, the cells can be activated from the 41 -

described above. The cells are cultured under standard conditions and examined for CAV mRNA expression.

Sequences of CAV polynucleotides, or sequences complementary thereto, may be used in this process. Probes for this hybridization technique may be created from CAV transcription in a plasmid, as described in detail in Example 4, or by other methods, as previously described. As described above for hybridization and primer sequences, it is possible that some nucleotide sequences of the HTLV II derived gag gene may also be useful in identifying this viral CAV mRNA according to this embodiment of the present process.

Using very restricted conditions, labeled probes for the CAV sequences are used to assay the sample mRNA. High restriction conditions preferably include an incubation temperature of 52 ° C. Conventional markings, such as those described above, may also be used in this embodiment. A preferred and present preferred marker S. The embodiment described in detail in the following Example 5 uses sequences derived from HTLV II. This local assay can be combined with other PCR assays and immunological assays to confirm the positive result of SFIC.

The CAV peptide fragments, as well as the PCR primers produced as described above, may also be used in diagnostic assays which rely on protein immunogens as targets for serum recognition. For example, the invention provides a method for the use of the CAV peptides of the invention as diagnostic agents useful for identifying patients with CFIC. In one assay type, the sensitivity of CAV peptides to fluids or biological cells of patients with SCSI may be assessed by Western blotting. The assay is preferably used in patient serum but may also be adapted to be performed in other suitable fluids or cells, for example macrophages or white blood cells. In the Western blotting technique, a nitrocellulose peptide is transferred to a nitrocellulose peptide,

The fairs are then rehearsed with sera with SFIC patients or controls. & binding of SFIC sera to the protein is detected by incubation with an appropriately labeled antibody # for example, an alkaline phosphatase-treated goat anti-human IgG followed by the BCIP / NBT enzyme substrate. The development of stained color by wash of the strip in water. Only the sera from the SFIC patients react with the peptide. Healthy humans do not react with the CAV peptide. In another embodiment the present invention also provides the possibility of determining the presence of CAV by examining body fluid samples containing patients to verify evidence of CAV exposure. An CAV peptide may be used in a diagnostic process to detest a CAV antibody in the body fluids of a patient with SCSI. For example, the peptides of this invention may be used in an elastase-based assay. A typical ELISA assay protocol would involve antigen adhesion (for example a CAV peptide) to the bore of a tray. The serum to be tested is then added. If the serum contains antibody to the antigen, it will undergo binding. The specificity of the reaction is determined by the antigen absorbed on the plate. Only sera from SFIC patients would bind to plaque; the sera of healthy people would not connect.

Fluid from the body of patients with SCFI revealed reactivity with SKFLV I antigens by Western blotting. Fluid samples from the patient's body, for example, serum or cerebrospinal fluid samples, can be isolated from patients suspected of having CFS For example, these samples can be used in immunorevelations with HTLV viral proteins. Viral proteins that have been electrophoretically separated are exposed to body fluids contained in samples *

Using known conventional techniques, viral proteins are screened which are immunoreactively or reactively reactive with antibodies in the samples as bands on a gel. As described below in Example 3, the as-

body fluid samples, for example, blood or serum samples obtained from patients with CFIC contain antibodies that react with at least 3 bands of proteins on development which are the products of at least 2 HTLV, gag and env genes . In addition, most patients with CFIC have serum antibodies to a P27 protein in the HTLV-I Western Revealing Assay. P27 is presumably a tax gene product.

PBMC can be activated according to known processes such as phytohemagglutinin, myristic phorbol acid, concanavalin A and 0KT3 MAb. Using conventional immunological assays, preferably the well-known immuno-tochemical assays, the presence of an antigen which reacts with a preferred antibody can be determined. One such suitable antibody is K-1 (available from Dr. Fluvia Veronese) [E. De Freitas et al., AIDS Research and Human Retroviruses, su pra]. This K-1 monoclonal antibody is capable of reacting with the HTLV I and HTLV II gag gene products.

If the PBMC of the patient or other cell type has an antigen which is recognized by an antibody (known to recognize HTLV gag I and XI itself), indicating the possible presence of CAV, further assays may be performed using CAV sequences or antibodies specific for an epitope encoded by such sequences to eliminate the possibility that the antigen is the gag gene of HTLV I and HTLV II. For example to eliminate the presence of HTLV I as a source of antibody response, a MAb that is specific for the HTLV I gag protein and can not be cross-reacted with the HTLV II gag can be used in this process. A suitable antibody is 13B12 [see, for example, T. J. Palker et al., J. Immunol., 136: 2393-2397 (1986)]. This antibody is used to assay body fluids, for example PBMC, from patients whose serum contains antibodies reactive with at least three HTLV proteins or immunorevels.

Viral proteins in the body fluid cells of patients who are infected with HTLV I will have an immunoreaction with that specific antibody. On the other hand, patients with CFIC who are infected with CAV do not produce PBMC that immunoreact with an HTLV I specific antibody.

This same type of deletion phase can be used in the process of this invention with an antibody capable of recognizing an epitope on εΪΙΛ 7 II, an epitope that is not present in HPLV I or CAV. Although such an antibody is not currently available, the development of a suitable antibody, preferably an MAh, is contemplated in this invention and may be used in the process

Yet another type of assay which can employ the reagents of this invention and be useful in the diagnosis of SFIC is a particle agglutination (PA) assay, of which there are currently three (3) specific types. These assays are used for qualitative detection of antibodies to various antigens when coated on a carrier. Thus the sequences of the invention containing CAV antigen points may be coated on a carrier. Alternatively antibody to antigenic points of CAV may be coated on an antibody support, as above, the sample is assayed for the presence of antibodies to the CAV antigen. In a later situation, the clinical sample is assayed for the presence of antigen capable of binding to an β-antibody. However, the skilled person can similarly prepare the assay so that the antibody is immobilized on the support, the existence of the antigen in the first and original assay is detected, and the haemagglutination assay using red blood cell (RBC) cells. In the haemagglutination assay, SBCs are sensitized

To carry out the assay, the sensitized BBCs are placed on a 96-well microtiter plate. A small amount of serum diluent is added to each well, followed by the test and control sera in designated wells. patient interaction to a bore # if specific antigen antibodies are present in the serum # the antigen-antibody-antibody interaction will cause the BBCs coated with the purified antigen to agglutinate. The interpretation of the results may be of the no reaction between the BBC coated with antigen and the serum sample added, as is visually observed on the 96-well plate by a solid round shaped patch. A positive result is indicated when a somewhat dispersed pattern appears as the antibody interacts with the antigen coated BBCs and binds to one or more antigen coated BBCs, thereby keeping the BBCs at a distance from each other. A strongly positive result occurs when there is strong reactivity and a visually distinct pattern of " aggregates " or agglutination.

To eliminate potential non-specific reactions that may occur with sensitized BBCs, 2 artificial vehicles have been developed. Most common of these are latex particles which are available in various sizes and colors, but however they are generally white. The most recent technology uses a gelatin agglutination process exemplified in the HIV-Serodia-HIV device (Fujirebio Inc.). The principles involved with such artificial vehicles are based on passive agglutination using either the carrier particles of latex or gelatin which are coated with purified antigens. The actual assay is performed and recorded in a manner similar to that described above in the BBC-based assay.

A comparison assay performed by Kobayashi et al., Clin. Virology, 14: 454-458 (1986), the gelatin agglutination assay was conducted together with the immunofluorescence (IF) assay and a commercially available ELISA assay. The gelatin agglutination assay revealed excellent reproducibility in a single assay and good disclosure with the IF and ELISA assays having some discrepancies in the results. Gelatin agglutination results were obtained without special instruments or equipment, and a definitive result was obtained in 2 hours.

In yet another aspect, the invention provides a diagnostic method for detecting CAV in a patient's master in a conventional reverse transcriptase assay as described in Example 10 below. This assay may be performed on the body fluid of a patient suspected of having SFIC, using a first polyvalent-

nylate and the named cation used this

Mu *** No other human virus co-primirio or catiao in this assay *

The methods, probes, primers and anti-can be effectively used in the assembly of a diagnostic device, which can be used by health services for the diagnosis and / or treatment of SFXC. Such a diagnostic device contains the components necessary for the practice of one or more of the above described assays for the detection of CAV nucleic acid in a sample of patients suspected of having SFXC. Thus, for example, such a device may contain sequences of primer as described above comprising a CAV sequence or fragments thereof, or sequences from other retroviruses, for example, MPMV for carrying out PCR assays on body fluids in samples. The device may also contain the sequences of the hybridization probes described above for carrying out the Southern Development Test, liquid hybridization or other hyphorization technique. Other components of the diagnostic device of this invention may include nucleotide sequences or other re-trovirus genes (HXIiV X and HTIV XX, and MFMV) for use in eliminating the possibility of the presence of such specific viruses *

Still further components to a diagnostic device contemplated by the present invention include CAV polypeptides, cav-epitope-specific antibodies, gag antibodies, or antibodies specific for other retroviruses which are ligated to CAV epitopes *

Other conventional reagents of diagnostic devices may also be included such as for example positive and negative controls, vials and labeling systems for hybridization assays such as enzymes and other reagents required to perform the PCR technique. When the detectable marker on the device is designed for non-visual detection, for example, for radioimmunoassay, the conventional components necessary for this assay are controls, standards and the like are included in the device.

Another aspect of the present invention involves the detection and isolation of the complete CAV.

In this aspect, an amplified and isolated CAV nucleotide sequence obtained by the PCR technique as described above for the design of additional primers was used. Example 4 relates to the sequencing of a putative CAV fragment which was obtained using primers g-2-1 and g-2-2, identified above. The previously identified CAV viral fragments may be used as primers or probes to obtain an additional CAV sequence.

These primers are used to isolate large portions of the viral sequence using the reverse PCR technique as described in 0. Ohara et al., Proc. Natl Acad. Sci. USA, 86: 5673-5677 (1989) and H. Ochman et al., Genetics, 120, 621-623 (1988). Using such techniques which are known and routine to the person skilled in the art that the virus is essentially isolated allows the isolation and characterization of the entire nucleic acid sequence of CAV.

In another aspect the present invention provides a vaccine composition comprising an effective amount of a non-infectious CAV ADM or a peptide sequence that is capable of eliciting a response in a T cell or B cell of the host immune system to a infection caused by CAV. This vaccine may also include all or part of a CAV ADH sequence or the peptides referred to herein. It is believed that at least one of the CAV polypeptide sequences (or fragments thereof) can provide an antigenic or immunogenic peptide. These peptides, as soon as identified, can be used as vaccine components.

An exemplary system for the production of a vaccine is that described in European patent application Ser. 290 246 wherein a peptide encoded by the CAV DNA sequence for the peptide in a vaccine composition can be substituted using fatty acids, liposomes, and adjuvants. Other types of vaccine are known and they can be prepared using a CAV peptide to produce SF1C vaccines. The above-mentioned European patent application is incorporated herein by reference for the preparation of a composition of examples as an example.

Another vaccine agent of the present invention

The sequence is an antisense A8E sequence created for a CAV nucleic acid sequence. This sequence can be readily produced synthetically by those skilled in the art. Such antisense ARE sequence upon administration to an infected patient should be capable of binding to the ARE of the viruses, thereby preventing viral replication in the cell. The alternative vaccine agent includes a synthetic peptide created in the virus envelope protein. These peptides can be easily grown once all of the CAV is sequenced. An additional concept for the development of vaccines as soon as the virus is fully sequenced includes the preparation of synthetic peptides which are susceptible of binding to the host cell receptor

Thus, there is included in the invention an for the vaccination of persons against CAV infection by administering an effective amount of a vaccine of this invention to a patient of choice. Vaccine compositions which include one or more of the peptides described herein are administered in suitable doses. The preparation of a pharmaceutically acceptable vaccine having regard to the pH value, isotonicity, stability and the like properties is within the skill of the skilled artisan. Conventional adjuvants may also be used in the composition of vaccines , for example an aluminum hydroxide gel. The amount and dosage regimen involved in a process for vaccination will be determined from various hosts and environmental factors, for example the patient's age, time of administration, the location and environment geographical*

The following examples illustrate various aspects of the present invention. Example 1 describes permissible cell cultures producing CAV and morphometric analysis of CAV in infected cells. Example 2 describes a Western blotting, Example 2 describes DNA detection rectroviral antibodies in PBMC from patients with CFIC by PCR using the primer sequences derived from EThV 1 and II-

Example 4 describes the purification and sequencing technique used to obtain a putative partial viral sequence of a DNA from an SFIC patient. Example 5 describes the detection by local hybridization of HTLV I and II-related cellular AKN in PBMC from patients with CFIC. Example 6 describes the detection in activated PBMC of certain patients with FICS of an in vitro expressed HTLV gag protein detected by an MAb and immunohistochemical development assay. Example 7 describes the determination of CABS kAK tAKN. Example 8 describes the possible gag proteins of CAV and Example 9 indicates the nuclear localization of CAV putative gag proteins. Example 10 describes a reverse transcriptase assay, suggesting that the CAV has the characteristics of a non-C-like retrovirus.

To perform these experiments, fluid samples were obtained from the patients' clinical practice in North Carolina and New York. The investigators were unaware of the samples by use of codes in each experiment.

Example 1 - SFIC Retrovirus Morphometric Analysis

Lymphoblastoid H-9 cells (obtained from the American Type Culture Collection, Rockville, Maryland) and B-Jab (Fig. 4) B lymphoblastoid cells (obtained from William Kall, MD, Ph.B, Cornell University) for 21 days at 37øC in 5% æg / 95% air in RPMI 1640 medium with a 10% fetal calf serum with leukocytes from patients with CFIC.

The cultures were examined by transmission electron micrographs after the cells were fixed (see Figures 3 and 4). Viral particles were visualized in both types of cultures. Associated with a rugged endoplasmic reticulum are electronically dense circular virions, some with light electron nuclei and others with dense electron nuclei, and in the inside large mitochondria are abnormally distributed within the cells. All particles had the same shape and size, 46-50 nm (460-500 A). 50

The extracellular virus was not observed. No outgoing forms of cytoplasmic membranes were observed.

These observations suggest that CAV is an animal retrovirus of the non-C type for three reasons; first human type C viruses such as HTLV I and HTLV XI do not appear to form intracellular viruses. The only human type C forming intracellular particles is EIV and these are only found intermediately in connection with prominent forms. Circular type C virions are usually formed as soon as the virus protrudes from the cytoplasmic membrane of the cell. Second, none of the HTLV X, XI, or HXV virions were ever found within the mitochondria. Third, the diameter and morphology of these virions suggest that they may be D-type primate retroviruses or Spuma-type viruses.

Example 2 - Western Disclosure Transfers HTLV X proteins from a purified virus with sucrose bands are separated by polyacrylamide gel electrophoresis. After electrophoretic separation, the proteins are transferred to nitrocellulose paper in a Transblot electrophoresis cell (BioRad Laboratories) at 60 V, 0.25 A for 4 hours according to the manufacturer's instructions. The nitrocellulose sheet is cut into strips, washed to saturate at free attachment points with a blocking buffer containing 20 mM Tris, 500 mM NaCl (pH 7.5) and 3% gelatin. The sheet is reacted overnight at 4 ° C with anti-virus (13B12) antibody from patients serum or CSF.

After a good wash with 20 mM Tris, 500 mM NaCl, and 0.05% Tween-20 (TBS), the strips are reacted with a peroxidase-labeled goat anti-human or anti-human IgG conjugate for 1 hour at room temperature. The strips are again washed and developed for 10-15 minutes with a freshly prepared solution containing 1 part of 4-chloro-1-naphthol in methanol (0.3%), 5 parts of 100 mM Tris (pH 7, 6) and H202 to a final concentration of 130,000. This siís tema can determine less than 100 ng of specific proteins -

cas. Strips with molecular weight markers are used to determine the molecular weights of the viral protein. The following Table IV relates to the detection of HTLV I serum antibodies by this Western Immunorescence in adult patients with SCSI. Positive results occurred in 41% (15/37) in patients with FIVS. Control sera were positive in only 6% (1/16) of the subjects. Positivity was determined using the American Red Cross criteria of antibody reactivity for at least two viral gene products. Healthy positive control was only non-Caucasian in this study.

TABLE IV

Positive negative

Patients with SFIC 15 * 22 (37 individuals) Reliable and other diseases 1 15 (16 individuals) * Significant for P 001

Example 3 - CAV Retroviral Sequences Detected in Patients with SFIC by Polymerase Chain Reaction Detection of the possible CAV retroviral DNA in patients with PBMC or SFIC was performed by the polymerase chain reaction using HTLV I and II primer sequences . The HTLV I tax region (7575-7701 bp) and other regions (HTLV I gag, HTLV II gag and HTLV II tax) were amplified for blood SFIC patients. The sequences of these primers and probes are shown in Table III above. DNA from HTLV I infected white blood cells from patients with TSP numbers 13-4 was used as a positive control. DNA from a human T cell line and HTLV II Mo-T and retroviral cell line U 937 (both available from the Ameri can Type Culture Collection, Rockville, Maryland, USA) were used as negative controls. The DNA was extracted from the cell lines by SDS / Proteinase-K digestion of cells followed by pre-

with phenolchloroform and ethanol. The ADR concentrations were estimated using the Warburg equation (Warburg, D and Christiemy, W., Biochem 2 310: 384) measuring the 260 and 280 nm obscuration corrected to the background at 320 nm. Two micrograms of DNA were amplified in 30 repetitive three-phase cycles, 1 minute incubation at 95 ° C, 1 minute incubation at 55 ° C and 2 minutes incubation at 72 ° C. All amplifications were performed on a Perkin-Elmer Cetus Thermal Cycler device. The 100æl PCR reaction ratios contained 2μg DNA sample, 278 pH each of dATP, dcTP, dgTP, dTTP, 0.8μM of each primer 10mM Tris (pH 8.3), 50mM KCl, 1.5 mM MgCl 2, 0.01% (w / v) gelatin, and 2.5 units of Thermus Aquaticus (Taq) polymerase enzyme [Perkin Elmer, Cetus]. The reaction mixture was overlaid with mineral oil to avoid evaporation and was denatured at 94 ° C for 7 minutes before being added to the Taq polymerase. The primer pairs were nucleotides # 7575-7696 (+), nucleotide # 7701-7680, and analyzed with the oligonucleotide probe at nucleotides # 7652-7677 (see Table I). The amplified DNA was analyzed by electrophoresis on 1.2% agarose gel and transferred to a Nytran nylon membrane [S & S Nytran] by development. The filter was soaked with 2xSSC for 5 minutes at room temperature, and heated at 80 ° C for 2 hours in vacuo. The prehybridization buffer consisted of 6XSSC, 1.0% SDS, 50% formamide, 5X Denhardt's Solution and 150æg / ml herring sperm DNA. The filter was prehybridized overnight at 37 ° C and then hybridized overnight with 12x106 cpm of a 32 P oligo-labeled probe in a prehybridization buffer. The filters were then washed with: 1) 2XSSC and 0.1% SDS (twice for 20 minutes at room temperature), 2) 0.2XSSC and 0.1% SDS (20 minutes at room temperature), and 3 ) 0.1XSSC and 0.1% SDS (30 minutes 370C) and autoradiographed for 5-7 days.

Results obtained with the same PCR analyzes of blood samples from patients with CFIC were compared with people they were living with or were intimately associated with, for example, roommates and friends (referred to as Exposure Controls). Controls of non -

position are healthy, randomly chosen individuals who had not come into contact with SFIC patients or experienced symptoms associated with SFIC. Viral controls included human Mo-T cells (infected with HTLV II) and MT-2 (infected with HTLV I). Both cell lines are available from ATCC. These results are reported in Table V below. Similar PCR analyzes were performed in pediatric patients with SFIC as referred to in Table VI below. Retroviral DNA was also detected with Southern blotting using labeled oligonucleotides.

These data demonstrate that the retroviral sequences related to HTLV II gag, but not HTLV I gag or tax, were detected in patients with SCFI. In addition, the positive results observed in the Exposure Controls support the possibility that this CAV may be capable of casual transmission to uninfected individuals, as with many non-human re-viruses. These data also indicate that the presence of HTLV II gag sequences does not identify only symptomatic individuals. 54

TABLE V

Primary and Tagged Oligonucleotides

Patients HTLV 3ÈSL I HTLV II gag HTLV II tax Revelation of Western PCI 0 + 0 + PC4 0 + 0 0 PC5 0 + 0 + PC7 0 + 0 + PC9 0 0 0 + PCll 0 + 0 0 PCI 2 0 + 0 0 PCI 3 0 0 0 0 PCI 4 0 + 0 0 PCI 5 0 + 0 0 PCI 8 o + 0 + Positive ratio 0/11 9/11 (82%) 0/11 5/11 (36%) tiva Exposure controls PC2 0 0 0 0 PC 0 0 + 0 + PC 6 0 0 0 0 PC10 0 + 0 + PCI 6 0 0 0 0 PC20 0 + + 0 PC21 0 · »· 0 0 PC22 0 + 0 + PC23 0 0 0 0 PC24 0 0 0 0 PC25 0 0 0 + PC26 0 + 0 0 PC27 0 0 0 0 PC28 0 0 0 0 Reason Pos 0/14 6/14 (43%) 1/14 (7%) 4/14 (28%) tiva Controls Non-exposure 0/10 0/10 0/10 0/10 Viral controls MT-2 + 0 0 Mo-T 0 + + 55

TABLE VI

Primary samples and labeled oligonucleotides

Patients HTLV S2SL I HTLV II gag HTLV II tax Western revelation 4-4 0 + 0 + 4-4 (2) 0 + 0 + 3-4 0 0 0 + 10-4 0 + 0 + 13-16 0 0 0 0 5-16 0 + 0 + 8-16 0 + 0 + 1-16 0 + 0 + 13-2 0 + 0 0 13-2 (2) 0 + 0 0 9-2 0 + 0 + 20-2 0 0 0 0 2-2 0 + 0 + 1-16 0 + 0 + 10-18 0 + 0 + 19-4 0 + 0 12-2 0 + 0 0 10-2 0 0 0 0 10-10 0 0 0 0 Exposure controls: Exposure controls: Exposure controls: Exposure controls: Exposure controls: Exposure controls: Exposure controls: Exposure controls: Exposure controls: Exposure controls: Exposure controls: Exposure controls: Exposure controls: 0 0 + 13-2 (3) 0 0 0 0 9-23 0 + 0 0 12-23 0 0 0 + Positive ratio Õ7T 2/7 (29%) 0/7 3/7 (43%) Non-controls - 0/10 0/10 0/10 0/10 viral controls MT-2 + 0 0 Mo-T 0 + +

56

Example 4 - DNA Purification and Sequencing

A partial and putative viral DNA sequence was obtained by the procedure described below of a patient with NYIC-1 SFIC using the specific primers of HTIVIII gag 9-2-1 and g-2-2 of Table III. Purification of the DNA was performed by PCR amplified DNA obtained in the manner described above in Example 3 using the Gene Clean kit device [Bio 101, La Jolla, CA] with minor modifications, as described below. PCR amplified DNA is processed in 3% Nusieve (FMC, Rockland, ME) which is a mini agarose gel in lxTAE buffer. Using ultra-violet wavelengths, the band is visualized and extracted. The extracted strip is then placed in a preweighed 1.5 ml tube and the weight of the agarose is determined. The liquid contents of each 7 ml capping tube of the Gene Clean Kit device is added to 140 ml of deionized (dd) distilled water and mixed with 155 ml of 100% ethanol to ensure that the water content of the solution is less than 50%. This solution can be stored in a -20C freezer between uses.

When ready for use, 2.5-3 volumes of the stored Nal (6M) solution are added to the agarose and the mixture is incubated at 45 ° C - 55 ° C for 5 minutes to dissolve the agarose, with blending after 2 minutes. A suspension of Glassmilk (5 Âμl) is added and the mixture is placed on ice for 5 minutes with mixing every 1-2 minutes to maintain the Glassmilk suspension. The silica matrix with the bound DNA is pelleted by microcentrifugation for 5 seconds. The Nal supernatant is then transferred to another tube. If any agarose remains undissolved, the pellet may be flushed with Nal. The pellet is then washed three times with ice (10-50 volumes or 200-700 μl) NaCl / EtOH / æc (recent). The pellet is resuspended and pipetted while pipetting the tip. After the supernatant from the third wash has been removed, the tablet is resuspended and the last wash is removed with - 57

a fine-tipped pipette. The washed white tablet is then resuspended with the Tris-EDTA (TE) buffer (water or a low salt buffer may be replaced) with a nearly equal volume of the tablet (usually about 7 μΐ). The mixture is incubated at 44-55 ° C for 2-3 minutes and centrifuged for 30 sec to give a firm pellet. The supernatant containing the DNA is then removed and the ET re-suspension phases are incubated, incubated, centrifuged and removed from the supernatant.

To obtain the template and equilibration primer for the sequencing reaction, 1 μΐ of primer (20 ng / μ) and 8 μl of gene-cleared DNA, obtained as described above, are combined in a spin tube, boiling for 3 minutes and chilled rapidly in ice water for 60 seconds. 1 μΐ of 10X reaction buffer is then added to the combined DNA primer, mixed by shaking and allowed to stand at room temperature for 10 minutes. To a 96-well sink with columns discarded by G, A, T or C, 2.5 μl dd GTP termination mix is added to the G-labeled hole. Similar amounts of ATP, TTP, and CTP are added respectively, to the holes designated A, T, and C, respectively. The plate is then preheated to 37øC for at least one minute. The labeling mixture is diluted to a concentration of 1:50 and the sequenase is diluted to a concentration of 1: 8 in ice-cooled 1XTE. The following ingredients are added: 1 μl of 32β-ATP, 2 μl of the 1:50 dilution of the labeling mixture, 1 μl of 0.1 M DTT, and 2 μΐ of 1: 8 of the sequenase dilution at primer and buffer mixture, mix well and incubate at room temperature for 5 minutes to complete the labeling reaction.

When the labeling reaction is complete, a 3.5 μ al aliquot of the reaction mixture is prepared from each of the marked holes [G, A, T, C] using separate tips. The combinations are continued for a total of 3-5 minutes, up to a maximum of 30 minutes. The reaction is then carried out.

of the stop by addition of 6 ul of 10 mM EDTA and can be stored for 1-2 days (32P) or 1 week (35S) at -2C.

In the 96-well cap, 1.5 .mu.l is mixed with 2 .mu.l of formamide. The cap is then incubated in an oven in a 80Â ° C water bath, and then poured into ice water quickly, and 6% acrylamide gel is charged.

Using 0.6xTBE as the processing buffer, the gel is processed for 1 hour before being used so as to heat it to 50 ° C. This is achieved by using 90W of constant power (voltage limit = 2900 V, limiting current = 50 mA). Samples are loaded sequentially at 0.2 and 4.5 hours and processed at a constant power of 90 W of constant power. After the last loading, the gel is allowed to stand for a further 90 minutes (total processing time = 6 hours) and the gel device is made flat in the fold with the (smaller) front glass plate facing downwards. The glass back plate is removed and a sheet of Whatman # 1 paper is placed in the gel and is wetted by spraying with distilled water. The filter paper with the attached gel is removed, covered with Saran Wrap and used for exposure of a Kodak XAR film. Exposure is carried out at -70 ° C for 12-72 hours as appropriate. Can be read then autoradiography.

Figs 1A and 1B illustrate the DNA sequences of the obtained partial putative CAV virus. After analysis in GenBank and EMBL, the putative CAV sequences of Figs. 1A and 1B were not found to be significantly similar to the sequences of any retroviruses. Thus, these sequences suggest that CAV may not be identified as any other known human or animal virus.

The sequences of Figs. 1A and 1B share some significant homology with a small portion of HTLV II gag gene sequences which were originally used to amplify tissue and fluid virus from the patient's body using the polymerase chain reaction (81.5% homologous ). Since these nucleotide fragments are less than 82% homologous with gag sequences comparable to other retroviruses, the identification of such nucleotide sequences

(or their encoded peptides) in the tissues and fluids and tissues of the body of patients suspected of having FIVs, can confirm the diagnosis of infection. All sequences of Figs. 1A and 1B are to be used to obtain the primers of FCR or hybridization probes in accordance with this invention.

A CAV peptide can be encoded by all or part of the ADH sequence of Figs. 1A and 1B. A nucleotide sequence of Figs. 1A or 1B is in part a coding sequence for CAV peptides and proteins. Six sequences of peptidic CAV peptides are shown in Figs. 2A by translation of the nucleotide sequences of Figs. 1A and 1B in three reading frames for each sequence, starting with the nucleotide number 5 '1, 2 or 3 respectively of Figs. 1A and 1B. Fig. 2A shows a reading frame starting at nucleotide 1 of Fig. 1A. Fig. 2B is a reading frame starting with nucleotide 2 of Fig. 1A. 2D is a reading frame starting with nucleotide 1 of Fig. 1B. Fig. 2E shows a reading frame starting with nucleotide 2 of Fig. 1B. Fig. 2F shows a reading frame starting with nucleotide 3 of Fig. 1B.

From Fig. 2A to F, the asterisk represents a putative stop signal, which is possible for simple base error of reading the nucleotide sequences of Figs. IA or 1B may indicate stopping nuclei where the native amino acid strand must be encoded. Thus, CAV peptide sequences may comprise fragments of the following encoded sequences occurring between stop codons, as well as their smaller fragments. It is expected that at least one of the sequences of the peptide (or fragments thereof) encoded by a nucleotide sequence of Figs. 1A or 1B provide an antigenic or immunogenic product. These peptides referred to in Fig. 2A through 2F as well as other peptides identified by the complete CAV sequence can be used as variant components.

Example 5 - Local Hybridization 60

A viral AKN related to HTLV I and XI was identified by local hybridization in PBMC from patients with CFIC, but not controls, as follows:

A freshly isolated PBMC was plated on Costarj aggregate plates in KPMI 1640 with 10% fetal tissue screen (FCS) containing an optimal mitogenic concentration of purified 0KT3 MAb [Ortho] and 10æg / ml XL2 recombinant for 3 days . The cell concentrations were adjusted 5-1 at 2 x 10 ml by complete growth with 50 ng / ml IL2 recombinant [Sandoz, Vienna, Austria] for 7 days and then shaken in formaldehyde fixed glass pieces, and stored in 100% ethanol.

Local hybridization was performed using a 35S-labeled specific ASM probe for the 5 '(gag) region of HTLV I and XI. The dimensions of the transcribed labeled riboprobes were 506 bp for HTLV X and 400 bp for HTLV II. 8-i

The probes were hybridized at 1-2 x 10 d.p. ml at a temperature of 52 ° C and autoradiographed for 4-8 days. All cell lines were hybridized using the same conditions in the same laboratory, and the cells were examined using a double-blind code. Table VII provides the detection data of retroviral AHN in adult patients with SCIA and in exposure controls and this local hybridization with the HTLV I gag probe and HTLV II gag probe. - 61 -

TABLE VII

Retroviral mRNA detection Retroviral by means of a Hibri local dissociation of Adult Activated PBMC with Ocean CPIDS Patents HTLV I HTLV II HIV gag sm gag PCI 0 +1 0 PC4 0 0 0 PC5 0 +1 0 PC7 0 0 0 PC9 +1 +1 0 PC11 +1 +2 0 PCI 2 +2 +2 0 PCI 3 0 0 0 PCI 4 0 0 0 PC15 0 0 0 PCI 8 0 +2 0 Positive ratio 3/11 - 27% 5/11 = 55% Exposure controls PC2 0 0 0 PC3 0 0 0 PC6 0 0 0 PC10 0 +1 0 PCI 6 0 0 0 Positive ratio 1/5 = 20% Virus control MT-2 cells (HTLV I) +4 0 0 Mo- t cells (HTLV II) 0 +4 0 HlV-infected H9 cells 0 0 +4>:

Scale used to classify samples: positive cells; 3+ = 50-1% positive cells; 2+ = 1--0.1% positive cells; 1+ = 1-0.01% positive cells; 0 = <0.01% positive cells. - 62

HTLV mRNA positive cells were detected in 45% of adult patients with SFIC assayed when the HTLV II gag probe was used. Only one of the five exposure controls contained these infected cells. PBMC from two out of eleven patients with SICS also contained RNA that reacted with HTLV I gag probe while none of the five controls did so. These data reveal that the PBMC of a part of the patients with SFIC are active in transmitting the mRNA gag virus in vitro. This virus RNA appears to be more homologous than the HTLV II gag virus in most patients but also reveals homology to HTLV II gag in several patients. Control cells infected with prototypic HTLV I gag (MT-2) or prototype HTLV II (Mo-T) do not reveal such cross-reactivity with mRNA gag. This indicates that this CAV is not HTLV I or HTLV II.

Example 6 - Detection of HTLV Gag Protein through Antibodies

To detect the CAV nucleotide sequence in the PBMC in patients suspected of having FIVCs using antibodies, a procedure was described in DeFreitas et al., Supra.

Bcitospan cells were air-dried for 2 hours and fixed with cold acetone for 10 minutes. They were then incubated for 30 minutes with 20 μl ascites optimally diluted with HTLV I p24 mAbs [from Dr. Fulvia Veronese, Litton Bionectics, Bethesda, MD] HTLV II p24, or HTLV pl5 protein [from Thomas Palker, Duke Univer-sity, Durham, NC].

In addition, MAb to p24 HIV was provided by Dr. Micah Popovic, NCI, Bethesda, MD. Positive control cells included MT2, Mo-T2, and H9-T cells infected with HTLV I, HTLV II, and HIV respectively. The cells were labeled with alkaline phosphatase anti-alkaline phosphatase (APAAP) immune complexes according to the method of J. Cordell et al., J. Histochem, Cytochem., 32: 219-225 (1984) using reagents obtained from Dako, Santa Barbara, CA. Uninfected H9 cells and T cell lines derived from non-

of healthy donors served as control for negative cells. Assays for the non-specific specification of the second antibody and in the APAAP complex were included.

Tables VIII and IX refer to the assays obtained in these assays.

TABLE VIII

Expression of HTLV-related Protein qaq in PBMC Acquired in Adult Patients with CFIDS by Immunohistochemistry 1

From PBMC Presence of protein-positive gag cells

HTLV I and II HTLV I CFIDS (K1 Mb) (13B12 MAb) PCI 0 0 PC4 +1 0 PC5 0 0 PC7 +1 0 PC9 0 0 PC11 +1 0 PCI 2 +1 0 PC13 0 0 PCI 4 0 0 PCI 5 0 0 Exposure controls PC2 0 0 PC3 +1 0 PC6 0 0 PC10 +1 0 PCI 6 0 0

Non-exposure controls Viral Controls MT-2 (HTLV I) +4 +4

Mo-T (HTLV II) +4 0 64-1

Scale used to classify samples: 4+ = 100-50% positive cells, 1+ = 1-0.01% positive cells? 0 = <0.01% positive cells.

TABLE XX

Expression of HTLV-Related Protein qag in Acetylated PBMC in Pediatric Patients with CfflDS by Immunohistochemistry *

From PBMC Presence of protein-positive gacf cells HTLV I and II HTLV I CFIDS (Kl MAb) (13B12 MAb) 4-4 +1 0 4-4 (2) 0 0 10-4 0 0 13- 16 0 0 2-2 0 0 1-16 0 0 10-18 +1 0 12-12 +1 0 Exposure controls 9-23 0 0 18-23 (2) 0 0 18-23 0 0 2-23 0 0 2-2 (2) 0 0 Viral Controls MT-2 (HTLV I) +4 +4 Mo-T (HTLV II) +4 0 * Scale used to classify samples: 4+ = 100-5 positive cells? 1+ = 1-0.01% of positive cells? 0 = &lt; 0.01% positive cells. 65 -

A low-frequency HTLV-specific gag protein in deactivated PMBC of patients with SCSI was detected by a specific MAb K1a of the gag region of the HTLV I and II region using immunohistochemical disclosure. MAb specific for HTLV I gag (13B12) did not react with any cells from patients with SCSI. This demonstrates that a viral gene product is expressed in at least one subpopulation of patients with SFIC and that this protein is not HTLV I encoded.

Example 7 - Primary Link Point tRNA

Two primers were created for use in the PCR technique. The primer primer was the tRNA DNA sequence for proline (# 766-783) whereas the antisense was the bases of the HTLV II gag region (# 1187- 1214).

The products created by the MT-2 (HTLV I), Mo-T (HTLV II) cell lines, and more than 20 patients with CFIC were assayed for hybridization with Southern blotting using radiolabeled 18-mer probes that correspond to a sequence of DNA that intervene with the two primers for both viruses.

The results obtained revealed that while MT-2 and Mo-T DNA were amplified through the tRNA binding site for proline, all CAV DNA samples were negative. Thus, CAV is apparently not a known human type C virus (except for HIV).

When the same experiment was performed using the primer binding site tRNA for the lysine as primer band &quot; &quot; for PCR (5 'TGGCGCCCAACGT-GGGGC 3') and the primer of the &quot; antisense &quot; was derived from a 9MPMVO 95 'prototype monkey D retrovirus GCTACGGGAGCCATTACTTG 3 *), the primers amplified two different size products of MPMV infected cells that were visible when assayed with an MPMV-derived intervention oligonucleotide (GATACTTGTCCTTGGTTTCCGCA). The products had 360 bp and 250 bp. Ten of ten DNA samples from patients with enlarged SFIC and the probes used in this system revealed. products of the same size. Thus, the SFIC retrovirus, CAV, appears to be a primary attachment site for lysine tRNA. This result suggests that the CAV is not HTLV I or II and suggests that it is either a type of lentivirus, primate D type retrovirus, or a Foam virus (Foam), all of which use a tAKN lysine primer.

Example 8 - Characterization of CAV gag proteins

Purified blood leukocytes were cultured in QKT3 Mab [Qrtho Pharmaceuticals] and recombinant 1L-2 for S days. After replacement of all media with a cysteine-free and methionine-free medium on day six, the cells were labeled with 35 S-methionine and cysteine for 16 to 18 hours. Upon disruption of the cells, antigenic determinants of gaq containing mouse Mab Kl-tagged proteins were precipitated which reacted with HTLV I, II, STLV and Staph A qag proteins.

The precipitates were boiled on SDS to remove the antigen-antibody complexes from Staph A, and the protein complexes were electrophoresed through 12% and 15% polyacrylamide gels with 0.1% SDS and 2-mercaptoethanol for 16-18 hours at an intensity of running, you constant. After the gels had dried and were exposed to an X-ray film for 12 to 15 days, the radiolabeled protein sizes of patients with SCSI and controls were calculated from standard curves created using molecular weight markers that were subjected to coelectrophoresis.

The results show that the precipitated gag proteins from HTLV I and II infected cell lines on 12% PAGE are 24 kD and 45 kD. In the same gels, ten of ten CAF gag proteins derived from SFIC have 27-28 kD, 45 kD, 55-56 kD and 76 kD. They did not precipitate gag proteins from healthy controls.

At 15% PAGE, patients with SFIC low molecular weight gag proteins could be visualized.

In addition to p27-28, pll-12 (11-12 kD), and pl3-14 (13-14 kD) were visualized. These bands were not present in Mo-T, or MT-2 lysates, or in healthy controls. - 67 ί. +

These data suggest that the CAV SFIC retrovirus is not HTLV I or II. Animal retrovirus that has been shown to express gag proteins at these molecular weights are: primate type D retroviruses; type C of primate, for example, SSAV, GALV and BaEV; lentiviruses, for example EIAV (but not HIV); for example type B mouse MMTV; retrovirus type C of birds, for example ASLV, REV; and perhaps Foamy virus (Spuma), although the gag proteins of this latter group have not been analyzed directly but only by extrapolation of the DNA sequence.

Example 9 - Location of gag Proteins in the Nucleus

The leukocytes from the samples of patients with above-mentioned DFIDS were reacted with K-1 Mab and immunorevated by goat anti-mouse alkaline phosphatase (APAAP). More than 50% of the patient samples tested (and none of the controls) revealed cells that were positive for gag proteins. More importantly, the revelation was found in the cytoplasm of the nucleus of the positive cells. The only known retroviruses presenting a nuclear development for viral proteins are the Foamy virus group.

Example 10 - Reverse Transcriptase Assay

A reverse transcriptase assay was performed as follows. CAV was cultured on B-Jab H-9 and V-937 (all positive by PCR for the HTLV-II region) lines. The virus was collected after three freezing cycles at -8Â ° C. The culture fluid was subsequently thawed and centrifuged at 1000 kg for 10 minutes at 46 ° C to remove the intact cells.

Viral particles were aggregated by centrifugation at a speed of 25,000 rpm for 90 minutes on a Beckman SW 28 rod. The pellet was suspended in 500 Âμl (to make 100 Âμl concentrations) of a TNE buffer (10 mM Tris / HCl pH , 8.0, 100 mM NaCl, 1 mM EDTA). The buffer can be assayed immediately or frozen at -20 ° C. 25 pl or 50 μl of lysate were used in each tube in buffer,

as indicated in Table X below. The reaction mixture with diverse transcriptase activity [I. M. Verma, J. Virol., 15: 843-854 (1975); I. M. Verma. J. Virol., 15, 121-126 (1975) 3 in 100 μΐ contained 50 mM Tris / HCl, pH 8.0, 40 mM KCl, 5 mM dithio threitol, 0.05% Triton X-100 , 0.2% Nomidet P-40, 100æg / ml bovine serum albumin, 40æg / ml template complex | rf. (Mg or Mn) to achieve the concentration shown in Table IX above. The exogenous primer-template complex was chosen from polyriboadenylate-oligodeoxythymidylate (poly. RA-oligo.dT) or polyribocytosylate-oligodeoxyguanidylate (poly-C-oligo.dg) [Pharmacia, Piscataway, NJ].

After 5 minutes on ice, 1.5æM 3-deoxythymidine triphosphate labeled with [H] (dTTP; 43 Ci / mmole) or deoxyguanosine triphosphate 3

(dGTP; 11 Ci / mmol) [Amersham, UK] and incubated at 37 ° C for 60 minutes. The reaction was quenched by addition of ice-cooled 10 mm sodium pyrophosphate and 15% trichloroacetic acid (ACT). After 15 minutes at 0Â ° C, the [H] -labeled polythimidines (poly T) and polyglycanidines (polyG) precipitated and synthesized in this reaction were collected on pre-wet Whatmann GF / C (2.4 cm) glass microfibrous filters in 5% TCA. The filters were washed 10 times with 5% ice-cold ACT and dried. The precipitated H-ACT material (i.e., double band nucleic acid) was counted with an Econofluor scintillation fluid by means of a Packard liquid scintillation counter. The data obtained in the following Table are expressed as counts per minute per reaction vial. Reverse transcriptase (RT) of each retrovirus prefers a single exogenous primary template, a bi-++ ++ valent cation (Mg or Mn), and a labeled substrate for polymerizing the ARS3 DNA [see for example, &quot; RNA TUMOR VIRDSES &quot;, second edition, eds. R. Weiss, N. Leich, H. Varmus and J, Coffin, Cold • Spring Harbor Lab Press, Cold Spring Harbor, NY (1984)].

The results of the RT study demonstrate - 69

that the CAV associated with SFIC increased in established cultures but did not apparently reveal the characteristics of a retrovirus type C by reverse transcriptase, for example, an HTLV-I or HTLV-II RT. HTLV-I RT (as shown by Table MT-2 cell lysate) and HTLV-II prefer a PC-oligo (dG) poly (βG) primer template with Mg (= 30 ÂμM). CAV appears to prefer a poly PA-oligo- (dT) primer with Mn ++. Among the retroviruses that show the same characteristics of RT as CAV preferences (poly PA-oligo (dT) primer-template and + 4 · ~

Mn) are Spuma viruses (foamy) and monkey D type retroviruses.

TABLE X

(Cpm) 25 μg polyYA-oligo- (dT) Mg ** (5 mM) Mg (cDNA) RNA-dependent ADR polymerase activity RNA- (DT) n-TTP (1.5 ÂμM) 752 25 Âμl polyyA-oligo- (dT) MG ** (10 mM) Mg (10 mM) â † 'H-TTP (1.5 μM) 862 50 μM polyYA-oligo- (dT) HH-TTP (1.5 μM) 430 25 μΐ polyVA-oligo- (dT) Mn ** (0.5 mM) Mn (0.5 mM) (dT) MnTT (2.0 mM) Mn (2.0 mM) β-TTP (1.5 μM) 17.157 50 μl TTP (1.5 μM) 20.737 50 μl polyYA-oligo- (dT) 13.011 25 μl poly YA- (dG) MgTJj0OmM) Mg (10 mM)? H-dGTP (6.6 μm) ND 50 μl polyYC-oligo- (dG) JH-TTP (1.5 μM) 13.579 25 μl poly YC- -dGTP (6.6 μm) 30 25 μl polyYC-oligo- (dG) Mg (3 mM) Mg ++ (30 mM) oH-dGTP (6.6 μm) 491 50 μl polyYC-oligo- (dG) &quot; 6.6 pm) 604 25 Âμl PolyYC-oligo- (dG) Mnlâ "¢ (0.5mM) Mn (0.5mM) 3H-dGTP (6.6pm) 117 50 ÂμM polyYC-oligo- (dG (DG) β-dGTP (6.6 Âμm) 171 50 Âμ HTLV-] polyYC-oligo- (dG) Mn (2.0mM) Mn (2.0mM) C culture E-dGTP (6.6 μm) 105 50 μl polyYC-oligo- (dG) MgTT (30 mM) -H-dGTP (6.6 μm) 14.366 50 μl polyYC-oligo- (dG) Mn (2 mM) Η-άΘΤΡίβ. δ pm) 608-70 -

Claims (1)

Included in the above specification are numerous modifications and variations of the present invention which are believed to be obvious to the skilled person. For example, the use of other suitable CAV genomic sequences as PCR primers and hybridization probes, as well as the use of other assay techniques and antibodies, and the use of other viral peptides for therapeutic agents are contemplated. Such modifications and modifications to the compositions and processes of the present invention should be considered to be within the scope of the appended claims. The method for the preparation of a virus associated with chronic fatigue immunodeficiency syndrome (CFIDS), referred to as CAV virus, is characterized in that the virus is isolated in substantially contaminant-free form from cells or body fluids of a human patient with symptoms of CFIDS or from human cells or components of human cells or any other CAV-infected animal. The method of claim 1, wherein the isolated CAV virus is a non-C-like retrovirus free of contaminants occurring in conjunction with the virus in its natural sources and having the ability to cause symptoms of CFIDS in infected human patients. A method according to claim 2, characterized in that the retrovirus has at least one of the following characteristics: (a) the presence of low molecular weight gag proteins p112, p3-14 or p27-28; (b) the ability to infect human B-cells and T-cells; (c) a binding site preference of an ABNt primer for the lysine amino acid; d) the ability to induce the presence of intracj particles. infected cells; (e) the ability to induce the presence of viral gag proteins in the nucleus and cytoplasm of cells infected by them; (f) the presence of a sequence of a gag gene which is different from the sequences of the HTLV I gag and HTLV II genes; and (g) a polynucleotide sequence comprising all or a portion of the 5 'sequence CAAAGTCCTC AGTGCGTCCA TCCAACCTAG GCACTGGCAT TAAACTTCTG CCAGGCTGAC TTACCGCTTA GACAGCCTGG GCCCTCGATT TCGACTTCCA GCAGCTAGCA GCCTTCTGAG ACTAGCCTTA ACGTCCATTT GGCTAAATCT ATTGACTACG CTTTAGCTAG CCTTATCACG AAGTGATATC AGTGCAAGGT GGTAGAGATT G 3' or 5 'CAATCTCTAC CACCTTGCAC TGATATCACT TCGTGATAAG GCTAGCTAAA GCGTAGTCAA TAGATTTAGC CAAATGGACG TTAAGGCTAG TCTCAGAAGG CTGCTAGCTG CTGGAAGTCG AAATCGAGGG CCCAGGCTGT CTAAGCGGTA AGTCAGCCTG GCAGAAGTTT AATGCCAGTG CCTAGGTTGG ATGGACGCAC TGAGGACTTT G 3 '43 - A process for the preparation of a GAV retroviral protein or polypeptide containing a 72- lime which is different in its sequence from the antigenic proteins occurring in HTLV I or HTLV II, characterized in that the protein or polypeptide is isolated in substantially free of contaminants form from cells or body fluids of a human patient with symptoms of CFIDS or from human cells or components of human cells or any other CAV-infected animal from expression systems or from culture supernatants obtained by recombinant DNA techniques, including cloning and expression in host cells or a microorganism of a DNA fragment which contains a sequence encoding the desired protein or polypeptide, or to be synthesized by chemical synthesis, suitably by solid phase synthesis or by coupling of amino acids or peptide fragments one to one or in blocks with formation of the amide bond by chemical or enzymatic methods. 5. A process according to claim 4, wherein the protein or polypeptide obtained in isolated form contains a sequence of CAV amino acids. The process according to claim 4, wherein the protein or polypeptide obtained is selected from the group consisting of the amino acid sequences of the amino acid sequence of the amino acid sequences. Asp Leu Pro Leu Arg Gin Pro Gly Pro; Ser Ile Ser Thr Ser Ser Ser Ser Gen Ser Ser Glu Thr Ser 1 Leu Asn Ser His Leu Ala Lys Ser Ile Asp Tyr Ala Leu Ala-73- * Ser Leu Ile Thr Lys Tyr Gin Cys Lys Vai Vai Glu Ile Fig. 2B Lys Leu Be Ala Ser Ile Gin Thr Be Ala Arg Leu Thr Tyr Arg Arg Phe Arg Leu Pro Ala Ala Ser Leu Thr Ser Ile Trp Leu Asn Leu Ala Leu Ser Arg Ser Asp Ile Ser Fig 2C Lys Ser Ser Vai Arg Pro Ser Asn Leu Leu Pro Gly * Leu Thr Ala Asp Phe Asp Phe Gin Gin Leu Ala * Arg Pro Phe Gly * Ile Tyr Pro Tyr His Glu Va Ile Ser Val Fig 2D Gin Ser Leu Pro Pro Cys Thr Asp * Leu Lys Arg Ser Gin * Ile Gly * Ser Gin i-ys Ala Ala Ser Arg Ala Gin Ala Val * Ala Val Leu Met Pro Vai Pro Arg Leu Asp Fig. 2E Asn Leu Tyr His Leu Ala Leu Ile Ser * Ser Val Val Asn Arg Phe Ala Ser Leu Arg Arg Leu Leu Ala Gly Pro Arg Leu Ser Lys Arg * * Cys Gin Cys Leu Gly Trp Met Fig. 2F Ile Ser Thr Thr Leu His * Tyr Ala Lys Ala * Ser Ile Asp Leu Leu Will Be Glu Gly Cys * Leu Gly Pro Gly Cys Leu Ser Gly Lys Asn Ala Be Ala * Val Gly Trp taken integrally or by Pro Arg His Trp His * Leu Asp Ser Leu Gly Pro Ser Leu Leu Arg Leu Ala Leu Thr Thr Leu * Leu Ala Arg Trp * Arg Leu Leu Gly Thr Gly Ile Lys * Thr Ala Trp Ala Leu Ala Phe * Asp * Pro * Leu Arg Phe Ser * Gin Gly Gly Arg Asp Ile Thr Ser * * Gly * Pro Asn Gly Arg * Cys Trp Lys Ser Lys Ser Ser Gin Pro Gly Arg Ser Gly Arg Thr Glu Asp Phe Ser Leu Arg Asp Lys Ala Ser Gin Met Asp Val Lys Ala Gly Ser Arg Asn Arg Will Be Leu Ala Glu Will Asp Ala Leu Arg Thr Leu His Phe Willi Ile Arg Leu Ala Lys Trp Thr Leu Arg Leu Glu Vai Glu Ile Glu Ser Ala Trp Gin Lys Phe Thr His * Gly Leu: tions of these sequences, or 74 by its allelic variations. A method according to claim 4, wherein the protein or polypeptide obtained additionally contains in combination a detectable ligand, a therapeutic molecule or a tonic molecule. 8. A process for the preparation of a CAV polynucleotide sequence, wherein the nucleic acid is extracted from the supernatant of leukocyte-co-cultured tissue cell cultures of a human patient with CPIDS. A method according to claim 8, wherein the polynucleotide sequence obtained contains a polynucleotide sequence that does not occur in HTLV I or HTLV II. A method according to claim 8, wherein the polynucleotide sequence obtained contains a continuous nucleotide sequence capable of selectively hybridizing to the CAV genome or a complement thereof. - 75 - 113 - The method of claim 8, wherein the obtained sequence is a DNA polynucleotide. The method of claim 8, wherein the obtained sequence is a polynucleotide according to claim 8, characterized in that the polynucleotide sequence obtained is selected from the group consisting of (a) to polynucleotide sequence 5'CAAAGTCCTC AGTGCGTCCA TCCAACCTAG GCACTGGCAT TAAACTTCTG CCAGGCTGAC TTACCGCTTA GACAGCCTGG GCCCTCGATT TCGACTTCCA GCAGCTAGCA GCCTTCTGAG ACTAGCCTTA ACGTCCATTT GGCTAAATCT ATTGACTACG CTTTAGCTAG CCTTATCACG AAGTGATATC AGTGCAAGGT GGTAGAGATT G 3 * OR 5 '6AATCTCTAC CACCTTGCAC TGATATCACT TCGTGATAAG GCTAGCTAAA GCGTAGTCAA TAGATTTAGC CAAATGGACG TTAAGGCTAG TCTCAGAAGG CTGCTAGCTG CTGGAAGTCG AAATCGAGGG CCCAGGCTGT CTAAGCGGTA AGTCAGCCTG GCAGAAGTTT AATGCCAGTG CCTAGGTTGG ATGGACGCAC TGAGGACTTT G 3 'or a fragment of one of these sequences, (b) a polynucleotide sequence encoding an antigenic site of CAV, (c) a polynucleotide sequence - capable of hybridizing under critical conditions with (a) or (b), and (d) a polynucleotide sequence other than (a) or (b) due to degeneracy of the genetic code; (e) a polynucleotide sequence which is a complement to the sequences of (a) to (d). A method for the preparation of a recombinant vector containing a coding sequence containing a CAV polynucleotide characterized by inserting into a selected expression vector a CAV polynucleotide sequence obtained according to any of claims 8 to 13. A method for the preparation of an antibody specific for an antigenic site encoded by a CAV polynucleotide sequence selected from the group consisting of a polyclonal antibody, a monoclonal antibody or a recombinant antibody characterized in that the generation of antibodies is raised by reaction to a CAV polypeptide sequence used as an immunogen or causing secretion of an antibody by a cell line. 16. A method according to claim 15, wherein the antibody obtained is optionally associated with a detectable label. - 77 - 17. A method for producing a pervirus cell line infected with the CAV retrovirus of the non-C type obtained according to claim 2 capable of producing an infectious progeny of said characteristic virus by cocultivating a permissible cell line under conditions with leukocytes from CF1DS patients. 18. A method for preparing a host cell transformed by a recombinant vector according to claim 14 wherein the coding sequence is operably linked to a suitable regulatory control sequence capable of directing the expression of the sequence of coding. A process for the preparation of a composition comprising incorporating as active principle a CAV polypeptide together with a pharmaceutically acceptable carrier. A process for the preparation of a pharmaceutical composition characterized in that it is incorporated as a starting material. or a CAV peptide or protein together with a pharmaceutically acceptable carrier. A process for the preparation of a therapeutic reagent for the treatment of CFIDS characterized in that a specific antibody is incorporated into an antigenic site encoded by a CAV polynucleotide sequence or a fragment thereof, said antibody being capable of targeting specifically an infected cell and introducing into the cell a toxic or therapeutic agent. 22. A process for the preparation of a component for a vaccine for the prophylaxis of CFIDS in mammals characterized in that a peptide of a non-C-like CAV retrovirus which does not occur in HTLV I or HTLV II is incorporated. 23. The method of claim 22, wherein the obtained vaccine component comprises at least one peptide encoded by the whole or a fragment of a polynucleotide sequence obtained according to claim 9. Process for the preparation of a vaccine component characterized in that an antisense RNA sequence corresponding to a CAV ADM sequence not occurring in HTLV I or HTLV II is incorporated. - 79 - 25. A method for the preparation of blood products free of CAV infection characterized in that a sample of a large blood aliquot is searched for the presence of a CAV polynucleotide sequence or an anti-CAV antibody , selecting the samples which give negative results in said search and isolating said blood products from said blood aliquot associated with said selected samples. - Method for the preparation of a diagnostic reagent useful for the diagnosis of CFIDS or a related disease characterized by incorporating a polynucleotide sequence obtained according to claim 8 or a complement thereof optionally associated with a detectable ligand, a therapeutic molecule or a toxic molecule. 27. The method of claim 26, wherein said sequence is capable of hybridizing with CAV under critical conditions but not with another virus. A method according to claim 80, 26, characterized in that the reagent obtained binds to a sequence present in the HTLV 1 gag protein and to a sequence present in CAV. 29. The method of claim 26 wherein said sequence is susceptible to hybridization with an anti-CAV antibody. A method of detecting the presence of a CAV polynucleotide sequence in its entirety or a fraction thereof in body fluids of a patient with symptoms of CPIDS characterized in that all or a fragment of a CAV nucleotide sequence is used as the primer or a complement thereof in an in vitro polymerase chain reaction on a sample of the patient's body fluids / indicating the amplification of said sequence the presence of the CFIDS etiologic agent. The method of claim 30, wherein the detection comprises the use of the whole or a fragment of a CAV nucleotide sequence or a complement thereof as a hybridization probe in an in vitro hybridization assay on a sample of patient's body fluids, indicating the hybridization of said sequence. the presence of the CFIDS ethiological agent. A method of detecting the presence of an antibody to a CAV antigenic peptide in body fluids of a patient with symptoms of CFIDS characterized by contacting the body fluid with a CAV peptide or protein, peptide or said protein an antigenic site susceptible to binding to said antibody, antigenic site not occurring in HTLV I or HTLV II. 33. The method of claim 32 wherein the body fluids of the CFIDS patient are contacted with a peptide or a protein of HTLV I or HTLV II, a peptide or protein encoding a an antigenic site capable of binding to said antibody and which is common to HTLV I and CAV or HTLV II and CAV. A method of performing an inverse transcritase assay on body fluids of a patient with CFIDS symptoms characterized in that a matrix primer is used. The polyA and the divalent catalyst Mn The applicant claims the priorities of the United States' applications filed on 29 August 1990, 17 April 1991 and 16 May 1991 under serial numbers 07 / 574,690, 07 / 686,594 and 07 / 702,161, respectively, Lisbon, August 29, 1991. Ì Aiffiiras OTICLIL © A © EOTEESSABE K®WfflSAL ·