IE913042A1 - Method and compositions for diagnosing chronic fatigue¹immunodysfuction syndrome - Google Patents

Abstract

The present invention provides compositions and methods for diagnosis, treatment and prophylaxis of Chronic Fatigue Immunodysfunction Syndrome (CFIDS) based on the detection of the presence of a novel CFIDS-associated virus, CAV, in the body fluids or tissues of a patient.

Description

METHOD AND COMPOSITIONS FOR DIAGNOSING AND TREATING CHRONIC FATIGUE IMMUNODYSFUNCTION SYNDROME The invention described herein wee made in the 5 course of work under grants or awards from The United States National Institutes of Health, the Department of Health and Human services.

Background of this Invention Chronic Fatigue Immunodysfunction Syndrome (CFIDS) ie an illness characterized by a myriad of symptoms including immunologic and neurologic abnormalities. However, because the symptoms of CFIDS are similar to those of a number of other conditions, CFIDS patients are often misdiagnosed as having some other condition, including psychosomatic illness. In fact, the disorder characterized by some or all of the symptoms of CFIDS listed below, has been diagnosed as being chronio active Epstein Barr Virus infection syndrome, chronic mononucleosis, poetviral fatigue syndrome, low natural killer cell syndrome, [D. Buchwald and A.L, Komaroff, Rev, Infectious Dis.. U(Suppl. 1) rS128 (1991)), Royal Free disease, ‘yuppie disease', neurasthenia, and myalgic encephalomyelitis. See, e.g., L. Williams, Time. May 14, 1990, p. 56; W. Boly, Hippocrates. July/August 1987, pg. 31-40; H. Johnson, Rolling Stone, p. 56; and G.P. Holmes et al, Annflle Intern. Med.. 1^1:387-389 (1988).

A working case definition of CFIDS has recently been developed [Holmes et al, cited above). To fulfill the working case definition of CFIDS, both major criteria and either six or more symptomatic criteria plus two or more physical criteria and eight or more symptomatic criteria muet be present. The two major criteria are persistent, relapsing or eaey fatigability that does not resolve with bed rest and ie severe enough to reduce dally activity by at least half and, the exclusion of other chronic clinical conditions, including preexisting psychiatric diseases. The minor criteria include, mild fever or chills, sore throat, lymph node pain, unexplained generalised muscle weakness, muscle discomfort, myalgia, prolonged (greeter than 24 hours) generalized fatigue following normal exercise levels, new generalized headaches, migratory noninflammatory arthralgia, neuropsychological symptoms Including photophobia, transient visual scotomata, forgetfulness, excessive irritability, confusion, difficulty thinking, inability to concentrate, and depression, sleep disturbance, end initial onset of symptoms as acute or subacute. The physical criteria include low-grade fever, nonexudative pharyngitis, and palpable or tender anterior or posterior cervical or axillary lymph nodes.

The first documented CFIDS-like epidemic occurred in Loe Angeles more than 50 years ago. Serious epidemics struck 1,136 people in Iceland in 1948 and affected as many ae 100,000 peoples in the U.S., Canada and New Zealand in 1984. New occurrences of CFIDS-like outbreaks have been reported steadily since then.

Diagnosis of CFIDS ie difficult, and expensive, because these symptoms resemble those of other conditions and diagnosis often involves eliminating the presence of other conditions. Currently, no specific tests to pinpoint the syndrome and, although in the past several specific agents including Epstein Barr virus, certain enteroviruses end Human Herpes virus type 6 have been associated with CFIDS-like illnesses, no etiological agent of CFIDS has been definitively identified.

Retroviruses are a family of spherical enveloped viruses comprising three sub-familiee, Oncovirlnaa, Spunavlrlnaa and Lantivirinaa. The viruses ar· designated as B-type, C-type or D-type, depending on certain structural characteristics of ths virions. Among such reported characteristics are the looation of the central nucleoid, the presence of low molecular weight gag gene proteins, ths DNA sequence of the transfer RNA primer binding site (PBS) in the 5' LTR/ and the eymptoms which the virus·· induce in infected hosts.

B-type viruses such ss ths mammalian virus, mouse mammary tumor virus (MMTV,, have a central nucleoid located acentrically and mature virions can bs visualized by electron microscopy both intracellularly and sxtrace1lularly.

All Known human retroviruses are C-typs viruses, both oncoviruses (HTLV I and IX) and lsntiviruses (HIV l and HIV 2), in which the central nucleoid ie located concentrically and mature virions are usually visualised extracellularly. Exogenous oncoviruses and lsntiviruses occur widely among vertebrates and are associated with many diseases.

C-type oncoviruses include human T-call lymphotropic viruses (HTLV) including HTLV X and II.

These HTLV viruses are linked with certain rare human Tcell malignancies. HTLV-l ie linked with a chronic demyelinating disease of the central nervous system called HTLV X-associated myelopathy (HAM) or tropical spastic paraparesis (TSP) (E. DeFreitae et al, AIDS Research and Human Retroviruses. 1(1)ι19-31 (1987)].

Both HTLV-I and XI have bean reported as a coinfection with HIV in many cases of AIDS. Two members of this family, HTLV x and HTLV II, have been cloned and sequenced, and appear to represent evolutionarily divergent viral subgroups. The sequence for HTLV I was published in M. Seiki et al, Proo. Natl, Acad. Sci.. usa. 11(3618-3622 (1983). See, also, 0. M. Shaw et al, Proc, Natl, Acad, Sci.. USA. W4544-4548 (1984). The nucleotide sequence of HTLV II was published in K. Shimotohno et al, Proc, Natl, Acad, Sci., USA. 12:31013105 (1985).

C-type lentiviruses include the human 5 retroviruses, HIV-1 (the causative agent of AIDS) and Hjv-2, as well as equine infectious anemia virus (EIAV).

To date, other non-C type retroviruses or D type retroviruses have been identified in primates, but not in humans. Mason Pfizer monkey virus (MPMV) ie a type D virue which produces depletion cf lymphocytes and hind-limb paralysia when innoculated into newborn monkeys [D. Fine et al, Canoer Res.. 21:3X23-3139 (1978)]. D type viruses are also characterised by the ability to infect human T and B cells. [See, e.g., M. D. Daniel et al, Sclancs. 222*602-605 (1984)/ C. S. Barker et el, Virol.. 153:201-214 (1986)/ A. A. Laokner et al, Curr, Topics Microbio. Immunol.. 111:77-96 (1990)].

The SpumtvirlnA· sub-family includes the Foamy viruses [J. J. Hooks st el, Bactariol. Rev.. 22*169-185 (1975)]. Ten serotypes of foamy viruses have been identified in a variety of Old World end New World monkeys but they appear to be non-pathogenic in all animal species tasted.

There exists a need for a diagnostic method to detect the occurrence of CFIDS, permitting patients to be properly diagnosed, as well as therapeutic and vaccinal agents to treat and/or desirably prevent the infection.

Summary of thi layantion The present invention provides a novel, substantially isolated Chronic Fatigue Immunodeficiency Syndrome-associated virus, hereafter referred to by the name CAV. Polynucleotide sequences of CAV and polypeptides of CAV are useful as diagnostic reagents in the diagnosis of CFIDS patients. Polynucleotide sequences of CAV and polypeptide sequences of CAV are useful In therapeutic or vaccinal compositions for the treatment or prevention of CFIDS.

Also disclosed by this Invention are methods 5 and assays for diagnosing and/or treating CFIDS patients.

Antibodies to CAV antigenic regions and An yltro calls containing CAV polynucleotide sequences or polypeptides are also described. other aspects and advantages of the present invention are described further in the following detailed description.

Brief Description of the Figures Fig. 1 illustrates the oligonucleotide primers and probes for htlv I gag and HTLV ii gag and tax used to originally detect CAV.

Fig. 2 illustrates a potential CAV DNA sequence fragment. Ona strand of the DNA sequence is reported as SEQ. A; the complementary strand is reported as seq. b.

Fig. 3 illustrates the six potential reading frames of a putative CAV polynucleotide sequence.

Detailed Description of the Invention The present invention provides methods and compositions for the detection, treatment and prevention against infection of humans, and possibly other mammals, by a virus which causes, or at least contributes to, the disease termed Chronic Fatigue Immunodysfunction Syndrome. This invention involves the discovery by the inventors and the substantial isolation of the apparently unknown CFlDS-associatsd virus, CAV.

It ie believed that at least a percentage of patients, both human and animal, exhibiting CFIDS symptoms are suffering from infection by CAV. Thia virus is present in the body fluids of a statisticallyIE 913042 significant number of suspected human CFIDS patients, based on the physioal symptoms normally associated with this disease, e.g., the presence of a chronic illness with a pattern of clinical symptoms, immunologic abnormalities, activation of herpes viruses and abnormalities of the central nervous system. Suspected CFIDS patients who do not test positive for the presence of this virus are believed to be suffering from a different disease, or to have presently undetectable levels of viral infection in the body fluids assayed.

This virus may also bs the causative agent of other diseases with symptoms similar to the above-defined CFIDS symptoms, but which diseases are known by other names.

CAV and polypeptides thereof, which may be found in cells of body fluids of e human patient with CFIDS symptoms, have been substantially isolated from contaminants with which the virus and its polypeptides occur in natural sources. CAV or a polypeptide thereof may aleo be obtained substantially isolated from contaminants with which it is associated by means of ite production, e.g., by recombinant means or by chemical synthesis. Such natural sources and/or production sources include human cells or cellular components, cells or cellular components of any other animal infected by CAV, host cell expression systeme, cell culture supernatants, chemical purification eluates and the like.

The terms substantially isolated or purified as used herein with reference to CAV or CAV polypeptides is defined as follows. A composition of CAV or a polypeptide thereof is substantially isolated from a natural or production source, as defined above, where the percentage of CAV or its polypeptide relative to the source and without regard to other contaminants is at least 10% on a weight percentage basis. The definition of substantially isolated from a natural or production source also encompasses a percentage purification of at lsaet 35¾ on a weight percentage basis. Similarly a composition of CAV or a polypeptide thereof is substantially isolated from a natural or production source as defined above where the percentage of CAV or its polypeptide relative to the eource and without regard to other contaminants is at least 40¾ on a weight percentage basis. The definition of substantially isolated may include a purification percentage of at least 60¾ on a weight percentage basis.

This virus may be characterized by one of the following morphological, physical and biological features. The virus may also be characterized by a combination of two or more of these features of the CAV prototype virus of this invention.

Based on the prototype virus specifically exemplified in the following examples, CAV may be morphologically characterized as a retrovirus, particularly a non-C retrovirus which is capable of infecting humans. Electron microscopy of viral particles formed in infected human cell cultures revealed that CAV was a non-C-type retrovirus because of its diameter, morphology, formation and location of intracellular virions. More specifically, as described in Example 1 below, CAV-infected celle are characterized by electrondense circular virions, some with electron-lucent cores and others with electron-dense cores, associated with the rough endoplasmic reticulum and ineide large abnormally distended mitochondria in the cells. All particles are the same shape and size, 46-50 nm (460-500A). No extracellular virue le observed. No forms budding from the cytoplasmic membranes are observed. Thus, CAVinfected cells are characterized by the presence of intracytoplasmic particles. β CAV 1« specifically distinguishable from the viruses previously identified with CFIDS, namely EpsteinBarr virus, HHV-6 and a variety of enteroviruses. CAV morphology also distinguishes it from the human C-type retroviruses, HTLV I and HTLV II. The location of its virions in the mitochondria distinguishes CAV from HIV.

One characteristics of CAV is its ability to infect both human B and T cells. As described in more detail in Example l, this virus was propagated in culture by mixing leukocytes from CFIDS patients with two types of human cell lines, H9 lymphoblastoid T cells and B-Jab lymphoblastoid B cells. These cell lines are also permissive for HTLV I and HTLV II, respectively. Both these cell lines are permissive for xenotropic primate D type viruses, e.g., Mason Pfizer monkey virus (MPMV), and Foamy (Spuma) viruses [see, Fine et al, Daniel et al, Barker et al and Hooks st al, cited above].

A characteristic of CAV is its tRNA primer binding site (PBS) preference. Retroviruses can be categorized with respect to the DNA sequence in the U5 region of their 5' LTR which binds transfer RNA's (tRNA) for certain types of amino aoids [see, e.g., F. Harada et al, Jon. J. Cancer Res.. £1(232-237 (1990)]. For example, a C type virus, such as HTLV I or II, has a tRNA primer binding site TGGGGGCTCGTCCGGGAT which binds the tRNA for proline. In fact, all mammalian C-type viruses use the tRNA site for proline except HIV. As described in detail in Example 7, the PCR technique was utilized to amplify the U5 region in CAV to determine its tRNA binding site. The results of thia experiment indicated that the primer binding site is for the tRNA of lysine. This result further indicates that CAV is a non-C type retrovirus.

CAV may be further characterized by the presence of the low molecular weight g&g proteins, pllIE 913042 12, pl3-l4, p27-28, Aa described in detail in Example 8, the CAV flAg proteins of these molecular weight· were immunoprecipitated from leukocyte· of CFIDS patient· using a mouse monoclonal antibody (MAb) ΚΊ [described in S. DeFreitas at al, AIDS Research and Human Retrovlruaea. 1:19-32 (1987), as the HTLV I MAb in Table 2, p. 26] which recognizes an antigenic determinant on the oao protein of HTLV I, II end Simian T call lymphotropic virus (BTLV). Classes of primate and non-primate animal retroviruses have such characteristically sized gag proteins [J. Leis et al, J, Virol.. £2»1808-1809 (1988)).

The virus has the ability to induce the presence of viral gag proteins in the nucleus and cytoplasm of cells which it infects, cav is characterized by immunohistochemical staining of the CFIDS leukocytes using KI Mab as having viral gag proteins located in the nucleus as well ae the cytoplasm of infected cells. This characteristic of viral aaa protein localization also indicates a non-c type retrovirus. The virus may alao be characterized by the presence of a gag gene sequence which differs from the qaa gene sequences of HTLV I and HTLV II.

The following Tables I and II illustrate comparative differences between cav and other known human and other animal ratrovirusee on the basis of the abovementioned reported viral characteristics, and the eymptomology which known retroviruses induce in infected hosts.

Table I SUMMARY OF CORRELATIONS OF CFIDS RETROVIRUS WITH KNOWN TYPES Virue Infects Human T and B Cells Intracyto plaamio particles by EM Uses tRNA lysine primer gag proteins mads in nucleus 9*9 proteins pll-12, pl3 p27-28 (Mr) 10 CAV fi-tYEl +* + + + + MMTV C-typs 0J + (oncovirus) ♦ 0 + Avian 0 0 0 0 0 15 Mammalian 0 (non-primate) 0 0 0 0 Primate 1 + 0 0 0 + (non-human) Human (HTLV I and II) + 0 0 0 0 HIV (lsntivirus) + 0 + 0 0 EIAV 0 + 0 + 25 p-typi MPMV + + + 0 + + + + 0: 1 Hbb (+) worn reported b IhtnUre or. for CTONI, ® fell ippUcotio*. * 2m (0) maisi ·« reported b Amur* » oer bwwtadg·.

* No report· oo f«f protob cbmcurtatio· b Ubrbore dAough A»y won doduood by DNA t*qu«eb|.

Table II CORRELATIONS OF CFIDS RETROVIRUS WITH KNOWN TYPES Exported Symptcmatolagy Syncytia Immuno Reactiv.

Formation Suppres- Neurologic Fatigue/ of Virus in vitro sion Dysfunction Wasting Herpes io CAV + B-tYPf MMTV 0 C-type (oncovirus) Avian 0 Mammalian 0 (non-primate) Primate 0 (non-human) Human (HTLV I and II) o c-tvoe (lentivirue) HIV EIAV Drlypm MPMV Foamy + + + + + 0* + ‘ bataM from wunl tluu*. cav, or a subtype of the virus, may be characterized by the presence of a polynucleotide sequence, either RNA or DNA, which may be obtained, and its nucleotides identified, by ths application of standard sequencing technique!, including polymerase chain reaction techniques (PCR), to sources containing the substantially isolated virue. It le within the skill of ths average viral taxonomist to obtain polynuoleotide sequences of a substantially isolated virus from sources thereof. Such sources are defined above ae natural sources or production sources.

Polynucleotide sequences of CAV or of subtype viruses thereof are thus part of this invention.

Sequences which contain one or more nucleotide differences from the sequences of CAV but which code for sequences homologous to CAV, are also included in the present invention. Due to a typical rate of transcription error in viral replication, it ie anticipated that CAV polynucleotide sequences will be characterized by certain hypervariable regions or domains. Distinct CAV subtypes may be characterized by sequences which very from the sequences of the prototype virue described herein, but which share overall genomic organization and large regions of conserved sequences.

Particularly, virally encoded enzyme sequences are expected to be similar among subtypes of CAV. Viral homology at ths nucleotide level among CAV subtypes is expected to bs at least 40%. Mors specifically, such homology ii expected to range between about 40% to about 95%. Homology between subtypes may ba at least 50%.

Other subtypes of CAV may have nucleotide homologies of at least 60% or more.

It ie understood that CAV polynucleotide sequences include those sequences which hybridize under stringent or relaxed hybridization condition! [see, T.

Maniatis st al, Molecular Cloning (A Laboratory Manual). Cold spring Harbor Laboratory (1982), pages 387 to 389] to the native CAV DNA sequences. Preferably, high stringency conditions are employed for hybridization of CAV sequences. A polynucleotide aequenoe of this invention may also be capable of hybridizing under stringent conditions to a polynucleotide sequence encoding an antigenic site of CAV. An example of stringent hybridization condition is hybridization in 4XSSC at 65*c, followed by a washing in o.ixssc at 65*0 for an hour. Alternatively an exemplary stringent hybridization condition is in 50% formamide, 4XSSC at 50*C.

Polynucleotide sequences may hybridize to native cav sequences under relaxed hybridization conditions. An example of such non-stringent hybridization conditions are 4XSSC at 50*C or hybridization with 30-40% formamide at 42*c.

A polynucleotide sequence of this invention may aleo differ from the CAV polynucleotide sequences described above due to the degeneracies of the genetic code. Further, a polynucleotide sequence according to this invention may be a sequence which is the complement of a CAV polynucleotide sequence. Polynucleotide sequences of CAV are expected to contain sequences not found in HTLV I or HTLV II.

Allelic variations (naturally-occurring base changes in the species population which may or may not result in an amino acid change) of CAV DNA sequences are also included in the present invention, as well as analogs or derivatives thereof. Similarly, DNA sequences which code for CAV peptides or antigenic sites, but which differ in codon sequence due to the degeneracies of the genetic code or variations in the DNA sequence of cav which are caused by point mutations or by induced modifications to enhance the activity, half-life or production of the paptides encoded thereby are also encompassed in the invention.

Modifications of interest in the CAV sequences 5 may include the replacement, insertion or deletion of a selected nucleotide or amino acid residue in the coding sequences. For example, a structural gene may be manipulated by varying individual nucleotides, while retaining the correct amino acid(s), or the nucleotides may be varied, ec as to change the amino acids, without loss of biological activity. Mutagenic techniques for such replacement, Insertion or deletion, e.g., in vitro mutagenesis and primer repair, are well known to one skilled In the art [See, e.g., United States Patent No. 4,518,584).

One potential source of polynucleotide sequences of CAV is the DNA obtained from supernatant extracted from tissue culture cells cocultivated with leukocytes from a human CFIDS patient. This DNA vbb deposited with the American Type Culture collection (ATCC), 12301 Parklawn Drive, Rockville, Maryland 20852, u.s.A. pursuant to the Budapest Treaty on the International Recognition of the Deposit of Microorganism for the Purposes of Patent Procedure on August 28, 1991 and designated ATCC No. ..,.

CAV polynucleotide sequences may be obtained and their nucleotidee identified by the application of standard sequencing techniques to the lambda Fix amplified phage library of Sau3A-digested genomic DNA containing integrated CAV, similarly deposited with the ATCC on August 28, 1991 and designated ATCC No. _, Another potential source of CAV polynucleotide sequences obtainable by the application of standard sequencing techniques is the Bluescript plasmid library of BamHI-digested genomic DNA containing integrated CAV IS in «η E, coll strain, similarly deposited with the ATCC on August 28, 1991 and designated ATCC No. _.

A CAV polynucleotide sequence may comprise a nucleic acid sequence obtained from one of the ATCC deposits identified above. CAV or a subtype thereof, may also be characterized ae comprising all or a portion of a DNA sequence reported in Fig. 2 below. In addition to the above, other CAV sequences may be obtained and/or created from the above deposits or from other animal cell sources. A DNA sequence of this invention may also be capable of hybridizing under stringent conditions to a DNA sequence from one of the above ATCC deposits. A DNA sequence of this invention may also be capable of hybridizing under etringent conditions to a DNA sequence of Fig. 2.

CAV ie not limited to containing the sequences of Fig. 3 or of the deposited material. The final characterization of CAV Ib within the skill of a viral taxonomist with reference to the prototype isolate described herein.

Still another aspect of the invention is a CAV polypeptide in substantially isolated form. Polypeptide sequences of CAV or of subtype viruses thereof are also part of thia invention. A CAV polypeptide may be encoded by the CAV polynucleotide sequences described above.

Preferably, a CAV polypeptide comprises a sequence of at leaet 10 amino acids encoded by the genome of CAV, and comprises an antigenic determinant. A CAV polypeptide may also comprise all or a fragment of a structural viral protein. A CAV polypeptide may also comprise all or a fragment of a non-structural protein.

Polypeptide sequences which contain one or more amino acid differences from ths polypeptide sequences of CAV, but which code for sequences sharing homology at the amino acid level to CAV, are also included in the present 1« invention. Ae described above, transcription error in viral replication may produce CAV polypeptide sequences characterized by certain hypervariable amino acid regions or domains. Distinct CAV subtypes may bs characterized by polypeptide sequences which vary from the polypeptide sequences of the prototype virus described herein, but which share overall structural (primary, secondary and tertiary) organization and large regions of conserved sequences with the prototype virus described herein.

Particularly, virally encoded enzyme sequences are expected to be similar among subtypes of CAV. viral homology at the amino acid level for CAV subtypes is expected to bs at least 40¾. Mors specifically, such homology is expected to range between about 40% to about 90%. Homology between subtypes may be at least 50%. Other subtypes of CAV may have amino acid homologies of at least 60% or more.

Other polypeptide sequences of this invention may be sequences capable of hybridizing under stringent conditions to a CAV amino acid sequence. A polypeptide sequence of this invention may also be capable of hybridizing under stringent conditions to an amino acid sequence encoding an antigenic site of CAV. Polypeptide sequences of CAV are expected to contain sequences not found in HTLV I or HTLV II.

Modified CAV polypeptides, analogs or derivatives thereof are also encompassed by this invention. A CAV polypeptide analog may be a mutant or modified protein or polypeptide that has a homology of at leaet 40% to CAV. Mors preferably a modified CAV protein may have e homology of about 60%, and moat preferably above about 80% to a native CAV polypeptide.

Typically, CAV polypeptide analogs differ by only 1, 2, 3, or 4 codon changes. Examples include CAV polypeptides with minor amino acid variations from the amino acid sequence· of native cav polypeptides or any of the above-described CAV polypeptides, in particular, conservative amino acid replacements. Conservative replacements are those that taka place within a family of amino aoide that are related in thair aide chains.

Genetically encoded amino acids are generally divided into four families: (1) acidic - aspartate, glutamate; (2) basic - lysine, arginine, histidine; (3) non-polar » alanine, valine, laucine, iaoleuclna, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar glycine, asparagine, glutamine, cystine, serine, threonine, tyroeine. Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids. For example, it is reasonable to expect that an isolated replacement of a leucine with an ieolaucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar oonsarvative replacement of an amino acid with a structurally related amino acid will not have a major affect on the cav polypeptide.

The isolation and Identification of CAV and polynucleotide and polypeptide sequences also enables the development of diagnostic reagents and probes useful In Western blots, ELISA'e or other diagnostic assays, immunogenic or therapeutic compositions and immunogenic compositions for the generation of antibodies and vaccine compositions. These compositions may ba useful in diagnosis, treatment and prevention of CFIDS or related diseases.

Thue, ae another aspect of this invention, a diagnostic reagent le provided which ie useful in the diagnosis of CFIDS or a related disease. Aa described in more detail below, auch a reagent can comprise a cav polynucleotide sequence, including complementary sequences thereto and the other eequencea described above. Such e reagent may also comprise a CAV polypeptide sequence as described above. The CAV sequences can be optionally associated with a detectable ligand, a therapeutic or toxic molecule.

The polynucleotide or polypeptide reagent may be capable of binding to a sequence present in the HTLV II gag protein and to a sequence present in CAV. Ths reagent may also comprise a polynucleotide sequence capable of hybridizing to an antibody to CAV. Ths reagent may be in the form of a hybridization probe for detection of CAV in patients. The reagent may be in the form of a PCR primer to enable the amplification of other sequences of CAV. The reagent may also bs an antibody to an epitope or antigenic site on the cav sequence.

PCR primer sequences employing CAV polynucleotide sequences as reagents of this invention are at least about io bases in length, with an intervening sequence of at least loo bases to as large as 1500 bases therebetween, according to conventional PCR technology. Larger sequences, up to about 30 nucleotides, may also bs employed as a practical upper limit. However, it is possible that larger or smaller sequence lengths may be useful based upon modifications to the PCR technology. At present the length of the primer is not a limitation upon the disclosure of this invention.

In a similar fashion, hybridization probes of ths invention are desirably at least 10 bases in length, based on current technology. Typically, such probe sequences are no larger than about 50 bases in length.

Probe lengths may mors preferably range between 15 to 30 bases in length. However, it is possible that smaller or larger probe sequences may be useful in the methods and compositions of this invention. Probe length ie not a limitation of this invention, as one of sXill in the art ι> is presumed to have the knowledge to design probes of suitable length. Hybridization probes of this invention may desirably be associated with detectable labels, as described below.

For use in conventional assays as well as in the assays described below, the primers and probes of this invention may be capable of selective hybridization to a target CAV sequence. Selective hybridization ae used herein may be defined as the ability of the probe to detectably hybridize at a suitable stringency to a target CAV sequence in a clinical sample from an infected patient end not to detectably hybridize to other sequences in the sample which ere unrelated to CAV. Sequences which comply with this requirement may be designed by one of skill in the art based on the functional level of homology between the probe sequence and the desired target CAV sequence.

It should be understood that all of the polynucleotide sequences and polypeptide sequences described herein, whether for use as diagnostic or therapeutic reagents, for research or otherwise may be prepared by techniques known to one of skill in the art. Such techniques Include chemical synthesis (including enzymatic synthesis methods), recombinant genetic engineering techniques (including PCR), or various combinations of these known techniques.

Conveniently, synthetic production of the polypeptide sequences of the Invention may be according to the solid phase synthetic method described by Merrifield in J.A.C.S. ££:2149-2154 (1963). This technique ie well understood and is a common method for preparation of peptides. Alternative techniques for peptide synthesis are described in Bodanazky et al, Peptide Synthesis. 2d edition (John Wiley and Sons: 1976). For example, the peptides of the invention may also be synthesized using standard solution peptide synthesis methodologies, involving either Btepwise or block coupling of amino acids or peptide fragments using chemical or encymatio methods of amide bond formation.

(See, e.g. H.D. Jakubke in The Peptides, Analysis, synthesis. Biology. Academic Press (New York 1987), p. 103-165; J.D. Glass, ibid.. pp. 176-184; and European Patent 0324659 A2, describing enzymatic peptide synthesis methods.] These documents are incorporated by reference io herein.

All polynucleotide sequences end polypeptide sequences of this invention may also be prepared, and modified if desired, by conventional genetic engineering techniques. Peptides may be prepared by known recombinant DNA techniques, including cloning and expressing within a host microorganism or cell a DNA fragment carrying a coding sequence for the selected peptide. Systems for cloning and expression of a selected polypeptide in various microorganisms and cells, Including, for example, bacteria, mammalian cells, yeast, baouloviruses and insect cells, are known and available from private and public laboratcrlea and depositories and from commercial vendors. [See also, Sambrook et al, cited above].

The CAV DNA obtained as described above or modified ae described above may be Introduced into a selected expression vector to make a recombinant molecule or veotor for use in the method of expressing CAV polypeptides. Numerous types of appropriate expression vectors art known in the art for mammalian (including human) expression, insect cell expreeeion, expression in yeast, expression in fungus and bacterial expression, by standard molecular biology techniques.

These vectors and vector constructs contain the CAV DNA sequences recited herein, which code for CAV polypeptides of the invention, including antigenic or immunogenic fragments thereof. The vector employed in the method also contains selected regulatory sequences in operative association with the CAV DNA coding sequences of the invention. Regulatory sequences preferably present in the selected vector include promoter fragments, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other suitable sequences which direct the expression of the io protein in an appropriate host cell, introns with functional splice donor and aooeptor sites, and leader sequences may also be included in an expression construct, if desired. The resulting vector is oapable of directing the replication and expression of an CAV in selected host cells. Expression constructs are often maintained in a replicon, such as an extrachromosomal element (e.g., plasmid) oapable of stable maintenance in a selected host.

The transformation procedure used depends upon the host to be transformed, and various procedures ara known in the art. In order to obtain expression of the CAV protein or polypeptide, recombinant host cells derived from the transformants ere incubated under conditions which allow expression of the recombinant CAV protein or polypeptide encoding sequence. These conditions will vary, dependent upon the host oell selected. However, the conditions are readily ascertainable to those of ordinary skill in the art.

The resulting CAV protein or polypeptide product may be purified by such techniques as chromatography, e.g., HPLC, affinity chromatography, ion exchange chromatography, etc.; electrophoresis; density gradient centrifugation; solvent extraction, or the like.

As appropriate, the product may be further purified, ae required, so as to remove substantially any host oell proteins which ars also secreted in the medium or result from lysis of host cells, so as to provide a product which is at least substantially free of host debris, e.g., proteins, lipids and polysaccharides.

For expression of a CAV peptide or protein in mammalian cells, expression vectors may bs synthesized by techniques well known to those skilled in this art. The components of the vectors, e.g. replicons, selection genes, enhancers, promoters, marker genes and the like, may be obtained from natural sources or synthesized by known procedures. See, Kaufman et al, ?. Mol, Biol.. l£i:5ll-521 (1982); and Kaufman, Froc, Natl. Acad, sci., USA. £2.:689-693 (1985). Alternatively, the vector DNA may include ell or part of the bovine papilloma virus genome [Luaky et al, Cell. ££:391-401 (1984)] and ba carried in cell lines such ae C127 mouse cells ae a stable episomal element.

Selected promoters for mammalian cell expression may include sequences encoding highly expressed mammalian viral genes which have a broad host range, such as the SV40 early promoter, mouse mammary tumor virus LTR promoter, adenovirus major late promoter (Ad MLP), and herpes simplex virus promoter. Non-viral gene eequenoes, such as the murine metallothionein gene, also provide useful promoter sequences. Examples of enhancer elements include the SV40 early gene enhancer [Dijkema et el, EMBO Jr, 4:761 (1985)] and the enhancer/promoters derived from the long terminal repeat (LTR) cf the Rous Sarcoma Virus [Gorman et al, Proc, Natl. Acad, Sci.. ££:6777 (1982)] and from human cytomegalovirus [Boshart et al, pell. £1:521 (1985)].

[See, aleo, Sassone-Corsi and Borelli, Trends Genet.. 2.:215 (1986); Maniatis et al, Science. £££:1237 (1987); and Alberta et al, Mol, Biol, of the Cell. 2d edit. (1989)]. Examples of transcription terminator/ polyadenylation signals include those derived from 8V40 [Sambrook st si, cited above].

Mammalian replication systems Include thoee derived from animal viruses, which require trans-acting factors to replicate. Examples of mammalian replicons include those derived from bovine papillomavirus and Epstein-Barr virus, papovaviruses, such as SV40 (Oluzman, fiftllt lit 175 (1981)] or polyomavirus. Examples of such mammalian-bacteria shuttle veotors include pMT2 [Kaufman et al, Mol, cell. Blol.r 1:946 (1989) and pHEBO [Shimizu et al, Biol., £:1074 (1986)].

Methods for introduction of haterologoue polynucleotides into mammalian cells are known in the art and include dextran-mediated transfection, calcium phosphate precipitation, polybrene mediated transfection, protoplast fusion, electroporation, encapsulation of the polynucleotide(s) in liposomes, and dirsot microinjection of the DNA into nuclei.

Mammalian cell lines available ae hosts for expression are known in the art and include many immortalized cell lines available from the ATCC, including but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BKX) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., Hep 62), and a number of other oell lines.

The polynucleotide encoding CAV proteins or polypeptide fragments can also be inserted into a suitable insect expression vector, and operably linked to control elements within that vsotor. Vector construction employs techniques which are known in the art.

Generally, the components of the expression system include a transfer vector, usually a bacterial plasmid, which contains both a fragment of the baculovirus genome, and a convenient restriction sits for insertion of the heterologous gens or genes to be expressed; a wild type >4 baculovirus with a sequence homologous to ths baculovirue-apecifio fragment in the transfer vector which allows for the homologous recombination of the heterologous gans into ths baculovirus genome; and appropriate insect host cells and growth media.

Materials and methods for baculovirus/insect cell expression systems are commercially available in kit form from, inter alia. Invitrogen, San Diego CA (MaxBac kit). These techniques are generally known to those skilled in the art and fully described in Summers and Smith, Texas Agricultural experiment Station Bulletin No. 1555 (1987) (hereinafter Summers and smith).

An insect cell transfer vector contains preferably a promoter, leader (if desired), one or more CAV coding sequence, and a transcription termination sequence. The plasmid usually also contains ths polyhedrin polyadenylation signal [Miller et al, Ann, Rev. Microbiol.. ±2:177 (1988)]) and a procaryotic ampicillin-resistance (±aa) gene and origin of replication for selection and propagation in fi* Roll. Currently, the most commonly used transfer vector for introducing foreign genes into AcNPV is pAc373. Many other vectors, known to those of skill in the art, have also been designed including pVL985 [See, Luckow end Summers, Virology. 12:31 (1989)].

Examples of promoters include sequences derived from the gene encoding the viral polyhedron protein [Friesen et al, The Regulation of Baculovirus Gene Expression, int The Molecular Biology of Baculovlrusam (sd. Walter Doerfler) (1986); EPO Publ. Nob. 127 839 and 155 476] and the gene encoding the pio protein [Vlak et al, J. Qen, Virol., ±2t765 (1988)).

DNA encoding suitable signal sequences can be derived from genes for secreted insect or baculovirus proteins, such as the baculovirus polyhedrin gene is [Carbon·11 et al, Sana, 22:409 (1988)]. Alternatively, leaders of non-insect origin, auch ae those derived from genes encoding human a-interferon [Maeda at al, Mature. 315:592 (1985)]; human gaatrin-raleasing peptide [Lebacq5 verheyden et al, Molac. Cell. Biol.. £:3129 (1988)]; human IL-2 [Smith at al, Prop. Nat«l Acad. Sci. USA. £2:8404 (1985)]; mouse IL-3 [Miyajima et el, film, 58:273 (1987)]; and human glucocerebrosidase [Martin at al, DNA. 2:99 (1988)], can aleo ba uead to provida for secretion In insects.

Methods for introducing heterologous DNA into the desired site in the baculovirus virus are known in the art [See, Summers and Smith £UB£>; Ju at al. (1987) supra: smith at al, Mol. Call, Biol.. 2:2136 (1983); and Luokow and Summers (1989) lUfiCA]. After inserting the DNA sequence encoding the CAV polypeptide or protein into the transfer vector, the vector and the wild type viral ganoma era transfected into an ineaot host call whara the vector and viral genome are allowed to recombine. The newly formed baculovirus expression vector is subsequently packaged into an infectious recombinant baculovirus. To identify recombinant viruses, a visual screen is performed by plequing the transfection supernatant onto a monolayer of insect cells by techniques known to those skilled in the art [Current Protocols in Microbiology Vol. 2 (Ausubsl et al. eds) at 16.8 (Supp. 10, 1990); Summers and Smith, supra; Miller et al. (1989) supra1. Recombinant viruses are identified by the presence cf reftactile occlusion bodies.

Recombinant baculovirus expression vectors have been developed for infection into Beveral insect oells. For example, recombinant baouloviruses have been developed for, Inter alia: Aedee aaovpti , Autograph! californica. asnfeyx Bprb BAftfgphlla nglanogaiter, SPQdoPtera frualperda. and TrlChOpmtlft nl.iPCT Pub. No.

WO 89/046699; carbonell et al, J. Virol.. ££:133 (1985); Wright, Nature. 221:718 (1986); Smith et al, Mol, Cell,. Biol.. 2:2156 (1983); and see generally, Fraser et al, In vitro Cell. Dev. Biol.. 22:225 (1989)].

Bacterial expression technique# and expression system components ars also known in the art. Among the components of a bacterial expression vector or construct include a bacterial promoter, a transoription initiation region, an RNA polymerase binding site, a transcription terminator sequence, a signal sequence and an operator, as well as the desired CAV sequence. Constitutive expression may occur in the absence of negative regulatory elements, such as the operator. In addition, positive regulation may be achieved by a gene activator protein binding sequence. An example of a gene activator protein is the catabolits activator protein (CAP), which helps initiate transcription of the lac operon in Escherichia coll [Raibaud et al, Ann, RsV.-Sftntt»> 12:173 (1984)]. Regulated expression may therefore be either positive or negative, thereby either enhancing or reducing transcription.

Examples of promoter sequences include sequences derived from sugar metabolizing enzymes, such as galactose, lactose (lac) [Chang et al, Nature. 198:1056 (1977)], and maltose; sequences derived from biosynthetic enzymes such as tryptophan (£cp) [Goeddel et al, Nuc. Acids Res.. 2:4057 (1980); Yelverton et el, Nucl. Acids Res.. £:731 (1981); U.8. Patent NO. 4,738,921; EPO Publ. Noe. 036 776 and 121 775}; the g-lactamase ibla) promoter system [Weieemann, The cloning of interferon and other mistakes." in interferon 2 (ed. I. Gresser) (1981)]; bacteriophage lambda PL (Shimatake et al, Nature. 222:128 (1981)] and T5 [U.S. Patent No. 4,689,406].

Synthetic promoter· which do not oocur in nature ere useful, e.g. the hybrid promoter described in U.S. Patent No. 4,551,433, and the tao promoter [Amann et al, fienft, 2£:167 (1983); de Boer et el, Proc. Natl. Acad.

Sci.. 8Q:2l (1983)]. A bacterial promoter oan include naturally occurring promoters of non-becterial origin, e.g., the bacteriophage T7 RNA pclymerase/proaoter eyetea [Studier et al, J, Mol, Biol.. 189:113 (1986); Tabor et el, Proc. Natl. Acad. Sci.. 22*1074 (1985); see, also, EPO Publ. No. 267 851].

In addition to a functioning promoter sequence, an efficient ribosome binding site ie also useful for the expression of foreign genes in prokaryotes, e.g., the Shine-Delgarno (8D) sequence of £x coll [Shine et al, £l&2£ft, 221*34 (1975)].

DNA encoding suitable signal sequences that provide for secretion of the foreign protein in bacteria can be derived from genes for secreted bacterial proteins, such as the £. coli outer membrane protein gene fompAl [Maeul et al, in: Experimental Manipulation of fiine Expression (1983); Ghrayeb et al, EttfiQJL., 2*2437 (1984)] and the £. fifiii alkaline phosphatase signal sequence (pfiflA) [Oke et el, Froc. Natl. Acad. Sci.. 22*7212 (1985); see, also, U.S. Patent No. 4,336,336]].

As an additional example, the signal sequence of the alpha-amylase gene from various Bacillus atrain· can be used to secrete heterologous proteins from fi. subtilis [Palva st al, Proc. Natl. Acad. Bel. USA. 22*5582 (1982); EPO Publ. No. 244 042). The cav proteins oan also be secreted from the cell by creating chimeric DNA molecules that encode a fusion protein with the eignal peptide sequence fragment.

Examples of transcription termination sequences are sequences derived from genes with strong promoters, such ss the trp gens in £. as veil as other biosynthetic genes.

Expression constructs may be maintained in a replicon, such as an extrachromoaomal element (e.g., a high or low copy number plasmid) capable of stable maintenance in a host cell. Alternatively, the expression constructs can bs integrated into the bacterial genome with an integrating vector. Integrating vectors typically contain at least one sequence homologous to the bacterial chromosome that allows the vector to Integrate. Integrations appear to result from recombinations between homologous DNA in the vector and the bacterial chromosome [see, e.g., IPO Publ. No. 127 328]. Integrating vectors may also be comprised cf bacteriophage or transposon sequences.

Alternatively, some of the above described components can be put together in transformation vectors. Transformation vectors are typically comprised of a eeleotable marker that ie either maintained in a replicon or developed into an integrating vector. Selectable markers can ba expressed in the bacterial host and may include genes which render bacteria resistant to drugs such ae ampicillin, chloramphenicol, erythromycin, kanamycin (neomyoin), and tetracycline [Davies et el, Annu, Rev, Microbiol.. ££i469 (1978)]. Salaotabla markers may also include biosynthetic genes, such ae those in tha hiatidina, tryptophan, and leucine biosynthetic pathways.

Bacterial expression end transformation vectors, either extra-chromosomal replicons or integrating vectors, have bean developed for transformation into many bacteria. See, e.g., the vectors described in Palva st al, Proc. Natl. Acad, sci. USA. ££:5582 (1982); Shimatake at al, Nature. £££:128 (1981); Powell et al, Appl, Environ, Microbiol.. ££>855 (1988); Powell et el, AppI. Environ. Microbiol.. £1:655 (1988) and U.S. Patent NO. 4,745,056].

Method· of Introducing exogenous dna into bacterial hosts ars well-known in the art, and typically include either the transformation of bacteria treated with CeCl2 or other agents, such as divalent cations and DMSO. DNA can also be introduced into bacterial cells by electroporation. Traneformation procedures usually vary with ths bacterial species to bs transformed. See e.g., Masson at al, FEMS Microbiol, Lett.. ££<273 (1989); Miller et al, Proc. Natl. Acad. Sci.. ££:856 (1988); Chasey et al, FEM8 Microbiol, Lett.. 11:173 (1987); Augustin et al, FEMS Microbiol, Lett.. ££:203 (1990) and numerous other references known to the art.

Yeast expression systems ars also known to one of ordinary skill in the art. Typically, a vector or expression construction for yeast expression includes a promoter, leader (if desired), a CAV coding sequence and transcription termination sequence. A yeaet promoter includes a transcription initiation region, an RNA polymerase binding site (the TATA Box), a transcription initiation site, an upstream activator sequence (UAS), which, permits regulated (induoible) expression. Constitutive expression occurs in ths absence of a UAS.

Regulated expression may be either positive or negative, thereby either enhancing or reducing transcription.

Particularly useful promoter sequences, include, e.g., alcohol dehydrogenase (ADH) [EPO Publ. No. 284 044], enolase, glucokinase, glucose-6-phosphate isomerase, glyceraldehyds-3-phosphate-dehydrogenase (GAP or GAPDH), hexokinase, phosphofructokinase, 3phosphoglycsrate mutase, and pyruvate kinase (PyK) [EPO Publ, No. 329 203]. The yeast PHO5 gene, encoding acid phoephatase, also provides useful promoter sequences [ My a noha r a at al, grgfii.Mltl. Afiid. .Sfli, USA/ Iflsl (1983)].

Synthetic hybrid promoters include the ADH regulatory sequence linked to the GAP transcription activation region [U.S. Patent Noe. 4,876,197 and 4,880,734], the regulatory sequences of either the ADH2. GAL4. GAL1Q. or PHQ5 genes, combined with the transcriptional activation region of a glycolytic enzyme gene such as GAP or PyK [EPO Publ. Mo. 164 556]. Non10 yeast origin sequences may function as promoters [See, e.g., Cohen et al, Proc, Natl. Acad. Sci. USA. 22:1078 (1980); and Kenikoff et al, Nature. 212:835 (1981)].

For intracellular expression in yeast, a promoter sequence may bs directly linked with the DNA molecule. For secretion of the expressed protein, DNA encoding suitable signal sequences can bs derived from genes for secreted yeast proteins, such as the yeast invertass gene [EPO Publ. No. 012 873; JPO Publ. No. 62,096,086] and the A-factor gene [U.S. Patent No. 4,588,684]. Alternatively, leaders of non-yeast origin, such as an interferon leader, exist that also provide for secretion in yeast [EPO Publ. No. 060 057]. A prsfsrrsd class of secretion leaders employ a fragment of the yeast alpha-factor gene [See, e.g,, U.S. Patent Noe. 4,546,083 and 4,870,008; EPO Publ. No. 324 274; and PCT Publ. No.

WO 89/02463].

Expraesion constructs are often maintained in a replicon (e.g., a high or low copy number plasmid) which may have two replication systems, allowing it to be maintained in yeast for expression and in a procaryotic host for cloning and amplification. Examples of such yeast-bacteria shuttle vectors include YEp24 [Botstein et al, fififlS/ 2:17-24 (1979)], pCl/l [Brake et al, Proc, Natl, Acad, Sci USA, 21:4842-4646 (1984)), and YRpl7 [Stinchcomb et al, J. Mol. Biol., 151:157 (1982)].

Alternatively, the expression constructs can ba integrated into the yeast genome with an integrating vsotor which typically contain st least one sequence homologous to a yeast chromosome that allows the vector to integrate, and preferably contain two homologoua sequences flanking the expression construct [Orr-Weaver et al, Math, Eniymol.. £21:228-245 (1983)].

Typically, sxtrachromosomal and integrating expression constructs may contain eelectable markers to io allow for the selection of yeast strains that have been transformed including biosynthetic genes that can ba expressed in the yeast host, such as £Q££, ££££, L£U2, ZB£1, and ALQ7. and the 6418 resistance gene. In addition, a auitable selectable marker may also provide yeast with the ability to grow in the presence of toxic compounds, such ss metal. For example, the presence of CUPl allows yeast to grow in the presence of copper ions [Butt et al, Microbiol, Rev.. £1:351 (1987)].

Alternatively, some of the above described components can be put together into transformation vectors, which typically comprise a selectable marker that is either maintained in a replicon or developed into an integrating vector, as described above.

Expression end transformation vectors, either sxtrachromosomal replicons or integrating vectors, have been developed for transformation into many yeast strains. See, e.g., Kurts st al, Mol. Cell, Biol., £:142 (1986); Kunse et al, J. Basic Microbiol.. ££:141 (1985); Gleeeon st si, J. Gen. Microbiol.. 132:3459 (1986); Das st al, J, Bacteriol.. £££:1165 (1984); De Louvsncourt et al, J. Bacteriol.. £££:737 (1983) and numerous other references known to ths art.

Methods of introducing exogenous DNA into yeast hosts are well-known in ths art, and typically include either the transformation of sphsroplasts or of intact yeast cells treated with alkali cations. Transformation procedures usually vary with the yeast specie· to he transformed. See, e.g., Kurtz et al, Mol, Cell, Biol.. £:142 (1986); Gleeson St al, J, Can, Microbiol.. £££:3459 (1986); Das st al, J. Bacterlol.. £££:1165 (1984); Cregg et al, Mol. Cell. Biol.. £:3376 (1985), among others.

Fusion proteins provide another alternative to direot expression of CAV proteins and polypeptides in yeast, mammalian, baculovirus, and bacterial expression syeteaa. Typically, a DNA sequence encoding tha Nterminal portion of an endogenous protein (depending on the host), or other stable protein, ie fused to the 5' end of heterologous ooding sequences. Upon expression, this construct will provide a fusion of the two amino acid sequences. The resulting fusion protein optionally retains a cleavable sequence at the junction of the two amino acid sequences for a processing enzyme to cleave the host cells protein from the CAV gene [See, e.g., Nagai et al, Nature. 109:810 (1984) and BPO Publ. No. 196 056]. One example ie a ubiquitin fusion protein that preferably retains a site for a processing enzyme to cleave the ubiquitin from the CAV protein. Through this method, native CAV protein can be isolated [See, e.g., Miller et al, Bio/Technology. 2:898 (1989)].

Alternatively, the CAV protein or polypeptide can be secreted from the selected host cell into the growth media by creating chimeric DNA molecules that encode a fusion protein comprised of a leader sequence fragment that provides for secretion of the CAV protein from the selected hoet cell. The adenovirus triparite leader ie an example of a leader sequence that provides for secretion of a foreign protein in mammalian cells [Birnstiel et el, Cell. ££:349 (1985); Proudfoot and Whitelaw, Termination and 31 end processing of eukaryotic RNA. In Transcription and splicing (ed. B.D.

Han·· and D.M. Glover) (1988); Proudfoot, Trends Biochem, Soi.. 1£:1O5 (1989)]. Preferably, there are processing sites encoded between ths leader fragnent and the foreign gene that oan bs cleaved either in vivo or In vitro.

Such leader sequence fragments are known to one of skill in the art for the various selected host cells described above.

The identification of the CAV polynucleotide sequences and polypeptide sequences and ths ultimate sequencing of the entire CAV sequence permit the development of suitable CAV-specific antibodies generated by standard methods. As diagnostic or research reagents, antibodies generated against these CAV sequences may be useful in affinity columns and the like to further purify cav proteins. The antibodies of the present invention may be utilized for In vivo and Xn vitro diagnostic purposes, such as by associating the antibodies with detectable labels or label systems. Alternatively these antibodies may be employed for Xn vivo and Xn vitro therapeutic purposes/ such as by association with certain toxic or therapeutic compounds or moieties known to those of skill in this art/ e.g., rioin.

Antibodies to peptides encoded by the CAV sequences, specifically to antigenic sites therein for use in the assays of this invention may include monoclonal and polyclonal antibodies, as well as ohimsrio antibodies or recombinant antibodies generated by known techniques, Additionally synthetically designed MAbs may bs mads by known genetic engineering techniques [W. D.

Huss et al, Science. 2££:1275-1281 (1989)] and employed in the methods described herein. For purposes of simplicity the term Mab(s) will bs used hereafter throughout this specification; however, it should be understood that certain polyclonal antibodies, particularly high titer polyclonal antibodies and recombinant antibodies, may alao be employed in place thereof, it ie generally deairabla for purposes of increased target specificity to utilise monoclonal antibodies (MAhs), both in the assays of this invention and ae potential therapeutic agents.

Preferably the present invention contemplates the development of a MAb to CAV, which dost not react with other human retroviruaee, e.g., HTLV II. In one embodiment, the antibody ie capable of identifying or binding to a CAV antigenic site encoded by an aboveidentified CAV DNA sequence. Such an antibody may be used in a screening test.

A MAh may be generated by the now well-known Kohler and Mileteln techniques end modifications thereof and directed to one or more antigenic sites on a CAV polypeptide. For example, an isolated CAV sequence, or a portion of the viral sequence encoding an antigenio site, which differs sufficiently from that of HTLV X and HTLV II and other viruses, may be presented as an antigen in conventional techniques for developing MAbs. A cell line secreting an antibody which reoognisee an epitope on CAV only, not on HTLV I or II or any other retrovirus, may then be identified for this use. Similarly, a cell line secreting an antibody which bindB much more strongly to a CAV epitope than to any epitope on another virus to enable the antibody to distinguish between the virus under suitable conditions may also he useful. One of akill in the art may generate any number of Mabe by using a CAV polypeptide Bequence ae an Immunogen and employing the teachings herein.

Antibodies specific for epitopes on CAV may also be used therapeutically as targeting agents to deliver virus-toxio or infected cell-toxic agents to infected cells. Instead of being associated with labels for diagnostic usee, a therapeutic agent employs the antibody linked to an agent or ligand capable of disabling the replicating mechanism of the virus or of destroying the virally-infected cell. Such agents, include, without limitation, ricin, diphtheria toxin or other known toxic agents. The identity of the toxic ligand does not limit the present invention. It ie expected that preferred antibodies to peptides encoded by CAV sequences may be screened for the ability to internalize into the infected cell and deliver the ligand io itself into the cell, as described in detail in Canadian Patent Application 2,016,830-7, published on November 16, 1990. This document is incorporated by reference for a description of a screening technique known to the art.

Both the antibodies and the probes of the present invention may be associated with conventional detectable labels. Detectable labels for attachment to the antibodies (or to the probes referred to above) useful in assays of this invention may also be easily selected by one skilled in the art of diagnostic assays.

Where more than one reagent of this invention, e.g. probe or antibody, is employed in a diagnostic method, the labels are desirably interactive to produce a detectable signal. Most desirably the label is detectable visually, e.g., colorimetrically. Detectable labels for attachment to reagents of this invention useful in the diagnostic assays of this invention may also be easily selected by one skilled in the art of diagnostic assays. Labels detectable visually are preferred for use in clinical applications due to the rapidity of the signal and its easy readability. For colorimetric detection, e variety of enzyme systems have been described in the art which will operate appropriately. Colorimetric enzyme systems include, e.g., horseradish peroxidase (HRP) or alkaline phosphatase (AP). other euch proximal enzyme systems are known to those of skill in the art, including hexokinase 3β in conjunction with glucose-β-phosphate dehydrogenase. Also, bioluminescence or chemiluminescence can be detected using, respectively, NAD oxidoreductaee with luciferaee and substrates NADH and FKN or peroxidase with luminol and substrate peroxide.

Other conventional label eyeterns that may be employed include fluorescent compounds, radioactive compounds or elements, or immunoelectrodee. These and other appropriate label systems ars known to those of skill in the art.

Similarly for diagnostic usee of the antibody, polynucleotide sequence and polypeptide sequence reagents of the present invention, a wide variety of known and conventional components may bs employed to immobilise the reagent, where desired. Such immobilising agents include conventional solid supports, such as microtitsr plates, plastic, cellulose stripe, beads, e.g., latex. Any composition known in the art which may be employed for immobilization of an antibody or nuoleio acid or peptide sequence may be similarly useful with the antibodies and sequences of the present invention, primarily for diagnostic uses, purification techniques and the like.

CAV polynucleotide sequences and polypeptides, ae well ae anti-CAV antibodies of the present invention may aleo be employed in an industrial method for the production of blood and blood products which are free of Infection by CAV. The ability to screen blood samples infected by cav enables producers and distributors of blood products, e.g, the American Red Cross, to identify and discard donated blood samples which are intended for use in transfusions or in the isolation of plasma, therapeutically useful blood proteins and blood cells.

If unscreened, the use of such blood and blood-derived products could contribute to the spread of CFIDS.

Thue, mother aspect of this invention is a method for preparing blood and blood producta free from infection with CAV by screening a blood product for the presence of CAV with a CAV polynucleotide or polypeptide probe, or complement thereof, oapable of Indicating the presence or abeenoe of CAV. An analogous method involves producing blood or blood products free of infection with CAV by screening s blood sample with anti-CAV antibodies, capable of indicating the presence or absence of CAV.

These CAV sequences and/or anti-CAV antibodies, optionally detectably labeled, may be employed in conventional assay formats substantially identical to those formats described herein for diagnostic purposes to identify blood samples containing CAV. For example, one soreeing method may employ all or a fragment of e CAV polynucleotide sequence or a complement thereof as a primer in a polymerase ohain reaction performed on a blood sample, wherein the amplification of said sequence indicates the presence of the etiologic agent of CFIDS.

Another screening step comprises employing all or a fragment of a CAV polynucleotide sequence ae a hybridization probe in a hybridization assay performed on a blood sample, wherein the hybridization of said sequence indicates the presence of the etiologic agent of CFIDS. still another screening step comprises contacting a blood sample with a CAV polypeptide or protein, wherein said peptide or protein represents an antigenic site capable of forming an antigen-antibody complex with any anti-CAV antibody in the sample. The use of such assays or modifications thereto are within the skill of the art given this disclosure.

A further aspect of the present invention is a in vitro cell culture containing a CAV polynucleotide sequence. Such a cell culture may be a mammalian cell, bacterial cell, yeast or insect cell infected with CAV.

Such a cell culture may be a recombinant host oell containing only selected CAV polynucleotide sequences, so that the virus is not capable of replication therein.

Also provided by this invention are hybridoma 5 cell lines generated by presenting s CAV polypeptide or a fragment thereof as an antigen to a selected mammal, followed by fusing cells of ths animal with certain cancer cells to Croats immortalized cell lines by known techniques. The methods employed to generate such cell lines and antibodies directed against all or portions of a human CAV protein or recombinant polypeptide of the present invention are also encompassed by this invention.

This invention also encompasses permissive cell lines infected with CAV and capable of producing infectious CAV progeny. As described in detail in Example 1, two human oell lines, a T cell lymphoblastoid and a B cell lymphoblastoid cell line, have been developed which produce infectious virus progeny Xn vitro. Another cell line, Human Macrophage Monocyte Cell Line U937, which is available from the ATCC has also been identified as supporting the growth of CAV. suoh cell lines when cultured under suitable conventional conditions are capable of generating large guantities of virus for further ressaroh and vaccina development use.

As still a further aspect of the invention, methods for confirming a suspected CFIDS diagnosis may now be based on the presence of such above-described CAV nucleotide sequences, polypeptide sequences and antibodies. The presence of CAV can be detected utilizing a variety of assays and Immunological techniques known in the art for detecting viruses, including detecting these viral proteins, nucleic acids, and antibodies directed against the virus. CAV polynucleotide fragments which are sufficiently lacking in homology with comparable gene sequences of other retrovirus·· may enable the identification of such nucleotide sequences (or peptides encoded thereby) in the body tissues and fluids of suspected CFIDS patients, confirming diagnosis of the infection.

The term body fluids as used herein ie defined ae including, without limitation, the following cell-containing materials* whole blood or fractions thereof, serum, urine, semen, vaginal secretions, saliva, tears, cerebrospinal fluid, and breast milk. Also included in this definition, for completeness, are selected human cell typee, including T cells and non-T cells. Preliminary data indicate that the presence of this virus may also be detected in granulocytes, eosinophils or basophils. This virus may also be detectable in muscle and ekin tieeue samples. While the following description of this invention refers to eerum samples end peripheral blood mononuclear cells (PBMC) as body fluids, the application of the methods and compositions of this invention are not limited to these particular fluids.

Preferred embodiments of diagnostic methods useful to detect the presence of CAV, however, utilize particularly the techniques of polymerase chain reaction [Saiki et al, Science. 212:487-491 (1988)] and hybridization assays (see, e.g., sambrook et al, Molecular cloning. A Laboratory Manual., cold spring Harbor Laboratories, Cold Spring Harbor, 2nd edition (1989)}. These documents are incorporated by reference herein for descriptions of PCR and assay techniques.

Particularly desirable hybridization assays include Southern blot and liquid hybridization, which are known in the art as rsprsssntsd by their descriptions in the latter reference.

The assay formats referred to above are preferably employed in the method of thia invention with a CAV polynucleotide sequence-derived PCR primer or hybridization probe according to thia invention.

One embodiment of a method of this invention involves the PCR technique as well as modifications thereof which are known to those of skill in ths art.

According to this embodiment, samples of selected patient body fluids are collected. The patients may be desirably selected for suoh diagnostic testing by having symptoms which are recognized to be associated with CFIDS, io although asymptomatic patients may also be tested, dna is extracted from ths selected body fluid, s.g., white blood cells. Techniques for preparing suoh extracts ere well-known in the art [See, for example, sambrook et al, cited above]. The sample DNA is used as a template end primers derived from CAV sequences are employed in the PCR technique.

As an example, it was originally observed that certain HTLV II gag gene sequences appeared to share a high degree of homology with several putative CAV polynucleotide sequences, ae described in Example 3.

Several deairable sequences which may bs ussful as PCR primers and hybridization probes are found within the nucleotide aequence spanning nucleotide /813 to /1214 of the HTLV II gag gene. These sequences were first used to amplify CAV sequences and isolate the virus from patient body fluids. For example, as illustrated in Fig. 1 below, an HTLV II gag sequence from nucleotide /1214 to /1187 may be useful as a preferred antisenae primer for PCR. Thia primer ie known ae g-2-1. An HTLV ll gag sequence from nucleotide /813 through /838 ls useful as a PCR gag sense primer. This primer ie called g-2-2. A sequence of HTLV II gag from nucleotide ιοβο through 1105 ie aleo useful ae a hybridization probe.

It should be noted that the nucleotide numbering of the HTLV II genomic sequence referred to «1 throughout this specification is identical to the numbering system published by K. shimotohno et al, cited above, for the complete proviral HTLV II genome. The nucleotide sequence of HTLV I referred to in the examples below is numbered according to M. Saiki st al, cited above. The latter two references are incorporated by reference herein ae sources of sequence Information known and available to one skilled in the art.

Primers or probes based on other retroviruses, 10 e.g., HTLV I-derived probes such as those identified in Fig. 1, or non-hybridixing HTLV II-derlved probes, or probes based on sequences of the known non-C type retroviruses, e.g., MPMV, may also be employed ss controls. For example, another diagnostic method involving PCR techniques may employ ths tRNA lysine primer binding sits 5* TGGCGCCCAACGTGGGGC 3' as a sense primer, and an MPMV-derived primer 5’ GCTACGGCAGCCATTACTTG 3* as an antisense" primer. A probe from an MPMV intervening region and having the 0 sequence 5 ’ GATACTTGTCCTTGGTTTCCCCA 3 ' may then be employed in hybridization.

Such a PCR reaction would also indicate MPMV infection of humans, but it is not presently believed that MPMV can infect humans. An alternative method step would be to perform a hybridization with another MPMV sequence which is not homologous to an CAV sequence under specific hybridization conditions to rule out MPMV infection. If CAV is present in the DNA isolated from the eample, the CAV polynucleotide sequences or fragments thereof, will be amplified, but not the control nucleotide sequences.

However, as above mentioned, use of HTLV II sequences or other retroviral sequences, e.g., MPMV, having some homology to CAV in diagnostic methods is less preferred because a separate method step would have to be employed to distinguish the isolated or identified virus in the body fluids of a suspected CFIDS patient from the other known retrovirus. Other HTLV II sequences different from the above-described HTLV II-derived probe and primer sequences may ba employed to rule out the presence of HTLV II infection. The method of the present invention employing PCR may be sequentially performed with htlv ii sequences and HTLV X sequences which do not produce amplified products using the patient's bample dna, for example, sequences from HTLV II tax which are not homologous with CAV nor detectable in CFIDS patients. These supplemental teats would eliminate the poeeibility of a co-infecting presence of these HTLV with CAV. cav primer sequences which are unique for CAV, and which do not bind to other viruses ere preferred in such assays. Such sequences can bs identified by a viral taxonomist.

Following PCR amplification, a Southern blot or other hybridisation technique may be employed, using a labeled cav polynucleotide-derived hybridisation probe. Probes which are lees desirable, ae referred to above, may contain a sequence homologous to a nucleotide sequence in th· HTLV II gas gene.

Hybridisation of the probe with the product of PCR amplification will occur in the presence of CAV nucleotide sequences in the body fluid. No hybridisation will occur in the absence of a CAV nucleic acid sequence which ie not significantly homologous to other reported retrovirus sequences in available databases. For a positive diagnosis, the hybridisation of the above sequence to the patient sample may desirably ba above about 901. The occurrence of hybridisation will indicate a confirmed diagnosis of CFIDS.

Another embodiment of e diagnostic method of the present invention to determine the presence of a CAV infection is in eltu hybridization to screen a patient sample for the presence of CAV RNA sequences. Ae described in more detail in Example 5 below, cells, typically pbmc, are isolated from a patient, if PBMC art the sample, the cells may be activated as described above. The cells era cultured under conventional condition· and examined for the expression oi mRNA of CAV.

Polynucleotide sequences of CAV, or sequences 10 complementary thereto may be used in this method. Probee for this hybridization technique may bs generated from transcription of CAV in a plasmid, as described in detail in Example 4, or by other methods, as described herein before. Ae described above for the hybridization and primer sequences, it is possible that some HTLV lids rived aaa gana nucleotide sequences may also prove useful in identifying this CAV viral mRNA according to thia embodiment of the present method.

Using high stringency conditions, labelled probes to the CAV sequences are used to probe the sample mRNA. Preferable high stringency conditions include an incubation temperature of 52°C. Conventional labels can also be employed in this embodiment, euoh as are described above. A presently preferred label is MS. The embodiment described in detail in Example 5 below employs HTLV Il-derivsd sequences. This lo ffjtu test may be combined with the other PCR and immunological tests to confirm the positive CFIDS result.

The CAV peptide fragments, as well as the PCR primers produced as described above, may also be employed in diagnostic assays which rely on protein immunogens as targets for sera recognition. For example, the invention provides a method of using CAV peptides of the invention as diagnostic agents useful for identifying CFIDS patients. In one assay format, the reactivity of CAV peptides to biological fluids or cells of CFIDS patients can be assayed by Western blot. The assay is preferably employed on patient sera, but may also be adapted to be performed on other appropriate fluids or cells, for example, macrophages or white blood cells. In the western blot technique, a CAV peptide, purified and separated by a preparative gel, is transferred to nitrocellulose and cut into multiple strips. The strips sre then probed with sera from CFIDS patients or controls. Binding of the CFIDS sera to the protein ie detected by incubation with an appropriately labelled antibody, e.g., an alkaline phosphatase tagged goat antihuman IgG followed by the enzyme substrate bcip/mbt.

Color development is stopped by washing the strip in water. Only sera of CFIDS patients would react with the peptide. Healthy humans would not react to the CAV peptide.

In another embodiment the present Invention also provides for determining the presence of cav by examining cell-containing body fluid samples from patients for evidence of exposure to CAV. A CAV peptide may be used in a diagnostic method to detect an antibody to CAV in the body fluids of a CFIDS patient. For example, CAV peptides of this invention may be used in an elisa based assay. A typical ELISA protocol would involve the adherence of antigen (e.g., CAV peptide) to the well of a tray. The serum to be tested is then added. If the serum contains antibody to the antigen, it will bind. Specificity of the reaction is determined by the antigen absorbed to the plate. Only sera from CFIDS patients would bind to the plate; sera from healthy patients would not bind.

Body fluids of CFIDS patients have shown reactivity with antigens of HTLV I by western blot.

Patient body fluid samples, e.g., serum samples or cerebrospinal fluid, can be isolated from patients suspected of having CFIDS. For example, these samples may bs used in protein immunoblots, typically called Western blots, with viral proteins of HTLV I and HTLV II.

Ths viral proteins which have been electrophoretically separated are exposed to sample body fluids.

Using conventional techniques known in the art, viral proteins which are immunoreactive or cross-reactive with antibodies in the samples are visualised as bands on a gel. As described below in Example 3, body fluid samples, e.g., blood or serum samples, from CFIDS patients contain antibodies which react with at least three protein bande on the blot which are the products of at least two HTLV genes, a&H and any. Moreover, the majority of CFIDS patients have serum antibodies to a P27 protein on the HTLV-I Western blot. P27 ie presumably a product of the tax gene.

PBMC can be activated according to means known in the art auch a phytohemagglutinin, phorbol myristic acid, concanavalin A and 0KT3 MAb. Using standard immunological tests, preferably well-known immunohistochemical tests, ths presence of an antigen which reacts with a prsferred antibody can be determined. One such suitable antibody is K-l (available from Dr.

Fulvia Veronese) [E. DeFreitas et al, AIDS Research and Human Retroviruses, supra]. This K-l monoclonal antibody is capable of reacting with both HTLV I and HTLV II gafl gene products.

If the patient's PBMC or other cell type has an antigen which is recognized by an antibody (which is itself known to reoognize gag cf HTLV I and II), indicating ths possible presenoe of CAV, further tests employing CAV sequences or antibodies specific for an epitope encoded by those sequences, can be performed to eliminate the possibility that ths antigen ie the gag 4« gene of HTLV I or HTLV II. For example, to eliminate the presence of HTLV I ae the source of the antibody response, a MAb which ie specifio for HTLV I gag protein and does not oroee-react with HTLV iz gag may be used in this method. A suitable antibody is 13B12 [See, e.g., T. J. PalXer et el, J, Immunol.. £££:2393-2397 (19B6)].

This antibody ie used to test body fluids, e.g., PBMC, of patients whose sera contains antibodies reactive with at least three HTLV proteins on immunoblots.

Viral proteins in ths cells from body fluids of patients who ars infected with HTLV I will immunoreaot with such specific antibody. In contrast, CFIDS patients who are infected with cav, do not provide PBMC which immunoreact with an HTLV I specific antibody. This same type of eliminating step may be employed in the method of this invention with an antibody capable of recognizing an epitope on HTLV II, which epitope is not present on HTLV I or cav. Although such an antibody ie not presently available, the development of a suitable antibody, preferably a MAb, ls contemplated by this invention and may be employed in the method.

Yet another assay format which may employ the reagents of this Invention and bs ussful in ths diagnosis of CFIDS is a particle agglutination (PA) assay, of which there currently exist three (3) specific types. These assays are used for the qualitative detection of antibodies to various antigens when coated to a support. Thus sequences of the invention containing antigenic sites of CAV may be coated to a support. Alternatively antibodies to cav antigenic sites may be coated to a support. In the former situation, the sample ie tested for the existence of antibodies to the cav antigen. In the latter situation, the clinioal sample ie tested for the existence of antigen capable of binding to the anti35 CAV antibody. The following diecussion refers to the former situation. However, one of skill in the art could similarly prepare the assay so that the antibody is immobilized on the support and the existence of the antigen in the sample is detected.

The first and original assay is the hemagglutination assay using red blood cell· (RBCs). In the hemagglutination assay, RBCs are sensitized by passively adsorbing antigen (or antibody) to the RBC. To perform the assay, sensitized RBCe are placed in a 9610 well microtiter plate, λ small quantity of serum diluent is added to each well, followed by test and control serum in designated wells. When test serum from a patient ie added to a well, if epecifio antigen antibodies are present in the serum, the antigen-antibody interaction will oauee the RBCs coated with the purified antigen to agglutinate, interpretation of the results oan be done with the naked eye. λ negative result ie scored when no reaction occurs between the antigen coated RBC end the added eerum sample, ae visually observed in the 96-well plate by a solid round dot formed by gravity. A positive result is indicated by a somewhat spread out pattern aa the antibody interacts with the antigen coated RBC and binds to one or more antigen coated RBC, thus holding the RBCe at a distance from each other. A strong positive result occurs when there is very strong reactivity and a clear visual pattern of clumps or agglutination is observed.

To eliminate potential non-specific reactions, which can occur with sensitized RBCe, two artificial 0 carriers have been developed. The most common of these are latex particles which ere available in a variety of sizes and colors, however, they are usually white. The newest technology utilizes a gelatin agglutination method, exemplified in the Serodia-HlV kit for the detection of HIV antibody [Fujirebio Inc.]. The principles Involved with both of these artificial carriers are based on passive agglutination utilising as carriers either the latex or gelatin particles which are coated with purified antigens. Ths actual assay is run and soored in a similar manner as described above in the RBC based assay.

In a comparison test performed by Kobayashi et al., Clin, virology. 14:454-458 (1986), the gelatin agglutination method was tested along side an immunofluorescence (IF) assay and a commercially available ELISA. The gelatin agglutination test showed excellent reproducibility in a single assay and good correlation with the IF and ELISA tests having fairly few discrepancies in results. The gelatin agglutination reBUlte were eohieved without any special instruments or equipment, and a definitive result was obtained in two hours.

In etill another aspect, the invention provides s diagnostic method for detecting CAV in a patient sample by a conventional reveres transcriptase eeeey ae described in Example 10 below. This essay may bs performed on body fluids of e suspected CFIDS patient, using e polyriboadenylets templets primer end the divalent cation Mn+*. No other known human retrovirus employs this primer or cation in this assay.

The methods, probes, primers end antibodies described herein may be efficiently utilized in ths assembly of a diagnostic kit, which may bs used by health cars providers for the diegnoeie and/or treatment of CFIDS. such e diagnostic kit contains the components necessary to practice one or more of the eeseye described above for the detection of the CAV nucleic aoid in body eample of suspected CFIDS patients. Thus, for example, such a kit may contain primer sequences as described above comprising a CAV sequence or fragments thereof, or sequence· of other retroviruses, e.g., MPMV, for performing PCR on sample body fluids, λ kit may also contain the hybridization probe sequences described above for the performance of a southern blot, liquid hybridization or other hybridization technique. Further components of the diagnostic kit of this invention may include nucleotide sequences of other retrovirus genes (HTLV I and II, and MPMV) for use in eliminating the possibility of the presence of those specific viruses.

Still additional components to a diagnostic kit contemplated by the present invention include cav polypeptides, antibodies specific for an epitope of CAV, antibodies tc HTLV I and HTLV II gag, or antibodies specific for other retroviruses which do not bind to CAV epitopee.

Other conventional diagnostic kit reagents such as positive and negative controls, vials and labelling systems for the hybridization assays may also be included, as well ae the enzymes and other reagents necessary for the performance of the PCR technique.

Where the detectable label present in the kit is designed for non-visual detection, e.g., for radioimmunoassay, the standard components necessary for this assay (controls, standards and the like) are included in the kit.

Another aspect of the present invention involves the detection and isolation of the complete CAV. According to this aspect, an amplified and isolated nucleotide sequence of CAV obtained by the PCR technique as above described is itself employed in the design of additional primers. Example 4 reports the sequencing of a putative CAV fragment which was obtained using primers g-2-1 and g-2-2, identified above. Previously identified CAV viral fragments may bs used as primera or probes to obtain and identify additional sequence of CAV. so These primers are used to isolate larger portions of the viral sequence using the inverse pcr technique, such ae described in 0. Ohara at al, Prcc, Natl Acad, Sci., USA. fl£:5673-5677 (1989) and H. Ochman at al, Genetics. 120:621-623 (1988). Employing such techniques which ere known and routine to one of skill in the art provided with a substantially isolated virus permits the isolation and charaoterisation of the entire nucleic acid sequence of CAV. io In another aspect the present Invention provides a vaccina composition comprising an effective amount of a non-infectiva CAV DNA or peptide sequence which ie capable of eliciting a T cell or B cell response from the host's immune system to CAV infection. This vaccine may alao include all or a portion of a CAV DNA eequenoe or peptides referred to herein. It ie expected that at least one of the CAV polypeptide saquanoae (or fragments thereof) may provida either an antigenic or immunogenio peptide. These peptides, once identified, may be used as vaccina components.

One exemplary system for generating a vaccina is described in European patent application No. 290,246 wherein a peptide encoded by the cav DNA eequenoe may ba substituted for the peptide in a vaccina composition employing fatty acids, liposomes, and adjuvants. Other vaccine constructs are known to those of skill in the art, end may be prepared using a peptide of CAV to generate a CFIDS vaccina. The above published European patent application ie incorporated herein by reference for disclosure of an exemplary vaccina composition.

Another vaooinal agent of the present invention is an antl-eense RNA sequence generated to a CAV nucleic acid eequenoe. This sequence may easily ba generated synthetically by one of skill in the art. Such an anti35 sansa RNA asquanca upon administration to an infected patient should ba capable of binding to the RNA of the virus, thereby preventing viral replication in the cell. An alternative vaccine agent includes s synthetic peptide generated to the envelope protein of the virue. These peptides can ba easily developed ones the entire CAV ie sequenced. An additional concept for vaccine development once the virus is completely sequenced includes preparing synthetic peptides which are capable of binding to the host cell'a recaptor for CAV.

Therefore, also included in the invention ie a method of vaccinating humane against infection with CAV by administering an effective amount of a vaccine of this invention to a selected patient. The vaccine preparations including one or more of the peptidea deeoribed herein are administered in a auitable dose.

The vaccine may be administered parenterally or by other conventional means.

The preparation of a pharmaceutically acceptable vaccine, having due regard to pH, iaotonicity, stability and ths like, is within the skill of the art. conventional adjuvants may also be employed in the vaccine composition, e.g., aluminum hydroxide gel. The dosage amount and regimen involved in a method for vaccination will be determined considering various hosts and environmental factors, e.g. the age of the patient, time of administration and ths geographical location and environment.

The following examples illustrative various aspects of ths present invention. Example 1 describe· permissive cell cultures producing CAV and the morphometric analyaia of CAV in infected cells. Example 2 describes a double-blind screen of antibody to purified HTLV I by Western immunoblct. Example 3 describes detection of retroviral DNA in PBMC of CFIDS patients by PCR using HTLV I and II derived primer sequences.

Example 4 describee the purification and sequencing techniques used to obtain a putative partial viral sequence from a CFIDS patient's amplified DNA. Example 5 describee the detection by in aitu hybridization of cellular RNA related to HTLV 1 and IX in aotivated PBMC from CFIDS patients. Example 6 describee the detection in activated PBMC from certain CFIDS patients of an expressed HTLV-specific oaq protein in vitro as detected by a MAb and immunohistochemical staining. Example 7 describes the determination of the CAV tRNA RBS. Example 8 describee characteristic gag proteins of cav, and Example 9 indicates the nuclear location of gig proteins of CAV. Example 10 describes a reveres transcriptase assay, shoving that CAV has the characteristics of a nonC type retrovirus.

For performance of these experiments, patient body fluid samples were obtained from clinical practices in North Carolina and New York. The investigators were all blinded by coded samples in each experiment.

Example 1 - Morphometric Analysis of CFIDS Retrovirus Both H-9 lymphoblastoid T cells (obtained from ths American Type Culture Collection, Rockville, Maryland) and B-Jab lymphoblastoid B cells (obtained from William Hall, M.D., Ph.D. of Cornell University) were cocultured for 21 days at 37*0 in 5% COj/95% air in RPMI 1640 medium with 10% fetal calf serum with leukocytes of cfids patients.

The cultures vers examined by transmission electron microscopy after the oella were fixed. Viral particles were visualized in both types of cocultures. Electron-dense circular virions, some with electronluecent corse and others with electron-denee corse, were seen associated with the rough endoplasmic reticulum and inside large abnormally distended mitochondria inside the cells. All particles wars the same ehape and sice, 46-50 na (460-500A). No extracellular virus vas observed. No forms budding from the cytoplasmic membranes vers observed.

These observations establish CAV aa a non-Ctypa animal retrovirus for three reasonst First, human C-type viruses like HTLV 1 and HTLV II do not form intracellular virions. Ths only human C-typs forming intracellular particles is HIV and these ere only found io intracisternally in conjunction with budding forme. circular C-type virions are usually formed es the virus buds from the cell's cytoplasmic membrane. Second, neither HTLV I, II, nor Hiv virions have ever been found ineide mitochondria. Third, the diameter end morphology of these virions suggest that they may be primate D-type retroviruses or Spume viruses.

Example 2 ?. western Blflt Transfers Proteins of HTLV I from sueross-banded purified virue ere separated by polyacrylamide gel electrophoresis. After electrophoretic separation, proteins ere transferred to nitrocellulose paper in a Transblot electrophoresis cell [BioRad Laboratories] at 60 volts, 0.25 amps for 4 hours following manufacturer's instructions. The nitrocellulose sheet is cut in stripe, washed to saturate free binding sites with blocking buffer containing 20mM Tris, 500 mM NaCl (pH 7.5) and 3% gelatin. The sheet is reacted overnight at 4*C with anti-virus antibody (13B12) or patient sera or CSF.

After thorough washing with 20 mM Tris, 500 mM NaCl, and 0.05% Tween-20 (TBS), strips are reacted with conjugate (peroxidase-labeled goat anti-mouse or antihuman IgG) for 1 hour at room temperature. Strips are washed again and developed for 10-15 minutes with freshly prepared solution containing 1 part of 4 ohloro-iIE 913042 naphthol in methanol (0.3%), 5 parte of loo mM Trie (pH7.6) and HjOj to final concentration 1:3000. This system can detect less than 100 ng specific proteins, strips with molecular weight markers are used to determine molecular weights of viral protein.

Table III below reports ths detection of serum antibodies to HTLV I by this Western Immunoblot in adult CFIDS patients. Positive results occurred in 41% (15/37) of CFIDS patients. Control sera was positive in only 6% (1/16) of individuals. Positivity was determined using ths American Red Cross criteria of antibody reactivity for at least two viral gens products. Ths one positive healthy control was ths only non-Caucasian in this study. ΚϊιΠ^ΓΒ^^Η···· Poftltiva Neqatlva CFIDS patients (37 individuals) 15* 22 Healthy 6 other diseases (16 individuals) 1 15 ♦Significant at P £.001. Example 3 - CAV Retroviral Sequences Detected .lh fiflBS Patients bv Polymerase Chain Reaction Detection of CAV retroviral DNA in PBMC of CFIDS patients wae performed by polymerase chain reaction using htlv I- and ii- derived primer sequences. htlv i tax region (7575-7701 bp) and other regions (HTLV I gag, HTLV II gag and HTLV II to) vers amplified from ths blood of CFIDS patients. The sequences of these primers and probes are reported below in Fig. 1. DNA from HTLV I-infected white blood cells from TSP patient number 13-4 was used ss positive control. DNA from one HTLV II human T cell line Mo-T and from a retroviral-negative cell line U937 (both available from ths American Type Culture collection, Rockville, Maryland, USA) were employed ae negative control·.

DMA was extracted from cell line· by SDS/Proteinase-K digestion of cells followed by phenol5 chloroform and ethanol precipitation. DMA concentrations were estimated using the Warburg equation [Warburg, D 6 christiemy, w., Biochem 2 310:384 (1942)] by measuring the absorbance at 280 and 280 nm corrected for the background at 320 nm. Two micrograms of DNA were amplified in 30 repetitive three step cycles, 1 minute incubation at 95’C, 1 minute incubation at 55'C and 2 minute Incubation at 72*c. All amplifications were carried out in a Perkin-Elmer Cetus Thermal Cycler. The 100 μΐ of PCR reaction mixture contained 2 >tg of sample DNA, 278 μΜ each dATP, dCTP, dGTP, dTTP, 0.8 μΜ of each primer 10 mM Tris (pH 8.3), 50 mM KC1, 1.5 mM MgCl}, 0.01% (w/v) gelatin and 2.5 units of Thsrmus Aquaticue polymerase (Taq) enzyme [Perkin Elmer, cetus].

The reaction mixture was overlayed with mineral oil to prevent evaporation and was denatured at 94*C for 7 minutes before the Taq polymerase was added. Primer pairs were nucleotide #7575-7696(+), nucleotide #77017680, and analyzed with nucleotide #7682-7677 oligonucleotide probe (see Fig. 1).

Amplified DNA was analyzed by electrophoresis on 1.2% agarose gel and transferred to Nytran nylon membrane [868 Nytran] by blotting. The filter was soaked with 2xSSC for 5 minutes at room temperature, and baked at 80*C for 2 hours under vacuum. The prehybridisation buffer consists of 6XSSC, 1.0% SDS, 50% formamide, 5X Denhardt's solution and 150 μο/ml herring sperm DNA. The filter was prehybridized overnight at 37'C and then hybridized overnight with 12x10*cpm of nP-labelled oligo probe In prehybridization buffer. Filters were then washed with: 1) 2XSSC and 0.1% SDS (two times for 20 minutes et room temperature), 2) 0.2XSSC and 0.1% SDS (20 minutes at room temperature), end 3) 0.1XSSC and o.l% SDS (30 minutes at 37®C) and autoradiographed for 5-7 days.

The results of the same PCR analyses of blood 5 samples from adult CFIDS patients was compared with person· with whom they live or closely associate, e.g., roommates and friends (called Exposure Controls). Nonexposure controls are healthy persons selected et random who have not come into contact with CFIDS patients nor experienced symptoms associated with CFIDS. Viral controls included the human cell lines Mo-T (HTLV IIinfeoted) and KT-2 (HTLV l-infeoted). Both cell line· are available from ATCC. Theee results are reported in Table IV below. Similar PCR analyses were performed on pediatric CFIDS patients as reported in Table V below.

The retroviral DNA was also detected with southern blotting using labeled oligonucleotide·.

This data demonstrate· that retroviral sequences related to HTLV II gag, but not HTLV Z g&g or tax, were detected in the CFIDS patients. Additionally the positive results seen in the Exposure control· support the possibility that this CAV is capable of casual transmission to non-infected persons, as ie the case with many non-human retroviruses. The·· data also indicate that presence of HTLV II ggg sequences does not identify only symptomatic individuals.

Tabla IV SanDles Primers and labeled Oligonucleotides HTLV 1 HTLV II HTLV II Weetern Patient* oao aaa tax aiat 5 PCI 0 + 0 + PC4 0 0 0 PC5 0 + 0 + PC7 0 + 0 + PC9 0 0 0 + 10 PC11 0 + 0 0 PC12 0 + 0 0 PCI 3 0 0 0 0 PC14 0 + 0 0 PC15 0 + 0 0 15 PC18 0 0 + Ratio positive 0/11 ¢/11 (828) 0/11 5/ii (36*) Exposure control! PC2 0 0 0 0 20 PC3 0 + 0 + PC6 0 0 0 0 PC10 0 + 0 + PC16 0 0 0 0 PC20 0 + + 0 25 PC21 0 + 0 0 PC22 0 + 0 + PC23 0 0 0 0 PC24 0 0 0 0 PC25 0 0 0 + 30 PC26 0 * 0 0 PC27 0 0 0 0 PC28 0 0 0 0 Ratio positive 0/14 6/14 (438) 1/14 (7%) 4/14 (28*) 35 Non-axpoflura.control» 0/10 0/10 0/10 0/10 Viral. control· MT-2 + 0 0 Mo-T 0 + + XAblUE Samples Primers and labeled Qllgonuclaotidea HTLV 1 Pitlanta aaa 4-4 0 4-4(2) 0 3-4 0 -4 0 13-15 0 -18 0 8-16 0 1-16 0 13-2 0 13-2(2) 0 9-2 0 -2 0 2-2 0 1-16 0 -18 0 19-4 0 12-2 0 -2 0 -10 0 HTLV II gag HTLV II tax Western Blot ♦ 0 4- + 0 4- 0 0 t ♦ 0 4- 0 0 0 + 0 4- + 0 4- + 0 + 4- 0 0 4- 0 0 4- 0 4- 0 0 0 4- 0 4- 4- 0 4- 4- 0 4- 4- 0 4- 4- 0 0 0 0 0 0 0 0 14/Π (74%) Qfi9 11/1$ (58%) Ratio positive b/19 Exposure controls 11- B 0 3-6 0 13-3 0 1-12 0 13-2(3) 0 9-23 0 12- 23 0 _ Ratio positive 0/7 Non-expoBure controls 40 0/10 Viral controls 0 0 4- 0 0 0 0 0 0 4- 0 4- 0 0 0 + 0 0 0 0 4· 2/7 (29%) 0/7 3/7 (43%) 0/10 0/10 0/10 MT-2 MO-T 4· + Example 4 - DNA Purification and Sequencing A putative, partial viral DNA sequence was obtained by the procedure described below from CFIDS patient NY1-12 using the HTLV II gag specific primers g5 2-1 and g-2-2.

DNA purification is performed upon the PCR amplified DNA obtained as described above in Example 3 using ths Gens clean kit [Bio 101, La Jolla, CA] with minor modifications, as described below. The PCR amplified DNA is run in 3¾ Nusieve [FMC, Rockland, me) agarose mini-gel in ixTAE buffer. Using long wavs ultraviolet light, ths band is visualized and excised. The excised band ia then placed in a pre-weighed 1.5 mL tube and the weight of the agarose determined.

The liquid contents of the 7 mL sorewcap tube from the Gene Clean kit are added to 140 mL distilled, deionized (dd) water and mixed with 155 mL of 100% EtOH to ensure that ths watsr content of the solution is lass than 50%. This solution can be stored in a freezer at -20’C between uses.

When ready to ba used, 2¼ - 3 volumes of Nal stock (6M) solution is added to ths agarose and the mixture ia incubated at 45’C - 55’C for 5 minutaa to dissolve the agarose, with mixing after 2 minutes.

Glassmilk suspension (5 ^L) is added end the mixture is placed on ice for 5 minutes, with mixing every 1-2 minutes to keep the glassmilk suspended. Ths silica matrix with the bound DNA is pelleted by microfuging for 5 seconds. Ths Nal supernatant is than transferred to another tubs, if any undissolvsd agarose remains, ths pellet may bs rewashed with Nal. Ths pellet is then washed 3 times with ice cold NaCl/EtOH/HjO (NEW) (10-50 volumes or 200-700 μί). Ths pellet ie resuspended by pipetting back and forth while digging with the pipet tip. After the aupernatant from the third wash has been removed, the pellet is suspended again and the lest of the wash removed with a fine tipped pipette.

The washed, white pellet is then resuspended with the buffer Tris-EDTA (TE) (water or a low salt buffer can be substituted) about equal to the volume of the pellet (usually approximately 7 pi). The mixture is incubated at 44-55*C for 2-3 minutes and centrifuged for 30 seconds to obtain a firm pellet. The supernatant containing the DNA is then removed end steps of resuspending with TE, incubating, centrifuging and removing the eupernetant are repeated.

To obtain the annealing template and primer for the sequencing reaction, 1 pi of primer (20 ng/pl) end 8 pi of gene aleaned DNA, obtained ee described above, are IS combined in a centrifuge tube, boiled for 3 minutes and snap chilled in ios water for 60 seconds. 1 pi of 10X reaction buffer ie then added to the combined primer and DNA, mixed by flicking and allowed to stand at room temperature for 10 minutes.

In a 96 well plate with columns labelled G, A, T or C, add 2.8 pi of ths dd GTP termination mix in ths well labelled O. similar amounts of ATP, TTP, and CTP, respectively ars added to ths wells labelled A, T, and c, respectively. Ths plats is then pre-warmed to 37*c for at least one minute.

Labelling mixture is diluted to a concentration of 1:50 and seguenase is diluted to a concentration of i:8 in ice cold 1XTE. The following ingredients: 1 pi alpha MP-ATP, 2 pi of ths 1:50 dilution of labelling mixture, l pi of 0.1 M DTT, and 2 pi of 1:8 dilution of sequenase are added to the annealed template primer and buffer mixture, mixed well end incubated at room temperature for 5 minutes to complete the labeling reaction. when the labelling reaction 1· complete, 3.5 pi of the reaction mixture ie aliquoted to each of the wells labelled [β, Α, T, C], using separate tips. The incubations ars continued for a total of 3-5 minutes, up to a maximum of 30 minutes. Ths reaction is then stopped by adding 6 pi of 10 mM EDTA and may bs stored for 1-2 days (MP) or l week (Μβ) at -20*C.

On the 96 well lid, 1.5 pi of the reaction is mixed with 2 pL of formamide dyes. The lid is then incubated in en oven on a water bath at 80*0, snap chilled on ice water, and 6% acrylamide gel is loaded.

Using Ο.βχΤΒΕ es ths running buffer, the gel ie run for en hour prior to uee in order to heat it up to 50*c. Thia ie accomplished by running at 90W constant power (voltage limit * 2900 V, current limit - 50 mA).

Samples ars loaded sequentially at 0, 2 and 4.5 hours and run at 90 W constant power. After the last loading, the gel is run for another 90 minutes (total run time - 6 hours) end the gel apparatus is laid flat down on ths bench with the front (shorter) glass plate down. The back glaee plats is removed and a sheet of Whatman 1*1 paper ie laid on the gel and is wetted by spraying with dietilled H,O. The filter paper with gel attached is removed, covered with Saren Wrap and used to expose Kodak xar film. Exposure is carried out et -70*C for 12-72 hours as appropriate. The autoradiograph can then be reed.

Fig. 2 illustrates the partial viral DNA sequences obtained. Upon analysis on GenBank and EMBL, ths CAV sequences of Fig. 2 have not been found to be significantly similar to the sequences of any known retrovirus. Thus, these sequences do not permit ths identification of CAV as any other known human or animal virue.

The sequence· of Fig. 2 do, however, share some significant homology with a small portion of HTLV II SUJI gene sequences, which were originally employed to amplify the virus from patient body tissues and fluids, using the polymerase chain reaction (81.5% homologous). Because these nucleotide fragments are lees than 82% homologous with comparable aaa gene sequences of other retroviruses, the identification of euoh nucleotide sequences (or peptides encoded thereby) in the body tissues and fluids cf suspected CFIDS patients, can confirm diagnosis of the infection. The entire sequences (SEQ. A & 8EQ. B) of Fig. 2 are presently preferred for use in obtaining the PCR primers or hybridization probes aooording to this invention.

A CAV peptide may be encoded by all or a fragment of a DNA sequence of Fig. 2. It ie anticipated that a nucleotide sequence of Fig. 2 ie, in pert, e coding sequence for peptides end proteins of CAV. The six putative CAV peptide sequences are determined by translating the nucleotide sequences of Fig. 2 into three reading frames for each sequence, beginning with the 5' nucleotide number 1, 2 or 3, respectively, of SEQ. A and SEQ. B of Fig. 1. in Fig. 3, an asterisk represents a putative stop codon. It ie possible that single base errors in reading the nucleotide sequences of Fig. 2 may indicate STOP codons where a codon for a native amino aoid should be encoded. Therefore, CAV peptide sequences may comprise fragments of the following encoded sequences which occur between stop codons, as well as smaller fragments thereof.

It ie expected that at least one of the peptide sequences (or fragments thereof) encoded by a nucleotide sequence of Fig. 2 may provide either an antigenic or immunogenic peptide. Theee peptides reported in Fig. 3 as vail aa other peptides identified by the complete sequencing of CAV may be used as vaccine components.

Example. S - In Situ ttvbrldintlpa viral RNA related to HTLV I and II vas identified by in situ hybridization in activated PBMC from CFIDS patients, but not controls, as follows.

Freshly isolated PBMC were cultured in cluster plates [Costar] in RPMI 1640 with 10% fetal calf serum (res) containing an optimal mitogenic concentration of purified OKT3 MAb [Ortho] and 10 U/ml recombinant IL2 for 3 days. Cell concentrations were adjusted to 2X10* ml-1 in complete growth media with 50 ng/ml recombinant IL2 [Sandoz, Vienna, Austria] for 7 days then spun onto glaee elides fixed with paraformaldehyde, and stored in 100% ethanol.

In situ hybridization wae carried out using **Slabelled RNA probe specific for the 5’ region (sas) of HTLV I and II. The eizee of transcribed labelled riboprobes were 506 bp for HTLV I and 400 bp for HTLV II.

Probes were hybridized at 1-2X10* d.p.m. ml'1 at a temperature of 52’C and autoradiographed for 4-S days.

All cells lines were hybridized using the earns conditions in the same laboratory, and cells were examined using a double-blind code.

Table VI provides the data on the detection of retroviral RNA in adult CFIDS patients and in exposure controls by this in situ hybridization with ths HTLV I gaa probe and HTLV II g|g probe.

Table VI Detection of Retroviral gag mRNA by in altu Hybridization of Activated PBMC from Adult CFIDS* CFIDS Patients PCI PC4 PCS PC7 PC9 PC11 PC12 PCI 3 PC14 PC15 PC18 Ratio positive gxpoBurt contrail HTLV I aaa +1 +1 +2 3/11 - 27¾ HTLV II aaa +1 o +1 +1 +2 +2 +2 S/li - 55% HIV aaa o o o o o o o o o o o PC2 PC3 PC6 PC10 PCI 6 +1 Ratio positive Ϊ/5 » 20% Virus controli MT-2 cells (HTLV I) +4 Mo-T cells (HTLV II) 0 HIV-infected K9 cella 0 +4 +4 ♦Scale used to ecore samplest 4+ - 100-50% positive cells; 3+ - 50-1% positive cells; 2+ - 1-0.1-% positive cells; 1+ - ΙΟ.01% positive cells; 0 - < 0.01% positive cells.

HTLV mRNA-poaitiv· cells wars detected In 45% of adult CFIDS patients tested when the HTLV II gag probe was used, only one of five exposure controls contained these infected cells. PBMC from two of eleven CFIDS patients also contained RNA that reacted with HTLV I gag probs while none of five controls did. These data show that PBMC from a proportion of CFIDS patients ars actively transcribing viral gaa mRNA la vitro. This RNA appears to be more homologous to HTLV ii g&g in most patients but also shows homology to HTLV I gig in several patients. Control cells infected with prototypic HTLV I (MT-2) or prototypic HTLV II (Mo-T) show no such gig mRNA croes-reactivity. This indicates that this CAV ie not HTLV I or HTLV II.

Example 6 - Detection of HTLV can Protein vie Antibody To detect the CAV nucleotide sequence in the PBMC of euepeoted cfids patients using antibody, the method described in DeFreitae et al, cited above, was performed.

Cytoepun cells were air dried for 2 hours end fixed with cold acetone for 10 minutes. They were then Incubated for 30 minutes with 20 pi of optimally diluted ascites containing MAbs to HTLV I p24 [from Dr. Fulvia Veronese, Litton Bionstics, Bethesda, MD], HTLV II p24, or HIV pl5 protein [from Thomas Palker, Duke University, Durham, NC). in addition, MAb to HIV p24 was supplied by Dr. Micah Popovic, NCI, Bethesda, MD. Positive control cello included MT2, Mo-T2, and H9-T cells infected with HTLV I, HTLV II, and HIV respectively. Cells wars labelled with immune complexes of alkaline-phosphatase and antialkaline phosphatase (APAAP) according to the method of J. Cordell et al, J. Hlstochem. Cvtochem.. 12:219-225 (1994) using reagents obtained from Dako, Banta Barbara, «6 CA. Uninfected H9 cell· and cerebrospinal fluid-derived T cell lines from healthy donors served as the negative cell controls. Tests for nonspecific binding of the second antibody and the APAAP complex were included.

Tables VII and VIII report the results of this assay.

ZABLE VII Expression of Protein Related to HTLVaaa In Activated PBMC from Adult CFIDS Patient· bv Imfflunohifltochamlstrv* £BMC iron Presence of gaa protein-positive calls 5 HTLV I and II HTLV I grips 1X1 MAb) (11B12 MAb) PCI 0 0 PC4 +1 0 PCS 0 0 10 PC7 +1 0 PC9 0 0 PC11 +1 0 PC12 +1 0 PC13 0 0 15 PCI 4 0 0 PC15 BgpQBurs contola 0 0 PCS 0 0 PC3 +1 0 20 PC6 0 0 PC10 +1 0 PCI 6 0 0 Hon-expaaurs controls Viral controls 25 MT-2 (HTLV I) +4 +4 Mo-T (HTLV II) +4 0 «Scale used to score samples: 4+ 100-50% positive cells; i+ 1-0.01% positive cells; 0 = < 0.01% positive cells.

TABU. VIII Expression of Protein Related to HTLV aaa In Activated PBMC from Pediatric CFIDS Patients by Immunohistochemistry* PBMC from Presenoe of gag protein-positive cells 5 HTLV I and II HTLV I CFIDS (K1 Mftb)- <13813 MAb) 4-4 +1 0 4-4(2) 0 0 10-4 0 0 10 13-16 0 0 5-16 0 0 2-2 0 0 1-16 0 0 10-18 +1 0 15 12-12 ExpggyM controls +1 0 9-23 0 0 18-23(2) 0 0 18-23 0 0 20 2-23 0 0 2-2(2) Viral controls 0 0 MT-2 (HTLV I) +4 +4 MO-T (HTLV II) +4 0 «Seals used to score samples: 4* 100-50% positive cells; 1+ - 1-0.01% positive cells; o - < 0.01% positive cells.

«» An HTLV-specific aaa protein wae detected at low frequency in inactivated PMBC from CFIDS patients by a MAb Kl specific for the g&g region of HTLV I and II using immunohistochemical staining. The MAb specific for HTLV I aAfl (13B12) did not react with any cells from CFIDS patients. This demonstrates that a viral gene product ia expressed in at leaat a subpopulation of CFIDS patisnts and that this protein is not htlv X encoded.

Examplt. 7..-.ΛΒΝΑ Primer Binding Site 10 Two primers were designed for use in the pcr technique: the sense primer wae the DNA sequence of tRNA site for proline (/766-783) while the antisense wee the HTLV II gag region bases (/1187-1214). Products generated from cell lines MT-2 (HTLV I), Mo-T (HTLV II), and mors than 20 cfids patisnts were probed by Southern blot hybridization with radiolabeled 18-mer probe which oorresponded to a DNA sequence intervening the two primers for both viruses.

Ths results showed that while MT-2 and Mo-T DNA were amplified via the tRNA binding site for proline, all CAV DNA samples were negative. Thue, CAV cannot be a known human c-type virus (except for HIV).

When the same experiment wae performed using the tRNA primer binding site for lysine ae the sense primer strand for PCR (5' tggcgcccaacgtggggc 3') and the antisense strand primer wae derived from a prototypic monkey D type retrovirus (MPMV) (5' GCTACGGCAGCCATTACTTG 3'), the primers amplified two different sized products from MPMV-infected cells which were visible when probed with an intervening oligonucleotide derived from MPMV (GATACTTGTCCTTGGTTTCCGCA). The products were 360 bp and 250 bp. Ten of ten CFXD8 patient DNA sample· amplified and probed using this system showed the same sized products.

Thus, the CFIDS retrovirus, CAV, has a primer binding site for the tRNA of lysine. This result shows that CAV is not HTLV I or II and suggests that it is either a type of lentivirus, primate D-type retrovirus, or Foamy (spuma) virus, all of which uae a tRNA lyeine primer.

Example 8 - Characterization of gag Proteins of CAV Peripheral blood leukocytes were activated in culture with OXT3 Mab [Ortho Pharmaceuticals] and recombinant IL-2 for five days. After replacing complete media with cysteine- and methionine-free media on day six, cells were labeled with HS-methionine and cysteine for 16-18 hours. After disruption of cells, labeled proteins containing gag antigenic determinants were precipitated with mouse Mab Xl which reaote with gag proteins of HTLV I, II, STLV and Staph A.

Precipitates were boiled in SDS to remove the antigen-antibody complexes from the Staph A, and the protein complexes electrophoresed through 12% and 15% polyacrylamide gels with 0.1% SDS and 2-mercaptoethanol for 16-18 hours at constant amperage. After gels were dried and exposed to X-ray film for 12-15 days, sizes of radiolabeled proteins from CFIDS patients and controls were calculated from standard curves generated using labeled molecular weight markers which were coelectrophoresed.

The results show that the precipitated ggg proteins from HTLV I and II Infected cell lines in 12% PAGE are 24 kD and 45 kD. On the same gels, ten out of ten CFiDS-derived cav gag proteins are 27-28 kD, 45 kD, 55-56 kD and 76 kD. Ho gag proteins were precipitated from healthy controls.

On ths 15% PAGE, lower molecular weight gag proteins could be visualized from CFIDS patientB. In addition to p27-28, pll-12 (11-12 kD), and pi3-14 (13-14 kD) war· visualized. No such bands were present in MT-2 or Mo-T lysates, or in healthy controls.

These data prove conclusively that the CFIDS 5 retrovirus CAV ie not HTLV I or II. Animal retroviruses that have been shown to express gig proteins of these molecular weights ere: primate D-type retroviruses; primate c-type, e.g. ssav, GALV and BeEV; lsntiviruses, s.g. EIAV (but not HIV); mouse B-type e.g. MMTV; avian C10 type retroviruses, e.g. A8LV, REV; and perhaps Foamy (Spume) viruses, although ths gftg proteins of this latter group have not been analyzed directly but only by DNA sequence extrapolation.

Example 9 - Location of gaa Proteins in Nucleus Leukocytes from ths above-mentioned CFIDS patient eamples ere reacted with Χ-l Nab and immunostained by goet-anti-mouee alkaline phoephatase (APAAP). More than 50% of patient eemplee tested (end none of controls) revealed cells staining for gftg proteins. Most importantly, ths staining is found in both the cytoplasm and nucleus of ths positive calls.

The only known retroviruses to display nuclear staining for viral proteins are the Foamy virus group.

Example 10 - Reverse Transcriptase Assay A reveres transcriptase essay was performed as follows. CAV was cultured in cell lines B-Jab H-9 and V937 (ell positive by PCR for HTLV-n gag region). The virue was harvested through three cycles of freezing at SO’C. Culture fluid was subsequently thawed end centrifuged et 1,000 xg for 10 minutes et 4’C to remove intact cells.

The viral particles were pelleted by running at a speed 25,000 rpm for 90 minutes in e Beckman SW28 rotor. The pellet was suspended in 500 pi (to make lOOx concentration) of TNi buffer (10 mM Tris/HCl pH 8.0, 100 mK NaCl, 1 mN EDTA). The buffer can be tested immediately or stored frozen et ~20’C. Either 25 pi or 50 pi of lysate in buffer, ee indicated in Table IX below, was used in each assay tube.

The reaction mixture of reverse transcriptase activity [I. M. Verve, J, Virol., i£:843-854 (1975); 1.

M. Verma, J, Virol.. l£t121-126 (1975)) in 100 pi contained 50 mM Tris/HCl, pH 8.0, 40 mM KCl, 5 mM dithiothreitol, 0.05« Triton X-100, 0.2« Nomidet P-40, 100 pg/ml bovine serum albumin, 40 pg/ml template-primer complex and varying amounts of divalent cation (Mg** or Mn*4) to achieve the concentration ae indicated in Table IX below.

The exogenous template-primer complex was selected from either polyriboadsnylatsoligodeoxythymidylate (poly.rA-oligo.dT) or polyribocytosylete-oligodsoxygusnidylets (poly.rC20 oligo.dG) [Pharmacia, Piscataway, NJ).

After 5 minutes on ice, 1.5 pM [hi]-labelled deoxythymidine triphosphate (dTTP; 43 Cl/mmole) or 6.6 pM [hl]-labelled deoxyguanoeine triphosphate (dGTP; ll Ci/mmols) [Amersham, United Kingdom] wars added in the mixture end incubated at 37*C for 60 minutes. The reaction was stopped by ths addition of ice cold 10 mM eodium pyrophosphate and 15« trichloracetic aoid (TCA). After 15 minutes At O’C ths precipitated [’H]-labelled polythymidines (poly T) and polyguanidines (poly G) synthesized in thia reaction was collected on a glass microfibsr filters (Whatmann GF/C, 2.4 cm) presoaked in 5« TCA. Ths filters were washed ten times with ice cold 5« TCA end dried. hl-TCA-precipitable material (i.e. double stranded nucleic acid) wee counted with Econofluor scintillation fluid by a Packard liquid scintillation counter. The data in the following table ie expressed ae counts per minute per reaction vial.

Reverse transcriptase (RT) of every retrovirus prefers a unique exogenous template-primer, a divalent cation (either Mg4* or Mn44), and a labelled substrate to polymeries DNA from RNA [See, e.g., RNA Tumor Viruses, second edition, eds. R. Weiss, N. Leioh, H. Varmue and J. Coffin, Cold Spring Harbor Lab Press, Cold Spring Harbor, NY (1984)]. io The results of the RT study demonstrated that the CFIDS-aesociated CAV growing in established cultures doss not show ths characteristics of e C type retrovirus reverse traneoriptaee, e.g., an RT of HTLV-I or HTLV-II. RT of HTLV-I (ae illustrated by the MT-2 cell lysate of the table) and HTLV-ιι prefer a template-primer of poly YC-ollgo(dG) with Mg44 (® 30 mM). It le clear from the table above that CAV prefers a template-primer of ροΙγγΑoligo-(dT) with Mn44. Among the retroviruses who show ths same RT characteristics as that of CAV (poly γλ20 oligo(dT) template-primer and Mn44 preferences) are the Spume (foamy) virus and the monkey D-type retroviruses.

Numerous modifications and variations of the present invention are included in the above-identified specification and are expected to be obvious to one of ekill in the art. For example, use of other appropriate cav genomic sequences as PCR or hybridization primers and probes le contemplated, ae well aa the use of other assay techniques and antibodies, and the use of other viral peptides for therapeutic agents. Such modifications and alterations to ths compositions and processes of the present invention are believed to be encompassed in the scope of the claims appended hereto.

TA5LX ZX RNA-dependent ONA polymer*·· (revere· trtntcripta··/ AT) activity CAV Templet* precipitebl· CultMgtf Divalent to-labelled to-TCA product iggaj citlan luhitrrti polyyA-oligo-(dT) Mg** (ImM) to-TTP (l.l μη) 1,572 SO μί polyyA-eligo-(dT) Mg** (SmM) to-TTP (1.5 μΛ) 752 25 Pl polyyA-oligo-(dT) Mg** (lOtnM) to-TTP (1.5 pm) 662 50 pi polyyA-oligo-(dT) Mg** (lOmM) to-TTP (1.5 μη) 430 25 pi polyyA-oligo-(dT) Mn** (O.BmM) to-TTP (1.5 pm) 20,737 50 Pl polyyA-oligo-(dT, Mn** (0.5«M) to-TTP (1.5 μ») 13,011 25 Pl polyyA-oligo-(dT) Mn** (2.0mM) Ή-ΤΓΡ (1.5 μα) 17,157 50 Pl polyyA-oligo-(dT) Mn** (2.0tnM) to-TTP (1.5 μα) 13,579 25 pl polyyC-o1igo-(do) Mg** (lOmM) to-dOTP (5.5 μΛ) N.D 50 Pl polyyC-oligo-(dO) Mg** (lOmM) to-dOTP (5.5 μα) 30 25 pl polyyC-oligo-(do) MgT* (30nM) to-dOTP (β.β μη) 491 50 pl polyyC-oligo-(do) Mg*+ (30mM) *H-dOTF (4.5 pm) 604 25 pl polyyC-oligo-(dO) Mn** (O.BmM) to-dOTP (5.5 μα) 117 50 pl polyYC-oligo-(dO) Mn** (0.5mM) to-dOTP (5.6 pm) 573 25 pl polyyc-oligo-(de) Mn** (2.0mM) to-dOTP (5.5 pm) 171 50 pi polyyC-oligo-(do) Mn** (2.0mM) to-dOTP (5.5 pm) 105 KILV-I -fittitart 50 μί polyyC-oligo-(do) Mg** (30mM) to-dOTP (5.5 pm) 14,365 50 μί polyyC-oligo-(do) Mn** (2«M) to-dOTP (6.6 pm) 606

Claims (46)

1. CFIDS-aaaociated virus, CAV.

2. The virus according to clain 1 substantially isolated from contaminants with which it occurβ in natural sources.

3. A CAV polynucleotide sequence.

4. The sequence according to claim 3 comprising a contiguous sequence of nucleotides capable of selectively hybridising to the genome of CAV or a complement thereof.

5. The sequence according to claim 3 which is a DNA polynucleotide.

6. The sequence according to claim 3 which is an RNA polynucleotide.

7. The sequence according to claim 3 which is associated with a detectable label.

8. The sequence according to claim 3 which is fixed to a solid support.

9. The sequence according to claim 3 which comprises a nucleotide sequence encoding an antigenic determinant of CAV.

10. The sequence according to claim 3 which comprises a nucleotide sequence encoding a structural protein of CAV,

11. The sequence according to claim 3 which comprises a nucleotide sequence encoding a non-etructural protein of CAV.

12. A substantially isolated polypeptide comprising a CAV amino acid sequence.

13. The polypeptide according to claim 12 comprising an antigenic site of CAV.

14. The polypeptide according to claim 12 prepared by recombinant techniques.

15. The polypeptide according to claim 12 prepared by chemical synthesis.

16. The polypeptide according to claim 12 comprising a CAV structural protein.

17. The polypeptide according to claim 12 comprising a CAV non-etructural protein.

18. The polypeptide according to claim 12 fixed to a solid support.

19. The polypeptide according to claim 12 for use in a method of making anti-CAV antibodies which comprises administering the polypeptide to a mammal in an amount sufficient to produce an immune response.

20. A recombinant vector comprising a coding Bequence which comprises a CAV polynucleotide.

21. λ host cell transformed by a recombinant vector according to claim 20, wherein the ceding sequence is operably linked to a suitable regulatory control sequence capable of directing the expression of the coding sequence.

22. λ composition comprising a CAV polypeptide and a pharmaceutically acceptable carrier.

23. The composition according to claim 22 wherein said polypeptide ie capable of generating the production of antibodies thereto.

24. The composition according to claim 23 which ie a vaccine composition.

25. An anti-CAV antibody composition.

26. The antibody composition according to claim 25 wherein said antibody is selected from the group consisting of a polyclonal antibody, a monoclonal antibody or a recombinant antibody.

27. The antibody composition according to claim 25, optionally aseociatsd with a detectable label or a solid support.

28. A method for diagnosing CFIDS comprising detecting the presence ot all or a portion of a polynucleotide sequence of CAV in the body fluids of a patient exhibiting the symptoms of CFIDS.

29. The method aooording to claim 28 wherein eaid detecting step comprises employing all or a fragment of a CAV polynucleotide sequence or a complement thereof sb a primer in a polymerase chain reaction performed on a sample of patient body fluids in vitro, wherein the amplification of said sequence indicates the presence of the etiologic agent of CFIDS.

30. The method according to claim 28 wherein Bald detecting step oomprises employing all or a fragment of a CAV polynucleotide sequence as a hybridization probe in a hybridization assay performed on a sample of patient body fluids in vitro, wherein the hybridization of eaid sequence indicates the presence of the etiologic agent of CFIDS.

31. A method for diagnosing CFIDS comprising detecting in the body fluids of a patient exhibiting the symptoms of cfids the presence of an anti-CAV antibody.

32. The method according to claim 31 wherein said detecting etep comprises contacting a body fluid from a CFIDS patient with a CAV polypeptide or protein, wherein said peptide or protein represents an antigenic site capable of forming an antigen-antibody complex with said antibody.

33. The method according to claim 32 wherein said detecting step comprises contacting a body fluid from a CFIDS patient with a peptide or protein from HTLV I or HTLV ii, which peptide or protein encodee an antigenic site capable of binding to said antibody and which antigenic site is common between HTLV I and CAV or between HTLV II and CAV.

34. λ method for producing blood and blood products free from infection with CAV comprising screening a sample of blood for a CAV polynucleotide sequence or an anti-CAV antibody.

35. CFIDS-associated virus, CAV, substantially as hereinbefore described.

36. A CAV polynucleotide sequence according to claim 3, substantially as hereinbefore described and with particular reference to Fig. 2 of the accompanying Drawings.

37. A substantially isolated polypeptide according to claim 12 comprising a CAV amino acid sequence, substantially as hereinbefore described and with particular reference to Fig. 3 of the accompanying Drawings.

38. Use according to claim 19, substantially as hereinbefore described.

39. A recombinant vector according to claim 20, substantially as hereinbefore described.

40. A host cell according to claim 21, substantially as hereinbefore described.

41. A composition according to claim 22, substantially as hereinbefore described.

42. An anti-CAV antibody composition according to claim 25, substantially as hereinbefore described.

43. A method according to claim 28 for diagnosing CFIDS, substantially as hereinbefore described and exemplified.

44. A method according to claim 31 for diagnosing CFIDS, substantially as hereinbefore described.

45. A method according to claim 34 for producing blood and blood products free from infection with CAV, substantially as hereinbefore described.

46. Blood or a blood product whenever produced by a method claimed in claim 34 or 45.