WO1991015603A1 - Enterically transmitted non-a/non-b hepatitis viral agent and characteristic epitopes thereof - Google Patents

Enterically transmitted non-a/non-b hepatitis viral agent and characteristic epitopes thereof Download PDF

Info

Publication number
WO1991015603A1
WO1991015603A1 PCT/US1991/002368 US9102368W WO9115603A1 WO 1991015603 A1 WO1991015603 A1 WO 1991015603A1 US 9102368 W US9102368 W US 9102368W WO 9115603 A1 WO9115603 A1 WO 9115603A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
dna
derived
viral
nanb
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1991/002368
Other languages
English (en)
French (fr)
Inventor
Gregory R. Reyes
Patrice O. Yarbough
Daniel W. Bradley
Krzysztof Z. Krawczynski
Albert Tam
Kirk E. Fry
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genelabs Inc
US Department of Health and Human Services
Government of the United States of America
Original Assignee
Genelabs Inc
US Department of Health and Human Services
Government of the United States of America
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=24012303&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO1991015603(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Genelabs Inc, US Department of Health and Human Services, Government of the United States of America filed Critical Genelabs Inc
Priority to CA002057052A priority Critical patent/CA2057052C/en
Priority to DE69133599T priority patent/DE69133599D1/de
Priority to EP91908163A priority patent/EP0476130B1/en
Priority to KR1019910701774A priority patent/KR0178399B1/ko
Publication of WO1991015603A1 publication Critical patent/WO1991015603A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10RNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/40Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/61Fusion polypeptide containing an enzyme fusion for detection (lacZ, luciferase)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/24011Flaviviridae
    • C12N2770/24211Hepacivirus, e.g. hepatitis C virus, hepatitis G virus
    • C12N2770/24222New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • This invention relates to recombinant proteins, genes, and gene probes and more specifically to such proteins and probes derived from an enterically transmitted nonA/nonB hepatitis viral agent, to diagnostic methods and vaccine applications which employ the proteins and probes, and to gene segments that encode specific epitopes (and proteins artificially produced to contain those epitopes) that are particularly useful in diagnosis and prophylaxis.
  • ET-NANB Enterically transmitted non-A/non-B hepatitis viral agent
  • HEV Enterically transmitted non-A/non-B hepatitis viral agent
  • NANB virus particles reacted with antibodies in serum from infected individuals from geographically distinct regions, suggesting that a single viral agent or class is responsible for the majority of ET-NANB hepatitis seen worldwide.
  • No antibody reaction was seen in serum from individuals infected with parenterally transmitted NANB virus (also known as hepatitis C virus or HCV), indicating a different specificity between the two NANB types.
  • parenterally transmitted NANB virus also known as hepatitis C virus or HCV
  • ET-NANB is characteristically an acute infection, often associated with fever and arthralgia, and with portal inflammation and associated bile stasis in liver biopsy specimens (Arankalle) . Symptoms are usually resolved within six weeks. Parenterally transmitted NANB, by contrast, produces a chronic infection in about 50% of the cases. Fever and arthralgia are rarely seen, and inflammation has a predominantly parenchymal distribution ( huroo, 1980). The course of ET-NANBH is generally uneventful in healthy individuals, and the vast majority of those infected recover without the chronic sequelae seen with HCV.
  • ET-NANB but not the parenterally transmitted agent, can be transmitted to cynomolgus monkeys.
  • the parenterally transmitted agent is more readily transmitted to chimpanzees than is ET-NANB (Bradley, 1987) .
  • ET-NANB Brain-NANB
  • One goal of this effort, requiring virus-specific genomic sequences, is to identify and characterize the nature of the virus and its protein products.
  • Another goal is to produce recombinant viral proteins which can be used in antibody-based diagnostic procedures and for a vaccine.
  • viral sequences associated with ET-NANB hepatitis have not been successfully identified or cloned heretofore, nor have any virus-specific proteins been identified or produced.
  • compositions as well as methods of preparation and use of the compositions are provided, where the compositions comprise viral proteins and fragments thereof derived from the viral agent for ET- NANB.
  • a number of specific fragments of viral proteins (and the corresponding genetic sequences) that are particularly useful in diagnosis and vaccine production are also disclosed.
  • Methods for preparation of ET-NANB viral proteins include isolating ET-NANB genomic sequences which are then cloned and expressed in a host cell. The resultant recombinant viral proteins find use as diagnostic agents and as vaccines. The genomic sequences and fragments thereof find use in preparing ET-NANB viral proteins and as probes for virus detection.
  • Figure 1 shows vector constructions and manipulations used in obtaining and sequencing cloned ET-NANB fragment
  • Figures 2A-2B are representations of Southern blots in which a radiolabeled ET-NANB probe was hybridized with amplified cDNA fragments prepared from RNA isolated from infected (I) and non-infected (N) bile sources (2A), and from infected (I) and non- infected (N) stool-sample sources (2B) .
  • DESCRIPTION OF SPECIFIC EMBODIMENTS Novel compositions comprising generic sequences and fragments thereof derived from the viral agent for ET-NANB are provided, together with recombinant viral proteins produced using the genomic sequences and methods of using these compositions. Epitopes on the viral protein have been identified that are particularly useful in diagnosis and vaccine production. Small peptides containing the epitopes are recognized by multiple sera of patients infected with ET-NANB.
  • the molecular cloning of HEV was accomp ⁇ lished by two very different approaches.
  • the first successful identification of a molecular clone was based on the differential hybridization of putative HEV cDNA clones to heterogeneous cDNA from infected and uninfected cyno bile. cDNAs from both sources were labeled to high specific activity with 32P to identify a clone that hybridized specifically to the infected source probe.
  • a cyno monkey infected with the Burma isolate of HEV was used in these first experiments. The sensitivity of this procedure is directly related to the relative abundance of the specific sequence against the overall background.
  • ET1.1 was first characterized as both derived from and unique to the infected source cDNA. Heterogeneous cDNA was amplified from both infected and uninfected sources using a sequence independent single premier amplification technique (SISPA) . This technique is described in copending application serial No. 208,512, filed June 17, 1988. The limited pool of cDNA made from Burma infected cyno bile could then be amplified enzymatically prior to cloning or hybridization using putative HEV clones as probes. ET1.1 hybridized specifically to the original bile cDNA from the infected source.
  • SISPA sequence independent single premier amplification technique
  • the viral specificity of ET1.1 was further established by the finding that the clone hybridized specifically to RNA extracted from infected cyno liver. Hybridization analysis of polyadenylated RNA demonstrated a unique 7.5 Kb polyadenylated transcript not present in uninfected liver. The size of this transcript suggested that it represented the full length viral genome. Strand specific oligonucleotides were also used to probe viral genomic RNA extracted directly from semi-purified virions prepared from human stool. The strand specificity was based on the RNA-directed RNA polymerase (RDRP) open reading frame (ORF) identified in ET1.1 (see below). Only the probe detecting the sense strand hybridized to the nucleic acid.
  • RDRP RNA-directed RNA polymerase
  • ORF open reading frame
  • HEV HEV as a plus sense, single stranded genome.
  • Strand specific hybridization to RNA extracted from the liver also established that the vast majority of intracellular transcript was positive sense. Barring any novel mechanism for virus expression, the negative strand, although not detectable, would be present at a ratio of less than 1:100 when compared with the sense strand.
  • ET1.1 was documented as exogenous when tested by both Southern blot hybridization and PCR using genomic DNAs derived from uninfected humans, infected and uninfected cynos and also the genomic DNAs from E_ coli and various bacteriophage sources. The latter were tested in order to rule out trivial contamination with an exogenous sequence introduced during the numerous enzymatic manipulations performed during cDNA construction and amplification. It was also found that the nucleotide sequence of the ET1.1 clone was not homologous to any entries in the Genebank database. The translated open reading frame of the ET1.1 clone did, however, demonstrate limited homology with consensus amino acid residues consistent with an RNA-directed RNA polymerase.
  • This consensus amino acid motif is shared among all positive strand RNA viruses and, as noted above, is present at the 3' end of the HCV genome.
  • the 1.3 Kb clone was therefore presumed to be derived, at least in part, from the nonstructural portion of the viral genome.
  • the genome of the ET-NANB viral agent is defined in this specification as containing a region which is homologous to the 1.33 kb DNA EcoRI insert present in plasmid pTZKFl (ET1.1) carried in E_ ; _ coli strain BB4 and having ATCC deposit no. 67717.
  • the entire sequence, in both directions, has now been identified as set forth below.
  • the sequences of both strands are provided, since both strands can encode proteins.
  • the sequence in one direction has been designated as the "forward" sequence because of statistical similarities to known proteins and because the forward sequence is known to be predominately protein-encoding.
  • the gene sequence given below is substantially identical to one given in the parent application.
  • the present sequence differs in the omission of the first 37 nucleotides at the 5' end and last 13 nucleotides at the 3' end, which are derived from the linker used for cloning rather than from the virus.
  • a G was omitted at position 227 of the sequence given in the parent application.
  • the following gene sequence has SEQ ID N0.1; the first amino acid sequence in reading frame beginning with nucleotide 1 has SEQ ID NO.2; the second amino acid sequence in reading frame beginning with nucleotide 2 has SEQ ID NO.3; and the third amino acid sequence in reading frame beginning with nucleotide 3 has SEQ ID NO.4.
  • Tyr Gly lie Leu Ser Gly Ile Trp Pro Leu Leu Pro Thr Val Met Thr 275 280 285
  • the complementary strand referred to here as the "reverse sequence, " is set forth below in the same manner as the forward sequence set forth above .
  • Several open reading frames shorter than the long open reading frame found in the forward sequence, can be seen in this reverse sequence. Because of the relative brevity of the open reading frames in the reverse direction, they are probably not expressed.
  • the following gene sequence has SEQ ID NO.5.
  • the Burmese isolate contains the following sequence of nucleotides (one strand and open reading frames shown) .
  • the following gene sequence has SEQ ID NO.6; the protein sequence corresponding to 0RF1 has SEQ ID NO.7; ORF2 has SEQ ID NO.8; and ORF3 has SEQ ID NO.9.
  • Total number of bases in this sequence as presented is 7195.
  • the poly-A tail present in the cloned sequence has been omitted.
  • cDNA libraries were made directly from a semi- purified human stool specimen collected from an outbreak of ET-NANB in Telixtac.
  • the recovery of cDNA and the construction of representative libraries was assured by the application of sequence independent single premier amplification (SISPA) .
  • SISPA sequence independent single premier amplification
  • a cDNA library constructed in lambda gtll from such an amplified cDNA population was screened with a serum considered to have "high" titer anti-HEV antibodies as assayed by direct immunofluorescence on liver sections from infected cynos .
  • Two cDNA clones, denoted 406.3-2 and 406.4-2, were identified by this approach from a total of 60,000 screened. The sequence of these clones was subsequently localized to the 3 ' half of the viral genome by homology comparison to the HEV (Burma) sequence obtained from clones isolated by hybridization screening of libraries with the original ET1.1 clone.
  • a composite cDNA sequence ( obtained from several clones of the Mexican strain) is set forth below.
  • Composite Mexico strain sequence ( SEQ ID NO . 10 ) :
  • CCTAATGTCC TCCATCGCTG CTTTCTCCAC CCCGTCGGCC GGGATGTTCA GCGCTGGTAC 360 ACAGCCCCGA CTAGGGGACC TGCGGCGAAC TGTCGCCGCT CGGCACTTCG TGGTCTGCCA 420
  • CAGCGCCAGT CGGTTATTGG TAGTTTGTGG CTGCACCCTG AAGGTTTGCT CGGCCTGTTC 2040 CCGCCCTTTT CACCCGGGCA TGAGTGGCGG TCTGCTAACC CATTTTGCGG CGAGAGCACG 2100
  • GAGAAGGCTA TTCTATCCCT TTTACCACAA GCTGTGTTCT ACGGGGATGC TTATGACGAC 4320
  • GAGCAGCTCC GCCTCGCCGT GCAGGATTTC CTCCGTAGGT TAACGAATGT GGCCCAGATT 4920
  • GGCATGCTCC AGACTATTGG TGATGGTAAG GCGCATTTTA CAGAGTCTGT TAAGCCTATA 5040
  • GCGTGTGGTC ATTCAGGATT ATGACAACCA GCATGAGCAG GATCGGCCCA CCCCGTCGCC 6480 TGCGCCATCT CGGCCTTTTT CTGTTCTCCG AGCAAATGAT GTACTTTGGC TGTCCCTCAC 6540
  • CTTTGTGCTC CCCCTTCGTG GCAAGCTCTC CTTTTGGGAG GCCGGCACAA CAAAAGCAGG 6780 TTATCCTTAT AATTATAATA CTACTGCTAG TGACCAGATT CTGATTGAAA ATGCTGCCGG 6840
  • the above sequence was obtained from polyadenylated clones. For clarity the 3' polyA "tail" has been omitted.
  • the sequence above includes a partial cDNA sequence consisting of 1661 nucleotides that was identified in a previous application in this series. The previously identified partial sequence is set forth below, with certain corrections (SEQ ID NO.11).
  • the corrections include deletion of the first 80 bases of the prior reported sequence, which are cloning artifacts; insertion of G after former position 174, of C after 270, and of GGCG after 279; change of C to T at former position 709, of GC to CG at 722-723, of CC to TT at 1238-39, and of C to G at 1606; deletion of T at former position 765; and deletion of the last 11 bases of the former sequence, which are part of a linker sequence and are not of viral origin.
  • Non-A N ⁇ n-B T Mexican Strain; SEQ ID NO.11 SEQ ID NO. 11:
  • GAACATGGCA ATCATTGCCC ATTGCTATGA GTTCCGGGAC CTCCAGGTTG CCGCCTTCAA 1080 GGGCGACGAC TCGGTCGTCC TCTGTAGTGA ATACCGCCAG AGCCCAGGCG CCGGTTCGCT 1140
  • Tashkent U.S.S.R.
  • the Tashkent sequence is given below (SEQ ID NO.12) :
  • the Tashkent (Tash. ) sequence more closely resembles the Burma sequence than the Mexico sequence, as would be expected of two strains from more closely related geographical areas .
  • the numbering system used in the comparison is based on the Burma sequence. As indicated previously, Burma has SEQ ID NO: 6; Mexico, SEQ ID NO: 10; and Tashkent, SEQ ID NO: 12. The letters present in the lines between the sequences indicate conserved nucleotides.
  • GCTGTGG TTGAAGTTGAAGG GA TTCCG CCGAT GG TGTATGC GG GTTGT G -MEXICO GCTGTGGTTTGAAGTTGAAGGCTGACTTCCGGCCGATTGGGCTGTATGCCGGGGTTGTCG
  • ACTGCTCG CAC C CG G G GACGGGACTGC GAGCT ACCAC AC GC -MEXICO ACTGCTCGTCACTCCGCCCGAGGGGCC—GACGGGACTGCGGAGCTGACCACAACTGCA
  • TGCCC CCT CTT TGC TTATTTC TTTCT GT CCGCGCTCCC -MEXICO TGCCCACCTACTTATATCTGCTGA CCTTTATTTCCTTTTTCTCGGTCCCGCGCTCCC v 7195 -BURMA TGA TGA -MEXICO TGA
  • ORF2 the second major opening reading frame
  • ORF3 is only 370 bp in length and would not have been predicted to be utilized by the virus were it not for the identification of the immunoreactive cDNA clone 406.4-2 from the Mexico SISPA cDNA library (see below for detailed discussion) .
  • This epitope confirmed the utilization of ORF3 by the virus, although the means by which this ORF is expressed has not yet been fully elucidated.
  • ORF3 overlaps ORFI by 1 bp at its 5' end and 0RF2 by 328 bp at its 3'end.
  • ORF2 contains the broadly reactive 406.3-2 epitope and also a signal sequence at its extreme 5' end. The first half of this 0RF2 also has a high pi value (>10) similar to that seen with other virus capsid proteins.
  • RNAs were produced by splicing from the 5' end of the genome.
  • a region of the genome displayed a high degree of homology with a 21 bp segment identified in Sindbis as a probably internal initiation site for RNA transcription used in the production of its subgenomic messages. Sixteen of 21 (76%) of the nucleotides are identical.
  • Epitopes derived from Mexican strain of HEV 406.4-2 sequence (nucleotide sequence has SEQ ID NO.13; amino acid sequence has SEQ ID NO.14): SEQ ID NO. 13 :
  • amino acid sequence has SEQ ID NO.16:
  • each of the specific DNA sequences given above shows a corresponding complementary DNA sequence as well as RNA sequences corresponding to both the principal sequence shown and the complementary DNA sequence. Additionally, open reading frames encoding peptides are present, and expressible peptides are disclosed by the nucleotide sequences without setting forth the amino acid sequences explicitly, in the same manner as if the amino acid sequences were explicitly set forth as in the ETl.1 sequence or other sequences above.
  • Enterically transmitted non-A/non-B hepatitis viral agent, ET-NANB, or HEV means a virus, virus type, or virus class which (1) causes water- borne, infectious hepatitis, (ii) is transmissible in cynomolgus monkeys, (iii) is serologically distinct from hepatitis A virus (HAV) , hepatitis B virus (HBV), hepatitis C virus (HCV), and hepatitis D virus, and (iv) includes a genomic region which is homologous to the 1.33 kb cDNA insert in plasmid pTZKFl(ETl.1) carried in E_ ⁇ coli strain BB4 identified by ATCC deposit number 67717.
  • Two nucleic acid fragments are "homologous" if they are capable of hybridizing to one another under hybridization conditions described in Maniatis et al. , op. cit. , pp. 320-323. However, using the following wash conditions: 2 x SCC, 0.1% SDS, room temperature twice, 30 minutes each; then 2 x SCC, 0.1% SDS, 50°C once, 30 minutes; then 2 x SCC, room temperature twice, 10 minutes each, homologous sequences can be identified that contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15-25% basepair mismatches, even more preferably 5-15% basepair mismatches. These degrees of homology can be selected by using more stringent wash conditions for identification of clones from gene libraries (or other sources of genetic material), as is well known in the art.
  • Two amino acid sequences or two nucleotide sequences are considered homologous (as this term is preferably used in this specification) if they have an alignment score of >5 (in standard deviation units) using the program ALIGN with the mutation gap matrix and a gap penalty of 6 or greater. See Dayhoff, M.O., in Atlas of Protein Sequence and Structure (1972) Vol. 5, National Biomedical Research Foundation, pp. 101-110, and Supplement 2 to this volume, pp. 1-10.
  • the two sequences (or parts thereof, preferably at least 30 amino acids in length) are more preferably homologous if their amino acids are greater than or equal to 50% identical when optimally aligned using the ALIGN program mentioned above.
  • a DNA fragment is "derived from" an ET-NANB viral agent if it has the same or substantially the same basepair sequence as a region of the viral agent genome.
  • a protein is "derived from" an ET-NANB viral agent if it is encoded by an open reading frame of a DNA or RNA fragment derived from an ET-NANB viral agent.
  • a virus-specific DNA clone can be produced by (a) isolating RNA from the bile of a cynomolgus monkey having a known ET-NANB infection,
  • ET-NANB infection in cynomolgus monkeys is initiated by inoculating the animals intravenously with a 10% w/v suspension from human case stools positive for 27-34 nm ET-NANB particles (mean diameter 32 nm) .
  • An infected animal is monitored for elevated levels of alanine aminotransferase, indicating hepatitis infection.
  • ET-NANB infection is confirmed by immunospecific binding of seropositive antibodies to virus-like particles (VLPs), according to published methods (Gravelle) .
  • a stool (or bile) specimen taken from the infected animal 3-4 weeks after infection is diluted 1:10 with phosphate- buffered saline, and the lot suspension is clarified by low-speed centrifugation and filtration successively through 1.2 and 0.45 micron filters.
  • the material may be further purified by pelleting through a 30% sucrose cushion (Bradley) .
  • the resulting preparation of VLPs is mixed with diluted serum from human patients with known ET-NANB infection. After incubation overnight, the mixture is centrifuged overnight to pellet immune aggregates, and these are stained and examined by electron microscopy for antibody binding to the VLPs.
  • ET-NANB infection can also be confirmed by seroconversion to VLP-positive serum.
  • serum of the infected animal is mixed as above with 27-34 nm VLPs isolated from the stool specimens of infected human cases and examined by immune electron microscopy for antibody binding to the VLPs.
  • Bile can be collected from ET-NANB positive animals by either cannulating the bile duct and collecting the bile fluid or by draining the bile duct during necropsy.
  • Total RNA is extracted from the bile by hot phenol extraction, as outlined in Example IA.
  • the RNA fragments are used to synthesize corresponding duplex cDNA fragments by random priming, also as referenced in Example IA.
  • the cDNA fragments may be fractionated by gel electrophoresis or density gradient centrifugation to obtain a desired size class of fragments, e.g., 500-4,000 basepair fragments.
  • VLPs obtained from stool samples as described in Example 4
  • alternative sources of viral material such as VLPs obtained from stool samples (as described in Example 4) may be used for producing a
  • the bile source is preferred. According to one aspect of the invention, it has been found that bile from ET-NANB-infected monkeys shows a greater number of intact viral particles than material obtained from stool samples, as evidenced by immune electron microscopy. Bile obtained from an ET-NANB infected human or cynomolgus macaque, for use as a source of ET-NANB viral protein or genomic material, or intact virus, forms part of the present invention.
  • the cDNA fragments from above are cloned into a suitable cloning vector to form a cDNA library. This may be done by equipping blunt-ended fragments with a suitable end linker, such as an EcoRI sequence, and inserting the fragments into a suitable insertion site of a cloning vector, such as at a unique EcoRI site. After initial cloning, the library may be re-cloned, if desired, to increase the percentage of vectors containing a fragment insert.
  • the library construction described in Example IB is illustrative. Here cDNA fragments were blunt-ended, equipped with EcoRI ends, and inserted into the EcoRI site of the lambda phage vector gtlO.
  • the library phage which showed less than 5% fragment inserts, was isolated, and the fragment inserts re-cloned into the lambda gtlO vector, yielding more than 95% insert-containing phage.
  • the cDNA library is screened for sequences specific for ET-NANB by differential hybridization to cDNA probes derived from infected and non-infected sources. cDNA fragments from infected and non-infected source bile or stool viral isolates can be prepared as above. Radiolabeling the fragments is by random labeling, nick translation, or end labeling, according to conventional methods (Maniatis, p. 109).
  • the cDNA library from above is screened by transfer to duplicate nitrocellulose filters, and hybridization with both infected-source and non-infected-source
  • clones can be selected if they hybridize under the conditions described in Maniatis et al. , op. cit. , pp. 320-323, but using the following wash conditions: 2 x SCC, 0.1% SDS, room temperature - twice, 30 minutes each; then 2 x SCC, 0.1% SDS, 50°C - once, 30 minutes; then 2 x SCC, room temperature - twice, 10 minutes each. These conditions allowed identification of the Mexican isolate discussed above using the ET1.1 sequence as a probe.
  • Plaques which show selective hybridization to the infected-source probes are preferably re-plated at low plating density and re- screened as above, to isolate single clones which are specific for ET-NANB sequences. As indicated in Example 2, sixteen clones which hybridized specifically with infected-source probes were identified by these procedures.
  • the basepair sequence of cloned regions of the ET-NANB fragments from Part B are determined by standard sequencing methods.
  • the fragment insert from the selected cloning vector is excised, isolated by gel electrophoresis, and inserted into a cloning vector whose basepair sequence on either side of the insertion site is known.
  • the particular vector employed in Example 3 is a pTZKFl vector shown at the left in Figure 1.
  • the ET-NANB fragment from the gtlO- 1.1 phage was inserted at the unique EcoRI site of the pTZKFl plasmid. Recombinants carrying the desired insert were identified by hybridization with the isolated 1.33 kilobase fragment, as described in Example 3.
  • E. coli strain BB4 infected with the pTZKFl(ET1.1) plasmid has been deposited with the American Type Culture Collection, Rockville, MD, and is identified by ATCC deposit number 67717.
  • the pTZKFl(ET1.1) plasmid is illustrated at the bottom in Figure 1.
  • the fragment insert has 5' and 3' end regions denoted at A and C, respectively, and an intermediate region, denoted at B.
  • the sequences in these regions were determined by standard dideoxy sequencing and were set forth in an earlier application in this series.
  • the three short sequences (A, B, and C) are from the same insert strand.
  • the B-region sequence was actually determined from the opposite strand, so that the B region sequence shown above represents the complement of the sequence in the sequenced strand.
  • the base numbers of the partial sequences are approximate.
  • the invention includes ET-NANB-specific fragments or probes which hybridize with ET-NANB genomic sequences or cDNA fragments derived therefrom.
  • the fragments may include full-length cDNA fragments such as described in Section II, or may be derived from shorter sequence regions within cloned cDNA fragments. Shorter fragments can be prepared by enzymatic digestion of full-length fragments under conditions which yield desired-sized fragments, as will be described in Section IV. Alternatively, the fragments can be produced by oligonucleotide synthetic methods, using sequences derived from the cDNA fragments. Methods or commercial services for producing selected-sequence oligonucleotide fragments are available.
  • Fragments are usually at least 12 nucleotides in length, preferably at least 14, 20, 30 or 50 nucleotides, when used as probes. Probes can be full length or less than 500, preferably less than 300 or 200, nucleotides in length.
  • the fragment can be shown to hybridize selectively with cDNA from infected sources.
  • the fragment was excised from the pTZKFl(ET1.1) plasmid, purified, and radiolabeled by random labeling. The radiolabeled fragment was hybridized with fractionated cDNAs from infected and non-infected sources to confirm that the probe reacts only with infected-source cDNAs.
  • Example 4 This method is illustrated in Example 4, where the above radiolabeled 1.33 kb fragment from pTZKFl(ET1.1) plasmid was examined for binding to cDNAs prepared from infected and non-infected sources.
  • the infected sources are (1) bile from a cynomolgus macaque infected with a strain of virus derived from stool samples from human patients from Burma with known ET- NANB infections and (2) a viral agent derived from the stool sample of a human ET-NANB patient from Mexico.
  • the cDNAs in each fragment mixture were first amplified by a linker/primer amplification method described in Example 4.
  • Fragment separation was on agarose gel, followed by Southern blotting and then hybridization to bind the radiolabeled 1.33 kb fragment to the fractionated cDNAs.
  • the lane containing cDNAs from the infected sources showed a smeared band of bound probe, as expected (cDNAs amplified by the linker/primer amplification method would be expected to have a broad range of sizes). No probe binding to the amplified cDNAs from the non- infected sources was observed. The results indicate that the 1.33 kb probe is specific for cDNA fragments associated with ET-NANB infection.
  • ET 1.1 As the probe, has demonstrated hybridization to ET-NANB samples collected from Tashkent, Somalia, Borneo and Pakistan.
  • the probe is specific for ET-NANB related sequences derived from different continents (Asia, Africa and North America) indicates the cloned ET-NANB Burma sequence (ET1.1) is derived from a common ET- NANB virus or virus class responsible for ET-NANB hepatitis infection worldwide.
  • ET-NANB-specific fragments One important use of the ET-NANB-specific fragments is for identifying ET-NANB-derived cDNAs which contain additional sequence information. The newly identified cDNAs, in turn, yield new fragment probes, allowing further iterations until the entire viral genome is identified and sequenced. Procedures for identifying additional ET-NANB library clones and generating new probes therefrom generally follow the cloning and selection procedures described in Section II.
  • the fragments are also useful as primers for a polymerase chain reaction method of detecting ET-NANB viral genomic material in a patient sample. This diagnostic method will be described in Section V below.
  • 406.3-2 and 406.4-2 sequences can be incorporated into other genetic material, such as vectors, for ease of expression or replication. They can also be used (as demonstrated above) for identifying similar antigenic regions encoded by related viral strains, such as the Burmese strain.
  • ET-NANB proteins can be prepared by expressing open reading-frame coding regions in ET-NANB fragments.
  • the ET-NANB fragments used for protein expression are derived from cloned cDNAs which have been treated to produce desired-size fragments, and preferably random fragments with sizes predominantly between about 100 to about 300 base pairs.
  • Example 5 describes the preparation of such fragments by DNAs digestion. Because it is desired to obtain peptide antigens of between about 30 to about 100 amino acids, the digest fragments are preferably size fractionated, for example by gel electrophoresis, to select those in the approximately 100-300 basepair size range.
  • cDNA libraries constructed directly from HEV-containing sources e.g., bile or stool
  • HEV-containing sources e.g., bile or stool
  • ET-NANB proteins expressed by the 406.3-2 and 406.4-2 sequences are particularly preferred since these proteins have been demonstrated to be immunoreactive with a variety of different human sera, thereby indicating the presence of one or more epitopes specific for HEV on their surfaces.
  • These clones were identified by direct screening of a gtll library.
  • the ET-NANB fragments are inserted into a suitable expression vector.
  • One exemplary expression vector is lambda gtll, which contains a unique EcoRI insertion site 53 base pairs upstream of the translation termination codon of the beta- galactosidase gene.
  • the inserted sequence will be expressed as a beta-galactosidase fusion protein which contains the N-terminal portion of the beta- galactosidase gene, the heterologous peptide, and optionally the C-terminal region of the beta- galactosidase peptide (the C-terminal portion being expressed when the heterologous peptide coding sequence does not contain a translation termination codon) .
  • This vector also produces a temperature- sensitive repressor (cl857) which causes viral lysogeny at permissive temperatures, e.g., 32°C, and leads to viral lysis at elevated temperatures, e.g., 37°C.
  • Advantages of this vector include: (1) highly efficient recombinant generation, (2) ability to select lysogenized host cells on the basis of host- cell growth at permissive, but not non-permissive, temperatures, and (3) high levels of recombinant fusion protein production.
  • phage containing a heterologous insert produces an inactive beta-galactosidase enzyme, phage with inserts can be readily identified by a beta-galactosidase colored- substrate reaction.
  • the viral digest fragments may be modified, if needed, to contain selected restriction-site linkers, such as EcoRI linkers, according to conventional procedures.
  • Example 1 illustrates methods for cloning the digest fragments into lambda gtll, which includes the steps of blunt-ending the fragments, ligating with EcoRI linkers, and introducing the fragments into EcoRI-cut lambda gtll.
  • the resulting viral genomic library may be checked to confirm that a relatively large (representative) library has been produced. This can be done, in the case of the lambda gtll vector, by infecting a suitable bacterial host, plating the bacteria, and examining the plaques for loss of beta- galactosidase activity. Using the procedures described in Example 1, about 50% of the plaques showed loss of enzyme activity.
  • the viral genomic library formed above is screened for production of peptide antigen (expressed as a fusion protein) which is immunoreactive with antiserum from ET-NANB seropositive individuals .
  • host cells infected with phage library vectors are plated, as above, and the plate is blotted with a nitrocellulose filter to transfer recombinant protein antigens produced by the cells onto the filter.
  • the filter is then reacted with the ET-NANB antiserum, washed to remove unbound antibody, and reacted with reporter-labeled, anti- human antibody, which becomes bound to the filter, in sandwich fashion, through the anti-ET-NANB antibody.
  • phage plaques which are identified by virtue of their production of recombinant antigen of interest are re-examined at a relatively low density for production of antibody-reactive fusion protein.
  • Several recombinant phage clones which produced immunoreactive recombinant antigen were identified in the procedure.
  • the selected expression vectors may be used for scale-up production, for purposes of recombinant protein purification.
  • Scale-up production is carried out using one of a variety of reported methods for (a) lysogenizing a suitable host, such as E ⁇ _ coli, with a selected lambda gtll recombinant (b) culturing the transduced cells under conditions that yield high levels of the heterologous peptide, and (c) purifying the recombinant antigen from the lysed cells.
  • a high-producer E_ ⁇ coli host, BNN103 is infected with the selected library phage and replica plated on two plates.
  • One of the plates is grown at 32°C, at which viral lysogeny can occur, and the other at 42°C, at which the infecting phage is in a lytic stage and therefore prevents cell growth. Cells which grow at the lower but not the higher temperature are therefore assumed to be successfully lysogenized.
  • the lysogenized host cells are then grown under liquid culture conditions which favor high production of the fused protein containing the viral insert, and lysed by rapid freezing to release the desired fusion protein.
  • the recombinant peptide can be purified by standard protein purification procedures which may include differential precipitation, molecular sieve chromatography, ion-exchange chromatography, isoelectric focusing, gel electrophoresis and affinity chromatography.
  • a fused protein such as the beta-galactosidase fused protein prepared as above
  • the protein isolation techniques which are used can be adapted from those used in isolation of the native protein.
  • the protein can be isolated readily by simple affinity chromatography, by passing the cell lysis material over a solid support having surface-bound anti-beta- galactosidase antibody.
  • the ET-NANB protein of the invention may also be derived directly from the ET-NANB viral agent.
  • VLPs or protein isolated from stool or liver samples from an infected individual, as above, are one suitable source of viral protein material.
  • the VLPs isolated from the stool sample may be further purified by affinity chromatography prior to protein isolation (see below) .
  • the viral agent may also be raised in cell culture, which provides a convenient and potentially concentrated source of viral protein.
  • Co- owned U.S. Patent Application Serial No. 846,757, filed April 1, 1986 describes an immortalized trioma liver cell which supports NANB infection in cell culture.
  • the trioma cell line is prepared by fusing human liver cells with a mouse/human fusion partner selected for human chromosome stability. Cells containing the desired NANB viral agent can be identified by immunofluorescence methods, employing anti-ET-NANB human antibodies.
  • the viral agent is disrupted, prior to protein isolation, by conventional methods, which can include sonication, high- or low-salt conditions, or use of detergents.
  • ET-NANB viral protein can be carried out by affinity chromatography, using a purified anti-ET-NANB antibody attached according to standard methods to a suitable solid support.
  • the antibody itself may be purified by affinity chromatography, where an immunoreactive recombinant ETNANB protein, such as described above, is attached to a solid support, for isolation of anti-ET-NANB antibodies from an immune serum source. The bound antibody is released from the support by standard methods.
  • the anti-ET-NANB antibody may be an antiserum or a monoclonal antibody (Mab) prepared by immunizing a mouse or other animal with recombinant ETNANB protein.
  • Mob monoclonal antibody
  • lymphocytes are isolated from the animal and immortalized with a suitable fusion partner, and successful fusion products which react with the recombinant protein immunogen are selected. These in turn may be used in affinity purification procedures, described above, to obtain native ET-NANB antigen.
  • ET-NANB is primarily of interest because of its effects on humans, recent data has shown that this virus is also capable of infecting other animals, especially mammals. Accordingly, any discussion herein of utility applies to both human and veterinary uses, especially commercial veterinary uses, such as the diagnosis and treatment of pigs, cattle, sheep, horses, and other domesticated animals.
  • the particles and antigens of the invention, as well as the genetic material, can be used in diagnostic assays.
  • Methods for detecting the presence of ET-NANB hepatitis comprise analyzing a biological sample such as a blood sample, stool sample or liver biopsy specimen for the presence of an analyte associated with ET-NANB hepatitis virus.
  • the analyte can be a nucleotide sequence which hybridizes with a probe comprising a sequence of at least about 16 consecutive nucleotides, usually 30 to 200 nucleotides, up to substantially the full sequence of the sequences shown above (cDNA sequences).
  • the analyte can be RNA or cDNA.
  • the analyte is typically a virus particle suspected of being ET-NANB or a particle for which this classification is being ruled out.
  • the virus particle can be further characterized as having an RNA viral genome comprising a sequence at least about 70% homologous to a sequence of at least 12 consecutive nucleotides of the "forward" and "reverse” sequences given above, usually at least about 80% homologous to at least about 60 consecutive nucleotides within the sequences, and may comprise a sequence substantially homologous to the full-length sequences.
  • the probe may contain a detectable label.
  • Particularly preferred for use as a probe are sequences of consecutive nucleotides derived from the 406.3-2 and 406.4-2 clones described herein, since these clones appear to be particularly diagnostic for HEV.
  • the analyte can also comprise an antibody which recognizes an antigen, such as a cell surface antigen, on a ET-NANB virus particle.
  • the analyte can also be a ET-NANB viral antigen.
  • the analyte is an antibody or an antigen, either a labelled antigen or antibody, respectively, can be used to bind to the analyte to form an immunological complex, which can then be detected by means of the label.
  • Immunoassays can be conducted either to determine the presence of antibodies in the host that have arisen from infection by ET-NANB hepatitis virus or by assays that directly determine the presence of virus particles or antigens. Such techniques are well known and need not be described here in detail. Examples include both heterogeneous and homogeneous immunoassay techniques. Both techniques are based on the formation of an immunological complex between the virus particle or its antigen and a corresponding specific antibody. Heterogeneous assays for viral antigens typically use a specific monoclonal or polydonal antibody bound to a solid surface. Sandwich assays are becoming increasingly popular.
  • Homogeneous assays which are carried out in solution without the presence of a solid phase, can also be used, for example by determining the difference in enzyme activity brought on by binding of free antibody to an enzyme-antigen conjugate.
  • a number of suitable assays are disclosed in U.S. Patent Nos. 3,817,837, 4,006,360, 3,996,345.
  • the viruses and antigens of the invention can be used as specific binding agents to detect either IgG or IgM antibodies.
  • IgM antibodies are typically the first antibodies that appear during the course of an infection, when IgG synthesis may not yet have been initiated, specifically distinguishing between IgM and IgG antibodies present in the blood stream of a host will enable a physician or other investigator to determine whether the infection is recent or convalescent.
  • Proteins expressed by the 406.3-2 and 406.4-2 clones described herein and peptide fragments thereof are particularly preferred for use as specific binding agents to detect antibodies since they have been demonstrated to be reactive with a number of different human HEV sera. Further, they are reactive with both acute and convalescent sera. In one diagnostic configuration, test serum is reacted with a solid phase reagent having surface- bound ET-NANB protein antigen.
  • the reagent After binding anti-ET- NANB antibody to the reagent and removing unbound serum components by washing, the reagent is reacted with reporter-labeled anti-human antibody to bind reporter to the reagent in proportion to the amount of bound anti-ET-NANB antibody on the solid support. The reagent is again washed to remove unbound labeled antibody, and the amount of reporter associated with the reagent is determined.
  • the reporter is an enzyme which is detected by incubating the solid phase in the presence of a suitable fluorometric or colorimetric substrate.
  • the solid surface reagent in the above assay prepared by known techniques for attaching protein material to solid support material, such as polymeric beads, dip sticks, or filter material. These attachment methods generally include non-specific adsorption of the protein to the support or covending attachment of the protein, typically through a free amine group, to a chemically reactive group on the solid support, such as an activate carboxyl, hydroxyl, or aldehyde group.
  • homogeneous assay In a second diagnostic configuration, known as a homogeneous assay, antibody binding to a solid support produces some change in the reaction medium which can be directly detected in the medium.
  • Known general types of homogeneous assays proposed heretofore include (a) spin-labeled reporters, where antibody binding to the antigen is detected by a change in reported mobility (broadening of the spin splitting peaks), (b) fluorescent reporters, where binding is detected by a change in fluorescence efficiency, (c) enzyme reporters, where antibody binding effects enzyme/substrate interactions, and (d) liposome-bound reporters, where binding leads to liposome lysis and release of encapsulated reporter.
  • spin-labeled reporters where antibody binding to the antigen is detected by a change in reported mobility (broadening of the spin splitting peaks)
  • fluorescent reporters where binding is detected by a change in fluorescence efficiency
  • enzyme reporters where antibody binding effects enzyme/substrate interactions
  • liposome-bound reporters where binding leads to lipo
  • the assay method involves reacting the serum from a test individual with the protein antigen and examining the antigen for the presence of bound antibody.
  • the examining may involve attaching a labeled anti-human antibody to the antibody being examined, either IgM (acute phase) or IgG (convalescent phase), and measuring the amount of reporter bound to the solid support, as in the first method, or may involve observing the effect of a ⁇ stibody binding on a homogeneous assay reagent, as in the second method.
  • an assay system or kit for carrying out the assay method just described is also forming part of the invention.
  • the kit generally includes a support with surface-bound recombinant protein antigen which is (a) immunoreactive with antibodies present in individuals infected with enterically transmitted nonA/nonB viral agent and (b) derived from a viral hepatitis agent whose genome contains a region which is homologous to the 1.33 kb DNA EcoRI insert present in plasmid pTZKFl(ET1.1) carried in E ⁇ Coli strain BB4, and having ATCC deposit no. 67717.
  • a reporter- labeled anti-human antibody in the kit is used for detecting surface-bound anti-ET-NANB antibody.
  • the genetic material of the invention can itself be used in numerous assays as probes for genetic material present in naturally occurring infections.
  • One method for amplification of target nucleic acids, for later analysis by hybridization assays, is known as the polymerase chain reaction or PCR technique.
  • the PCR technique can be applied to detecting virus particles of the invention in suspected pathological samples using oligonucleotide primers spaced apart from each other and based on the genetic sequence set forth above.
  • the primers are complementary to opposite strands of a double stranded DNA molecule and are typically separated by from about 50 to 450 nt or more (usually not more than 2000 nt) .
  • This method entails preparing the specific oligonucleotide primers and then repeated cycles of target DNA denaturation, primer binding, and extension with a DNA polymerase to obtain DNA fragments of the expected length based on the primer spacing. Extension products generated from one primer serve as additional target- sequences for the other primer.
  • the degree of amplification of a target sequence is controlled by the number of cycles that are performed and is theoretically calculated by the simple formula 2 ⁇ where n is the number of cycles. Given that the average efficiency per cycle ranges from about 65% to 85%, 25 cycles produce from 0.3 to 4.8 million copies of the target sequence.
  • the PCR method is described in a number of publications, including Saiki et al., Science (1985) 230:1350-1354; Saiki et al.. Nature (1986) 324:163-166; and Scharf et al., Science (1986) 233:1076-1078. Also see U.S. Patent Nos. 4,683,194; 4,683,195; and 4,683,202.
  • the invention includes a specific diagnostic method for determination of ET-NANB viral agent, based on selective amplification of ET-NANB fragments.
  • This method employs a pair of single-strand primers derived from non-homologous regions of opposite strands of a DNA duplex fragment, which in turn is derived from an enterically transmitted viral hepatitis agent whose genome contains a region which is homologous to the 1.33 kb DNA EcoRI insert present in plasmid pTZKFl(ET1.1) carried in E_ ; _ coli strain BB4, and having ATCC deposit no. 67717.
  • These "primer fragments,” which form one aspect of the invention are prepared from ET-NANB fragments such as described in Section III above.
  • the method follows the process for amplifying selected nucleic acid sequences as disclosed in U.S. Patent No. 4,683,202, as discussed above.
  • any of the antigens of the invention can be used in preparation of a vaccine.
  • a preferred starting material for preparation of a vaccine is the particle antigen isolated from bile.
  • the antigens are preferably initially recovered as intact particles as described above. However, it is also possible to pre ⁇ pare a suitable vaccine from particles isolated from other sources or non-particle recombinant antigens.
  • non-particle antigens typically soluble antigens
  • proteins derived from the viral envelope or viral capsid are preferred for use in preparing vac ⁇ cines. These proteins can be purified by affinity chromatography, also described above.
  • the purified protein is not immunogenic per se, it can be bound to a carrier to make the protein immunogenic.
  • Carriers include bovine serum albumin, keyhole limpet hemocyanin and the like. It is desirable, but not necessary, to purify antigens to be substantially free of human protein. However, it is more important that the antigens be free of proteins, viruses, and other substances not of human origin that may have been introduced by way of, or contamination of, the nutrient medium, cell lines, tissues, or pathological fluids from which the virus is cultured or obtained.
  • Vaccination can be conducted in conventional fashion.
  • the antigen whether a viral particle or a protein
  • a suitable diluent such as water, saline, buffered salines, complete or incomplete adjuvants, and the like.
  • the immunogen is administered using standard techniques for antibody induction, such as by subcutaneous administration of physiologically compatible, sterile solutions containing inactivated or attenuated virus particles or antigens.
  • An immune response producing amount of virus particles is typically administered per vaccinizing injection, typically in a volume of one milliliter or less.
  • a specific example of a vaccine composition includes, in a pharmacologically acceptable adjuvant, a recombinant protein or protein mixture derived from an enterically transmitted nonA/nonB viral hepatitis agent whose genome contains a region which is homologous to the 1.33 kb DNA EcoRI insert present in plasmid pTZKFl(ET1.1) carried in E ⁇ coli strain BB4, and having ATCC deposit no. 67717.
  • the vaccine is administered at periodic intervals until a significant titer of anti-ET-NANB antibody is detected in the serum.
  • the vaccine is intended to protect against ET ⁇ NANB infection.
  • vaccines prepared using proteins expressed by the 406.3-2 and 406.4-2 clones described herein and equivalents thereof, including fragments of the expressed proteins. Since these clones have already been demonstrated to be reactive with a variety of human HEV-positive sera, their utility in protecting against a variety of HEV strains is indicated.
  • the compositions can be used to prepare antibodies to ET ⁇ NANB virus particles.
  • the antibodies can be used directly as antiviral agents.
  • a host animal is immunized using the virus particles or, as appropriate, non-particle antigens native to the virus particle are bound to a carrier as described above for vaccines.
  • the host serum or plasma is collected following an appropriate time interval to provide a composition comprising antibodies reactive with the virus particle.
  • the gamma globulin fraction or the IgG antibodies can be obtained, for example, by use of saturated ammonium sulfate or DEAE Sephadex, or other techniques known to those skilled in the art.
  • the antibodies are substantially free of many of the adverse side effects which may be associated with other anti-viral agents such as drugs.
  • the antibody compositions can be made even more compatible with the host system by minimizing potential adverse immune system responses. This is accomplished by removing all or a portion of the FC portion of a foreign species antibody or using an antibody of the same species as the host animal, for example, the use of antibodies from human/human hybridomas.
  • the antibodies can also be used as a means of enhancing the immune response since antibody-virus complexes are recognized by macrophages.
  • the anti ⁇ bodies can be administered in amounts similar to those used for other therapeutic administrations of anti ⁇ body.
  • pooled gamma globulin is admini ⁇ stered at 0.02-0.1 ml/lb body weight during the early incubation of other viral diseases such as rabies, measles and hepatitis B to interfere with viral entry into cells.
  • antibodies reactive with the ET-NANB virus particle can be passively administered alone or in conjunction with another anti-viral agent to a host infected with an ET-NANB virus to enhance the immune response and/or the effectiveness of an antiviral drug.
  • anti-ET-NANB-virus antibodies can be induced by administering anti-idiotype anti- bodies as immunogens.
  • a purified anti— ET-NANB-virus antibody preparation prepared as de ⁇ scribed above is used to induce anti-idiotype antibody in a host animal.
  • the composition is administered to the host animal in a suitable diluent. Following administration, usually repeated administration, the host produces anti-idiotype antibody.
  • antibodies pro ⁇ substituted by the same species as the host animal can be used or the Fc region of the administered antibodies can be removed.
  • serum or plasma is removed to provide an antibody composition.
  • composition can be purified as described above for anti-ET-NANB virus antibodies, or by affinity chromatography using anti-ET-NANB-virus antibodies bound to the affinity matrix.
  • anti-idiotype antibodies produced are similar in conformation to the authentic ET-NANB antigen and may be used to prepare an ET-NANB vaccine rather than using a ET-NANB particle antigen.
  • the manner of injecting the antibody is the same as for vaccination purposes, namely intramuscularly, intraperitoneally, subcutaneously or the like in an effective concentration in a physiologically suitable diluent with or without adjuvant.
  • One or more booster injections may be desirable.
  • the anti-idiotype method of induction of anti-ET-NANB virus antibodies can alleviate problems which may be caused by passive administration of anti-ET-NANB-virus antibodies, such as an adverse immune response, and those associated with administration of purified blood components, such as infection with as yet undiscovered viruses.
  • the ET-NANB derived proteins of the invention are also intended for use in producing antiserum designed for pre- or post-exposure prophylaxis.
  • an ET-NANB protein, or mixture of proteins is formulated with a suitable adjuvant and administered by injection to human volunteers, according to known methods for producing human antisera.
  • Antibody response to the injected proteins is monitored, during a several- week period following immunization, by periodic serum sampling to detect the presence an anti-ET-NANB serum antibodies, as described in Section IIA above.
  • the antiserum from immunized individuals may be administered as a pre-exposure prophylactic measure for individuals who are at risk of contracting infection.
  • the antiserum is also useful in treating an individual post-exposure, analogous to the use of high titer antiserum against hepatitis B virus for post- exposure prophylaxis.
  • Monoclonal anti-virus particle antibodies or anti-idiotype antibodies can be produced as follows.
  • the spleen or lymphocytes from an immunized animal are removed and immortalized or used to prepare hybridomas by methods known to those skilled in the art.
  • a human lymphocyte donor is selected.
  • a donor known to be infected with a ET-NANB virus (where infection has been shown for example by the presence of anti-virus antibodies in the blood or by virus culture) may serve as a suitable lymphocyte donor.
  • Lymphocytes can be isolated from a peripheral blood sample or spleen cells may be used if the donor is subject to splenectomy.
  • Epstein-Barr virus (EBV) can be used to immortalize human lymphocytes or a human fusion partner can be used to produce human-human hybridomas .
  • Primary in vitro immunization with peptides can also be used in the generation of human monoclonal antibodies.
  • Antibodies secreted by the immortalized cells are screened to determine the clones that secrete antibodies of the desired specificity.
  • the antibodies For monoclonal anti-virus particle antibodies, the antibodies must bind to ET-NANB virus particles .
  • Cells producing antibodies of the desired specificity are selected.
  • Enzymes DNAse I and alkaline phosphatase were obtained from Boehringer Mannheim Biochemicals (BMB, Indianapolis, IN); EcoRI, EcoRI methylase, DNA ligase, and DNA Polymerase I, from New England Biolabs
  • EcoRI linkers were obtained from NEB; and nitro blue tetrazolium (NBT) , S-bromo-4- chloro-3-indolyl phosphate (BCIP) S-bromo-4-chloro-3- indolyl-B-D-galactopyranoside (Xgal) and isopropyl B-
  • cynos Two cynomolgus monkeys (cynos) were intravenously injected with a 10% suspension of a stool pool obtained from a second-passage cyno (cyno #37) infected with a strain of ET-NANB virus isolated from Burma cases whose stools were positive for ET ⁇ NANB, as evidenced by binding of 27-34 nm virus-like particles (VLPs) in the stool to immune serum from a known ETNANB patient.
  • VLPs virus-like particles
  • the animals developed elevated levels of alanine aminotransferase (ALT) between 24-36 days after inoculation, and one excreted 27-34 nm VLPs in its bile in the pre-acute phase of infection.
  • ALT alanine aminotransferase
  • duplex cDNA fragments were blunt-ended with T4 DNA polymerase under standard conditions (Maniatis, p. 118), then extracted with phenol/chloroform and precipitated with ethanol.
  • the blunt-ended material was ligated with EcoRI linkers under standard conditions (Maniatis, pp. 396-397) and digested with EcoRI to remove redundant linker ends. Non-ligated linkers were removed by sequential isopropanol precipitation.
  • Lambda gtlO phage vector (Huynh) was obtained from Promega Biotec (Madison, WI). This cloning vector has a unique EcoRI cloning site in the phage Cl repressor gene.
  • the cDNA fragments from above were introduced into the EcoRI site by mixing 0.5 - 1.0 ⁇ g EcoRI-cleaved gtlO, 0.5-3 ⁇ l of the above duplex fragments, 0.5 ⁇ l 10X ligation buffer, 0.5 ⁇ l ligase (200 units), and distilled water to 5 ⁇ l . The mixture was incubated overnight at 14°C, followed by in vitro packaging, according to standard methods (Maniatis, pp. 256-268).
  • the packaged phage were used to infect an E. coli hfl strain, such as strain HG415.
  • E. coli strain C600 hfl available from Promega Biotec, Madison, WI, could be used.
  • the percentage of recombinant plaques obtained with insertion of the EcoRI-ended fragments was less than 5% by analysis of 20 random plaques.
  • the resultant cDNA library was plated and phage were eluted from the selection plates by addition of elution buffer. After DNA extraction from the phage, the DNA was digested with EcoRI to release the heterogeneous insert population, and the DNA fragments were fractionated on agarose to remove phage fragments. The 500-4,000 basepair inserts were isolated and recloned into lambda gtlO as above, and the packaged phage was used to infect E_ ⁇ coli strain HG415. The percentage of successful recombinants was greater than 95%.
  • the phage library was plated on E_ ; _ coli strain HG415, at about 5,000 plaques/plate, on a total of 8 plates.
  • Duplex cDNA fragments from noninfected and ETNANB-infected cynomolgus monkeys were prepared as in Example 1.
  • the cDNA fragments were radiolabeled by random priming, using a random-priming labeling kit obtained from Boehringer-Mannheim (Indianapolis, IN).
  • Each of the sixteen clones was picked and replated at low concentration on an agar plate.
  • the clones on each plate were transferred to two nitro ⁇ cellulose ag duplicate lifts, and examined for hybrid ⁇ ization to radiolabeled cDNA probes from infected and noninfected sources, as above.
  • Clones were selected which showed selective binding for infected-source probes (i.e., binding with infected-source probes and substantially no binding with non-infected-source probes).
  • One of the clones which bound selectively to probe from infected source was isolated for further study.
  • the selected vector was identified as lambda gtlO-1.1, indicated in Figure 1.
  • this plasmid contains a unique EcoRI site adjacent a T7 polymerase promoter site, and plasmid and phage origins of replication. The sequence immediately adjacent each side of the EcoRI site is known.
  • E. coli BB4 bacteria obtained from Stratagene (La Jolla, CA, were transformed with the plasmid.
  • Radiolabeled ET-NANB probe was prepared by excising the 1.33 kb insert from the lambda gtlO-1.1 phage in Example 2, separating the fragment by gel electrophoresis, and randomly labeling as above.
  • Bacteria transfected with the above pTZKFl and containing the desired ET-NANB insert were selected by replica lift and hybridization with the radiolabeled ET-NANB probe, according to methods outlined in Example 2.
  • Example 4_ Detecting ET-NANB Sequences cDNA fragment mixtures from the bile of noninfected and ET-NANB-infected cynomolgus monkeys were prepared as above.
  • the cDNA fragments obtained from human stool samples were prepared as follows. Thirty ml of a 10% stool suspension obtained from an individual from Mexico diagnosed as infected with ET ⁇ NANB as a result of an ET-NANB outbreak, and a similar volume of stool from a healthy, non-infected individual, were layered over a 30% sucrose density gradient cushion, and centrifuged at 25,000 x g for 6 hr in an SW27 rotor, at 15°C.
  • the pelleted material from the infected-source stool contained 27-34 nm VLP particles characteristic of ET-NANB infection in the infected-stool sample.
  • RNA was isolated from the sucrose-gradient pellets in both the infected and non- infected samples, and the isolated RNA was used to produce cDNA fragments as described in Example 1.
  • the CDNA fragment mixtures from infected and non-infected bile source, and from infected and non- infected human-stool source were each amplified by a novel linker/primer replication method described in co-owned patent application serial number 07/208,512 for "DNA Amplification and Subtraction Technique," filed June 17, 1988. Briefly, the fragments in each sample were blunt-ended with DNA Pol I then extracted with phenol/chloroform and precipitated with ethanol. The blunt-ended material was ligated with linkers having the following sequence (top or 5' sequence has SEQ ID NO.21; bottom or 3'sequence has SEQ ID NO:22):
  • duplex fragments were digested with Nrul to remove linker dimers, mixed with a primer having the sequence 5'-GGAATTCGCGGCCGCTCG-3' , and then heat denatured and cooled to room temperature to form single-strand DNA/primer complexes.
  • the complexes were replicated to form duplex fragments by addition of Thermus aquaticus (Taq) polymerase and all four deoxynucleotides.
  • the amplified cDNA sequences were fractionated by agarose gel electrophoresis, using a 2% agarose matrix. After transfer of the DNA fragments from the agarose gels to nitrocellulose paper, the filters were hybridized to a random-labeled 32p probe prepared by (i) treating the pTZKFl(ETl.1) plasmid from above with EcoRI, (ii) isolating the released 1.33 kb ET-NANB fragment, and (iii) randomly labeling the isolated fragment. The probe hybridization wag performed by conventional Southern blotting methods (Maniatis, pp. 382-389).
  • Figure 2 shows the hybridization pattern obtained with cDNAs from infected (I) and non-infected (N) bile sources (2A) and from infected (I) and noninfected (N) human stool sources (2B).
  • the ET-NANB probe hybridized with fragments obtained from both of the infected sources, but was non-homologous to sequences obtained from either of the non-infected sources, thus confirming the specificity of derived sequence.
  • the pTZKFl(ET1.1) plasmid from Example 2 was digested with EcoRI to release the 1.33 kb ET-NANB insert which was purified from the linearized plasmid by gel electrophoresis.
  • the purified fragment was suspended in a standard digest buffer (0.5M Tris HC1, ' pH 7.5; 1 mg/ml BSA; lOmM MnC12) to a concentration of about 1 mg/ml and digested with DNAse I at room temperature for about 5 minutes.
  • a standard digest buffer 0.5M Tris HC1, ' pH 7.5; 1 mg/ml BSA; lOmM MnC12
  • the fragments in the digest mixture were blunt-ended and ligated with EcoRI linkers as in Example 1.
  • the resultant fragments were analyzed by electrophoresis (5-10V/cm) on 1.2% agarose gel, using PhiX174/HaeIII and lambda/HindiII size markers.
  • the 100-300 bp fraction was eluted onto NA45 strips (Schleicher and Schuell), which were then placed into 1.5 ml microtubes with eluting solution (1 M NaCl, 50 mM arginine, pH 9.0), and incubated at 67°C for 30-60 minutes.
  • the eluted DNA was phenol/chloroform extracted and then precipitated with two volumes of ethanol.
  • the pellet was resuspended in 20 ⁇ l TE (0.01 M Tris HC1, pH 7.5, 0.001 M EDTA) .
  • Lambda gtll phage vector (Huynh) was obtained from Promega Biotec (Madison, WI). This cloning vector has a unique EcoRI cloning site 53 base pairs upstream from the beta-galactosidase translation termination codon.
  • the packaged phage were used to infect E. coli strain KM392, obtained from Dr. Kevin Moore, DNAX (Palo Alto, CA) .
  • E ⁇ Coli strain Y1090 available from the American Type Culture Collection (ATCC #37197), could be used.
  • the infected bacteria were plated and the resultant colonies were checked for loss of beta-galactosidase activity-(clear plaques) in the presence of X-gal using a standard X- gal substrate plaque assay method (Maniatis). About 50% of the phage plaques showed loss of beta- galactosidase enzyme activity (recombinants) .
  • ET-NANB convalescent antiserum was obtained from patients infected during documented ET-NANB outbreaks in Mexico, Borneo, Pakistan, Somalia, and Burma. The sera were immunoreactive with VLPs in stool specimens from each of several other patients with ET ⁇ NANB hepatitis.
  • a lawn of E_ ⁇ coli KM392 cells infected with about 104 pfu of the phage stock from above was prepared on a 150 mm plate and incubated, inverted, for 5-8 hours at 37°C
  • the lawn was overlaid with a nitrocellulose sheet, causing transfer of expressed ETNANB recombinant protein from the plaques to the paper.
  • the plate and filter were indexed for matching corresponding plate and filter positions.
  • the filter was washed twice in TBST buffer (10 mM Tris, pH 8.0, 150 mM NaCl, 0.05% Tween 20), blocked with AIB (TBST buffer with 1% gelatin), washed again in TBST, and incubated overnight after addition of antiserum (diluted to 1:50 in AIB, 12-15 ml/plate).
  • the sheet was washed twice in TBST and then contacted with enzyme-labeled anti-human antibody to attach the labeled antibody at filter sites containing antigen recognized by the antiserum.
  • the filter was developed in a substrate medium containing 33 ⁇ l NBT (50 mg/ml stock solution maintained at 4°C) mixed with 16 ⁇ l BCIP (50 mg/ml stock solution maintained at 4°C) in 5 ml of alkaline phosphatase buffer (100 mM Tris, 9.5, 100 mM NaCl, 5 mM MgC12). Purple color appeared at points of antigen production, as recognized by the antiserum.
  • NBT 50 mg/ml stock solution maintained at 4°C
  • BCIP 50 mg/ml stock solution maintained at 4°C
  • alkaline phosphatase buffer 100 mM Tris, 9.5, 100 mM NaCl, 5 mM MgC12
  • the areas of antigen production determined in the previous step were replated at about 100-200 pfu on an 82 mm plate.
  • the identified plaques were picked and eluted in phage buffer (Maniatis, p. 443).
  • a series of subclones derived from the original pTZKFl (ET1.1) plasmid from Example 2 were isolated using the same techniques described above. Each of these five subclones were immunoreactive with a pool of anti-ET antisera noted in C.
  • the subclones contained short sequences from the "reverse" sequence set forth previously. The beginning and ending points of the sequences in the subclones (relative to the full "reverse” sequence), are identified in the table below.
  • the coding system for this epitope falls between nucleotide 2 (S -end) and 101 (3 -end).
  • Two particularly preferred subclones for use in preparing polypeptides containing epitopes specific for HEV are the 406.3-2 and 406.4-2 clones whose sequences are set forth above. These sequences were isolated from an amplified cDNA library derived from a
  • polypeptides expressed by these clones have been tested for immunoreactivity against a number of different human HEV-positive sera obtained from sources around the world. As shown in Table 3 below, 8 sera immunoreactive with the polypeptide expressed by the 406.4-2, and 6 sera immunoreacted with polypeptide expressed by the 406.3-2 clone.
  • the Table also shows reactivity of the various human sera with the Y2 clone identified in Table 1 above. Only one of the sera reacted with the polypeptide expressed by this clone.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Saccharide Compounds (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US1991/002368 1990-04-05 1991-04-05 Enterically transmitted non-a/non-b hepatitis viral agent and characteristic epitopes thereof Ceased WO1991015603A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
CA002057052A CA2057052C (en) 1990-04-05 1991-04-05 Enterically transmitted non-a/non-b hepatitis viral agent and characteristic epitopes thereof
DE69133599T DE69133599D1 (de) 1990-04-05 1991-04-05 Enterisch übertragendes non-a/non-b-hepatitis-virus agens und charakteristische epitope von selbigem
EP91908163A EP0476130B1 (en) 1990-04-05 1991-04-05 Enterically transmitted non-a/non-b hepatitis viral agent and characteristic epitopes thereof
KR1019910701774A KR0178399B1 (ko) 1990-04-05 1991-04-05 장을 통해 전염되는 비a비b형 간염 바이러스 병원체 및 그것의 특유한 에피토프

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US505,888 1990-04-05
US50588890A 1990-07-05 1990-07-05

Publications (1)

Publication Number Publication Date
WO1991015603A1 true WO1991015603A1 (en) 1991-10-17

Family

ID=24012303

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1991/002368 Ceased WO1991015603A1 (en) 1990-04-05 1991-04-05 Enterically transmitted non-a/non-b hepatitis viral agent and characteristic epitopes thereof

Country Status (10)

Country Link
EP (1) EP0476130B1 (https=)
JP (2) JPH04506608A (https=)
KR (1) KR0178399B1 (https=)
CN (1) CN1075112C (https=)
AT (1) ATE400658T1 (https=)
AU (1) AU644878B2 (https=)
CA (1) CA2057052C (https=)
DE (1) DE69133599D1 (https=)
TW (1) TW210355B (https=)
WO (1) WO1991015603A1 (https=)

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0510952A1 (en) * 1991-04-26 1992-10-28 Immuno Japan Inc. Oligonucleotide primers and their application for high-fidelity detection of non-a, non-b hepatitis virus
WO1993014116A1 (en) * 1992-01-17 1993-07-22 Genelabs Technologies, Inc. Hepatitis e virus peptide antigens and antibodies
WO1993014208A3 (en) * 1992-01-17 1993-10-14 Genelabs Tech Inc Hepatitis e virus vaccine and method
WO1994009032A1 (en) * 1992-10-21 1994-04-28 United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods and compositions for detecting anti-hepatitis e virus activity
US5686239A (en) * 1988-06-17 1997-11-11 Genelabs Technologies, Inc. Hepatitis E virus peptides and methods
US5741490A (en) * 1988-06-17 1998-04-21 Genelabs Technologies, Inc. Hepatitis E virus vaccine and method
US5824507A (en) * 1994-05-20 1998-10-20 Genelabs Technologies, Inc. Hepatitis G virus and molecular cloning thereof
US5859230A (en) * 1992-07-30 1999-01-12 Genelabs Technologies, Inc. Non-A/non-B/non-C/non-D/non-E hepatitis agents and molecular cloning thereof
US5874563A (en) * 1994-05-20 1999-02-23 Genelabs Technologies, Inc. Hepatitis G virus and molecular cloning thereof
US6054567A (en) * 1997-04-11 2000-04-25 The United States Of America As Represented By The Department Of Health And Human Services Recombinant proteins of a pakistani strain of hepatitis E and their use in diagnostic methods and vaccines
US6207416B1 (en) 1992-09-18 2001-03-27 The United States Of America As Represented By The Department Of Health And Human Services Recombinant proteins of a Pakistani strain of hepatitis E and their use in diagnostic methods and vaccines
US6214970B1 (en) 1988-06-17 2001-04-10 Genelabs Technologies, Inc. Hepatitis E virus antigens and uses therefor
US6287759B1 (en) 1992-09-18 2001-09-11 The United States Of America As Represented By The Department Of Health And Human Services Recombinant proteins of a Pakistani strain of hepatitis E and their use in diagnostic methods and vaccines
US6291641B1 (en) 1988-06-17 2001-09-18 Genelabs Technologies, Inc. Hepatitis E virus antigens and uses therefor
US6458562B1 (en) 1998-04-09 2002-10-01 The United States Of America As Represented By The Secretary Of Health And Human Services Recombinant proteins of a Pakistani strain of hepatitis E and their use in diagnostic methods and vaccines
US6787145B1 (en) 1992-09-18 2004-09-07 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Recombinant proteins of a pakistani strain of hepatitis E and their use in diagnostic methods and vaccines
EP1400588A4 (en) * 2001-06-25 2006-07-19 Toshiba Kk POLYNUCLEOTIDE PROBE AND PRIMER ORIGINATING IN JAPANESE HEPATITIS E VIRUS, FISH WITH SUCH PROBE, KITS HAVING THE SAME, AND METHOD FOR DETECTING HEPATITIS E VIRUS USING THE SAME

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1059928C (zh) * 1992-09-29 2000-12-27 天津普生生物科技有限公司 利用大肠杆菌制备可用来检验c型肝炎之抗原蛋白的方法

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1985001517A1 (en) * 1983-09-30 1985-04-11 Massachusetts Institute Of Technology PRODUCTION OF cDNA REPRESENTING HEPATITIS A VIRAL SEQUENCES
US4659678A (en) * 1982-09-29 1987-04-21 Serono Diagnostics Limited Immunoassay of antigens
US4683195A (en) * 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4871659A (en) * 1986-04-16 1989-10-03 Institut Pasteur Reagent for detecting non-A, non-B viral hepatitis (NANBH) and an immunoenzymatic method for detecting NANBH antigens in fecal extracts
WO1989012641A1 (en) * 1988-06-17 1989-12-28 Genelabs Incorporated Enterically transmitted non-a/non-b hepatitis viral agent

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4659678A (en) * 1982-09-29 1987-04-21 Serono Diagnostics Limited Immunoassay of antigens
WO1985001517A1 (en) * 1983-09-30 1985-04-11 Massachusetts Institute Of Technology PRODUCTION OF cDNA REPRESENTING HEPATITIS A VIRAL SEQUENCES
US4683195A (en) * 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683195B1 (https=) * 1986-01-30 1990-11-27 Cetus Corp
US4871659A (en) * 1986-04-16 1989-10-03 Institut Pasteur Reagent for detecting non-A, non-B viral hepatitis (NANBH) and an immunoenzymatic method for detecting NANBH antigens in fecal extracts
WO1989012641A1 (en) * 1988-06-17 1989-12-28 Genelabs Incorporated Enterically transmitted non-a/non-b hepatitis viral agent

Cited By (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6455492B1 (en) * 1988-06-17 2002-09-24 Genelabs Technologies, Inc. Hepatitis E virus vaccine and method
US5686239A (en) * 1988-06-17 1997-11-11 Genelabs Technologies, Inc. Hepatitis E virus peptides and methods
US6291641B1 (en) 1988-06-17 2001-09-18 Genelabs Technologies, Inc. Hepatitis E virus antigens and uses therefor
US5741490A (en) * 1988-06-17 1998-04-21 Genelabs Technologies, Inc. Hepatitis E virus vaccine and method
US5770689A (en) * 1988-06-17 1998-06-23 Genelabs Technologies, Inc. Hepatitis E virus ORF Z peptides
US6214970B1 (en) 1988-06-17 2001-04-10 Genelabs Technologies, Inc. Hepatitis E virus antigens and uses therefor
EP0510952A1 (en) * 1991-04-26 1992-10-28 Immuno Japan Inc. Oligonucleotide primers and their application for high-fidelity detection of non-a, non-b hepatitis virus
WO1993014208A3 (en) * 1992-01-17 1993-10-14 Genelabs Tech Inc Hepatitis e virus vaccine and method
WO1993014116A1 (en) * 1992-01-17 1993-07-22 Genelabs Technologies, Inc. Hepatitis e virus peptide antigens and antibodies
US5859230A (en) * 1992-07-30 1999-01-12 Genelabs Technologies, Inc. Non-A/non-B/non-C/non-D/non-E hepatitis agents and molecular cloning thereof
US6706873B1 (en) 1992-09-18 2004-03-16 The United States Of America As Represented By The Department Of Health And Human Services Recombinant proteins of a pakistani strain of hepatitis E and their use in diagnostic methods and vaccines
US6287759B1 (en) 1992-09-18 2001-09-11 The United States Of America As Represented By The Department Of Health And Human Services Recombinant proteins of a Pakistani strain of hepatitis E and their use in diagnostic methods and vaccines
US6787145B1 (en) 1992-09-18 2004-09-07 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Recombinant proteins of a pakistani strain of hepatitis E and their use in diagnostic methods and vaccines
US6207416B1 (en) 1992-09-18 2001-03-27 The United States Of America As Represented By The Department Of Health And Human Services Recombinant proteins of a Pakistani strain of hepatitis E and their use in diagnostic methods and vaccines
US6696242B1 (en) 1992-09-18 2004-02-24 The United States Of America As Represented By The Department Of Health And Human Services Recombinant proteins of a Pakistani strain of hepatitis E and their use in diagnostic methods and vaccines
US6022685A (en) * 1992-10-21 2000-02-08 United States Of America Methods and compositions for detecting anti-hepatitis E virus activity
US5736315A (en) * 1992-10-21 1998-04-07 National Institute Of Health Methods and compositions for detecting anti-hepatitis E virus activity
WO1994009032A1 (en) * 1992-10-21 1994-04-28 United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods and compositions for detecting anti-hepatitis e virus activity
US5824507A (en) * 1994-05-20 1998-10-20 Genelabs Technologies, Inc. Hepatitis G virus and molecular cloning thereof
US5874563A (en) * 1994-05-20 1999-02-23 Genelabs Technologies, Inc. Hepatitis G virus and molecular cloning thereof
US5856134A (en) * 1994-05-20 1999-01-05 Genelabs Technologies, Inc. Hepatitis G virus and molecular cloning thereof
US6054567A (en) * 1997-04-11 2000-04-25 The United States Of America As Represented By The Department Of Health And Human Services Recombinant proteins of a pakistani strain of hepatitis E and their use in diagnostic methods and vaccines
EP1958958A1 (en) 1997-04-11 2008-08-20 THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES Recombinant proteins of a pakistani strain of hepatitis E and their use in diagnostic methods and vaccines
US6458562B1 (en) 1998-04-09 2002-10-01 The United States Of America As Represented By The Secretary Of Health And Human Services Recombinant proteins of a Pakistani strain of hepatitis E and their use in diagnostic methods and vaccines
EP1400588A4 (en) * 2001-06-25 2006-07-19 Toshiba Kk POLYNUCLEOTIDE PROBE AND PRIMER ORIGINATING IN JAPANESE HEPATITIS E VIRUS, FISH WITH SUCH PROBE, KITS HAVING THE SAME, AND METHOD FOR DETECTING HEPATITIS E VIRUS USING THE SAME

Also Published As

Publication number Publication date
ATE400658T1 (de) 2008-07-15
KR0178399B1 (ko) 1999-04-01
CA2057052A1 (en) 1991-10-06
EP0476130A1 (en) 1992-03-25
AU644878B2 (en) 1993-12-23
CA2057052C (en) 2009-06-30
CN1063507A (zh) 1992-08-12
EP0476130B1 (en) 2008-07-09
CN1075112C (zh) 2001-11-21
DE69133599D1 (de) 2008-08-21
EP0476130A4 (en) 1993-05-19
JP2004043470A (ja) 2004-02-12
TW210355B (https=) 1993-08-01
KR920701481A (ko) 1992-08-11
JPH04506608A (ja) 1992-11-19
AU7765191A (en) 1991-10-30

Similar Documents

Publication Publication Date Title
AU644878B2 (en) Enterically transmitted non-A/non-B hepatitis viral agent and characteristic epitopes thereof
CA2065287C (en) New hcv isolates
JP2656996B2 (ja) Nanbvの診断用薬
JP3746291B2 (ja) E型肝炎ウィルスワクチン及びその接種方法
US5885768A (en) Hepatitis E virus peptide antigen and antibodies
WO1994018217A1 (en) Non-a, non-b, non-c, non-d, non-e hepatitis reagents and methods for their use
CA1341464C (en) Hepatitis e, an enterically transmitted hepatitis viral agent
JP2007513604A (ja) 新規エンテロウイルス、ワクチン、医薬および診断キット
WO1995021922A2 (en) Non-a, non-b, non-c, non-d, non-e hepatitis reagents and methods for their use
US5741490A (en) Hepatitis E virus vaccine and method
CA2055149A1 (en) Non-a, non-b hepatitis virus related antigen, antibody, detection systems, polynucleotides and polypeptides
US7094406B2 (en) Enterically transmitted non-A/non-B hepatitis viral agent and characteristic epitopes thereof
Uchida et al. Hepatitis E virus: cDNA cloning and expression
US5824649A (en) DNA sequences of enterically transmitted non-A/non-B hepatitis viral agent and characteristic epitopes thereof
HK1001542B (en) Hepatitis e virus vaccine and method
HK1001542A1 (en) Hepatitis e virus vaccine and method
EP0745129A1 (en) Non-a, non-b, non-c, non-d, non-e hepatitis reagents and methods for their use

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP KR

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 2057052

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1991908163

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1991908163

Country of ref document: EP