WO1991014696A1 - Conjugues a base de disulfure d'oligonucleotide et d'un agent de transport - Google Patents

Conjugues a base de disulfure d'oligonucleotide et d'un agent de transport Download PDF

Info

Publication number
WO1991014696A1
WO1991014696A1 PCT/US1991/002224 US9102224W WO9114696A1 WO 1991014696 A1 WO1991014696 A1 WO 1991014696A1 US 9102224 W US9102224 W US 9102224W WO 9114696 A1 WO9114696 A1 WO 9114696A1
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotide
oligonucleotide conjugate
cell
nucleic acid
conjugate
Prior art date
Application number
PCT/US1991/002224
Other languages
English (en)
Inventor
John A. Latham
Kuei-Ying Lin
Mark Matteucci
Original Assignee
Gilead Sciences, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gilead Sciences, Inc. filed Critical Gilead Sciences, Inc.
Priority to JP91508586A priority Critical patent/JPH05505941A/ja
Publication of WO1991014696A1 publication Critical patent/WO1991014696A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6841—In situ hybridisation
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/554—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being a steroid plant sterol, glycyrrhetic acid, enoxolone or bile acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays

Definitions

  • compositions and - methods for enhancing the delivery of an oligo ⁇ nucleotide into a viable cell or organism comprise oligonucleotide conjugates consisting of an oligonucleotide conjugated via a molecular linker containing at least one j ⁇ disulfide bond, to an agent which facilitates transport across a cell membrane, or across the blood-brain barrier. Also included within the present invention are oligonucleotide conjugates containing a molecular linker having at least one disulfide bond wherein the
  • oligonucleotide 20 directed to methods for inhibiting the expression of a nucleic acid sequence in a cell comprising providing the cell with an oligonucleotide conjugate of the invention.
  • the oligonucleotide can hybridize to the nucleic acid
  • the invention is directed to methods for detecting a nucleic acid sequence in a cell comprising contacting the cell with an oligonucleotide conjugate of the invention, in which the oligonucleotide can hybridize to the nucleic acid
  • the present invention also includes a method for detecting the presence of a nucleic acid sequence of an exogenous infectious agent utilizing oligomer-disulfide conjugates in diagnostic
  • the oligomer-disulfide conjugates utilized in the diagnostic probe includes covalent crosslinking agents, which results in increased sensitivity and reduced background in diagnostic or detection assays.
  • Pharmaceutical compositions and therapeutic methods are also provided.
  • a biotinylated mononucleotide or mononucleo- side linked to an organic basic group via a chemically cleavable bond, e.g. a disulfide linkage, has also recently been disclosed (Herman, U.S. Patent No. ⁇ 4,772,691, issued September 20, 1988). It was suggested that such compositions may be useful in isolating target macromolecules from crude physiological mixtures. Specifically, it was suggested that the biotinylated nucleotides may contact a target on
  • the nucleotide may be cleaved via the cleavable bond to obtain the affinity-macromolecule-target macromolecule complex from which the target macromolecule may be obtained.
  • glutathione a cysteine containing peptide
  • 1-5 mM reduced form
  • target site involves attaching the drug to a carrier capable of transporting the drug from the site of application directly to the site of action (reviewed in
  • Such carriers may be divided into three categories: (1) linear polymers; (2) cells; and (3) three dimensional systems (e.g. liposomes) .
  • Linear polymers are usually covalently linked to the drug via a hydrolyzable bond (reviewed in Hoes and Feijen, 1989, in Drug Carrier Systems, eds. F.H.D. Roerdink and A.M. Kroon, John Wiley & Sons, N.Y., pp. 57-109) .
  • the linkage between the drug and the carrier is cleaved effecting the release of the drug.
  • the carrier is biodegradable.
  • Such carriers include proteins, which are cleaved by 5 proteolytic enzymes inside the cell, polysaccharides which are cleaved by glycosidases or vinyl polymers, which contain hydrolytically labile ester bonds.
  • the success of this approach is dependent on a number of factors which include the conformation of the polymeric 0 carrier and the stability of the drug-carrier bond. There is also the risk of incomplete cleavage of the drug-carrier bond.
  • Another approach involves linking a non-biodegradable polymer to the drug via a hydrolyz- able linkage.
  • Another example involved the conjugation of methotrexate to poly (D-lysine) via a disulfide linkage
  • Cells could potentially be used to deliver a drug to a specific target site.
  • erythro- cytes may be useful in delivering agents to the reticuloendothelial system.
  • cells are limited in both the range of agents which they can carry and 5 target accessibility.
  • the third approach i.e. the use of three dimensional systems such as liposomes and microspheres has the advantage of containing agents within a well protected space.
  • these systems have the disadvantages of being limited in tissue selectivity and their size-imposed inability to cross most normal membrane barriers.
  • Access of drugs to a given target site may also be prevented due to gross anatomical barriers.
  • a barrier is the blood-brain barrier.
  • a chimeric peptides that include a peptide that acts as a neuropharmaceutical agent conjugated, e.g., by disulfide linkage, to a transportable peptide that is capable of crossing the blood-brain barrier at a relatively high rate by receptor-mediated transcytosis (PCT Application Publication No. WO 89/10134, published April 25, 1988).
  • phosphorothioates may in addition to binding to complementary target nucleic acid sequences also direct the inhibition of primer binding to HIV reverse transcriptase (Matsukura et al., 1987, Proc. Natl. Acad. Sci. U.S.A. 84:7706- f J- ⁇ J ) • All . cxu ⁇ wc .IUI JCJ. w wn u ⁇ o «-. ⁇ . ⁇ w MCCII COCJ. iwcu for polymerases using polynucleotides , including partially thiolated polycytidylic acid (reviewed in Stein and Cohen, 1988, Cancer Res. 48:2659-2668).
  • Another approach has involved conjugating the oligonucleotide to a molecule that will increase the efficiency of uptake of the oligonucleotide by the cell.
  • conjugates include cholesteryl- conjugated oligonucleotides (Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556) and a poly-
  • Another example includes an oligonucleotide joined through a linking arm to a group that imparts amphophilic character to the final product in order to increase the efficiency of membrane transport (PCT Publication No. WO 88/09810, published December 15, 1988) .
  • Another approach that has been taken involves the use of reactive oligonucleotides, i.e. antisense oligonucleotides linked to reactive agents that are able to modify the target nucleic acid.
  • One such group of reacting agents are intercalating agents which can bind to the duplex by internal insertion between adjacent base pairs or bind to external nucleoside and phosphate elements respectively.
  • inter ⁇ alators that have been attached to oligonucleo ⁇ tides and oligonucleotide analogs include acridine, anthridium, and photoactivatable psoralen (reviewed in zon, 1988, Pharm. Res. 5:539-549).
  • Another such group of reactive groups coupled to oligonucleotides include metal complexes such as EDTA-Fe(II) , o-phenanthroline- Cu(I), or porphyrin-Fe(II) (reviewed in Krol et al. , 1988, BioTechniques 6:958-976) .
  • These compounds can generate hydroxyl radicals in the presence of molecular oxygen and a reducing agent. The resulting radicals can cleave the complementary strand following attack on the target nucleic acid backbone.
  • One problem with using such compounds is since such oligonucleotides are reactive, they may be subject to autodegradation.
  • Pyrimidine oligonucleotides 15 to 18 nucleotides have been shown to bind with sequence specific dependence to homopurine sites in duplex DNA (Moser and Dervan, 1987, Science 238:634-650). These oligonucleotides bind in the major groove, parallel to the purine strand of Watson-Crick double-helical DNA.
  • the binding affinity and specificity of the pyrimidine oligonucleotide for duplex DNA has been shown to be sensitive to pH, organic cosolvent, added cations, and temperature.
  • homopyridine oligonucleotides have been suggested that the sequence specificity of homopyridine oligonucleotides would render such oligonucleotides useful as tools for mapping chromosomes when equipped with DNA cleaving moieties (Moser and Dervan, 1987, Science 238:645-650).
  • Micromolar concentrations of homopyrimidine oligo ⁇ deoxyribonucleotides have also been shown to block recognition of double helical DNA by prokaryotic modifying enzymes and a eukaryotic transcription at a homopurine target site (Maher et al. , 1989, Science 245:725-730).
  • results of a study of 20 base triplets indicate that the triple helix can be extended from homopurine to mixed sequences (Griffin and Dervan, 1989, Science 245:967-971).
  • compositions of the present invention comprise oligonucleotide conjugates.
  • oligo ⁇ nucleotide conjugates consist of an oligonucleotide conjugated, via a molecular linker consisting of at least one disulfide bond, to an agent (termed herein
  • compositions of the present invention also comprise oligonucleotide conjugates containing a molecular linker having at least one disulfide bond wherein the molecular linker confers stability under extracellular conditions but is labile under intracellular conditions.
  • the disulfide linkage of the molecular linker is cleaved during or after transport of the composition into the cell.
  • the oligonucleotide portion of the conjugate consists of at -li-
  • the oligonucleotide portion of the conjugate consists of 6-50 nucleotides, and is capable of hybridizing to at least a portion of a nucleic acid sequence within the target cell.
  • the transport agent may be selected from the group including but not limited to cholesterol, a peptide, a protein, a lipid, a saccharide, a nucleoside or analog thereof, an antibody, and a biocompatible polymer. In a specific embodiment, the transport agent is cholesterol.
  • the invention further provides pharmaceutical compositions comprising an effective amount of the oligonucleotide conjugates of the invention in a pharmaceutically acceptable carrier.
  • compositions of the invention are also provided.
  • the invention is thus directed to therapeutic methods involving increased delivery of a therapeutically effective oligonucleotide into a cell, comprising providing the cell with a composition comprising the oligonucleotide conjugated to a transport agent via a molecular linker containing at least one disulfide linkage.
  • the invention is directed to methods for inhibiting the expression of a nucleic acid sequence in a procaryotic or eucaryotic cell comprising providing the cell with an effective amount of a composition comprising an oligonucleotide conjugate of the invention.
  • the expression of the nucleic acid sequence in the cell is inhibited by hybridization of the oligonucleotide with the nucleic acid sequence in the cell.
  • such composition may inhibit the expression of a nucleic acid in a cell by inhibiting the action of polymerases in the cell.
  • such composition may inhibit the expression of a nucleic acid sequence in a cell by forming a triple helix with a double-stranded nucleic acid sequence in the cell.
  • the compositions can be effective antiviral, antifungal, or antibacterial agents.
  • these compositions may be used to inhibit the expression of cellular genes such as cellular oncogenes.
  • the invention is also directed to methods for detecting a nucleic acid sequence within a procaryotic or eucaryotic cell comprising providing a viable cell with a composition comprising an oligonucleotide conjugate of the invention, in which the oligonuc ⁇ leotide thereof is (a) linked to a detectable label, and (b) is capable of hybridizing to the nucleic acid sequence within the cell.
  • the invention is also directed to methods for detecting a nucleic acid sequence utilizing oligonucleotide-disulfide conjugates in a diagnostic probes comprising an indirect binding assay whereby human body fluids, cell or tissue extracts are screened - ⁇ ⁇ ⁇ - - ⁇ * ⁇ i ⁇ k4 ⁇ TYWT of a pathogen or gene sequence associated with a pathological state whereby an oligonucleotide probe containing a reporter group linked to the oligonucleotide via a disulfide linker can be added to the material containing the target DNA sequence and the reporter group may be released and measured from the hybrid target/probe DNA complex by adding reducing agents.
  • the indirect binding assay can be modified such that the oligonucleotide probe containing a linker group with a free thiol group can be hybridized with DNA bound on to a support membrane.
  • a reporter group containing a free thiol group can then be attached to the free thiol group of the oligonucleotide linker complexed with the target DNA, by formation of a disulfide linkage under oxidizing conditions. If desired, the reporter group target DNA linkage can be subsequently cleaved by exposure to reducing conditions, followed by detection of the reporter group.
  • Oligonucleotides in diagnostic detection assays can be further modified in order to increase sensitivity and reduce background through the incorporation of hybridization-triggered specific crosslinking agents (see e.g., Meyer et al., 1989, J.Am. Chem. Soc. 111:8517-8519; Birg et al., 1990, 10 Nucl. Acids Res. 18:2901-2907; Uhlmann and Peyman, 1990, Chemical Reviews 90(4) :543).
  • Another modification of the above disclosed indirect binding assay involves utilizing probes containing reporter groups and disulfide linkers in 15 combination with nucleic acid analogs that allow sequence specific binding to double stranded DNA bound to a membrane, thereby forming triple helix structures.
  • the indirect binding assay can additionally be modified utilizing double stranded oligonucleotides 20 (containing the binding site sequence recognized by a cognate DNA-binding protein) to bind specifically to and isolate DNA binding proteins. Additionally, the assay can be modified to use commercially available solid support resins derivatized with thiol groups
  • oligonucleotide as defined herein is a DNA or RNA sequence comprising at least 6 nucleotides, with an upper limit of about 50 nucleotides.
  • the oligonucleotide may be single-stranded or double-
  • the oligonucleotide may be modified at the base moiety, sugar moiety, or phosphate backbone.
  • the oligonucleotide may also include other appending groups such as peptides. Portions of the phosphate backbone may be replaced by other moieties.
  • a “peptide” is a fragment of a protein containing at least one amino acid.
  • the peptide may be modified at any reactive site, e.g. amide linkage, and at one or more of the amino acids in the peptide.
  • the peptide may also include other appending groups.
  • oligonucleotide disulfide conjugate as used herein means an oligonucleotide linked to another entity via a disulfide group.
  • reporter group as used herein means a entity capable of being detected.
  • reporter group includes but is not limited to enzymes, fluorescent labels, radioactive labels and biotin avidin labels.
  • FIGURES Figure 1 shows the structure of CHOLESTEROL- TC-R-S-S-R-CAGTGATT.
  • Figure 3 shows an autoradiogram of
  • CHOLESTEROL-TC-R-S-S-R-CAGTGATTTTTTTCTCCAT for 0, 4, and 48 hours with H938 cells.
  • SM represents starting material, and R represents sample reduced in vitro with 10 mM DTT.
  • Figure 4 shows the effect of incubating CHOLESTEROL-TC-R-S-S-R-CAGTGATTTTTTTCTCCAT in RPMI medium + 15% heat inactivated fetal calf serum (FCS) for 0, 30, 60, and 180 minutes.
  • FCS heat inactivated fetal calf serum
  • C represents control, i.e.. compound not incubated in RPMI + 15% heat inactivated FCS.
  • the present invention relates to compositions and methods for enhancing the delivery of an oligonuc ⁇ leotide into a viable cell or organism.
  • the composi- tions of the invention comprise oligonucleotide conjugates. These oligonucleotide conjugates consist of an oligonucleotide conjugated, via a molecular linker consisting of at least one disulfide bond, to an agent (termed herein "transport agent") which facilitates transport across an outer cell membrane, and/or across the blood-barrier.
  • the oligonucleotide conjugates contain a molecular linker having at least one disulfide bond wherein the molecular linker confers stability under extracellular conditions but is labile under intracellular conditions.
  • the disulfide linkage of the molecular linker is cleaved during or after transport of the composition into the cell.
  • the invention further provides pharmaceutical compositions comprising an effective amount of the oligonucleotide conjugates of the invention in a pharmaceutically acceptable carrier.
  • Methods for treatment of various diseases and disorders comprising administering the pharmaceutical compositions of the invention are also provided.
  • the invention is directed to methods for inhibiting the expression of a nucleic acid sequence in a procaryotic or eucaryotic cell comprising providing the cell with an effective amount of a composition comprising an oligonucleotide conjugate of the invention.
  • the invention is also directed to methods for detecting a nucleic acid sequence within a procaryotic or eucaryotic cell comprising providing a viable cell with a composition comprising an oligonucleotide conjugate of the invention, in which the oligonucleotide thereof is (a) linked to a detectable label, and (b) is capable of hybridizing to the nucleic acid sequence within the cell.
  • the invention is also directed to methods for detecting a nucleic acid sequence utilizing oligonucleotide-disulfide conjugates in a diagnostic probes comprising an indirect binding assay whereby human body fluids, cell or tissue extracts are screened for the presence of exogenous target DNA of a pathogenic organism, whereby an oligonucleotide probe containing a reporter group linked to an oligonucleotide via a disulfide linker can be added to the material containing the target DNA sequence, and the reporter group may be released and measured from the hybrid target/probe DNA complex by adding reducing agents.
  • the indirect binding assay can be modified such that the oligonucleotide probe containing a linker group with a free thiol group can be hybridized to DNA or RNA bound to a support membrane.
  • a reporter group containing a free thiol group can then be attached to the free thiol group of the oligonucleotide linker complexed with the target DNA by formation of a disulfide linkage under oxidizing conditions. If desired, the disulfide linkage may be subsequently cleaved and the reporter group detected.
  • Oligonucleotides in diagnostic detection assays can be further modified in order to increase sensitivity and reduce background through the incorporation of hybridization-triggered specific crosslinking agents (see e.g., Meyer et al., 1989, J. Am. Chem. Soc. 111:8517—8519; Berg et al., 1990, Nucl. Acids REs. 18:2901-2907; Uhlmann and Peyman, 1990, Chemical Reviews 90(4):543).
  • Another modification of the above disclosed indirect binding assay involves utilizing probes containing reporter groups and disulfide linkers that also contain nucleotide sequence specific binding to double stranded DNA, thereby forming triple helix structures.
  • an analog includes, but is not limited to, 5-methylcytosine (Mayer et al., 1989, Science 245:725-730).
  • the indirect binding assay can additionally be modified utilizing double stranded oligonucleotides (containing the binding site sequence recognized by a cognate DNA-binding protein) to bind specifically to and isolate DNA binding proteins.
  • a binding assay can be carried out using commercially available solid support resins ⁇ X* ⁇ i» XJ»o& - u ⁇ *o * c ⁇ ** ⁇ to attach to thiol groups on oligonucleotides to form a disulfide linkage. Subsequent binding of the oligonucleotide to target DNA sequences can be used to isolate such target DNA sequences. The bound complex may then be released from the solid support resin by exposure to reducing conditions.
  • the invention provides compositions for facilitating the uptake of an oligonucleotide by a viable cell.
  • the disulfide linkage within the oligonucleotide conjugate can be cleaved via intracellular reduction, freeing the oligonucleotide from the transport agent.
  • the resulting product is a free thiol which under the high intracellular reducing condition- is capable of seeking its target of interest.
  • the molecular linker in the conjugates of the invention preferably comprises a hydrocarbon structure containing, at either or both of its termini or internally, at least one disulfide linkage between the oligonucleotide and the transport agent.
  • the molecular linker may contain heteroatoms, an amino acid or peptide, nucleoside or nucleotide, etc. Alternatively, the molecular linker may consist solely of a disulfide.
  • the molecular linker containing one or more disulfide groups can be introduced at either the 5' or 3• terminus of the oligonucleotide, or internally. In specific embodiments, the molecular linker can be introduced at the 5' position of a pyrimidine, the 8' position of a purine, or the 2' position of a sugar within the oligonucleotide.
  • the molecular linker has the formula:
  • X is 0, S , S , NR l f CH 2 , C (R ! ) 2 , or C;
  • Y is H, Ch 3 , alkyl, aryl or C when
  • X NRi, CH 2 or C fR j ,* and Ri is H, CH 3 , alkyl or aryl .
  • the above described molecular linker has a controllable t% in vivo, facilitating its use as a prodrug/transport component.
  • Utilizing these molecular linkers in the oligonucleotide conjugates of the present invention confers stability to the disulfide bond found in the molecular linker under extracellular conditions but allows for cleavage of the disulfide bond under intracellular conditions. This allows for increased stability of the oligonucleotide conjugate prior to transport into the cell, but provides cleavage of the disulfide bond during or after transport of the composition into the cell.
  • the regulation, in vivo, of the disulfide bond stability is done by varying the groups adjacent to the disulfide bond in the molecular linker. Stability is increased by having election withdrawing groups near the disulfide bond.
  • X is 0 or NH 2
  • Y is CH 2CH 2 or CO
  • R* is H or CH 3 .
  • oligonucleotide conjugates of the present invention provided a t% of >24 hours under extracellular conditions i.e., in a tissue culture medium and a t% of ⁇ 1 hour inside a cell.
  • This increased stability under extracellular conditions as opposed to intracellular conditions is shown by a redox potential that is in the range of about -200mV to about -230mV. This is shown in Example 7.8 of the present application.
  • the oligonucleotide may be conjugated to the transport agent using various procedures known in the art (see for example, Chu and Orgel, 1988, Nucl. Acids
  • the disulfide linkage may be introduced by reacting the oligonucleotide with a bifunctional reagent containing the disulfide linkage so that the oligonucleotide comprises at least one disulfide linkage.
  • reagents include but are not limited to 2-hydroxyethyl disulfide cystamine (Chu and Orgel, 1988, Nucl. Acids
  • oligonucleotide comprising the disulfide linkage is then reacted with the transport agent containing a free thiol group.
  • a bifunctional agent may be reacted with the transport agent and the resulting product may be subsequently reacted with the oligonucleotide containing a free thiol group, forming a oligonucleotide-transport agent conjugate.
  • a bifunctional reagent which uses disulfide as a junction piece and then is capable of cross-reaction with either proteins or DNA (RNA) can be used.
  • the conjugation methods described in the example Section 6, infra, or a modification thereof, can be used.
  • conjugation can be carried out by use of the reagent N-succinimidyl 3-(2-pyridyldithio) propionate (SPDP; Pierce Chemical Co.) (See e.g., Jung et al., 1981, Biochem. Biophys. Res. Commun. 101:599- 606) .
  • SPDP readily modifies free-amino groups via formation of an amide linkage. At the same time, this in a second reaction involving disulfide exchange.
  • Coupling is achieved via disulfide exchange with an entity containing a free thiol via displacement of 2- thiopyridinone.
  • the resulting product contains the two molecules joined via a reducible disulfide linkage.
  • the oligonucleotide portion of the conjugates of the invention may be DNA or RNA, single-stranded or double-stranded.
  • the oligonucleotide is single-stranded DNA.
  • the oligonucleotide portion of the conjugate consists of 6-50 nucleotides, with a size of 8-30 nucleotides most preferred.
  • the oligonucleo- tide portion of the conjugate consists of 6-50 nucleo ⁇ tides, and is capable of hybridizing to at least a portion of a nucleic acid sequence within the target cell.
  • the oligonucleotide may be modified at any position on its structure with substituents generally known in the art.
  • the oligonucleotide may comprise at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil, 5-bromo- uracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D- galactosylqueosine, inosine, N6-isopentenyladenine, 1- methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5- methylcytosine, N6-adenine, 7-methylguanine, 5-methyl-
  • the oligonucleotide comprises at least one modified sugar moiety selected from the group including but not limited to arabinose,
  • the oligonucleo- tide comprises at least one modified phosphate backbone selected from the group consisting of a phosphoro- thioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphos- phonate, an alkyl phosphotriester, and a formacetal or analog thereof.
  • the oligonucleo ⁇ tide is an ⁇ -anomeric oligonucleotide.
  • oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual ⁇ -units, the strands run parallel to each other (Gautier et al, 1987, Nucl. Acids Res. 15:6625-6641).
  • the oligonucleotide may be conjugated to the transport agent via the molecular linker containing a disulfide linkage at the base moiety, at the sugar moiety, and/or at the phosphate backbone of the oligonucleotide.
  • the transport agents of the invention increase delivery of the oligonucleotides to which they are conjugated to a target cell.
  • the transport agents facilitate transport of the conjugated oligonucleotide across a cell membrane, or across the blood brain barrier in vivo.
  • the transport agent is cleaved from the oligonucleotide after uptake by the target cell, by intracellular reduction of the disulfide linkage.
  • the transport agent can be a molecule known in the art to gain entry into the cell through adsorptive endocytosis
  • the transport agent may be selected from the group including but not limited to cholesterol, a peptide, a protein, a lipid (e.g.
  • a fatty acid containing at least 12 carbon atoms a triglyceride, a phospholipid, a glucocorticoid) , a saccharide (e.g., mannose, glucose, galactose) , an 5 antibody, a nucleoside or nucleoside analog, and a biocompatible polymer (e.g. cellulose, polyethylene glycol, polyvinyl alcohol) .
  • the transport agent is a fatty acid containing 18 carbon atoms.
  • the transport agent is a fatty acid containing 18 carbon atoms.
  • oligonucleotide is a compound having the structure: cholesterol- dinucleotide-R j -S-S-R j -oligonucleotide, where R j and R 2 are hydrocarbon chains, and Rj may be identical to R 2 .
  • the oligonucleotide is a compound having the structure: cholesterol- dinucleotide-R j -S-S-R j -oligonucleotide, where R j and R 2 are hydrocarbon chains, and Rj may be identical to R 2 .
  • the oligonucleotide is a compound having the structure: cholesterol- dinucleotide-R j -S-S-R j -oligonucleotide, where R j and R 2 are hydrocarbon chains, and Rj may be identical to R 2 .
  • the oligonucleotide is a compound having the structure: cholesterol- dinucleotide-R j -S-S-R
  • the conjugates of the invention comprise a transport agent which facilitates passage through the blood-brain barrier. Since the
  • 9 -ft v blood-brain barri.er primarily comprises li.pi.ds, i.n this embodiment, it is preferred that the transport agent be lipophilic.
  • Such transport agents include but are not limited to cholesterol, a hydrophobic peptide, a fatty acid comprising at least 12 carbon atoms, a trigly-
  • the transport agent can be a peptide capable of crossing the blood-brain barrier, such as one of those disclosed in PCT International
  • transport agents may be modified at any position on their structure with substituents generally used in the art.
  • Peptides, 35 proteins, cholesterol, and lipid analogs may be substituted with substituents including but not limited to alkyl, cycloalkyl, aryl, alkaryl, hydroxyalkyl, ester, ether, amide, halo, nitro, cyano, and carboxylic acid.
  • derivatized nucleotides or nucleotide analogs providing for hybridization- 5 triggered cross-linking to other nucleotide sequences may be incorporated into conjugated oligonucleotides of the invention.
  • the present invention relates to methods for inhibiting the expression of a nucleic acid sequence in a procaryotic or eucaryotic plant or animal cell comprising providing a viable cell in culture or in vivo with a composition comprising an effective amount of the oligonucleotide conjugates of the invention.
  • the expression of the nucleic acid sequence in the cell is inhibited by hybridization of 0 . the oligonucleotide with the nucleic acid sequence in the cell.
  • such composition may inhibit the expression of a nucleic acid in a cell by inhibiting the action of polymerases in the cell.
  • such composition may inhibit the expression of a nucleic acid sequence in a cell by forming a triple helix with a double-stranded nucleic acid sequence in the cell.
  • the nucleic acid sequence may be present in a Q procaryotic or eucaryotic cell, a normal or neoplastic cell.
  • the cell is a mammalian cell.
  • the nucleic acid sequence may be endogenous to the cell, or may be found within the cell yet specific to a pathogenic organism.
  • 5 the nucleic acid sequence may be a DNA or RNA sequence.
  • the compositions of the present invention may be useful as therapeutic agents, and for example may be used to inhibit the expression of bacterial or viral or fungal proteins, or of cellular proteins such as oncogenes, as well as T cell receptors, which are postulated to play a role in autoimmune diseases. Alternatively, the compositions may be useful for agricultural purposes.
  • compositions may be used to alter the phenotypic characteristics of a plant, such as the modification of a particular enzymatic activity.
  • the oligonuc ⁇ leotide is cleaved from the transport agent during or after entry into a cell.
  • the expression of a nucleic acid sequence may be inhibited by providing the cell with an effective amount of a composition comprising the oligonucleotide conjugates of the invention, in which the oligonucleotide portion of the conjugate consists of 6-50 nucleotides, with a size of 8-30 nucleotides most preferred, and is capable of hybridizing to at least a portion of the nucleic acid sequence.
  • the oligonucleotide sequence is "antisense" or complementary, and thus capable of hybridizing, to the nucleic acid sequence.
  • the nucleic acid sequence can be contained within a single stranded, double stranded, or multiply stranded nucleic acid. Where the oligonucleo ⁇ tide conjugate binds to the oligonucleotide's comple ⁇ mentary sequence contained on a double stranded nucleic acid, a triple helix can be formed.
  • the oligonucleotide sequence may be complementary to the sequence of the complementary strand of the nucleic acid sequence. In another specific aspect, the oligonucleotide sequence can be complementary to the RNA transcribed off the nucleic acid sequence.
  • the oligonucleotide of the conjugate need not have a 5 sequence complementary to the nucleic acid sequence or to its complementary strand, since, e.g., certain oligonucleotides which are of random sequence or homopolymeric may inhibit the expression of certain non-complementary nucleic acid sequences such as those 0 which are of viral origin (see e.g., Aradi, J. and Ho, Y. K. , 1985, Cancer Biochem. Biophys. 7:349-359; Majumdar, C. , et al., 1989, Biochem. 28(3) :1340-1346) .
  • the expression of a nucleic acid sequence of a pathogenic organism can be ® inhibited.
  • the oligonucleotide portion of the conjugates of the invention comprises a sequence complementary and capable of hybridizing to at least a portion of a DNA or RNA sequence of the pathogenic organism.
  • a variety of diseases and disorders can be treated by administration to a subject of a composition comprising an effective amount of the oligonucleotide conjugates of the invention.
  • a composition comprising an effective amount of the oligonucleotide conjugates of the invention.
  • the disulfide linkage is cleaved and the oligonucleotide is released.
  • Viral diseases and disorders which can be treated by administration of a conjugate of the invention, in which the oligonucleotide inhibits 0 expression of a viral nucleic acid sequence include but are not limited to those caused by hepatitis B virus, cytomegalovirus, herpes simplex virus I or II, human immunodeficiency virus type I or II, influenza virus, respiratory syncytial virus, and human papilloma 5 virus.
  • Malignancies which can be treated by adminis- tration of a conjugate of the invention include but are not limited to lung cancer (e.g., small cell lung carcinoma) , colorectal cancer, prostate cancer, breast cancer, leukemias and lymphomas.
  • the oligonucleotide portion of the conjugate can be complementary to (and capable of hybridizing to) a gene encoding an aberrantly expressed oncogene, or to a gene encoding a growth factor required for maintenance of the malignant state.
  • the compositions may be used to treat a neurological disorder.
  • disorders can also be detected by detecting nucleic acid sequences associated with the presence of such diseases, disorders or malignancies, as provided by the present invention.
  • compositions consisting of an effective amount of the oligonucleotide conjugates of the invention formulated for a variety of modes of administration, including systemic and topical or localized administration. Techniques and formulations generally may be found in Remington's Pharmaceutical Sciences. Meade Publishing Co., Easton, PA, latest edition.
  • compositions of the invention are formulated in liquid solutions, such as deionized water, water, phosphate- buffered saline, or ethanol, and preferably in physiologically compatible buffers, such as Hank's or Ringer's.
  • physiologically compatible buffers such as Hank's or Ringer's.
  • the compositions may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms are also included.
  • Systemic administration can also be by transmucosal or transdermal means, or the compositions may be administered orally.
  • penetrants appropriate to the barrier to be permeated are used in the formula ⁇ tion.
  • penetrants are generally known in the art and include, for example, for transmucosal administra ⁇ tion bile salts and fusidic acid derivatives.
  • detergents may be used to facilitate permeation.
  • Transmucosal administration may be through nasal sprays, for example, or using suppositories.
  • the compositions are formulated into conventional oral administration forms such as capsules, tablets, and tonics.
  • compositions of the invention are formulated into ointments, salves, gels, or creams, as generally known in the art.
  • the compositions may be formulated in the lumen of vesicles, such as liposomes.
  • an oligonucleotide conjugated at its 5' terminus to a transport agent via a molecular linker containing a disulfide, and which is endcapped at its 3' end with methoxyethylamine to help prevent degradation in vivo is administered intravenously.
  • compositions may be administered to a plant using various procedures known in the art (see Shew aker et al., U.S. Patent No. 4,801,540, issued
  • compositions of the present invention may be introduced into a suitable vector and administered to the plant via electropora- tion, transformation, inoculation, and the like.
  • an effective amount of an oligonucleotide conjugate of the invention in which the oligonucleotide consists of at least 6 nucleotides, is capable of hybridizing to at least a portion of a nucleic acid sequence within a cell, and is detectably labeled, may be used as a detection or diagnostic agent by hybridizing to its complementary nucleic acid sequence within the cell.
  • an effective amount of such an oligonucleotide conjugate may be used to detect a nucleic acid sequence in a viable procaryotic or eucaryotic cell in culture or in vivo
  • the detectable label which is linked to the oligonucleotide may be selected from the group including but not limited to a radioactive group, an enzyme, a fluorescent group, and an antibody.
  • the labelled oligonucleotide hybridizes to its complementary nucleic acid sequence within the cell, and is detected using procedures known in the art.
  • the present invention also includes methods for detecting the presence of a nucleic acid sequence of an exogenous infectious agent or of a selected gene utilizing oligonucleotide-disulfide conjugates as nucleic acid-based diagnostic probes.
  • One such method consists of an indirect assay, whereby human body fluids, tissue or cell extracts are screened for the presence of a target DNA by binding an oligonucleotide bound to a support membrane.
  • An oligonucleotide probe containing a reporter group linked to an oligonucleotide via a disulfide linker can be added to a DNA mixture containing the target DNA sequence.
  • the reporter group which may consist of, but is not limited to, an enzyme such as alkaline phosphatase may be released from the target DNA/oligonucleotide probe by adding a reducing reagent, e.c ., dithiothreitol.
  • a reducing reagent e.c ., dithiothreitol.
  • DNA can then be qualitatively and quantitatively measured by detection of the reporter group, e.g., spectrophotometrically.
  • Another such embodiment of the invention utilizes a diagnostic assay whereby an oligonucleotide probe containing a linker with a free thiol group can be used to hybridize with a target DNA sequence that has previously been immobilized on a solid support membrane. The resulting unbound DNA probe is then washed away and a reporter group containing a free thiol group is attached to the free thiol group of the oligonucleotide linker complex by disulfide bond formation. The presence of target DNA can then be measured by detection of the reporter group.
  • the oligonucleotide, rather than the target DNA can be immobilized on the solid support.
  • nucleotides containing specific hybridization-triggered crosslinking agents can be incorporated within the oligonucleotide probe, in order to amplify sensitivity and reduce background in diagnostic assays.
  • the use of crosslinking agents w ll permit novel diagnostic assay modifications such as a) the use of the crosslinker to increase probe discrimination b) incorporation of a denaturing wash step to reduce background and c) carrying out hybridization and crosslinking at or near the melting temperature of the hybrid DNA will reduce secondary structure in the target DNA and to increase probe specificity.
  • Another specific embodiment of the present invention involves using probes containing disulfide linkers in combination with base analogs such as 5 methycytosine, for use in diagnostic assays that are based on sequence specific binding to double stranded
  • triple helix probes may be conjugated to various reporter groups known in the art to facilitate detection or quantitation of specific regions of double stranded DNA. Probes that form triple helix structures can also incorporate additional modifications such as altered internucleotide linkages that render the oligonucleotide nuclease stable. Such stable oligonucleotides will be useful for assays conducted in the presence of cell or tissue extracts which normally contain nuclease activity.
  • An additional embodiment of the present invention comprises using oligonucleotides with a thiol group for attachment to a solid support derivatized with thiol groups, by formation of a disulfide linkage, in order to bind complementary DNA sequences found in human body fluids, cell or tissue extracts.
  • the solid support is comprised of one of the following: Sulfolink® Coupling Gel Columns, Tresyl Activated Agarose, ImmunoPure® Epoxy-activated Agarose, and TNB Thiol Agarose (Pierce Chemical Company) .
  • Another embodiment of this invention is comprised of double stranded oligonucleotides containing the binding site sequence recognized by a cognate DNA-binding protein, which can be used in the assays described above to bind specifically to a DNA- binding protein from a mixture of proteins isolated from cell or tissue extracts.
  • 2-Dimethoxytrityl-2-hydroxyethyl disulfide hydrogen phosphonate was prepared by reacting 2- dimethoxytrityl-2-hydroxyethyl disulfide with 2-chloro- 4H-1,2,3-benzodioxaphosphorin-4-one.
  • Cholesterol (3.4 g; 8.8 mmole) in 50 ml methylene chloride was added to a 0 ⁇ C methylene chloride solution (100 ml) or 2-chloro-4H-l,2,3- benzodioxaphozphorin-4-one (20 mmole in 20 ml l M methylene chloride) and pyridine (1.6. ml, 20mmole) .
  • the hydrogen phosphonate was incorporated into the 5' position of d-CAGTGATT using standard hydrogen phosphonate chemistry on a Biosearch automated DNA synthesizer using the procedure described by 5 Froehler et al. (1986, Nucl. Acids Res. 14:5399-5407).
  • the dimethoxytrityl group was removed and TC was subsequently added to R-S-S-R-CAGTGATT using standard hydrogen phosphonate chemistry on a Biosearch automated DNA synthesizer as described.
  • TC-R-S-S-R-CAGTGATT was subsequently reacted with the triethylammonium salt of cholesteryl hydrogen-phosphonate triethylammonium salt.
  • the structure of the reaction product is shown in Figure 1.
  • CHOLESTEROL-TC-R-S-S-R-CAGTGATT (I) was labelled at the 3' end by the incorporation of 10 ⁇ Ci ⁇ .- 32 P-UTP (A ⁇ rsham, 3000 Ci/ramol ⁇ ) using 10 U terminal 0 transferase (New England Nuclear) .
  • the reaction mixture was incubated for 1 hour at 37°C using terminal transferase tailing buffer.
  • the reaction mixture was subsequently diluted in 10 mM Tris, 1 mM EDTA, pH 7.5.
  • the oligodeoxyribonucleotide 5'- TTTTTTTCTCCAT-3' was 5' end labelled using ⁇ - 32 P-ATP and T4 polynucleotide kinase.
  • This oligonucleotide contains 0 methoxyethylamine end-caps at the 2-3 • most diester linkages and was prepared via hydrogen-phosphonate chemistry (Froehler, 1986, Tet. Letters 27:5575-5578).
  • the oligodeoxyribonucleotide was phosphorylated at the 5' end by reacting the oligodeoxyribonucleotide with ⁇ -
  • the 32 P-labelled oligonucleotide was eluted from the gel in 10 mM Tris, pH 7.5, l mM EDTA overnight. The sample was desalted and concentrated using a C8 quick sep column (Baker) , eluting the 32 P-labelled oligodeoxyribonucleotide with 30% acetonitrile/water. 35 The solvent was then removed and the product resuspended in 100 ⁇ l of sterile water.
  • CAGTGATTTTTTTTTCTCCAT (4 X 10 6 cpm) which was endcapped at the 3' end with methoxy ethylamine (MEA) phosphor- amidate in 10% heat inactivated fetal calf serum (FCS)-
  • the reaction was stopped by the addition of 5 mM EDTA. 0
  • the cell suspension was pelleted via cent ⁇ fugation in an eppendorf microcentrifuge at 6000 rpm for 5 minutes at 4°C.
  • the cell pellet was washed with 100 ⁇ l PBS and respun in an eppendorf microcentrifuge at 6000 rpm for
  • Tris pH 7.5 containing 15 mM KC1, 2 mM MgC12, 0.1 mM
  • 3'-MEA endcapped internal 3 P-labelled CHOLESTEROL-TC-R-S-S-R-CAGTGATTTTTTTTTCTCCAT was tested 5 for nuclease and reduction stability in RPMI medium supplemented with 15% heat inactivated FCS.
  • 3'-MEA endcapped internal 32 P-labelled CHOLESTEROL-TC-R-S-S-R- CAGTGATTTTTTTTTCTCCAT (4 X 10 5 cpm) was added to 20 ⁇ l of cell medium. Five ⁇ l was removed at 0, 30, 60, and
  • the disulfide linkage is stable to reduction in media containing FCS.
  • the hydrogen phosphonate (2) was incorporated into the 5* position of GC using standard hydrogen phosphonate chemistry on a Biosearch automated DNA synthesizer using the procedure described by Froehler et al. ((1986) Nucleic Acids Res. 14 5399-5407). The dimethoxytritryl group was subsequently removed and oligodeoxynucleotide synthesis continued. Oxidation to the phosphodiester was performed using CC1 4 as previously described.
  • the ligated product was purified via 15% denaturing polyacrylamide gel electrophoresis. Product was visualized via autoradiography and cut out of the gel. The 32 P labeled oligonucleotide was eluted from the gel, desalted and concentrated using C8 reverse phase chromatography.
  • the product was eluted using 30% acetonitrile in water.
  • the cell pellet was washed with 100 uL PBS and respun (6K-5mins) . This procedure was repeated three times. The cell pellet was resuspended in 20 uL of 10 mM Tris pH 7.5 containing 15 mM KC1, 2 mM MgCL2, 0.1 mM EDTA and 0.2% NP-40. The sample was placed on ice for 1 minute followed by 30 seconds of vortexing. This was repeated. This extract was then spun at 3K for 5 mins at 4°C. The supernatent was then removed and diluted into 7M urea loading buffer.
  • the pelleted nuclei were then disrupted in 20 uL of 10 mM Tris pH 7.5 containing 15 mM KC1, 2 mM MgCl 2 , 0.1 mM EDTA and 100 mM NaCl at 65°C for 5 mins. An equal volume of 7M urea loading buffer was then added.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Botany (AREA)
  • Plant Pathology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Saccharide Compounds (AREA)

Abstract

Cette invention concerne des compositions et des méthodes servant à renforcer le transport d'un oligonucléotide dans une cellule. Ces compositions comprennent des conjugués de nucléotide composés d'un oligonucléotide conjugué, à travers un agent de liaison moléculaire contenant au moins une liaison de disulfure, à un agent (ici appelé 'agent transporteur') qui faclilite le transport à travers une membrane cellulaire externe, ou à travers la barrière du sang et du cerveau. Dans un mode préféré, la liaison de disulfure est segmentée lorsque la cellule reçoit la composition. Les compositions pharmaceutiques comprenant un conjugué oligonucléotide de cette invention peuvent être utilisées pour traiter une grande variété de maladies et de désordres. Des méthodes pour inhiber l'expression d'une séquence d'acide nucléique à l'intérieur d'une cellule et des méthodes pour détecter une séquence d'acide nucléique dans une celllule sont aussi fournies. Dans un mode de réalisation particulier, un oligonucléotide conjugué à du cholestérol à travers un agent de liaison contenant une liaison de disulfure peut être utilisé pour des besoins thérapeutiques ou diagnostiques, par l'hybridisation de l'oligonucléotide à une séquence d'acide nucléique complémentaire dans une cellule procaryotique ou encaryotique.
PCT/US1991/002224 1990-03-29 1991-03-29 Conjugues a base de disulfure d'oligonucleotide et d'un agent de transport WO1991014696A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP91508586A JPH05505941A (ja) 1990-03-29 1991-03-29 オリゴヌクレオチド―輸送剤ジスルフィド結合体

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US50236190A 1990-03-29 1990-03-29
US502,361 1990-03-29

Publications (1)

Publication Number Publication Date
WO1991014696A1 true WO1991014696A1 (fr) 1991-10-03

Family

ID=23997461

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1991/002224 WO1991014696A1 (fr) 1990-03-29 1991-03-29 Conjugues a base de disulfure d'oligonucleotide et d'un agent de transport

Country Status (5)

Country Link
EP (1) EP0537299A1 (fr)
JP (1) JPH05505941A (fr)
AU (1) AU7759291A (fr)
CA (1) CA2079109A1 (fr)
WO (1) WO1991014696A1 (fr)

Cited By (109)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2691463A1 (fr) * 1992-05-25 1993-11-26 Centre Nat Rech Scient Dérivés nucléotidiques, leur préparation et leur application en thérapeutique.
WO1993024510A1 (fr) * 1992-05-25 1993-12-09 Centre National De La Recherche Scientifique (Cnrs) Composes biologiquement actifs de type phosphotriesters
WO1994023751A1 (fr) * 1993-04-14 1994-10-27 Boehringer Mannheim Gmbh Peptides de tranfert d'acides nucleiques et leur utilisation pour injecter des acides nucleiques dans des cellules eucaryotes
WO1995007092A1 (fr) * 1993-09-10 1995-03-16 The University Of Medicine And Dentistry Of New Jersey Vecteurs de transport d'agents neurologiques traversant la barriere hemato-encephalique
WO1995015183A1 (fr) * 1993-12-02 1995-06-08 Basf Aktiengesellschaft Conjugues d'hirudine comprenant de l'hirudine et des composes lipophiles
WO1995029186A1 (fr) * 1994-04-20 1995-11-02 The Trustees Of Princeton University Compositions et procedes de transformation de cellules
WO1995034665A2 (fr) * 1994-06-16 1995-12-21 Peter Seibel Fragment chimerique d'acide nucleique-peptide, son procede de production et son utilisation afin d'introduire de maniere appropriee des acides nucleiques dans des organelles de cellules et dans des cellules
EP0724447A4 (fr) * 1991-10-24 1996-01-22 Isis Pharmaceuticals Inc Oligonucleotides derives presentant diverses qualites dont une meilleure facilite d'absorption
EP0716604A1 (fr) * 1993-09-03 1996-06-19 Isis Pharmaceuticals, Inc. Nucleosides et oligonucleosides a fonction(s) thiol
WO1996030536A1 (fr) * 1995-03-24 1996-10-03 Board Of Regents, The University Of Texas System Apport d'un acide nucleique cible egf
US5580972A (en) * 1993-06-14 1996-12-03 Nexstar Pharmaceuticals, Inc. Purine nucleoside modifications by palladium catalyzed methods
US5607691A (en) * 1992-06-12 1997-03-04 Affymax Technologies N.V. Compositions and methods for enhanced drug delivery
US5627185A (en) * 1994-11-23 1997-05-06 Gosselin; Gilles Acyclovir derivatives as antiviral agents
US5683867A (en) * 1990-06-11 1997-11-04 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: blended SELEX
US5693769A (en) * 1991-12-13 1997-12-02 Transcell Technologies, Inc. Glycosylated steroid derivatives for transport across biological membranes and process for making and using same
US5705337A (en) * 1990-06-11 1998-01-06 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: chemi-SELEX
US5719273A (en) * 1993-06-14 1998-02-17 Nexstar Pharmaceuticals, Inc. Palladium catalyzed nucleoside modifications methods using nucleophiles and carbon monoxide
US5723592A (en) * 1990-06-11 1998-03-03 Nexstar Pharmaceuticals, Inc. Parallel selex
US5770725A (en) * 1992-05-25 1998-06-23 Gosselin; Gilles Phosphotriester type biologically active compounds
US5780444A (en) * 1991-12-13 1998-07-14 Trustees Of Princeton University Compositions and methods for cell transformation
WO1998050417A1 (fr) * 1997-05-09 1998-11-12 Genzyme Corporation Amphiphiles cationiques contenant une sequence de liaison disulfure pour transfections cellulaires
US5849905A (en) * 1994-11-23 1998-12-15 Centre National De La Recherche Scientifique Biologically active phosphotriester-type nucleosides and methods for preparing same
US5852182A (en) * 1990-01-11 1998-12-22 Isis Pharmaceuticals Inc. Thiol-derivatized oligonucleosides
US5859228A (en) * 1995-05-04 1999-01-12 Nexstar Pharmaceuticals, Inc. Vascular endothelial growth factor (VEGF) nucleic acid ligand complexes
WO1999005302A1 (fr) * 1997-07-24 1999-02-04 The Perkin-Elmer Corporation Conjugues de peptides transporteurs et analogues d'acides nucleiques ainsi que leur utilisation
US5912239A (en) * 1997-04-04 1999-06-15 Genzyme Corporation Imidazole-containing cationic amphiphiles for intracellular delivery of therapeutic molecules
US5925628A (en) * 1997-03-31 1999-07-20 Genzyme Corporation Cationic amphiphiles for intracellular delivery of therapeutic molecules
US5945527A (en) * 1996-05-30 1999-08-31 Nexstar Pharmaceuticals, Inc. Palladium catalyzed nucleoside modification methods using nucleophiles and carbon monoxide
US5948925A (en) * 1997-05-06 1999-09-07 Genzyme Corporation Cationic amphiphiles containing linkers derived from neutral or positively charged amino acids
US5952516A (en) * 1997-05-08 1999-09-14 Genzyme Corporation Cationic amphiphiles containing multiplesteroid lipophilic groups
US5955591A (en) * 1993-05-12 1999-09-21 Imbach; Jean-Louis Phosphotriester oligonucleotides, amidites and method of preparation
US5959100A (en) * 1996-03-27 1999-09-28 Nexstar Pharmaceuticals, Inc. Pyrimidine nucleosides as therapeutic and diagnostic agents
US5962219A (en) * 1990-06-11 1999-10-05 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: chemi-selex
WO1999055717A1 (fr) * 1998-04-24 1999-11-04 Isis Pharmaceuticals, Inc. Procedes de synthese de composes oligomeres
WO1999058152A1 (fr) * 1998-05-12 1999-11-18 University Of Florida Lipides cationiques a liaisons disulfure pour l'administration intracellulaire de substances therapeutiques
US5998142A (en) * 1993-09-08 1999-12-07 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: chemi-SELEX
US6011020A (en) * 1990-06-11 2000-01-04 Nexstar Pharmaceuticals, Inc. Nucleic acid ligand complexes
US6020482A (en) * 1992-05-25 2000-02-01 Gosselin; Gilles Phosphotriester type biologically active compounds
US6020483A (en) * 1998-09-25 2000-02-01 Nexstar Pharmaceuticals, Inc. Nucleoside modifications by palladium catalyzed methods
US6030776A (en) * 1990-06-11 2000-02-29 Nexstar Pharmaceuticals, Inc. Parallel SELEX
WO2000012530A1 (fr) * 1998-08-26 2000-03-09 Nexstar Pharmaceuticals, Inc. CLIVAGE DIRIGE SUR SITE dU DE CONJUGUES COVALENTS
US6048698A (en) * 1994-09-20 2000-04-11 Nexstar Pharmaceuticals, Inc. Parallel SELEX™
US6051698A (en) * 1997-06-06 2000-04-18 Janjic; Nebojsa Vascular endothelial growth factor (VEGF) nucleic acid ligand complexes
US6057299A (en) * 1994-01-13 2000-05-02 Calydon, Inc. Tissue-specific enhancer active in prostate
US6083696A (en) * 1990-06-11 2000-07-04 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands exponential enrichment: blended selex
US6114513A (en) * 1990-01-11 2000-09-05 Isis Pharmaceuticals, Inc. Thiol-derivatized oligonucleotides
US6136792A (en) * 1994-01-13 2000-10-24 Calydon, Inc. Prostate specific enhancer polynucleotides and methods of use thereof
US6147204A (en) * 1990-06-11 2000-11-14 Nexstar Pharmaceuticals, Inc. Nucleic acid ligand complexes
US6153737A (en) * 1990-01-11 2000-11-28 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
US6168778B1 (en) 1990-06-11 2001-01-02 Nexstar Pharmaceuticals, Inc. Vascular endothelial growth factor (VEGF) Nucleic Acid Ligand Complexes
US6229002B1 (en) 1995-06-07 2001-05-08 Nexstar Pharmaceuticlas, Inc. Platelet derived growth factor (PDGF) nucleic acid ligand complexes
WO2001060412A2 (fr) 2000-02-15 2001-08-23 Genzyme Corporation Modification de biopolymeres pour administration amelioree de medicaments
EP1155056A1 (fr) * 1998-12-04 2001-11-21 Mosaic Technologies, Inc. Methode d'immobilisation d'oligonucleotides
US6335436B1 (en) 1995-02-10 2002-01-01 Hybridon, Inc. Oligonucleotides active against drug-resistant bacteria
WO2002020544A1 (fr) * 2000-09-08 2002-03-14 Isis Pharmaceuticals, Inc. Procédé pour l'élaboration de composés oligomères en dérivation de peptides
US6395492B1 (en) 1990-01-11 2002-05-28 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
US6426335B1 (en) 1997-10-17 2002-07-30 Gilead Sciences, Inc. Vascular endothelial growth factor (VEGF) nucleic acid ligand complexes
US6465189B1 (en) 1990-06-11 2002-10-15 Gilead Sciences, Inc. Systematic evolution of ligands by exponential enrichment: blended selex
US6465188B1 (en) 1990-06-11 2002-10-15 Gilead Sciences, Inc. Nucleic acid ligand complexes
WO2002092631A1 (fr) * 2001-05-14 2002-11-21 The Horticulture And Food Research Institute Of New Zealand Limited Dosage cinetique
US6521252B1 (en) 1998-01-30 2003-02-18 Aventis Pharma S.A. Transfecting compounds which are sensitive to reducing conditions, pharmaceutical compositions containing them and their applications
WO2003026590A2 (fr) * 2001-09-28 2003-04-03 Board Of Regents, The University Of Texas System Regulation biologique de nanoparticules
US6610837B1 (en) * 1999-03-16 2003-08-26 Isis Pharmaceuticals, Inc. Phosphate and thiophosphate protecting groups
WO2003091443A1 (fr) * 2002-04-24 2003-11-06 Avaris Ab Complexe de transfert synthetique et methode de transfert d'acides nucleiques
US6653458B1 (en) 1993-09-03 2003-11-25 Isis Pharmaceuticals, Inc. Modified oligonucleotides
US6749865B2 (en) 2000-02-15 2004-06-15 Genzyme Corporation Modification of biopolymers for improved drug delivery
US6753423B1 (en) 1990-01-11 2004-06-22 Isis Pharmaceuticals, Inc. Compositions and methods for enhanced biostability and altered biodistribution of oligonucleotides in mammals
US6783931B1 (en) 1990-01-11 2004-08-31 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US6822086B1 (en) 1999-08-09 2004-11-23 The General Hospital Corporation Drug-carrier complexes and methods of use thereof
US6831166B2 (en) 1992-10-23 2004-12-14 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
US6838238B1 (en) 1996-10-17 2005-01-04 Invitrogen Corporation Morphatides: novel shape and structure libraries
WO2005041859A2 (fr) 2003-04-30 2005-05-12 Sirna Therapeutics, Inc. Conjugues et compositions
US6916918B2 (en) 1997-08-04 2005-07-12 Cell Genesys, Inc. Human glandular kallikrein enhancer, vectors comprising the enhancer and methods of use thereof
EP1594977A2 (fr) * 2003-02-18 2005-11-16 Mirus Corporation Fixation reversible d'un polymere a action membranaire a un polynucleotide
US7037646B1 (en) 1990-01-11 2006-05-02 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
EP1667522A2 (fr) * 2003-09-09 2006-06-14 Geron Corporation Oligonucleotides modifies destines a l'inhibition de la telomerase
EP1695717A1 (fr) * 2005-02-23 2006-08-30 Ludwig-Maximilians-Universität Transport de structures nano-et macromoléculaires dans le cytoplasme et le noyau des cellules
US7119184B2 (en) 1991-08-12 2006-10-10 Isis Pharmaceuticals, Inc. Oligonucleotides having A-DNA form and B-DNA form conformational geometry
US7179907B2 (en) 2001-12-18 2007-02-20 Bruce Eaton Antibiotic compounds
US7374893B2 (en) 2002-09-18 2008-05-20 Board Of Regents, University Of Texas System- Peptide mediated synthesis of metallic and magnetic materials
WO2008089248A2 (fr) * 2007-01-19 2008-07-24 The Board Of Trustees Of The University Of Illinois Substances amphiphiles et vésicules lipidiques fonctionnalisées contenant de telles substances
EP2046964A2 (fr) * 2006-07-12 2009-04-15 The Regents of the University of California Distribution transductrice d'acides nucléiques par des groupes de protection phosphotriester réversible à neutralisation de charge
US7538192B2 (en) 2002-12-18 2009-05-26 Palo Alto Research Center Incorporated Process for preparing albumin protein conjugated oligonucleotide probes
US7799554B2 (en) 2006-03-16 2010-09-21 The Board Of Trustees Of The University Of Illinois Lateral flow devices
US7892734B2 (en) 2005-08-11 2011-02-22 The Board Of Trustees Of The University Of Illinois Aptamer based colorimetric sensor systems
US7902353B2 (en) 2000-06-27 2011-03-08 The Board Of Trustees Of The University Of Illinois Nucleic acid enzyme biosensors for ions
US7906320B2 (en) 2002-05-10 2011-03-15 The Board Of Trustees Of The University Of Illinois Fluorescence based biosensor
WO2011130289A1 (fr) 2010-04-12 2011-10-20 Somalogic, Inc. Pyrimidines modifiées en position 5 et leur utilisation
US8058415B2 (en) 2007-04-24 2011-11-15 The Board Of Trustees Of The University Of Illinois Aptamer- and nucleic acid enzyme-based systems for simultaneous detection of multiple analytes
US8062893B2 (en) 2008-10-10 2011-11-22 The Board Of Trustees Of The University Of Illinois Fluorescent sensor for mercury
US8071737B2 (en) 1995-05-04 2011-12-06 Glead Sciences, Inc. Nucleic acid ligand complexes
US8106098B2 (en) 1999-08-09 2012-01-31 The General Hospital Corporation Protein conjugates with a water-soluble biocompatible, biodegradable polymer
US8188247B2 (en) 2001-05-18 2012-05-29 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US8367416B2 (en) 2007-08-10 2013-02-05 The Board Of Trustees Of The University Of Illinois Nucleic acid based fluorescent sensor for mercury detection
US8372949B2 (en) 2001-06-05 2013-02-12 The Board Of Regents, The University Of Texas System Molecular recognition of materials
US8409800B2 (en) 2007-07-16 2013-04-02 The Board Of Trustees Of The University Of Illinois Nucleic acid based fluorescent sensor for copper detection
US8568690B2 (en) 2007-07-31 2013-10-29 The Board Of Trustees Of The University Of Illinois MRI contrast agents and high-throughput screening by MRI
US8785409B2 (en) 2007-01-30 2014-07-22 Geron Corporation Compounds having anti-adhesive effects on cancer cells
US8815156B2 (en) 2010-07-19 2014-08-26 Andalyze, Inc. Sensor housing and reagent chemistry
US8853376B2 (en) 2002-11-21 2014-10-07 Archemix Llc Stabilized aptamers to platelet derived growth factor and their use as oncology therapeutics
US9205099B2 (en) 2010-06-22 2015-12-08 Dna Therapeutics Optimized in vivo delivery system with endosomolytic agents for nucleic acid conjugates
US20160257961A1 (en) * 2013-11-06 2016-09-08 Solstice Biologics, Ltd. Polynucleotide constructs having disulfide groups
US9796747B2 (en) 2014-05-01 2017-10-24 Geron Corporation Oligonucleotide compositions and methods of making the same
US9950001B2 (en) 2012-08-20 2018-04-24 The Regents Of The University Of California Polynucleotides having bioreversible groups
US10563197B2 (en) 2015-07-23 2020-02-18 Institut Curie Use of a combination of Dbait molecule and PARP inhibitors to treat cancer
US11236334B2 (en) 2017-08-22 2022-02-01 National University Corporation Nagoya University Modified polynucleotide
US11390642B2 (en) 2016-08-23 2022-07-19 Dicerna Pharmaceuticals, Inc. Compositions comprising reversibly modified oligonucleotides and uses thereof
US11597744B2 (en) 2017-06-30 2023-03-07 Sirius Therapeutics, Inc. Chiral phosphoramidite auxiliaries and methods of their use
US11981703B2 (en) 2016-08-17 2024-05-14 Sirius Therapeutics, Inc. Polynucleotide constructs

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2527440A1 (fr) * 2011-05-27 2012-11-28 Institut Curie Traitement du cancer en combinait des molécules d'ADN mimant des ruptures de double brin par hyperthermie

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4358535A (en) * 1980-12-08 1982-11-09 Board Of Regents Of The University Of Washington Specific DNA probes in diagnostic microbiology
US4471113A (en) * 1982-02-03 1984-09-11 The United States Of America As Represented By The Department Of Energy Prodrugs based on phospholipid-nucleoside conjugates
US4587044A (en) * 1983-09-01 1986-05-06 The Johns Hopkins University Linkage of proteins to nucleic acids
EP0302175A2 (fr) * 1982-06-23 1989-02-08 Enzo Biochem, Inc. Nucléotides et polynucléotides modifiés marqués et méthodes pour leur préparation, utilisation et détection
US4806463A (en) * 1986-05-23 1989-02-21 Worcester Foundation For Experimental Biology Inhibition of HTLV-III by exogenous oligonucleotides
US4837311A (en) * 1987-06-22 1989-06-06 Hoffman-La Roche Inc. Anti-retroviral compounds
WO1989005853A1 (fr) * 1987-12-15 1989-06-29 Synthetic Genetics Conjugue de chelate d'acide nucleique utilise comme agent therapeutique et de diagnostic
US4876335A (en) * 1986-06-30 1989-10-24 Wakunaga Seiyaku Kabushiki Kaisha Poly-labelled oligonucleotide derivative
WO1990000555A1 (fr) * 1988-07-07 1990-01-25 Vical, Inc. Derives lipides de nucleosides anti-viraux, incorporation liposomale et procede d'utilisation
US4904582A (en) * 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4358535A (en) * 1980-12-08 1982-11-09 Board Of Regents Of The University Of Washington Specific DNA probes in diagnostic microbiology
US4358535B1 (fr) * 1980-12-08 1986-05-13
US4471113A (en) * 1982-02-03 1984-09-11 The United States Of America As Represented By The Department Of Energy Prodrugs based on phospholipid-nucleoside conjugates
EP0302175A2 (fr) * 1982-06-23 1989-02-08 Enzo Biochem, Inc. Nucléotides et polynucléotides modifiés marqués et méthodes pour leur préparation, utilisation et détection
US4587044A (en) * 1983-09-01 1986-05-06 The Johns Hopkins University Linkage of proteins to nucleic acids
US4806463A (en) * 1986-05-23 1989-02-21 Worcester Foundation For Experimental Biology Inhibition of HTLV-III by exogenous oligonucleotides
US4876335A (en) * 1986-06-30 1989-10-24 Wakunaga Seiyaku Kabushiki Kaisha Poly-labelled oligonucleotide derivative
US4904582A (en) * 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates
US4837311A (en) * 1987-06-22 1989-06-06 Hoffman-La Roche Inc. Anti-retroviral compounds
WO1989005853A1 (fr) * 1987-12-15 1989-06-29 Synthetic Genetics Conjugue de chelate d'acide nucleique utilise comme agent therapeutique et de diagnostic
WO1990000555A1 (fr) * 1988-07-07 1990-01-25 Vical, Inc. Derives lipides de nucleosides anti-viraux, incorporation liposomale et procede d'utilisation

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Nucleic Acids Research, Volume 16, No. 9, issued 11 May 1988, CHU et al., "Ligation of oligonucleotides to nucleic acids or proteins via disulfide bonds", pages 3671-3691, see entire document. *
Proceedings of the National Academy of Sciences, Volume 86, No. 17, issued September 1989, LESTINGER et al., "Cholesteryl-conjugated oligonucleotides: Synthesis, properties, and activity as inhibitors of replication of human immunodeficiency virus in cell culture", pages 6553-6556, see entire document. *
See also references of EP0537299A4 *

Cited By (189)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6153737A (en) * 1990-01-11 2000-11-28 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
US7235650B2 (en) 1990-01-11 2007-06-26 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
US6783931B1 (en) 1990-01-11 2004-08-31 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US6753423B1 (en) 1990-01-11 2004-06-22 Isis Pharmaceuticals, Inc. Compositions and methods for enhanced biostability and altered biodistribution of oligonucleotides in mammals
US6114513A (en) * 1990-01-11 2000-09-05 Isis Pharmaceuticals, Inc. Thiol-derivatized oligonucleotides
US7037646B1 (en) 1990-01-11 2006-05-02 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US6395492B1 (en) 1990-01-11 2002-05-28 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
US6919439B2 (en) 1990-01-11 2005-07-19 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
US6265558B1 (en) 1990-01-11 2001-07-24 Isis Pharmaceuticals, Inc. Thiol-derivatized nucleosides and oligonucleosides
US5852182A (en) * 1990-01-11 1998-12-22 Isis Pharmaceuticals Inc. Thiol-derivatized oligonucleosides
US5578718A (en) * 1990-01-11 1996-11-26 Isis Pharmaceuticals, Inc. Thiol-derivatized nucleosides
US5723592A (en) * 1990-06-11 1998-03-03 Nexstar Pharmaceuticals, Inc. Parallel selex
US5789160A (en) * 1990-06-11 1998-08-04 Nexstar Pharmaceuticals, Inc. Parallel selex
US7176295B2 (en) 1990-06-11 2007-02-13 Gilead Sciences, Inc. Systematic evolution of ligands by exponential enrichment: blended SELEX
US6465188B1 (en) 1990-06-11 2002-10-15 Gilead Sciences, Inc. Nucleic acid ligand complexes
US6030776A (en) * 1990-06-11 2000-02-29 Nexstar Pharmaceuticals, Inc. Parallel SELEX
US6011020A (en) * 1990-06-11 2000-01-04 Nexstar Pharmaceuticals, Inc. Nucleic acid ligand complexes
US5683867A (en) * 1990-06-11 1997-11-04 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: blended SELEX
US6300074B1 (en) 1990-06-11 2001-10-09 Gilead Sciences, Inc. Systematic evolution of ligands by exponential enrichment: Chemi-SELEX
US5705337A (en) * 1990-06-11 1998-01-06 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: chemi-SELEX
US6465189B1 (en) 1990-06-11 2002-10-15 Gilead Sciences, Inc. Systematic evolution of ligands by exponential enrichment: blended selex
US6168778B1 (en) 1990-06-11 2001-01-02 Nexstar Pharmaceuticals, Inc. Vascular endothelial growth factor (VEGF) Nucleic Acid Ligand Complexes
US6083696A (en) * 1990-06-11 2000-07-04 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands exponential enrichment: blended selex
US5763595A (en) * 1990-06-11 1998-06-09 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: Chemi-SELEX
US5962219A (en) * 1990-06-11 1999-10-05 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: chemi-selex
US6147204A (en) * 1990-06-11 2000-11-14 Nexstar Pharmaceuticals, Inc. Nucleic acid ligand complexes
US7119184B2 (en) 1991-08-12 2006-10-10 Isis Pharmaceuticals, Inc. Oligonucleotides having A-DNA form and B-DNA form conformational geometry
EP1331011A3 (fr) * 1991-10-24 2003-12-17 Isis Pharmaceuticals, Inc. Oligonucléotides dérivés présentant une meilleure facilité d'absorption.
EP0724447A1 (fr) * 1991-10-24 1996-08-07 Isis Pharmaceuticals, Inc. Oligonucleotides derives presentant diverses qualites dont une meilleure facilite d'absorption
EP1331011A2 (fr) * 1991-10-24 2003-07-30 Isis Pharmaceuticals, Inc. Oligonucléotides dérivés présentant une meilleure facilité d'absorption.
EP0724447A4 (fr) * 1991-10-24 1996-01-22 Isis Pharmaceuticals Inc Oligonucleotides derives presentant diverses qualites dont une meilleure facilite d'absorption
US7125975B2 (en) 1991-10-24 2006-10-24 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
US5795870A (en) * 1991-12-13 1998-08-18 Trustees Of Princeton University Compositions and methods for cell transformation
US5780444A (en) * 1991-12-13 1998-07-14 Trustees Of Princeton University Compositions and methods for cell transformation
US5693769A (en) * 1991-12-13 1997-12-02 Transcell Technologies, Inc. Glycosylated steroid derivatives for transport across biological membranes and process for making and using same
US6399589B1 (en) 1992-05-25 2002-06-04 Isis Pharmaceuticals, Inc. Biologically active phosphotriester-type compounds
FR2691463A1 (fr) * 1992-05-25 1993-11-26 Centre Nat Rech Scient Dérivés nucléotidiques, leur préparation et leur application en thérapeutique.
US5770725A (en) * 1992-05-25 1998-06-23 Gosselin; Gilles Phosphotriester type biologically active compounds
US6020482A (en) * 1992-05-25 2000-02-01 Gosselin; Gilles Phosphotriester type biologically active compounds
FR2692265A1 (fr) * 1992-05-25 1993-12-17 Centre Nat Rech Scient Composés biologiquement actifs de type phosphotriesters.
US6555676B2 (en) 1992-05-25 2003-04-29 Centre National De La Recherche Scientifique Biologically active phosphotriester-type compounds
WO1993024510A1 (fr) * 1992-05-25 1993-12-09 Centre National De La Recherche Scientifique (Cnrs) Composes biologiquement actifs de type phosphotriesters
US5607691A (en) * 1992-06-12 1997-03-04 Affymax Technologies N.V. Compositions and methods for enhanced drug delivery
US7122649B2 (en) 1992-10-23 2006-10-17 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
US6831166B2 (en) 1992-10-23 2004-12-14 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
WO1994023751A1 (fr) * 1993-04-14 1994-10-27 Boehringer Mannheim Gmbh Peptides de tranfert d'acides nucleiques et leur utilisation pour injecter des acides nucleiques dans des cellules eucaryotes
US5955591A (en) * 1993-05-12 1999-09-21 Imbach; Jean-Louis Phosphotriester oligonucleotides, amidites and method of preparation
US5719273A (en) * 1993-06-14 1998-02-17 Nexstar Pharmaceuticals, Inc. Palladium catalyzed nucleoside modifications methods using nucleophiles and carbon monoxide
US5783679A (en) * 1993-06-14 1998-07-21 Nexstar Pharmaceuticals, Inc. Purine nucleoside modifications by palladium catalyzed methods and oligonucleotides containing same
US5580972A (en) * 1993-06-14 1996-12-03 Nexstar Pharmaceuticals, Inc. Purine nucleoside modifications by palladium catalyzed methods
EP0716604A4 (fr) * 1993-09-03 2000-12-27 Isis Pharmaceuticals Inc Nucleosides et oligonucleosides a fonction(s) thiol
US6653458B1 (en) 1993-09-03 2003-11-25 Isis Pharmaceuticals, Inc. Modified oligonucleotides
EP0716604A1 (fr) * 1993-09-03 1996-06-19 Isis Pharmaceuticals, Inc. Nucleosides et oligonucleosides a fonction(s) thiol
US5998142A (en) * 1993-09-08 1999-12-07 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: chemi-SELEX
WO1995007092A1 (fr) * 1993-09-10 1995-03-16 The University Of Medicine And Dentistry Of New Jersey Vecteurs de transport d'agents neurologiques traversant la barriere hemato-encephalique
WO1995015183A1 (fr) * 1993-12-02 1995-06-08 Basf Aktiengesellschaft Conjugues d'hirudine comprenant de l'hirudine et des composes lipophiles
US5919762A (en) * 1993-12-02 1999-07-06 Basf Aktiengesellschaft Conjugates of hirudin and lipophilic compounds
US6057299A (en) * 1994-01-13 2000-05-02 Calydon, Inc. Tissue-specific enhancer active in prostate
US6136792A (en) * 1994-01-13 2000-10-24 Calydon, Inc. Prostate specific enhancer polynucleotides and methods of use thereof
WO1995029186A1 (fr) * 1994-04-20 1995-11-02 The Trustees Of Princeton University Compositions et procedes de transformation de cellules
AU687557B2 (en) * 1994-04-20 1998-02-26 Trustees Of Princeton University, The Compositions and methods for cell transformation
WO1995034665A2 (fr) * 1994-06-16 1995-12-21 Peter Seibel Fragment chimerique d'acide nucleique-peptide, son procede de production et son utilisation afin d'introduire de maniere appropriee des acides nucleiques dans des organelles de cellules et dans des cellules
US6921816B2 (en) * 1994-06-16 2005-07-26 Peter Seibel Chimerical peptide-nucleic acid fragment, process for producing the same and its for appropriately introducing nucleic acids into cell organelles and cells
WO1995034665A3 (fr) * 1994-06-16 1996-02-22 Peter Seibel Fragment chimerique d'acide nucleique-peptide, son procede de production et son utilisation afin d'introduire de maniere appropriee des acides nucleiques dans des organelles de cellules et dans des cellules
US6048698A (en) * 1994-09-20 2000-04-11 Nexstar Pharmaceuticals, Inc. Parallel SELEX™
US5858660A (en) * 1994-09-20 1999-01-12 Nexstar Pharmaceuticlas, Inc. Parallel selex
US5627185A (en) * 1994-11-23 1997-05-06 Gosselin; Gilles Acyclovir derivatives as antiviral agents
US6124445A (en) * 1994-11-23 2000-09-26 Isis Pharmaceuticals, Inc. Phosphotriester oligonucleotides, amidities and method of preparation
US5849905A (en) * 1994-11-23 1998-12-15 Centre National De La Recherche Scientifique Biologically active phosphotriester-type nucleosides and methods for preparing same
US6335436B1 (en) 1995-02-10 2002-01-01 Hybridon, Inc. Oligonucleotides active against drug-resistant bacteria
WO1996030536A1 (fr) * 1995-03-24 1996-10-03 Board Of Regents, The University Of Texas System Apport d'un acide nucleique cible egf
US5859228A (en) * 1995-05-04 1999-01-12 Nexstar Pharmaceuticals, Inc. Vascular endothelial growth factor (VEGF) nucleic acid ligand complexes
US8071737B2 (en) 1995-05-04 2011-12-06 Glead Sciences, Inc. Nucleic acid ligand complexes
US6582918B2 (en) 1995-06-07 2003-06-24 Gilead Sciences, Inc. Platelet derived growth factor (PDGF) nucleic acid ligand complexes
US6229002B1 (en) 1995-06-07 2001-05-08 Nexstar Pharmaceuticlas, Inc. Platelet derived growth factor (PDGF) nucleic acid ligand complexes
US7879993B2 (en) 1995-06-07 2011-02-01 Gilead Sciences, Inc. Platelet derived growth factor (PDGF) nucleic acid ligand complexes
US6441161B1 (en) 1996-03-27 2002-08-27 Gilead Sciences, Inc. Urea nucleosides as therapeutic and diagnostic agents
US6143882A (en) * 1996-03-27 2000-11-07 Nexstar Pharmaceuticals, Inc. Urea nucleosides as therapeutic and diagnostic agents
US6914138B2 (en) 1996-03-27 2005-07-05 Gilead Sciences, Inc. Urea nucleosides as therapeutic and diagnostic agents
US5959100A (en) * 1996-03-27 1999-09-28 Nexstar Pharmaceuticals, Inc. Pyrimidine nucleosides as therapeutic and diagnostic agents
US5945527A (en) * 1996-05-30 1999-08-31 Nexstar Pharmaceuticals, Inc. Palladium catalyzed nucleoside modification methods using nucleophiles and carbon monoxide
US6838238B1 (en) 1996-10-17 2005-01-04 Invitrogen Corporation Morphatides: novel shape and structure libraries
US6962784B2 (en) 1996-10-25 2005-11-08 Gilead Sciences, Inc. Vascular endothelial growth factor (VEGF) nucleic acid ligand complexes
US5925628A (en) * 1997-03-31 1999-07-20 Genzyme Corporation Cationic amphiphiles for intracellular delivery of therapeutic molecules
US5912239A (en) * 1997-04-04 1999-06-15 Genzyme Corporation Imidazole-containing cationic amphiphiles for intracellular delivery of therapeutic molecules
US5948925A (en) * 1997-05-06 1999-09-07 Genzyme Corporation Cationic amphiphiles containing linkers derived from neutral or positively charged amino acids
US5952516A (en) * 1997-05-08 1999-09-14 Genzyme Corporation Cationic amphiphiles containing multiplesteroid lipophilic groups
US5942634A (en) * 1997-05-09 1999-08-24 Genzyme Corporation Cationic amphiphiles for cell transfections
WO1998050417A1 (fr) * 1997-05-09 1998-11-12 Genzyme Corporation Amphiphiles cationiques contenant une sequence de liaison disulfure pour transfections cellulaires
US6051698A (en) * 1997-06-06 2000-04-18 Janjic; Nebojsa Vascular endothelial growth factor (VEGF) nucleic acid ligand complexes
US6025140A (en) * 1997-07-24 2000-02-15 Perseptive Biosystems, Inc. Membrane-permeable constructs for transport across a lipid membrane
WO1999005302A1 (fr) * 1997-07-24 1999-02-04 The Perkin-Elmer Corporation Conjugues de peptides transporteurs et analogues d'acides nucleiques ainsi que leur utilisation
US6916918B2 (en) 1997-08-04 2005-07-12 Cell Genesys, Inc. Human glandular kallikrein enhancer, vectors comprising the enhancer and methods of use thereof
US6426335B1 (en) 1997-10-17 2002-07-30 Gilead Sciences, Inc. Vascular endothelial growth factor (VEGF) nucleic acid ligand complexes
US7939654B2 (en) 1997-12-16 2011-05-10 Gilead Sciences, Inc. Platelet derived growth factor (PDGF) nucleic acid ligand complexes
US6521252B1 (en) 1998-01-30 2003-02-18 Aventis Pharma S.A. Transfecting compounds which are sensitive to reducing conditions, pharmaceutical compositions containing them and their applications
US6531590B1 (en) * 1998-04-24 2003-03-11 Isis Pharmaceuticals, Inc. Processes for the synthesis of oligonucleotide compounds
WO1999055717A1 (fr) * 1998-04-24 1999-11-04 Isis Pharmaceuticals, Inc. Procedes de synthese de composes oligomeres
WO1999058152A1 (fr) * 1998-05-12 1999-11-18 University Of Florida Lipides cationiques a liaisons disulfure pour l'administration intracellulaire de substances therapeutiques
US6169078B1 (en) 1998-05-12 2001-01-02 University Of Florida Materials and methods for the intracellular delivery of substances
US6153434A (en) * 1998-05-12 2000-11-28 University Of Florida Methods for the intracellular delivery of substances
WO2000012530A1 (fr) * 1998-08-26 2000-03-09 Nexstar Pharmaceuticals, Inc. CLIVAGE DIRIGE SUR SITE dU DE CONJUGUES COVALENTS
US6020483A (en) * 1998-09-25 2000-02-01 Nexstar Pharmaceuticals, Inc. Nucleoside modifications by palladium catalyzed methods
US6355787B1 (en) 1998-09-25 2002-03-12 Gilead Sciences, Inc. Purine nucleoside modifications by palladium catalyzed methods and compounds produced
US6846918B2 (en) 1998-09-25 2005-01-25 Gilead Sciences, Inc. Nucleoside modifications by palladium catalyzed methods
US6512106B2 (en) 1998-09-25 2003-01-28 Gilead Sciences, Inc. Nucleoside modifications by palladium catalyzed methods
EP1155056A4 (fr) * 1998-12-04 2004-05-12 Mosaic Technologies Inc Methode d'immobilisation d'oligonucleotides
EP1155056A1 (fr) * 1998-12-04 2001-11-21 Mosaic Technologies, Inc. Methode d'immobilisation d'oligonucleotides
US6610837B1 (en) * 1999-03-16 2003-08-26 Isis Pharmaceuticals, Inc. Phosphate and thiophosphate protecting groups
US8106098B2 (en) 1999-08-09 2012-01-31 The General Hospital Corporation Protein conjugates with a water-soluble biocompatible, biodegradable polymer
US8247383B2 (en) 1999-08-09 2012-08-21 The General Hospital Corporation Drug-carrier complexes and methods of use thereof
US6822086B1 (en) 1999-08-09 2004-11-23 The General Hospital Corporation Drug-carrier complexes and methods of use thereof
WO2001060412A2 (fr) 2000-02-15 2001-08-23 Genzyme Corporation Modification de biopolymeres pour administration amelioree de medicaments
US6749865B2 (en) 2000-02-15 2004-06-15 Genzyme Corporation Modification of biopolymers for improved drug delivery
WO2001060412A3 (fr) * 2000-02-15 2002-01-24 Genzyme Corp Modification de biopolymeres pour administration amelioree de medicaments
EP1263472A2 (fr) * 2000-02-15 2002-12-11 Genzyme Corporation Modification de biopolymeres pour administration amelioree de medicaments
US7417021B2 (en) 2000-02-15 2008-08-26 Genzyme Corporation Biologically active conjugate of a biopolymer and therapeutic agent
US7902353B2 (en) 2000-06-27 2011-03-08 The Board Of Trustees Of The University Of Illinois Nucleic acid enzyme biosensors for ions
US8206915B2 (en) 2000-06-27 2012-06-26 Board Of Trustees Of The University Of Illinois Nucleic acid enzyme biosensors for ions
US6762281B2 (en) 2000-09-08 2004-07-13 Isis Pharmaceuticals, Inc. Process for preparing peptide derivatized oligomeric compounds
WO2002020544A1 (fr) * 2000-09-08 2002-03-14 Isis Pharmaceuticals, Inc. Procédé pour l'élaboration de composés oligomères en dérivation de peptides
US6559279B1 (en) 2000-09-08 2003-05-06 Isis Pharmaceuticals, Inc. Process for preparing peptide derivatized oligomeric compounds
WO2002092631A1 (fr) * 2001-05-14 2002-11-21 The Horticulture And Food Research Institute Of New Zealand Limited Dosage cinetique
US8188247B2 (en) 2001-05-18 2012-05-29 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US8372949B2 (en) 2001-06-05 2013-02-12 The Board Of Regents, The University Of Texas System Molecular recognition of materials
WO2003026590A3 (fr) * 2001-09-28 2003-12-04 Univ Texas Regulation biologique de nanoparticules
WO2003026590A2 (fr) * 2001-09-28 2003-04-03 Board Of Regents, The University Of Texas System Regulation biologique de nanoparticules
US7179907B2 (en) 2001-12-18 2007-02-20 Bruce Eaton Antibiotic compounds
WO2003091443A1 (fr) * 2002-04-24 2003-11-06 Avaris Ab Complexe de transfert synthetique et methode de transfert d'acides nucleiques
US8043802B2 (en) 2002-05-10 2011-10-25 The Board Of Trustees Of The University Of Illinois Fluorescence based biosensor
US7906320B2 (en) 2002-05-10 2011-03-15 The Board Of Trustees Of The University Of Illinois Fluorescence based biosensor
US7374893B2 (en) 2002-09-18 2008-05-20 Board Of Regents, University Of Texas System- Peptide mediated synthesis of metallic and magnetic materials
US8969252B2 (en) 2002-09-18 2015-03-03 Board Of Regents, University Of Texas System Peptide mediated synthesis of metallic and magnetic materials
US8853376B2 (en) 2002-11-21 2014-10-07 Archemix Llc Stabilized aptamers to platelet derived growth factor and their use as oncology therapeutics
US7538192B2 (en) 2002-12-18 2009-05-26 Palo Alto Research Center Incorporated Process for preparing albumin protein conjugated oligonucleotide probes
EP1594977A4 (fr) * 2003-02-18 2009-01-28 Mirus Bio Corp Fixation reversible d'un polymere a action membranaire a un polynucleotide
US7816337B2 (en) 2003-02-18 2010-10-19 Roche Madison Inc. Reversible attachment of a membrane active polymer to a polynucleotide
EP1594977A2 (fr) * 2003-02-18 2005-11-16 Mirus Corporation Fixation reversible d'un polymere a action membranaire a un polynucleotide
WO2005041859A2 (fr) 2003-04-30 2005-05-12 Sirna Therapeutics, Inc. Conjugues et compositions
EP1622572A4 (fr) * 2003-04-30 2011-04-06 Sirna Therapeutics Inc Conjugues et compositions pour la livraison cellulaire
EP1622572A2 (fr) * 2003-04-30 2006-02-08 Sirna Therapeutics, Inc. Conjugues et compositions pour la livraison cellulaire
US10196641B2 (en) 2003-09-09 2019-02-05 Geron Corporation Modified oligonucleotides for telomerase inhibition
US9657296B2 (en) 2003-09-09 2017-05-23 Geron Corporation Modified oligonucleotides for telomerase inhibition
US9404112B2 (en) 2003-09-09 2016-08-02 Geron Corporation Modified oligonucleotides for telomerase inhibition
EP3342425A1 (fr) * 2003-09-09 2018-07-04 Geron Corporation Oligonucléotides modifiés pour l'inhibition de la télomérase
KR101319388B1 (ko) * 2003-09-09 2013-10-22 제론 코포레이션 텔로머라제 억제를 위한 변형 올리고뉴클레오티드
US9388415B2 (en) 2003-09-09 2016-07-12 Geron Corporation Modified oligonucleotides for telomerase inhibition
EP1667522A4 (fr) * 2003-09-09 2011-04-27 Geron Corp Oligonucleotides modifies destines a l'inhibition de la telomerase
EP3682903A1 (fr) * 2003-09-09 2020-07-22 Geron Corporation Oligonucléotides modifiés pour l'inhibition de la télomérase
EP1667522A2 (fr) * 2003-09-09 2006-06-14 Geron Corporation Oligonucleotides modifies destines a l'inhibition de la telomerase
US9388416B2 (en) 2003-09-09 2016-07-12 Geron Corporation Modified oligonucleotides for telomerase inhibition
WO2006089668A1 (fr) * 2005-02-23 2006-08-31 Ludwig-Maximilians-Universität Transport de structures nano- et macromoleculaires dans des cytoplasme et noyaux de cellules
EP1695717A1 (fr) * 2005-02-23 2006-08-30 Ludwig-Maximilians-Universität Transport de structures nano-et macromoléculaires dans le cytoplasme et le noyau des cellules
US8470532B2 (en) 2005-08-11 2013-06-25 The Board Of Trustees Of The University Of Illinois Aptamer-based colorimetric sensor systems
US7892734B2 (en) 2005-08-11 2011-02-22 The Board Of Trustees Of The University Of Illinois Aptamer based colorimetric sensor systems
US7799554B2 (en) 2006-03-16 2010-09-21 The Board Of Trustees Of The University Of Illinois Lateral flow devices
EP2046964A4 (fr) * 2006-07-12 2014-05-14 Univ California Distribution transductrice d'acides nucléiques par des groupes de protection phosphotriester réversible à neutralisation de charge
EP2046964A2 (fr) * 2006-07-12 2009-04-15 The Regents of the University of California Distribution transductrice d'acides nucléiques par des groupes de protection phosphotriester réversible à neutralisation de charge
US8415461B2 (en) 2007-01-19 2013-04-09 The Board Of Trustees Of The University Of Illinois Amphiphilic substances and functionalized lipid vesicles including the same
WO2008089248A2 (fr) * 2007-01-19 2008-07-24 The Board Of Trustees Of The University Of Illinois Substances amphiphiles et vésicules lipidiques fonctionnalisées contenant de telles substances
WO2008089248A3 (fr) * 2007-01-19 2009-05-28 Univ Illinois Substances amphiphiles et vésicules lipidiques fonctionnalisées contenant de telles substances
US8785409B2 (en) 2007-01-30 2014-07-22 Geron Corporation Compounds having anti-adhesive effects on cancer cells
US9732114B2 (en) 2007-01-30 2017-08-15 Geron Corporation Compounds having anti-adhesive effects on cancer cells
US8058415B2 (en) 2007-04-24 2011-11-15 The Board Of Trustees Of The University Of Illinois Aptamer- and nucleic acid enzyme-based systems for simultaneous detection of multiple analytes
US8409800B2 (en) 2007-07-16 2013-04-02 The Board Of Trustees Of The University Of Illinois Nucleic acid based fluorescent sensor for copper detection
US8568690B2 (en) 2007-07-31 2013-10-29 The Board Of Trustees Of The University Of Illinois MRI contrast agents and high-throughput screening by MRI
US8367416B2 (en) 2007-08-10 2013-02-05 The Board Of Trustees Of The University Of Illinois Nucleic acid based fluorescent sensor for mercury detection
US8062893B2 (en) 2008-10-10 2011-11-22 The Board Of Trustees Of The University Of Illinois Fluorescent sensor for mercury
EP3345915A1 (fr) 2010-04-12 2018-07-11 Somalogic, Inc. Pyramidines modifiés en position 5 et leur utilisation
WO2011130289A1 (fr) 2010-04-12 2011-10-20 Somalogic, Inc. Pyrimidines modifiées en position 5 et leur utilisation
US9687557B2 (en) 2010-06-22 2017-06-27 Onxeo Optimized in vivo delivery system with endosomolytic agents for nucleic acid conjugates
US9428538B2 (en) 2010-06-22 2016-08-30 Dna Therapeutics Optimized in vivo delivery system with endosomolytic agents for nucleic acid conjugates
US9205099B2 (en) 2010-06-22 2015-12-08 Dna Therapeutics Optimized in vivo delivery system with endosomolytic agents for nucleic acid conjugates
US10363317B2 (en) 2010-06-22 2019-07-30 Onxeo Optimized in vivo delivery system with endosomolytic agents for nucleic acid conjugates
US10765758B2 (en) 2010-06-22 2020-09-08 Onxeo Optimized in vivo delivery system with endosomolytic agents for nucleic acid conjugates
US8815156B2 (en) 2010-07-19 2014-08-26 Andalyze, Inc. Sensor housing and reagent chemistry
US9950001B2 (en) 2012-08-20 2018-04-24 The Regents Of The University Of California Polynucleotides having bioreversible groups
US20160257961A1 (en) * 2013-11-06 2016-09-08 Solstice Biologics, Ltd. Polynucleotide constructs having disulfide groups
EP3066105A4 (fr) * 2013-11-06 2017-10-11 Solstice Biologics, Ltd. Constructions polynucléotidiques contenant des groupes disulfure
US11299511B2 (en) 2014-05-01 2022-04-12 Geron Corporation Oligonucleotide compositions and methods of making the same
US10392418B2 (en) 2014-05-01 2019-08-27 Geron Corporation Oligonucleotide compositions and methods of making the same
US9796747B2 (en) 2014-05-01 2017-10-24 Geron Corporation Oligonucleotide compositions and methods of making the same
US11739114B2 (en) 2014-05-01 2023-08-29 Geron Corporation Oligonucleotide compositions and methods of making the same
US10563197B2 (en) 2015-07-23 2020-02-18 Institut Curie Use of a combination of Dbait molecule and PARP inhibitors to treat cancer
US11162095B2 (en) 2015-07-23 2021-11-02 Institut Curie Use of a combination of Dbait molecule and PARP inhibitors to treat cancer
US11981703B2 (en) 2016-08-17 2024-05-14 Sirius Therapeutics, Inc. Polynucleotide constructs
US11390642B2 (en) 2016-08-23 2022-07-19 Dicerna Pharmaceuticals, Inc. Compositions comprising reversibly modified oligonucleotides and uses thereof
US11597744B2 (en) 2017-06-30 2023-03-07 Sirius Therapeutics, Inc. Chiral phosphoramidite auxiliaries and methods of their use
US11236334B2 (en) 2017-08-22 2022-02-01 National University Corporation Nagoya University Modified polynucleotide

Also Published As

Publication number Publication date
AU7759291A (en) 1991-10-21
CA2079109A1 (fr) 1991-09-30
JPH05505941A (ja) 1993-09-02
EP0537299A1 (fr) 1993-04-21
EP0537299A4 (fr) 1993-02-05

Similar Documents

Publication Publication Date Title
WO1991014696A1 (fr) Conjugues a base de disulfure d'oligonucleotide et d'un agent de transport
EP0462145B1 (fr) Conjugue covalent de lipides et d'oligonucleotides
US5574142A (en) Peptide linkers for improved oligonucleotide delivery
US5214136A (en) Anthraquinone-derivatives oligonucleotides
US6444806B1 (en) Conjugates and methods of forming conjugates of oligonucleotides and carbohydrates
JP3529135B2 (ja) 特定のｒｎａ鎖の切断方法
US6235886B1 (en) Methods of synthesis and use
CA2071536C (fr) Formation de la triple helice de l'adn dans les traitements a base d'oligonucleotides
CN102869774B (zh) 用于靶向递送siRNA的组合物
US20070161587A1 (en) Cobalamin mediated delivery of nucleic acids, analogs and derivatives thereof
JPH06508022A (ja) 生体分子に特異的なアプタマーおよび生産方法
WO1994013325A9 (fr) Sequences de liaison peptidiques pour l'amelioration de l'apport d'oligonucleotides
WO1991013080A1 (fr) Pseudonucleosides, pseudonucleotides et leurs polymeres
US20080071069A1 (en) Conjugates and processes for their preparation and their use for transporting molecules across biological membranes
WO1992010590A1 (fr) Inhibition de transcription par formation de triple helice
WO1992020698A1 (fr) Medicaments liant l'adn de maniere specifique a une sequence
US6828434B2 (en) Oligonucleotide and nucleotide amine analogs, methods of synthesis and use
EP0579771A1 (fr) Oligonucleotides circulaires a brin unique
US5834607A (en) Amines and methods of making and using the same
WO1994006815A9 (fr) Analogues d'amines d'oligonucleotides et de nucleotides et procedes de synthese et d'utilisation desdits analogues
EP0531436A1 (fr) Agents de reticulation non photoactives, specifiques a une sequence, qui se lient au sillon principal d'adn duplex
JP4854913B2 (ja) オリゴヌクレオチド結合体
WO2003025139A2 (fr) Administration d'acides nucleiques, d'analogues et de derives de ceux-ci induite par cobalamine
Boiziau et al. Modified oligonucleotides in rabbit reticulocytes: uptake, stability and antisense properties
CA2153057A1 (fr) Nouveaux oligonucleotides modifies par des groupes de pontage non nucleotidiques

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP KR US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 1991918074

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2079109

Country of ref document: CA

WWP Wipo information: published in national office

Ref document number: 1991918074

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1991918074

Country of ref document: EP