WO1991013158A1 - Production de proteines dans la levure - Google Patents

Production de proteines dans la levure Download PDF

Info

Publication number
WO1991013158A1
WO1991013158A1 PCT/GB1991/000305 GB9100305W WO9113158A1 WO 1991013158 A1 WO1991013158 A1 WO 1991013158A1 GB 9100305 W GB9100305 W GB 9100305W WO 9113158 A1 WO9113158 A1 WO 9113158A1
Authority
WO
WIPO (PCT)
Prior art keywords
globin
yeast
feature
haemoglobin
promoter
Prior art date
Application number
PCT/GB1991/000305
Other languages
English (en)
Inventor
Jill Elizabeth Ogden
Original Assignee
Delta Biotechnology Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GB909004441A external-priority patent/GB9004441D0/en
Priority claimed from GB909017597A external-priority patent/GB9017597D0/en
Application filed by Delta Biotechnology Limited filed Critical Delta Biotechnology Limited
Publication of WO1991013158A1 publication Critical patent/WO1991013158A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/795—Porphyrin- or corrin-ring-containing peptides
    • C07K14/805—Haemoglobins; Myoglobins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to the production of a protein, human haemoglobin, in yeast.
  • Haemoglobin the oxygen carrying protein of blood, is a tetrameric molecule comprising two identical ⁇ chains (m.w. 15,126) and two identical ⁇ chains (m.w. 15,867). Each globin subunit contains a haem which binds an oxygen molecule (total m.w. Hb 64,450).
  • the oxygen affinity of haemoglobin is modulated by the prevailing physiological conditions and is dependent on such factors as the availability of oxygen, the pH of the environment and 2,3-diphosphoglycerate (2,3-DPG) within the erythrocyte.
  • haemoglobin is high in the presence of a plentiful supply of oxygen in the lungs and lowered in the oxygen poorer and more acidic environment of the muscles and tissues.
  • the pH dependence of oxygen dissociation from haemoglobin is termed the Bohr Effect and is a consequence of the haemoglobin oxygen saturation curve shifting to the right with increasing acidity.
  • 2,3- diphosphoglycerate which binds between the N-termini of the ⁇ chains, fine-tunes the oxygen affinity of haemoglobin within the erythrocyte.
  • 2,3-DPG the oxygen affinity of haemoglobin is very high. Thus free haemoglobin would release very little oxygen to respiring tissues.
  • haemoglobin tetramers in solution undergo concentration-dependent dissociation into their component ⁇ dimers.
  • stroma-free haemoglobin, SFHb stroma-free haemoglobin
  • SFHb stroma-free haemoglobin
  • Normally haemoglobin escaping from ageing erythrocytes into the plasma is cleared from the system via binding to the scavenging protein haptoglobin.
  • the resulting haemoglobin-haptoglobin complex is degraded by the spleen and liver.
  • High concentrations of free haemoglobin in plasma are cleared through but are toxic to the kidneys.
  • red cell red cell
  • haemoglobin in a host microorganism has many attractive features, particularly because it will be virus-free. Furthermore the oxygen affinity and stabilisation of the tetramer could be achieved either by employing mutant globin chains which already exist naturally or by relying on the cross-linked formulations under development.
  • the fusion protein is expressed as an insoluble intracellular product which requires denaturing, refolding and cleavage with Factor Xa to release an authentic ⁇ or ⁇ -globin protein chain.
  • ⁇ and ⁇ -globin chains purified in this way are then reconstituted In vitro, with exogenous haem, to give functional haemoglobin tetramers.
  • the cost of production of recombinant haemoglobin via this route would be prohibitive on a large scale.
  • WO 88/09179 describes solutions of mutant haemoglobins for use as blood substitutes.
  • the mutant globin chains can be produced by recombinant DNA techniques. Only mutant ⁇ chains are exemplified.
  • the host selected was E. coli , although yeast was mentioned as a possible host for the production of mutant globin chains.
  • haemoglobin A ⁇ 2 ⁇ 2
  • WO84/03712 although based on immunoglobulin production, refers generally to co-expressing multichain polypeptides in host cells. More recently Hoffman and others have described the production of recombinant haemoglobin in E. coli and yeast (WO90/13645) by co-expressing ⁇ and ⁇ -globin chains in the same cell. They took care to express the ⁇ - and ⁇ -globin chains in stoichiometrically equal amounts (page 36, lines 23-24). Horowitz et al (1990 J. Blol . Chem. 265(8), 4189-
  • ⁇ - thalassaemia is caused by a defect in ⁇ -globin synthesis and ⁇ - thalassaemia by a defect in ⁇ -globin synthesis (Weatherail, D. J . and Clegg, J. B. In The Thalassaemia Syndromes, 1981 (3rd edition), Blackwell Scientific Publications, Oxford) .
  • ⁇ - thalassaemia excess ⁇ -chains can form ⁇ 4 tetramers (haemoglobin H). These molecules are unstable, unable to deliver oxygen and, in older red cell populations, tend to precipitate.
  • ⁇ - thalassaemia excess ⁇ chains cannot form viable molecules and precipitate in the red cell precursors resulting in cell membrane damage.
  • ⁇ -globin mRNA is produced in higher amounts than the ⁇ -globin mRNA and/or ⁇ - globin protein is produced in higher amounts than ⁇ -globin protein.
  • the globin proteins are expressed as soluble intracellular products, contain haem and have correctly processed N-termini.
  • the synthesis of increased levels of ⁇ -globin or ⁇ -globin mRNA can be achieved by using promoters of different strengths on the same plasmid or on different plasmids co-transformed.
  • the promoters can be those of the S. cerevisiae genes GAL1 , GAL10 , GAPDH, MF ⁇ 1 , TPI, PYK, PHO5, PRB1 , PGK, ADH1 , CYC1 or GUT 2, or hybrid promoters such as those of EP-A-258 067. These have been shown to direct expression of foreign proteins with varying efficiencies. This may be compared with the methods of WO90/13645 (page 106, for example), where the same promoter was used for each coding sequence.
  • CYC1 resulted in an expression level of 0.14% of the total cell protein (TCP); GAPDH, 0.22% TCP; PHO5 , 0.26% TCP; PGK, 0.9% TCP; and GAL 7, 0.96% TCP.
  • the codons may be so chosen according to the well-known criteria regarding yeast preferences that the ⁇ -globin mRNA is translated more efficiently than the ⁇ -globin mRNA.
  • Highly expressed yeast genes show a very high codon bias.
  • Highly expressed yeast genes (>1% of the total mRNA) have yeast codon bias indices of >.90.
  • Moderately expressed genes (0.1-.05% of the total mRNA) have bias indices of 0 . 6-0 . 8
  • genes expressed at low levels have a codon bias of 0.10-0.50 (Bennetzen and Hall, J. Blol . Chem. 257: 3026-3031 (1982)). See also Sharp et al (1986) Nuc.
  • the calculated value for the codons of the human ⁇ -globin cDNA is 0.23.
  • a similar value can be calculated for the ⁇ -globin cDNA. Because there is a very high correlation between the most commonly used codons, it is possible that hemoglobin expression from the human cDNA in yeast is limited by the availability of the appropriate tRNA molecules. If this is so, a complete synthesis of the gene using the most highiy favoured yeast codons could improve the expression levels. It is quite possible that the greatest negative effect of adverse codon use would be if there was an abundance of codons used in the cDNA that are represented by low abundance tRNAs.
  • plasmids may be used which have different copy numbers as determined by their selectable markers.
  • LEU2d LEU2 gene present on pJDB207-based plasmids
  • LEU2d which lacks efficient promoter sequences, confers a potentially higher copy number than other selectable markers such as URA3, TRP1 and the complete LEU2 gene present on YEP13-based plasmids.
  • This provides a further way of adjusting the relative levels of ⁇ - and ⁇ -globin production.
  • the ratio of ⁇ -globin mRNA molecules to ⁇ -globin mRNA molecules is at least 1.1:1, preferably at least 1.4:1 or 2:1 and may be 5:1 or more. It is generally not desirable for the ratio to exceed 100:1 and it is typically less than 50:1 or 20:1.
  • the co-expression is achieved by using the "bidirectional expression system" of EP-A-317 254.
  • a single upstream activation site UAS controls two promoters which regulate transcription, in mutually divergent directions, of two coding sequences.
  • the ⁇ - chain coding sequence is placed on one side of the UAS, with a suitable promoter interposed, and the ⁇ chain coding sequence is placed on the other side, with another promoter (or another copy of the same promoter) interposed.
  • Appropriate further signals providing for efficient transcription and translation, for example poly A tails, are provided as necessary or desirable and in known ways.
  • ⁇ and ⁇ -globin expression cassettes may be inserted into different plasmids which carry complementary auxotrophic markers, such as the LEU2 and TRP1 genes, and which are then co-transformed into yeast strains containing the relevant mutations.
  • promoters of various strengths may be employed, for example the yeast glyceraldehyde-3-phosphate dehydrogenase promoter, glycerol-3-phosphate dehydrogenase ( GUT2) promoter or the protease B1 promoter, and this may be useful in optimising expression.
  • the DNA sequence of the PRB1 gene and of 150 bp of its promoter have been reported (Moehle et al (1987) Mol . Cell . Blol . 7, 4390-4399) and a fuller sequence for the promoter is given at Genbank release 60, accession number M18097, locus YSCPRB1.
  • a lkbp sequence extending upstream of the start codon to the SnaBl site is effective as a promoter.
  • Plasmids may also be constructed with independent ⁇ and ⁇ -globin expression cassettes comprising identical or different promoters reading in the same direction or opposite directions.
  • Any suitable promoter or promoters may be used, for example the promoters normally associated with the S. cerevl ⁇ lae PGK, PHO5, ADH1 , CYC1 or GAL1 genes, or hybrid promoters such as those of EP-A-258 067, EP-A-225 887 or EP-A-164 556.
  • Any 5' DNA sequence which is effective at promoting transcription may be used, for example the shortened PGK promoter of WO 87/03008, providing (in the case of bidirectional expression) that it can be controlled by the common UAS.
  • the UAS is preferably the UAS normally associated with the PGK promoter (which is described in WO 84/04757) or the GAL1 and GAL10 promoters (described in EP-A-258 067 and EP-A-317 254).
  • the ⁇ -globin and ⁇ -globin coding sequences may encode nature- identical globins representative of the majority of the human population or mutant globins which may be natural or not found in nature and may be shorter than the natural globin.
  • a mutant globin is one which shares some homology with the corresponding region of the nature-identical globin (preferably 80%, 90%, 95% or 99%, and is capable of forming a non-immunogenic, non-toxic oxygen-carrying complex with haem, optionally with other globin monomers.
  • mutant globin chains which combine to form haemoglobin having a reduced oxygen affinity since the affinity of purified nature-identical haemoglobin (due to lack of 2,3 DPG) is too high to allow for sufficient delivery of oxygen to the tissues.
  • ⁇ -globin and ⁇ -globin in this specification encompass all these types of globin.
  • the yeast host is preferably Saccharomyces cerevlslae , but may alternatively be Schlzosaccharomyces pombe or Kluveromyces lactls , in which case an appropriate S. pombe or K. lactls promoter may be chosen.
  • haem production is not usually limiting in yeast , although , clearly , mutants which are auxotrophic for haem should not be used as hosts for haemoglobin production unless haem or protoporphyrin is added. Haem synthesis is favoured by aerobic conditions, using a non-fermentable carbon source.
  • the yeast host is fermented in conventional ways and, if the haemoglobin is obtained as an intracellular product, the yeast cells are lysed in known ways to obtain the haemoglobin. This is then purified in known ways.
  • the purified haemoglobin may be dissolved in a sterile, pyrogen-free medium, for example saline, and administered by intravenous injection as a haemoglobin-based oxygen delivery system. It may alternatively be combined with other blood components, or presented in liposomes or other bodies intended to mimic erytnrocytes.
  • Figure 1 is a map of an expression vector pKV50, described in more detail in EP-A-258 067;
  • Figure 2 is a map of plasmid pGLB ⁇ 2, in which a met- ⁇ -globin cDNA has been inserted into the pKV50 vector of Figure 1;
  • Figure 3 is a map of pSP646 ⁇
  • Figure 4 is a map of pGLB ⁇ 6 which corresponds to pGLB ⁇ 2 (Fig 2) but has a ⁇ -globin cDNA inserted instead of an ⁇ -globin cDNA;
  • Figure 5 is a map of plasmid pEK30 which is based on pKV50 but which has a bidirectional expression system included;
  • Figures 6 to 8 are respective maps of plasmids pHb2, pHb1 and pHb3 in which cDNAs for ⁇ -globin, ⁇ -globin or both, respectively, are inserted into the bidirectional expression system vector (pEK30) of Figure 5; and
  • Figures 9 to 33 are respective maps of plasmids pHb6, pAYE333, pAYE334, pAYE328, pAYE335, pDBP5, pDBP6, pBN1, pSP646 ⁇ 'delta, pBN1 ⁇ , pXL5, pAYE274, pAYE275, pAYE276, PAYE323, ⁇ AYE344, pSN344 ⁇ , pGT ⁇ 10, pGLB ⁇ 9, PKV50-TRP, pTN2, pGT ⁇ PRB, pGT ⁇ PRB, pHbD2-1 and pHbD3-1.
  • hsd5 ( r- ,m- ) , ( F'proAB, lacIqzdelta . M15) and XL1 Blue ( supE44 , hsdR1 7, recA1 , endA1 , gyrA46, thi , recA1, lac- ) and preparation of plasmid, M13 RFDNA and single-stranded DNA used standard methods (Sambrook, J. et al . , Molecular Cloning, Cold Spring Harbor, New York, 1989).
  • DNA sequencing was by the dideoxy chain termination method (Sanger, F.S. et al . Proc. Natl . Acad. Scl . USA 1977, 74,
  • Oligonucleotides were synthesised using an Applied Biosystems 380B DNA Synthesizer and were purified and annealed according to Sambrook et al . (Molecular Cloning, Cold Spring Harbor, New York, 1989).
  • Yeast cultures were grown on YEP (yeast extract 1% (w/v), peptone 2% (w/v)) or defined minimal medium (Hawthorne, D.C. and Mortimer, R.K. Genetics, 1960, 40, 1085) with amino acid supplements where necessary. Transformation of yeast was by published protocols (Hinnen, A. et al . , Proc. Na tl . Acad. Sci . USA , 1978, 75, 912).
  • ⁇ and ⁇ -globin cDNAs (Sequences 1 and 3) which corresponded to those described previously (Hoffman, S. and Nagai, K. WO88/09179) were tailored using oligonucleotides to produce an ⁇ -globin BamHI fragment and a ⁇ -globin Sglll fragment for insertion into expression vectors.
  • the initial ATG codon is not shown in the sequences.
  • the ⁇ -globin cDNA was tailored as follows: a 2l5bp BssHII- Hindl I I fragment containing part of the ⁇ -globin cDNA was ligated with a 57bp BamHI-BssHII synthetic fragment, produced by annealing oligonucleotides J07 and J08 (SEQ5 and 3EQ5 respectively), J07 5'- GATCC AAA AAA ATG GTG CTG TCT CCT GCC GAC AAG ACC J08 3'- G TTT TTT TAC CAC GAC AGA GGA CGG CTG TTC TGG
  • RFDNA prepared from one of the recombinant plaques was digested with BamHI and HindIII and the 282bp 5' ⁇ - globin fragment was purified by electroelution from a 1% agarose gel. This fragment was ligated with the 3' Hindlll-BamHI ⁇ - globin fragment and Bglll digested, phosphatased pKV50 ( Figure
  • Plasmid pSP646 is a derivative of pSP64 (Promega Biotech) in which the polylinker sites HindIII and Smal were converted to BglIl and HindiII respectively using oligonucleotide linkers.
  • the tailoring of the ⁇ -globin cDNA was as follows: a 543bp ApaLI-Hindlll fragment containing ⁇ -globin cDNA (SEQ3) was ligated with a 15bp synthetic Bglll-ApaLI fragment, produced by annealing oligonucleotides J09 and J010 (shown below), and Bglll-HindIII digested pSP646.
  • Plasmids pGLB ⁇ 2 and pGLB ⁇ 6 were transformed separately into yeast strain DBY745 ( ⁇ , adel-100, leu2-3, leu2-112, ura3-52).
  • Leu + transformants containing pGLB ⁇ 2 or pGLB ⁇ 6 were grown in 3ml precultures overnight at 30°C in minimal medium containing adenine and uracil, both at 20 ⁇ g/ml, with 2% glucose as carbon source. The cells were then inoculated into 100ml of the same medium, except that the carbon source was 2% galactose, and grown until the stationary phase of growth.
  • the yeast cells were harvested by centrifugation (2770g, 5 min) and the cell pellet was resuspended in 1-1.5ml 50mM Tris HCl buffer pH7.6 containing 2mM PMSF (phenylmethylsulphonyl fluoride, Sigma). Glass beads (BDH, 40 mesh) were added until they reached the meniscus of the cell suspension and the tubes were vortexed (4 x 45 sec, with 1 min on ice in between). The cell lysate was centrifuged to sediment the glass beads and the cell extracts were removed to eppendorf tubes. The cell extracts were centrifuged (5 min 16000g M AX ) and the supernatants containing soluble protein fractions were transferred to clean tubes. The cell pellets containing the insoluble protein fractions were resuspended in an equivalent volume of Laemmli buffer (Laemmli, U.K. Nature 1970, 227, 680).
  • Laemmli buffer Laemmli, U.K. Nature 1970, 227
  • Proteins in the soluble and insoluble protein fractions were resolved on 10% SDS-PAGE gels (Laemmli, U.K. Na ture 1970, 227, 680) followed by electroblotting onto a membrane support ( Immobilon P, Miliipore). The Western blot was probed with a polyclonal rabbit anti-human haemoglobin antibody (1:1000 dilution), followed by peroxidase-conjugated goat anti-rabbit antibody (Sigma). Immunoreactive proteins were visualised using the ECL detection system (Amersham). The data demonstrated that transformants containing pGLB ⁇ 6 expressed an immunoreactive protein species in soluble and insoluble fractions which comigrated with standard globin (Sigma).
  • pGLB ⁇ 2 transformants contained barely detectable levels of immunoreactive protein.
  • Northern blotting analysis of total RNA (for protocol see Mellor J. et al . , Gene 1985, 33, 215) from pGLB ⁇ 2 and pGLB ⁇ 6 transformants demonstrated that ⁇ and ⁇ - globin-specific mRNAs were abundant in respective transformants. This suggested that the poor expression of ⁇ -globin protein must result from a defect at the translational or post-translational level.
  • ⁇ and ⁇ -globin within the same cell was achieved using a vector containing a galactose-inducible bidirectional promoter.
  • This vector was constructed by modifying pKV50 (Figure 1) as follows. pKV50 was digested with BamHI and the ends "filled-in” using Klenow, followed by ligation with an approximately 500bp ZhoI-Hindlll end-filled fragment containing the promoter and terminator of the iso-I- cytochrome c gene ( CYC1 ) . This gave plasmid pEK30 ( Figure 5).
  • Plasmids based on pEK30 were then constructed which contained the ⁇ -globin cDNA only (pHb2), the ⁇ -globin cDNA only (pHb1) and ⁇ and ⁇ -globin cDNAs (pHb3) ( Figures 6-8).
  • Plasmid pHb1 was constructed by ligating BamHI-digested, phosphatased PEK30 with a gel-purified BglII fragment containing ⁇ -giobin isolated from pGLB ⁇ 6.
  • pHb2 was constructed by ligating BgIll-digested, phosphatased pEK30 with gel-purified BamHI ⁇ -giobin fragment from pSP646 ⁇ .
  • pHb3 was constructed by ligating BgIll-digested, phosphatased pHbl with the BamHI ⁇ -giobin fragment from pSP646 ⁇ . Plasmids pHb1, pHb2 and pHb3 were transformed into strain DBY745 and the resulting LEU + transformants were analysed for the presence of globin protein as described in Example 1. As expected, pHb2 ( ⁇ -globin only) transformants contained barely detectable levels of immunoreactive protein. As the Western blots were probed with antibody raised against human haemoglobin, rather than against isolated ⁇ and ⁇ -globin chains, it was not possible at this stage to confirm whether both ⁇ and ⁇ -globin proteins were produced in pHb3 transformants.
  • the globin proteins in the intracellular soluble fractions from a 6 litre culture of a pHb3 transformant grown in minimal medium under galactose-inducing conditions were purified as follows.
  • the yeast ceils were harvested by centrifugation (7,000g, 15 min) , resuspended in lysis solution ( 2mM PMSF, ImM EDTA in deionised water) and broken in a bead beater (Biospec Products). Carbon monoxide was bubbled through the cell lysate and the cell extract was then clarified by centrifugation (30,000g, 30 min).
  • the supernatant containing the soluble protein fractions was desalted on a Sephadex G-25 column using 10mM phosphate pH6.5 as buffer and then loaded on to a Sepharose Fast Flow column equilibrated with the same buffer.
  • the red band formed on the column was eluted with a pH gradient (10mM phosphate to pH8.0).
  • the pH of the eluate was adjusted with acetic acid to pH6.5 and then loaded on to a CM Sepharose column equilibrated with 10mM phosphate pH6.5.
  • the recombinant haemoglobin was eluted from the column using a 10mM phosphate pH gradient ( to pH8.0).
  • Each step of the purification was monitored by measuring absorbance spectra from 240 to 650nm. Haemoglobin concentrations were determined using published extinction coefficients. Total soluble protein was determined using Coomassie Protein Assay Reagent (Pierce). This purification procedure gave haemoglobin of 94% purity.
  • yeast-derived haemoglobin samples were denatured in 4M urea, 10% ⁇ -mercaptoethanol, 0.1M sodium phosphate (10 min, 20°C) and ⁇ and ⁇ -globin chains were separated using a 300 ⁇ pore Vydac C4 column equilibrated at lml/min in 70% solvent A (0.1% trifluoroacetic acid), 30% solvent 3 (90% acetonitrile - 0.09% trifluoroacetic acid).
  • the chains were identified by chromatography of ⁇ and ⁇ -globin chain standards isolated using the PMB method (Bucci, E. Methods in Enzymology 1981, 76, 97).
  • Recombinant globins were subject to 20 cycles of N-terminal sequence analysis (Applied Biosystems Model 477A Protein Sequencer) which demonstrated that the N- termini were authentic.
  • the purified carbonmoncxyhaemogicbin was converted into oxyhaemogiobin by flushing tne solution with oxygen in bright light.
  • the absorbance spectra in the oxy-, deoxy- (after reducing with sodium dithionite) and carbonmonoxy- (after bubbling through carbon monoxide) forms were characteristic of haemoglobin A.
  • the recombinant haemoglobin was assessed for oxygen and carbon monoxide binding properties.
  • CO binding studies using a stopped-flow spectrophotometer were carried out at a number of wavelengths and CO concentrations using haemoglobin solutions at around 2 ⁇ m haem in 0.1M sodium phosphate pH7.0, 20°C (Antonini, E. et al . J. Blol . Chem. 1967, 242, 4360).
  • the rate constant (1') for CO combination of the recombinant haemoglobin was -2 x 10 5 M -1 s -1 , identical to that for standard HbA derived from erythrocytes.
  • Oxygen binding measurements were made using either a tonometric method (see Antonini, E. and Brunori, M. in Hemoglobin and Myoglobln In their Reactions with Ligands 1971, North. Holland Publishing Company, London) or an enzymic method.
  • oxyhaemoglobin solutions (30 ⁇ M haem; 0.1M sodium phosphate with 0.01% Tween 80) and an oxygen electrode (Silversprings) were sealed in a 3ml cuvette with constant stirring at 25°C.
  • the solution was deoxygenated by addition of sodium ascorbate (10mM) N, N, N', N'-tetramethyl-p-phenylene diamine (50 ⁇ M), cytochrome c (horse) (0.25 ⁇ m) and cytochrome c oxidase (bovine heart) (at 0.4 ⁇ M haem). Repeat spectral scans over a period of 20-25 mins allowed measurement of fractional saturation as a function a oxygen tension.
  • the relative proportions of ⁇ and ⁇ -globin in the yeast cell can be adjusted in a number of different ways. For example different combinations of promoters of varying efficiencies can be used on the same plasmid or on plasmids co-transformed. In the co-transformati ⁇ n approach, plasmids can be used which have different copy numbers as determined by their selectable markers. For example, plasmids carrying the LEU2 gene from pJDB207 (LEU2d) , which lacks efficient promoter sequences, have higher copy numbers than plasmids carrying other selectable markers such as URA3, TRP1 and the complete LEU2 gene present on YEp13-based plasmids.
  • pHb6 Figure 9
  • PRB1 the promoter of the protease B gene
  • GUT2 the promoter of the glycerol-3- phosphate dehydrogenase gene
  • the PRB1 promoter has been shown to be more efficient than GUT2 for the expression of human serum albumin.
  • the construction of pHb6 was as follows.
  • Plasmid PAYE333 was linearised by partial digestion with SnaBI and the double stranded oligonucleotide linker 1 inserted by ligation at the SnaBI site within the PRB1 promoter. Linker 1
  • the promoter element was further modified by site directed mutagenesis (oligonucleotide direct in vitro mutagenesis system - version 2, Amersham) according to the manufacturer's instructions. Mutagenesis with the 31-mer oligonucleotide
  • Plasmid pAAH5 (Goodey et al . 1987: In Yeast Biotechnology, 401- 429, edited by Berry, D. R., Russell, I and Stewart, G. G. Published by Allen and Unwin) was linearised by partially digesting with BamHI. The 5' protruding ends were blunt-ended with T4 D ⁇ A polymerase and d ⁇ TPs and ligated with the double- stranded oligonucleotide Linker 1. A recombinant plasmid pAYE334 ( Figure 11) was selected in which a NotI restriction site had replaced the BamHI site at the 3' end of the ADHI terminator.
  • Plasmid pAT153 (Twigg & Sherratt (1980) Nature 283, 216-218) was digested with BcoRI/BamHI and the larger 3.36kbp D ⁇ A fragment purified. The 5' protruding ends were blunt-ended with T4 D ⁇ A polymerase and d ⁇ TPs and recircularised with the double-stranded oligonucleotide Linker 1, generating plasmid pAYE328 ( Figure 12).
  • Plasmid pAAH5 (Goodey et al . 1987: In Yeast Biotechnology, 401-429, edited by Berry, D.R., Russell, I. and Stewart, G.G. Published by Alien and Unwin) was digested with SphI and the 326bp SphI fragment that spans the BamHI site at the end of the ADHI terminator was purified by gel electrophoresis. This fragment was cloned into SphI-digested, phosphatased pDBP6, to regenerate the ADH1 terminator, but replacing the NotI site with a BamHI site. The resulting plasmid, pB ⁇ 1 ( Figure 16) was purified from transformed E.
  • coli ⁇ M522 carried a unique NotI cloning site, the PRB1 promoter region, a unique Hindlll cloning site and the ADH1 terminator region.
  • a modified ⁇ -globin cDNA in which the internal Hindlll site and 3' untranslated mRNA region had been removed by in vi tro mutagenesis was used to construct a pBNl-based ⁇ -globin plasmid.
  • the oligonucleotide used to remove the internal Hindlll site is shown below.
  • RFDNA was prepared from one of the clones ( ⁇ RF3).
  • the 3' untranslated mRNA region of ⁇ -globin was removed by creating a Ba ⁇ nHI site immediately downstream of the ⁇ -globin stop codon (TAA) using a 21-mer oligonucleotide shown below.
  • the glycerol-3-phosphate dehydrogenase ( GUT2) yeast promoter fragment was obtained from a genomic library of fragments obtained by Bglll restriction of yeast DNA.
  • the Bglll restriction fragments are inserted into a unique Bglll site of a plasmid containing the Herpes Simplex thymidine kinase (TK) gene. Only when promoter fragments are cloned in front of the thymidine kinase gene will yeast transformed with this plasmid crow in the presence of foiate antagonists such as sulphanilamide and amethopterin, as described by Goodey et al . (Molecular and General Genetics, 204, 505-511 (1986)) which is incorporated herein by reference.
  • a plasmid having an active promoter was selected by measurement of thymidine kinase activity in the cell extract.
  • the promoter fragment was contained within a Bglll restriction fragment of plasmid pXL5 ( Figure 19).
  • a 1.48kbp fragment of the glycerol-3- phosphate dehydrogenase promoter was sequenced (SEQ17).
  • the promoter fragment was modifed by the introduction of an Sfil restriction endonuclease site on the 3' end of the yeast promoter.
  • a 282bp Pstl-Rsal fragment of the GUT2 promoter i.e. from the CTGCAG at position 1031-1036 to the GTAC at 1314-1317 of SEQ17
  • a 56bp double stranded oligonucleotide linker i.e. from the CTGCAG at position 1031-1036 to the GTAC at 1314-1317 of SEQ17
  • Plasmid pAYE274 was linearised with BcoRI and Pstl and recircularised with the 2.3kb EcoRI-PstI fragment from pXL5 ( Figure 19) generating pAYE275 ( Figure 121. This was digested with EcoRI -HindIII and the 2.3kb GUT2 promoter fragment purified.
  • Plasmid pAYE276 was linearised with HcoRI-Sstll, the 3' recessed ends filled in with T4 D ⁇ A polymerase and d ⁇ TP and the result recircularised with excess NotI linker (5' - GCGGCCGC - 3') generating plasmid pAYE323 ( Figure 23). Plasmid pAYE323 was digested with Sfil and Hindlll and the small intervening sequence replaced with oligonucleotide,
  • the NotI fragment from this plasmid was purified and ligated with Notl-digested , phosphatased pDBP5 ( Figure 14), to generate PAYE344 ( Figure 24) which carries the GUT2 promoter region, a unique Hindlll cloning site and the ADH1 terminator region.
  • the ⁇ -globin cD ⁇ A was cloned into pAYE344 on an ApaLI-Sall fragment purified from pGLB ⁇ 6, with oligonucleotides XL5BU and XL53L, by ligation with Hindlll- and SaIl-digested, gel-purified PAYE344 vector.
  • the sequence of these oligonucleotides was:- XL5BU 5' - AGCTTGATAATATAAAGATGG - 3' (SEQ20)
  • the recombinant plasmid, pAYE344 ⁇ was isolated from E. coli NM522 transformants, and double-stranded DNA sequencing confirmed the sequence of the oligonucleotides and the junction with the ⁇ -globin cDNA.
  • the Sall site of this plasmid was replaced with a NotI site by ligating Sall-digested, phosphatased OAYE344, the plasmid was "filled in” by treatment with Klenow fragment, with the oligonucleotide Linker 1 described previously.
  • the recombinant plasmid, pS ⁇ 344 ⁇ ( Figure 25), was purified from E. coli NM522 transformants.
  • Notl fragment from pS ⁇ 344 ⁇ was purified by restriction with NotI followed by gel purification, and cloned into the unique NotI site of pB ⁇ 1 ⁇ ( Figure 18) by ligation with NotI-digested, phosphatased vector.
  • E. coli ⁇ M522 transformants were found to carry two recombinant plasmids, pHb5 in which the ⁇ and ⁇ -globin cDNAs were in the same direction (tandem) and pHb6 in which the cDNAs were in opposite directions (divergent ) as shown in Figure 9 .
  • Plasmid pHb6 was transformed into strain 3J1991 ( ⁇ pep4. 3, prb1-1122, leu2, trp1 , ura3-52) .
  • Recombinant haemoglobin was purified from a 3 litre culture of one of the transformants and characterised as described in Example 2.
  • the same promoter e.g. PAL, PRB1
  • PAL, PRB1 can be used to produce both giobins, with excess ⁇ -globin mRNA achieved by using an ⁇ -globin LEU2d selectable plasmid and ⁇ -giobin TRPl or URA3 selectable plasmid.
  • the PAL promoter plasmids for co transformation are the ⁇ -globin LHU2d-selectable pGLB ⁇ 9 and the ⁇ -globin TRP1-selectable pGT ⁇ 10 ( Figure 26).
  • pGLB ⁇ 9 Figure 27
  • pGLB ⁇ 9 Figure 27
  • Figure 2 Figure 2 except that the modified ⁇ - globin BamHI fragment from pSP646 ⁇ ' was inserted into pKV50.
  • Plasmid pGT ⁇ 10 was constructed as follows.
  • a TRPl selectable PAL expression vector, pKV50-TRP ( Figure 28), was constructed by ligating a partial Hindlll fragment containing the TRPl gene and 2 ⁇ m origin of replication and STB region with HindiII-digested, phosphatased pKV50.
  • pKV50-TRP is identical to pKV50 except the TRPl gene replaces the LEU2d gene.
  • a Bglll fragment containing the ⁇ -globin cDNA was inserted into the Bglll expression site of pKV50-TRP to give pGT ⁇ 10 ( Figure 25).
  • the ⁇ -globin Bglll fragment in pGT ⁇ 10 is identical to that in pGLB ⁇ 6 except that the 3' mRNA untranslated region has been removed by oligonucleotide-directed in vitro mutagenesis.
  • the 21-mer oligonucleotide used for in vitro mutagenesis of 3' ⁇ -globin is shown below.
  • Plasmids pGLB ⁇ 9 and pGT ⁇ 10 were co-transformed into yeast strain 3J1991, and transformants growing on plates of minimal medium without leucine and tryptophan were selected for further analysis. Co-transformants were grown to stationary phase in 100ml selective medium in shake flasks under galactose-inducing conditions.
  • Cell extracts were prepared and the soluble protein fractions were analysed by Western blotting using anti-human haemoglobin antibody as previously described. Immunoreactive protein was detected in all transformants. Globin protein from a 3 litre culture of one of the co-transformants was partially purified as follows. The cell extract, prepared as in Example 1, was desalted on Sephadex G-25 equilibrated with 5mM Tris HCl pH8.5 and then loaded onto a DEAE cellulose (Whatman DE52) column equilibrated with the same buffer. The column was washed with 5mM Tris HCl pH8.5 and the red band eluted stepwise with 75mM Tris HCl pH8.5.
  • the plasmid PKV50TRP was linearised by restriction with BamHI and Sall and the gel-purified vector was "filled-in” by incubation with Klenow fragment and dNTPs.
  • the oligonucleotide Linker 1 was ligated with this vector to generate plasmid pTN2 ( Figure 29).
  • the ⁇ -globin cDNA from pSP646 ⁇ ' was isolated on a BssHII- Hindlll DNA fragment, and the ⁇ -globin cDNA from RF ⁇ 1 was isolated on an ApaLI-Hindlll DNA fragment.
  • oligonucleotides BC2L and BC2U (above) and J016 and J017 (shown below) were used as oligonucleotides BC2L and BC2U (above) and J016 and J017 (shown below).
  • the NotI cassettes from both of these plasmids were purified and cloned into Notl-digested , phosphatased pT ⁇ 2, to generate pGT ⁇ PRB and pGT ⁇ PRB ( Figures 30 and 31). Both of these plasmids are TRP1 selectable.
  • Plasmids pGT ⁇ PRB and pBN1 ⁇ were co-transformed into S. cerevlslae strain BJ1991 and transformants selected on media lacking leucine and tryptophan. Both plasmids have the PRB1 promoter, but the ⁇ -globin cDNA is located on the LEU2d selectable plasmid, which is a higher copy number plasmid and should therefore produce more ⁇ -globin mRNA.
  • Another combination of plasmids that allows co-transformation of S. cerevisiae BJ1991, is pHb6 with pGT ⁇ PRB.
  • Transformants were selected on media lacking leucine and tryptophan, and carry one copy of the ⁇ -globin cDNA, regulated by the GUT2 promoter on the LEU2d selectable plasmid, but two copies of the ⁇ -globin cDNA, both regulated by the PRB1 promoter, one copy on each plasmid.
  • ⁇ -globin mRNA may be over-expressed relative to ⁇ -globin mRNA.
  • ⁇ : ⁇ -globin mRNAs within yeast cells were calculated as follows. Total RNA was isolated from yeast and resolved oh Northern gels as described in Example 1. Northern blots were probed with mixtures of either ⁇ or ⁇ -globin specific oligonucleotides (AGL1 and BGL1 respectively) and an oligonucleotide specific for the LEU2 gene transcript (LEU2) as internal standard. The sequences of the oligonucleotides are given below.
  • oligonucleotides were synthesised as 30 mers and have equivalent GC and AT content, to ensure identical dissociation temperatures.
  • Duplicate Northern filters were probed with 32 P gamma ATP end-labelled oligonucleotides: a mixture of AGL1 and LEU2 (5.25 pmoles of each) or a mixture of BGL1 and LEU2 (6.25 pmoles of each).
  • the levels of ⁇ and ⁇ -globin and LEU2 transcripts on filters were quantitated using an Ambis Radioanalytic Imaging System (Ambis Systems, San Diego). Ratios of ⁇ : ⁇ -globin mRNAs were determined based on the LEU2 transcript at internal control.
  • the ⁇ : ⁇ -globin mRNA ratios for various combinations of promoters and co-transformed plasmids in 3J1991 grown in shake flasks are given below.
  • PRB1 promoter ( PRB1 promoter, ⁇ -globin, LEU2d/ URA3 ) ( PRB1 promoter,
  • PRB1 promoter ( PRB1 promoter , ⁇ -globin , LEU2d/ URA3 ) ( PRB1 promoter ,
  • Plasmids pGLU ⁇ PRB and pGLU ⁇ PRB were constructed from a derivative of pBN1 ( Figure 13) in which a DNA fragment containing the URA3 gene has been inserted at the unique BamHI site. Thus these plasmids carry both the LEU2d and URA3 genes as selectable markers and ⁇ or ⁇ -giobin cDNAs under the control of the PRB1 promoter. Plasmids pBN1 ⁇ ( Figure 18), PGT ⁇ PRB and pGT ⁇ PRB ( Figure 30) have been described previously. Plasmid pGT ⁇ 7 is similar to pGT ⁇ 10 ( Figure 26) except that it contains the complete PGK promoter (Mellor, J. et al . , 1983, Gene, 24, 1) rather than the PAL ( PGK-UAS GAL hybrid) promoter.
  • Ratios of ⁇ : ⁇ -globin mRNAs were also measured in yeast transformants grown in 2 litre fed batch fermenter cultures. For this, ⁇ and ⁇ -giobin expression cassettes were transferred into the stable 2 ⁇ m plasmid system described by Chinery and Hinchliffe (1989, Curr. Genezics, 16, 21). The resulting plasmids were pHbD2-1 ( Figure 32) ( GUT 2 promoter - ⁇ -globin/PRB1 promoter - ⁇ -globin, equivalent to pHb6 ( Figure 9)) and pHbD3-1 ( PRB1 promoter - ⁇ -globin/ GUT2 promoter - ⁇ -globin) ( Figure 33).
  • pHbD2-1 and pHbD3-1 were transformed into yeast strain DBX1 ( leu2, pra , cir°) and total RNA was prepared and analysed from yeast cells harvested at the end of the fermentation.
  • the ⁇ : ⁇ - globin mRNA ratios were:-
  • pHbD3-1 1.95:1 3.45:1 1 : 1.35 55
  • MOLECULE TYPE DNA (genomic)
  • ORGANISM Saccharomyces cerevisiae
  • GCAGATAAGA CAATCAACCC TCATGGCGCC TCCAACCACC ATCCGCACTA GGGACCAAGC 660GCTCGCACCG TTAGCAACGC TTGACTCACA AACCAACTGC CGGCTGAAAG AGCTTGTGCA 720 ATGGGAGTGC CAATTCAAAG GAGCCGAATA CGTCTGCTCG CCTTTTAAGA GGCTTTTTGA 780
  • TAGTTAAAAA TTACATATAC TCTATATAGC ACAGTAGTGT GATAAATAAA AAATTTTGCC 900
  • CTCGGTGCCC TAGGGAGCAT CTCTGCTGCT TTGGTCATCC CAAATCTTGA AAATGCCGCC 1380
  • MOLECULE TYPE DNA (genomic)
  • AAGAAAGATT CTCGGTAACG ACCATACAAA TATTGGGCGT GTGGCGTAGT CGGTAGCGCG 60 CTCCCTTAGC ATGGGAGAGG TCTCCGGTTC GATTCCGGAC TCGTCCAAAT TATTTTTTAC 1 20 TTTCCGCGGT GCCGAGATGC AGACGTGGCC AACTGTGTCT GCCGTCGCAA AATGATTTGA 180 ATTTTGCGTC GCGCACGTTT CTCACGTACA TAATAAGTAT TTTCATACAG TTCTAGCAAG 240 ACGAGGTGGT CAAAATAGAA GCGTCCTATG TTTTACAGTA CAAGACAGTC CATACTGAAA 300 TGACAACGTA CTTGACTTTT CAGTATTTTC TTTTTCTCAC AGTCTGGTTA TTTTTGAAAG 360 CGCACGAAAT ATATGTAGGC AAGCATTTTC TGAGTCTGCT GACCTCTAAA ATTAATGCTA 420 TTGTGCACCT TAGTAACCCA AGGCAGGACA
  • TTAATTTTCT TTTATCTTAC TCTCCTACAT- AAGACATCAA GAAACAATTG TATATTGTAC 1440
  • MOLECULE TYPE DNA (genomic)
  • ORGANISM Saccharomyces cerevisiae

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Mycology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Production d'hémoglobine recombinante dans la levure par co-expression d'α-globine et de β-globine, la quantité d'ARNm d'α-globine et/ou de protéine d'α-globine produite étant supérieure à celle d'ARNm de β-globine ou de protéine de β-globine, respectivement. La co-expression peut être obtenue par un site commun d'activation en amont (par exemple GAL1/GAL10 UAS) qui régule des promoteurs arrangés de façon divergente pour des séquences de codage d'α- et de β-globine transcrites de façon divergente. On peut manipuler les quantités relatives d'ARNm α et β en situant des séquences de codage respectives sur des plasmides séparés avec différents numéros de copie ou en sélectionnant des promoteurs respectifs de puissances différentes pour les deux séquences de codage.
PCT/GB1991/000305 1990-02-28 1991-02-27 Production de proteines dans la levure WO1991013158A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GB9004441.3 1990-02-28
GB909004441A GB9004441D0 (en) 1990-02-28 1990-02-28 Protein production in yeast
GB9017597.7 1990-08-10
GB909017597A GB9017597D0 (en) 1990-08-10 1990-08-10 Production of protein in yeast

Publications (1)

Publication Number Publication Date
WO1991013158A1 true WO1991013158A1 (fr) 1991-09-05

Family

ID=26296728

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB1991/000305 WO1991013158A1 (fr) 1990-02-28 1991-02-27 Production de proteines dans la levure

Country Status (1)

Country Link
WO (1) WO1991013158A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0537160A1 (fr) * 1990-04-16 1993-04-21 Apex Bioscience, Inc. Expression d'hemoglobine recombinante dans de la levure
FR2688784A1 (fr) * 1992-03-18 1993-09-24 Pasteur Merieux Serums Vacc Transporteur d'oxygene.
US5827693A (en) * 1990-04-16 1998-10-27 Apex Bioscience, Inc. Expression of recombinant hemoglobin and hemoglobin variants in yeast

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990013645A1 (fr) * 1989-05-10 1990-11-15 Somatogen, Inc. Production d'hemoglobine et de ses analogues dans des bacteries et de la levure

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990013645A1 (fr) * 1989-05-10 1990-11-15 Somatogen, Inc. Production d'hemoglobine et de ses analogues dans des bacteries et de la levure

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BIOTECHNOLOGY, Vol. 9, No. 1, 01 January 1990, New York, US., WAGENBACH M. et al., "Synthesis of Wild Type and Mutant Human Hemoglobins in Saccharomyces Cerevisiae", pages 57-61. *
NATURE, Vol. 343, No. 11, 11 January 1990, London, GB., GREAVES D.R. et al., "A Transgenic Mouse Model of Sickle Cell Disorder", pages 183-185. *
PROC. NATL. ACAD. SCI. U.S.A., Vol. 86, No. 1, January 1989, Washington, US., RYAN T.M. et al., "High-level Erythroid Expression of Human Alpha-globin Genes in Transgenic Mice", pages 37-41. *
SCIENCE, Vol. 245, 01 September 1989, Lancaster, PA, US., BEHRINGER R.R. et al., "Synthesis of Functional Human Hemoglobin in Transgenic Mice", pages 971-973. *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0537160A1 (fr) * 1990-04-16 1993-04-21 Apex Bioscience, Inc. Expression d'hemoglobine recombinante dans de la levure
EP0537160A4 (en) * 1990-04-16 1993-09-01 Strohtech, Inc. Expression of recombinant hemoglobin in yeast
US5827693A (en) * 1990-04-16 1998-10-27 Apex Bioscience, Inc. Expression of recombinant hemoglobin and hemoglobin variants in yeast
US6172039B1 (en) 1990-04-16 2001-01-09 Apex Bioscience, Inc. Expression of recombinant hemoglobin and hemoglobin variants in yeast
FR2688784A1 (fr) * 1992-03-18 1993-09-24 Pasteur Merieux Serums Vacc Transporteur d'oxygene.
WO1993019089A2 (fr) * 1992-03-18 1993-09-30 Pasteur Merieux Serums & Vaccins S.A. Transporteur d'oxygene
WO1993019089A3 (fr) * 1992-03-18 1993-10-28 Pasteur Merieux Serums Vacc Transporteur d'oxygene

Similar Documents

Publication Publication Date Title
FI105104B (fi) Di-alfa-globiinin tai di-beeta-globiinin kaltainen polypeptidi, sitä koodaava yhdistelmä-DNA ja sen käyttö
EP0358708B1 (fr) Succedanes de sang
Wagenbach et al. Synthesis of wild type and mutant human hemoglobins in Saccharomyces cerevisiae
US6274331B1 (en) Method of determining a functional linker for fusing globin subunts
JP4512673B2 (ja) 増大した可溶性発現および／または低下した一酸化窒素の排出を伴うヘモグロビン変異体
EP0625202A1 (fr) Serum-albumine humaine, preparation et utilisation
US6172039B1 (en) Expression of recombinant hemoglobin and hemoglobin variants in yeast
Konishi et al. Preparation and characterization of the water-soluble heme-binding domain of cytochrome c1 from the Rhodobacter sphaeroides bc1 complex
FI90353C (fi) Plasmidi humaani mangaanisuperoksididismutaasin ilmentämiseksi bakteereissa sekä menetelmä entsymaattisesti aktiivisen humaani mangaanisuperoksididismutaasin tuottamiseksi ja talteenottamiseksi
WO1993008831A1 (fr) Expression d'hemoglobine recombinee et de variants d'hemoglobine recombines dans des levures
US5844090A (en) Modified hemoglobin-like compounds
WO1991013158A1 (fr) Production de proteines dans la levure
EP0826064B1 (fr) Hemoglobine mutante a faible affinite pour l'oxygene
US6171826B1 (en) Methods of controlling beta dimer formation in hemoglobin
EP0719284A1 (fr) Ameliorations apportees a l'hemoglobine
US6150506A (en) Modified hemoglobin-like compounds and methods of purifying same
EP0561245A1 (fr) Produits de remplacement du sang comprenant d'hémoglobine recombinante
US6812207B1 (en) Hemoglobin mutants that reduce heme loss
KonishiSP et al. Preparation and Characterization of the Water-soluble Heme-binding Domain of Cytochrome c1 from the Rhodobacter sphueroides bcl Complex
JPH0795893A (ja) 新規なポリペプチド、その製造方法、そのポリペプチドをコードするｄｎａ、そのｄｎａからなるベクター、そのベクターで形質転換された宿主細胞、そのポリペプチドの抗体、およびそのポリペプチドまたは抗体を含有する薬学的組成物
JPH07145199A (ja) 新規なポリペプチド、その製造方法、そのポリペプチドをコードするｄｎａ、そのｄｎａからなるベクター、そのベクターで形質転換された宿主細胞、そのポリペプチドの抗体、およびそのポリペプチドまたは抗体を含有する薬学的組成物

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 1991904370

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1991904370

Country of ref document: EP