WO1989001037A1 - Production de toxines de ricine dans un systeme d'expression de cellules d'insectes-baculovirus - Google Patents

Production de toxines de ricine dans un systeme d'expression de cellules d'insectes-baculovirus Download PDF

Info

Publication number
WO1989001037A1
WO1989001037A1 PCT/US1988/002442 US8802442W WO8901037A1 WO 1989001037 A1 WO1989001037 A1 WO 1989001037A1 US 8802442 W US8802442 W US 8802442W WO 8901037 A1 WO8901037 A1 WO 8901037A1
Authority
WO
WIPO (PCT)
Prior art keywords
ricin
amino acid
galactoside
mutein
group
Prior art date
Application number
PCT/US1988/002442
Other languages
English (en)
Inventor
L. L. Houston
Julie A. Lane
Michael Piatak, Jr.
Robin Clark
Original Assignee
Cetus Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cetus Corporation filed Critical Cetus Corporation
Publication of WO1989001037A1 publication Critical patent/WO1989001037A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/14011—Baculoviridae
    • C12N2710/14111—Nucleopolyhedrovirus, e.g. autographa californica nucleopolyhedrovirus
    • C12N2710/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2710/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • the present invention relates to the field of molecular biology and proteins.
  • the invention relates to the achievement of expression of ricin toxin proteins using an insect cell/baculovirus expression system.
  • prokaryotic host vector systems for the synthesis of desirable eukaryotic proteins is diminished by certain limitations inherent in such systems.
  • the mRNA transcript or protein product of such systems may be unstable in the prokaryote.
  • the optimal DNA sequence introduced into the microorganism must be free of intervening DNA sequences, nonsense sequences, and initial or terminal sequences which encode for polypeptide sequences which do not comprise the active eukaryotic protein.
  • some eukaryotic proteins require modification after synthesis (e.g., glycosylation and all membrane associated processing) to become biologically active, and prokaryotic cells are generally incapable of such modifications.
  • nonviral eukaryotic host vector systems are also available for the expression of heterologous proteins. Certain limitations are inherent in each of these systems as well. For example, high levels of expression are frequently difficult to obtain in yeast systems where autonomously replicating vectors may be unstable. Additionally, glycosylation patterns in yeast differ from those in higher euk ' aryotes. Limitations encountered with mammalian host vector systems include difficulties in host cell cultun ' ng and its scale-up. The expense of mammalian cell culture media as well as a requirement for serum often restricts its use on a large scale and complicates the use of these systems for production of parenterally administered pharmaceuticals. Furthermore, levels of expression in these systems are generally substantially lower than that obtained in prokaryotic or viral expression systems.
  • viruses in eukaryotic host-vector systems have been the object of much speculation.
  • some viral vector systems also suffer from significant disadvantages and limitations which diminish their utility.
  • a number of eukaryotic viral vectors are either tumorgenic or oncogenic in mammalian systems and create potential health and safety problems associated with resultant gene products and accidental infection.
  • Baculoviruses are insect pathogenic viruses which, until recently, were studied mostly for their potential use as viral insecticides for control of agriculturally important insect pests. Because certain baculoviruses are highly virulent for pest insects, some of the most promising have been commercially developed and are used as biological pesticides ( iltenburger and rieg 1984 Bioinsecticides:II: Baculoviridae. Adv. Biotechnol. Processes _3:291; Granados, R.R. and Feden ' ci, B.A. eds. The Biol.
  • Baculoviruses are very stable and are able to persist for longer times in the environment than other animal viruses. This unusual biological stability is the result of a unique association of the infectious virus particles and a viral occlusion that is a crystalline assembly of a viral encoded structural protein called polyhedrin. Late in viral replication, baculovirus particles become embedded in a protein occlusion composed of the polyhedrin protein. Insects acquire a baculovirus disease by ingesting the occluded virus (OV) which contaminate their food supply. The polyhedrin matrix protects the virus particles in the environment and during their passage through the foregut of the insect. In the insect midgut, the alkaline pH activates the dissolution of the polyhedrin crystalline matrix resulting in the release of many viruses. The virus become absorbed by the midgut epithelial cells and initiate the infection process.
  • NOVs nuclear polyhedrosis viruses
  • NOVs nuclear polyhedrosis viruses
  • NOVs nuclear polyhedrosis viruses
  • OV occluded virus
  • Baculoviruses are unique among animal viruses, not only in the protective function of the viral occlusion in the viral life cycle but also because the. polyhedrin gene is the most highly expressed eucaryotic virus gene known.
  • the polyhedrin protein can accumulate to greater than 1 mg/ml of infected cultured insect cells (70-75% of the total cellular protein) or can comprise up to 25% of the total protein of an infected insect.
  • wery highly expressed neither the polyhedrin gene nor its protein is essential for viral infection or replication in cultured insect cells or insects, thus making the polyhedrin gene an ideal target for genetic manipulation.
  • the Autographa cal forn ca nuclear polyhedrosis virus (AcNPV).
  • the Autographa californica host for AcNPV is a moth commonly referred to as the alfalfa looper.
  • Studies of the physical and functional organization of the AcNPV genome have resulted in the mapping, cloning, and sequencing of the AcNPV polyhedrin gene and its regulatory sequences
  • polyhedrin gene exhibit a strong promoter, but expression can continue late in infection well beyond the point of repression of nearly all other baculovirus and host genes.
  • plO Another non-essential occlusion-related viral protein, plO, is also abundantly produced and its promoter has reportedly been used to drive foreign gene expression (D.W. Miller et al . in Genetic Engineering Principles & Methods _8_:277-298, Setlow and Hollaender, eds. New York: Plenum Press, 1986).
  • polyhedrin gene promoter heterologous gene expression levels never reach polyhedrin levels but are usually in the range of tens to hundreds of micrograms per ml (Summers et al., 1985, p.321, supra).
  • recombinant proteins produced in insect cells may be co- and post-translationally processed in a manner similar to what occurs in mammalian cells.
  • glycosylation of IFN- ⁇ in infected insect cells has been reported (G.E. Smith et al . (1983) supra).
  • IL-2 insulin-like growth factor-2
  • human Jurkat cells glycosylated cells
  • there was no evidence of any glycosylation of the recombinant IL-2 produced in insect cells (G.E. Smith et al., (1985) supra).
  • correct cleavage of mammalian secretory signal peptides has been observed (G.E.
  • the potent ricin toxin and the Ricin communis agglutinin (RCA) are two major lectins found in the beans produced by the castor oil plant (Ricinus communis). These proteins have been extensively studied, including determination of the complete amino acid sequence for one form of ricin toxin (for review, see Olsnes, S. and Pihl, A. (1982a) in Molecular Action of Toxins and Viruses, pp. 51-105, Cohen and vanHeyningen (eds.), Elsevier Biomedical Press; Olsnes, S. and Pihl, A. (1982b) Pharmac. Ther. 15, 355-381).
  • Each of these lectins contains two different glycosylated subunits (A and B), each of approximate molecular weight 30,000, linked via a disulfide bridge.
  • the toxin contains one subunit of each type, whereas the agglutinin contains two of each.
  • the A subunit acts to catalytically inactivate eukaryotic ribosomes, whereas the B subunit binds to cell surface galactose-containing structures and facilitates entry of the A subunit into the cytoplasm.
  • both of the toxin subunits have been used extensively as components in hybrid toxins targeted to specific cells (Olsnes, S. et al . (1982b) supra; Moller, G. (ed.) (1982) Immunol . Rev., 62, Vitetta, E.S. et al. (1985) Cell, _41_:653).
  • the A subunit provides the essential catalytic cytotoxicity to these molecules
  • the B subunit may also be used to enhance membrane transport (Vitetta, E. , et al . (1983) Proc. Nat! . Acad. Sci. (USA) 80, 6332).
  • Ricin subunits have been individually expressed in bacterial hosts.
  • the ribosomes of prokaryotic cells are resistant to enzymatic inactivation by ricin toxin A and intact ricin comprising ricin toxin A and B chains.
  • ricin fragments are thought to be toxic in E. coli.
  • European Patent Publication No. 237,676, published September 27, 1987 discloses the expression of the ricin A subunit in E ⁇ coli.
  • European Patent Application No. 86301227.4 filed February 20, 1986 and PCTW0/88/00593, filed February 24, 1988 describe the expression of ricin B subunit or its muteins in E. coli. M. O . 'Hare et al. (Febs Letts. (1987) 216:73) more recently reported the expression of ricin A subunit in E. coli.
  • the invention relates, in one respect, to methods for producing by recombinant DNA technology biologically active ricin toxin, ricin toxin subunits or isotoxins thereof and proteins having an amino acid sequence substantially equivalent to these molecules, including Ricin communis agglutinin, and expressing these molecules using recombinant baculovirus expression vectors in suitable host insect cells. Accordingly, one aspect of the invention relates to growing the infected insect cells under suitable conditions to produce the desired recombinant ricin toxin, subunits thereof or related molecules and recovering the biologically active polypeptide, dimerized polypeptide or subunits thereof from the culture medium.
  • a second aspect of the invention is directed to recombinant baculovirus transfer and expression vectors for producing active muteins of ricin isotoxins D, E and El, or their subunits, and Ricin communis agglutinin, having reduced galactose binding activity.
  • the invention is directed to recombinant baculovirus expression vectors which are capable of affecting the expression of ricin toxin, ricin toxin subunits or proteins having an amino acid sequence substantially equivalent to that of ricin toxin or to the host insect cells infected .with such vectors, and to cultures thereof.
  • One aspect of the invention concerns recombinant baculovirus expression vectors in which ricin toxin, ricin toxin subunits and related molecules are expressed under the transcriptional control of a baculovirus promoter.
  • the baculovirus promoter is the polyhedrin gene promoter.
  • Another aspect of the invention concerns recombinant baculovirus expression vectors in which the DNA encoding ricin toxin, ricin toxin subunits or proteins having an amino acid sequence substantially equivalent to that of ricin toxin is in proper translational reading frame with the DNA encoding a heterologous secretory signal peptide. Also, aspects of the invention are the recombinant baculovirus transfer vectors which are used to transfer the desired recombinant gene into the baculovirus genome.
  • Figure 1 is a ribbon representation of the ricin backbone.
  • the A chain is in the upper right and the B chain at lower left.
  • the two lactose moieties bound to the B chain are each represented as pairs of discs.
  • the chains have been separated slightly to facilitate viewing.
  • the disulfide bond linking the chains is indicated in the lower right portion of the molecule.
  • Figure 2A shows the position and sequence of oligodeoxyribonucleotide primers used to create Sail and PvuII sites in the amino terminal region of the ricin B sequence.
  • Figure 2B shows the position and sequence of oligodeoxyribonucleotide primers used to create an Xbal and SacII site in the carboxyl terminal region of the ricin B sequence.
  • the numbers at the right of the figures are nucleotide numbers in the complete ricin sequence. Amino acids are designated by the single letter observations approved by the IUPAC-IUB Commission on Biochemical Nomenclature.
  • Figure 3 shows the DNA sequence of ricin toxin D.
  • Figure 4 shows the DNA sequence comparison between the recombinant baculovirus transfer vectors pAcCl-C5.
  • the carrots represent restriction endonuclease cleavage sites.
  • Figure 5 shows the vector constructs used to produce ricin B muteins.
  • Figure 6 shows the vector constructs used to produce the ricin B double construct-46/255.
  • Figure 7 shows cytotoxicity assays of supernatants of baculovirus expression system products.
  • Figure 8 shows a Western blot analysis -of insect cell expression products after infection with a recombinant baculovirus containing full length ricin toxin gene sequences.
  • Figure 9 shows a Western blot analysis of insect cells expression products after infection with recombinant baculovirus containing ricin B gene sequences.
  • Figure 10 shows the binding of native ricin B to asialofetuin coated on the wells of 96-well dishes in the presence or absence of lactose.
  • Figure 11 shows the binding of ricin B mutein 255 at different concentrations to asialofetuin in the presence or absence of lactose.
  • Ricin toxin is best defined by describing what is known in the scientific literature.
  • Ricin toxin (RT or ricin) is a naturally occurring toxin composed of an enzyr ⁇ atically active, cytotoxic "A" amino acid sequence or subunit, and a "B" sequence or subunit, which is presumed to be responsible both for attaching the "A" subunit to a target cell to be killed, and to aid in the translocation or transport of A subunit into the cytoplasm (see Olsnes, S. et al . (1982a&b) supra).
  • Other examples of such toxins include diphtheria toxin and the exotoxin from Pseudomonas aeruginosa.
  • ricin peptides of the present invention are derived from the seeds of Ricinus communis, commonly known as castor beans. Two similar proteins (often called lectins) are extractable from these seeds: the above-mentioned ricin and Ricin communis agglutinin (RCA).
  • Both proteins contain A and B portions; however, the A and B portions do not comprise a single peptide.
  • the A portions or these moieties are- capable of catalytically inactivating the large subunit of ribosomes J_n_ vitro and the mechanism of ricin for jm_ vivo cytotoxicity is believed to reside in this capacity for ⁇ ' bosome inactivation.
  • Ricin and RCA appear to be highly homologous (Cawley, D. B., et al, Arch. Biochem. Biophys. (1978) 190:744) but differences exist. RCA is dramatically less toxic, and appears to exhibit some characteristics corresponding to those expected of a dimer of ricin.
  • ricins D and E Careful fractionation of castor bean extracts shows the presence of several ricin isotoxins.
  • the distinction between ricins D and E has been previously disclosed (Mise, et al., Agric Bio! Chem (1977) _41_:2041-2046; Wei, et al., J Biol Chem (1978) 253:2061-2066; Lin, et al., Eur J Biochem (1980) 105:453-459; Wegd, et al., J_ Immunol Meth (1982) _49_:323-332).
  • Ricin D has a pi near 7.4 and a high affinity for agarose
  • ricin E has a pi near 8.8 and a low affinity for agarose.
  • isoenzymes differ in molecular weight by SDS-PAGE and in carbohydrate content, and can be resolved by ion exchange chro atography with a very shallow salt gradient (Olsnes, et al., Biochemistry (1973) _12_:3121-3126, Foxwell, B.M.J., et al . (1985) Bioch. Biophys. Acta, 840:193).
  • Ricin E2 has a pi identical to that of ricin El. Compared to ricin El, it is 1% as toxic to mice and 2-4% as toxic to cultured cell lines, is bound to agarose more tightly at moderate to high ionic strength, and is approximately 2 kD larger by SDS-PAGE.
  • Ricin has an apparent molecular weight of 58,000 daltons and consists of the A chain with a molecular weight of 32,000 daltons and a B chain of molecular weight of 34,700 daltons.
  • RCA is a tetramer which has two A subunits of molecular weight 32,000, and two B subunits of molecular weight 36,000 each. In their native environments, the A and B chains are generally glycosylated. The A and B subunits of both ricin and RCA are linked only by a single disulfide bond, and not by peptide linkage unlike, for example, diphtheria toxin which is found as a single chain peptide. It is also known that both ricin and RCA, though having separate peptides for A and B portions, are each derived from a single chain precursor in each case (Butterworth, H.E., et al., Eur J Biochem (1983) 137:57).
  • the cDNA insert in pRT17 corresponds to the composite between the ricin toxin B chain encoded in the DNA disclosed in PCT/US88/00197 (supra) and the ricin A encoding sequences disclosed in European Patent Publication No. 237,676 (supra). This is the DNA, then, encoding the precursor for ricin D.
  • the cDNA sequence for the ricin toxin precursor and RCA has recently been reported (Lamb, F.I., Roberts, L.M., and Lord, J.M. (1985) Eur J Biochem 148, 265-270; European Patent Application Publication No. 0145,111 to Lord, J.M. et al., June, 1985).
  • ricin toxin As is the case for all proteins, the precise chemical structure of ricin toxin, its muteins or subunits, depends on a number of factors. As ionizable amino and carboxyl groups are present in the molecule, a particular protein may be obtained as an acidic or basic salt, or in neutral form. All such preparations which retain their activity when placed in suitable environmental conditions are included in the definition. Further, the primary amino acid sequence may be augmented by derivatization using sugar moieties (glycosylation) or by other supplementary molecules such as lipids, phosphate, acetyl groups and the like, more commonly by conjugation with saccharides. The primary amino acid structure may also aggregate to form complexes.
  • ricin refers to proteins having cytotoxic activity which contain both A and B chains, as set forth herein.
  • ricin is distinguished from RCA in the art. Both ricin D and ricin E contain A and B chains; it appears that the differences in these proteins lies in the B portions. Mutei ns
  • Ricin B muteins are defined to be substantially similar forms of ricin B or isotoxins thereof according to the invention in that they fulfill the functional definition of facilitating the intracellularization of an associated toxin molecule.
  • the alterations of the galactoside binding sites of the ricin B muteins decrease the affinity of the ricin B muteins according to the invention for galactosides, yet retain, at least partial functional ability to facilitate the intracellularization of an associated toxin molecule.
  • the precise mechanism whereby ricin B or ricin B muteins facilitates translocation of ricin A is unknown.
  • coding sequence “operably linked” to control sequences refers to a configuration wherein the coding sequence can be expressed under the control of these sequences.
  • Control sequences refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism.
  • Eukaryotic cells including the insect cells of the instant invention appear to utilize promoters and polyadenylat on signals.
  • Expression system refers to DNA sequences containing a desired coding sequence and control sequences in operable linkage, so that hosts transformed with these sequences are capable of producing the encoded proteins. These DNA sequences may also direct the synthesis of the encoded proteins in an j_n_ vitro cellular environment. In order to effect transformation, the expression system may be included on a transfer vector; however, the relevant DNA may then also be integrated into the viral chromosome to result in a recombinant viral genome.
  • cell Cell, Cell Line, Cell Culture
  • progeny includes the primary subject cell and cultures derived therefrom without regard for the number of transfers. It is also understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Mutant progeny which have the same functionality as screened for in the originally transformed cell are included. Where distinct designations are intended, it will be clear from the context.
  • Infection refers to the invasion of cells by pathogenic viral agents where conditions are favorable for their replication and growth.
  • Transfection refers to a technique for infecting cells with purified nucleic acids by adding calcium chloride to solutions of DNA containing phosphate or other appropriate agents such as dextran sulfate thereby causing the DNA to precipitate and be taken up into the cells.
  • Recombinant transfer vector refers to a plasmid containing a "heterologous” gene under the control of a functional promoter (e.g., polyhedrin or plO promoter) and flanked by viral sequences.
  • the "recombinant expression vector” is formed after cotransfection of the recombinant transfer vector and wild-type baculovirus DNA into host insect cells whereupon homologous recombination occurs between the viral sequences flanking the heterologous gene and the homologous sequences in the wild-type viral DNA. This results in the replacement of wild-type sequences in the virus with the transfer vector sequences between the crossover points.
  • the recombinant expression vector is the recombinant viral DNA containing the desired heterologous gene.
  • Bioly active refers to retaining the enzymatic or other biological behavior which typifies the function of the protein in its native state.
  • the biological activity of ricin A refers in one aspect to enzymatic activity, i.e., its ability to inhibit protein synthesis in a rabbit reticulocyte j_n_ vitro translation system (a commercially available system obtainable, e.g., from Bethesda Research Laboratories, Rockville, MD).
  • soluble preparations of ricin A toxin are also capable of exhibiting specific cytotoxic activity when associated with specific binding portions, for example, immunoglobulins, to form immunotoxins or with the ricin B subunit to reconstitute ricin toxin activity.
  • the biological activity of ricin B refers to its ability to facilitate the intracellularization of an associated toxin molecule via cell surface _ binding to galactose-containing receptors.
  • “Secretory signal peptide” refers to a sequence of amino acids that functions to transport a protein expressed in insect cells, such as ricin toxin or subunits thereof, outside the cell.
  • a “heterologous secretory signal peptide” is an amino acid sequence not naturally found in association with the protein to be secreted.
  • a cDNA library was constructed by isolating mRNA from maturing castor bean seeds, and preparing the corresponding cDNA by, in general, conventional methods.
  • the oligonucleotide 5'-GACCATTTCGAC CTACG-3' which complements the mRNA encoding the N-terminal region of the B chain (which is thus just downstream from the A chain codons) was used as primer in synthesizing the single stranded copy; and an oligo dC homopolymeric tail was added to the 3 1 end to permit oligo dG to be used as primer in double stranding.
  • the resulting double stranded cDNA fragments were then inserted into the PstI site of the t cloning vector, pBR322, by annealing homopolymeric oligo dC tails provided by standard tailing methods to the cDNA with the oligo dG tails which are also thus provided on the cleaved vector.
  • the ligation mixture was transformed into E. coli. About 5000 successful 0 transformants were screened for hybridization with probe.
  • the olignonucleotide mixture ⁇ '-GCATCTTCTTGGTTGTCNGGATGAAA GAAATAGGC-3 1 (wherein N is A, T, G, or C) was used as a probe.
  • This sequence was initially predicted based on the amino acid sequence described in the review by Olsnes, S., et al., supra, and verified. 5 Positive colonies were analyzed by restriction and showed two pattern types—one predicted to be found from ricin A, and the other presumed to be associated with agglutinin A, since it was significantly different from that obtained from ricin A.
  • a colony was obtained which contained the entire sequence for ricin A, as confirmed 0 by sequencing and comparison of the deduced amino acid sequence to that of native ricin A. Plasmid DNA isolated from this colony was designated pRAI23, and given number CMCC 2108 in the assignee's culture collection. pRA123 was deposited with the ATCC on 14 August 1984, and has accession No. 39799.
  • Desired sequence modifications useful in obtaining the desired portions of the ricin may be made using site-specific mutagenesis in a manner analogous to that described for the construction of expression vectors below.
  • the cDNA insert in pRA123 which contained the coding sequence for the entire ricin A chain, was modified by primer directed mutagenesis to place a HindiII site in front of a newly constructed ATG start codon preceding the RTA sequence, and to place a stop signal at the C-terminus.
  • the properly terminating coding sequence for the ricin A chain could then be removed as a Hindlll/BamHI cassette and ligated into appropriate transfer vectors.
  • a cDNA library was constructed by isolating mRNA from castor bean seeds, and preparing the corresponding cDNA by, in general, conventional methods. However, during the construction, appropriate linkers were ligated to the ends of the cDNA so as to obtain inserts bounded by EcoRI/Sal I sites. EcoRI/Sal I inserts were then ligated into the cloning vector, pUC13, and transformed into _E ⁇ _ coli. Successful transformants capable of hybridizing with the probe were selected and sequenced.
  • Colonies were obtained which contained large portions of the ricin B and agglutinin B sequences.
  • a colony was obtained which contained the sequences for a portion of the putative peptide precursor of both RCA and ricin which was thus shown to contain a twelve amino acid bridging peptide.
  • the cDNA insert contained a sequence which began in the A portion and overlapped into the B region of each.
  • the plasmids derived from the foregoing colonies are designated pRTB5, pRTB4, and pRTAll ⁇ , respectively.
  • pRTB5 The cDNA insert in pRTB5, which contained the coding sequence for the entire ricin B chain except for the 11 N-terminal amino acids, was excised and placed in the correct orientation with respect to the lac promoter by insertion into pUC8, to give pRTBl ⁇ l.
  • pRTBl ⁇ l was modified by the procedure described in Section B.2.b. below to add the appropriate coding sequences, a start codon, and a conveniently placed upstream Hindlll site to give pRTB601.
  • the cloning vector used to obtain the cDNA library contains a HindiII site immediaely downstream of the Sail site used for ligation into the vector, and thus the entire coding sequnce including the start codon can be excised by treatment of the modified vector with Hindlll.
  • Oligo 2 5'-GACCATGATAAGCTTATGGCTGATGTTTGTATGGATCC and
  • Oligo 1 which have complementary sequnces as shown, and wherein 01igo-2 encodes a Hindlll site upstream of an ATG start codon.
  • the 5' end of Oligo-l is complementary to 15 bases at the 5' end of the pRTBl ⁇ l cDNA sequence as there shown and is complementary to the contiguous missing codons of the ricin B sequence.
  • the 5' end of 01igo-2 is complementary to the 5' sticky end of the vector residue of the exonuclease III treated pRTBl ⁇ l.
  • the mixture was heated to 60°C for five minutes in order to denature completely completion of single-stranded DNA, cooled to 37°C for five minutes to hybridized complementary strands, and then chilled on ice.
  • the solution brought to polymerase I ( lenow) buffer conditions and reacted for two hours at 12°C in the presence of the ⁇ O ⁇ M each of the 4 dNTPs, 0.1 mM NAD, 0.3 units/ ⁇ l Klenow, and 0.08 units/ ⁇ l E. coli DNA ligase.
  • the ligation mixture was used directly to transform competent E ⁇ coli MM294 and several thousand Amp ⁇ colonies found.
  • pRTB601. pRTB601 thus contains the ricin B coding sequence as a Hindlll cassette.
  • the upstream Hindlll site is introduced immediately upstream of the ATG codon in 01igo-2; the downstream Hindlll site arises from the pUC8 vector plasmid.
  • Ricin B has two functional characteristics, it first plays a role in binding to galactoside on the surface of cells and then participates in the internalization of ricin toxin A chain into the cell.
  • the muteins of ricin B according to the invention have amino acid sequences that are specifically altered from those described sequences herein for ricin toxin B chain.
  • the alterations are made in amino acids that comprise the galactoside binding sites of ricin B, and most preferably in amino acids that affect the binding of ricin B chain to galactosides, e.g., lactose.
  • the muteins of ricin B of the present invention are altered in these amino acids to decrease the binding of ricin B to galactoside.
  • B.2.d Identification of Galactoside Binding Sites of Ricin B
  • the three dimensional structure of the ricin B molecule has been determined to a resolution of 2.8 Angstroms A by Robertus et al., and a two dimensional representation of the ricin B chain structure is shown in Figure 1.
  • the representation shows two domains within the B chain of ricin and each domain has a galactoside binding region.
  • Each domain of the ricin B chain has two disulfide loops, and each domain has a single galactoside binding site.
  • the two domains have folding patterns that are similar and can be classified for purposes of the invention as an amino terminal domain encompassing amino acid residues 1-135 which includes the amino galactoside binding site, and a carboxyl terminal domain encompassing amino acids 136-267 which includes the carboxyl galactoside binding site.
  • the amino galactoside binding site is defined by two regions of the amino acid sequences, residues 22-28 (Asn22, Val23, Arg24, Asp25, Gly26, Arg27, and Phe28) and residues 35-46 (Gln3 ⁇ Leu36 Trp37 Pro38 Cys39 Lys40 Ser41 Asn42 Thr43, Asp44 AIa4 ⁇ and Asn46). Amino acids that can potentially interact with galactose are contained within the residues 22-28 and 3 ⁇ -46.
  • the carboxyl galactoside binding site may be defined by three regions of amino acid sequences, residues 197-200 (Argl97, Glul98, Thrl99 and Val200) residues 233-239 (Leu233 Asp234 Val23 ⁇ Arg236 Ala238 Ser238 Asp239) and residues 244-256 (Gln244, Ile24 ⁇ , Ile246, Leu247, Tyr248, Pro249, Leu2 ⁇ 0, His251, Gly252, Asp253, Pro2 ⁇ 4, Asn255 and G!n256). Amino acids that can potentially interact with galactose are contained within the residues 233-239 and 244-256. Not all of the residues described above however are considered to bind or contact to lactose.
  • Table 3 shows the distances of particular amino acids residues of the carboxyl galactoside binding site of ricin B to some part of the lactose residue bound therein.
  • Asp22, Gln3 ⁇ , Lys40, and Asn46 all are within 3.2 ⁇ A of at least one atom of galactose.
  • the nature of the side groups of the amino acids and galactose that are within 3.7 ⁇ A of one another suggest that they are hydrogen bonded.
  • the approximate bond lengths of biologically important hydrogen bonds range from to 3.lO ⁇ 0.13 A and below. (See Molecular Biology of the Gene, Watson ed., W. A. Benjamin Inc., New York, 2nd Edition (1970).
  • a hydrogen bond can be considered to be an intermediate stage of transfer of a proton from an acid to a base.
  • the strength of a hydrogen bond increases with the acidity (ability to donate a proton) of the proton donor and with the basicity (ability to accept a proton) of the proton acceptor.
  • alterations in amino acids that form hydrogen bonds with the galactoside include amino acid derivatives, amino acid substitutions and deletions that result in a decrease in binding of galactoside to the galactoside binding site or sites.
  • Amino acid residues to which such alterations may be carried out are those that form hydrogen bonds with the galactoside, and amino acids stabilizing amino acids that form 26 hydrogen bonds with the galactoside.
  • residues Asp22, Arg24, Gln35, Lys40 and Asn46 of the ricin B chain are in positions that indicate potential formation of hydrogen bonds with galactoside.
  • residues His251 and Asn2 ⁇ are in positions that indicate potential formation of hydrogen bonds with galactoside.
  • Asp234 also is in a position that suggests hydrogen bond formation.
  • Amino acid residues that stabilize an amino acid which is in a position to form a hydrogen bond with galactoside are Asp22 of the amino galactoside binding site, and Asp234 of the carboxy galactoside binding site. Both of these residues may also participate in hydrogen bonding to the galactoside. Intervening water molecules between amino acid residues, such as Asn2 ⁇ , may hydrogen bond to galactose.
  • Muteins of ricin B according to the invention may be formed by deletion or substitution of at least one of the amino acids that form hydrogen bonds with galactoside or stabilize amino acids that form hydrogen bonds with galactoside.
  • substituting amino acids that do not form hydrogen bonds will generally have either a side group that lacks charge, such as glycine, alanine, valine, isoleucine, leucine.
  • Substituting amino acids with no side chain (glycine) or short side chain are generally preferred.
  • amino acids having side chains that are oppositely charged from side chain of the amino acid for which it substitutes are preferred.
  • aspartic acid or glutamic acid are the residues in the native ricin B chain to be substituted, both of which have negatively charged carboxyl side groups, lysine and arginine, which have terminal amino side groups are preferred in the ricin B mutein.
  • Both the amino and carboxyl galactoside binding sites have one site that 1s formed by an aromatic amino acid residue, Trp37 and Tyr248 1n the amino and carboxyl galactoside binding sites, respectively.
  • the aromatic side chain of both of these amino acids is about 5 A from the lactose residue and substantial portions of each amino acid are within 4 A of the lactose residue.
  • the distances of the side chains from the lactose ring are such that strong nonspecific attractive forces or Van der Waals interactions are indicated. Van der Waals interactions may occur over distances such as those Indicated above between the aromatic ring of the amino adds and the ring structure of lactose.
  • the aromatic amino adds are deleted or are substituted with amino acids that do not lead to stabilization of nonspecific attractive forces such as Van der Waals ' invention.
  • substitutions will be made with amino acids that do not have aromatic or heterocyclic side chains.
  • substitution with tryptophan, phenylalanine, tyrosine and histidine are not desirable for either Trp37 or Tyr248.
  • the substitutions are preferably made with amino acids that have small side chains. Most preferred are those that do not have significant charge separation and therefore do not have the potential for formation of stabilizing hydrogen bonds.
  • Glycine and alanine are particularily preferred. Not desirable are large uncharged side chains such as those of leucine and isoleucine which, because of their extended uncharged structure, may have sufficient proximity to the lactose residue to stabilize the bonding thereto by Van der Waals interaction.
  • a cystelne residue or residue may be inserted into one or both of the gal actoside binding sites of ricin B chain.
  • the thi ol group of cystelne reacts quickly under mild conditions with Iodoacetate, Iodoacetaralde, N-ethylmalelmide and other reagents that are specific, or can be made specific, for thiol groups.
  • a site is provided for easy manipulation.
  • 8 thiol groups have formed 4 disulfide bonds.
  • the ninth thiol group, Cys4 remains free. This can be either left and chemically modified, or it can be removed by site-specifi c modifi cati on (changed to a serine or other residue). If the molecule being modified is ricin, then Cys4 would be left and it would be linked to the Interchain thiol group of ricin A chain to form a disulfide bond.
  • cysteines In such a molecule the only thi ol that can react with sulfhydryl reagents would be the cysteines inserted into the galactose binding pockets.
  • the cysteine at 171 of, ricin A chain has been shown to be unavailable for reaction as it is deeply situated 1n a hydrophobic . region of the molecule.
  • the substitution of a cysteine residue for an amino acid in either or both of the gal actoside binding sites may be sufficient to decrease or el iminate the binding of gal actosi de to ricin B.
  • the cysteine residue may be derivatized with thiol specific groups such as alkylating agents to yield a cysteine derivative that interferes with gal actoside binding.
  • the size of the thiol specific reagent may. be increased if lodoacet mide, iodoacetate or N-ethylmaleimide did not prevent galactose binding.
  • the carboxyl group of iodoacetate may be l inked in an amide bond to glycine. It could l ink to the ami no group of cysteine 1n which the thiol group was blocked by a disulfide, such as with 5-thio-2-nitrobenzoic acid (TNB).
  • TBN 5-thio-2-nitrobenzoic acid
  • the thiol group could be modified with iodoacetate, lodoacet amide or N-ethylmaleimide.
  • Various means for chemically derivatizing the cystelne residue placed In the gal actoside binding site are possible and are considered within the scope of the invention to the extent that the Hdn B mutein shows decreased binding to galactoside while retaining the ability to aid in translocation of the toxin molecule.
  • Asp 234 and Asn 255 for the carboxyl gal actoside binding site are the preferred residues for substitution with cysteine.
  • Residues 22 (Asp ) and 46 (Asn ) in the amino terminal site can be modified using the following ol igonucleotides for site specific modification:
  • Ricin B protein havinq the desired amino acid replacement or deletion may be made by conventional Merrifield synthesis as is known in the art. However, Merrifield synthesis of a complete ricin B molecule is undesirably complicated. .
  • Substitutions and deletions may be accomplished by digesting to completion DNA encoding the native ricin B protein with specified endonucleases that cut in the region of the DMA surrounding the amino acid to be altered, removing the DNA fragment which encodes the amino acid residue or residues of the native ricin B galactoside binding site to be altered, and Ugating, either under blunt ended or sticky ended conditions as appropriate, a double stranded DNA made of complementary chemically synthesized oligonucleotides that encode the desired amino acid alteration.
  • the means for making such oligonucleotides are known and Include commercially available automated DNA synthesizers such as that made by Biosearch, San Rafael, California.
  • Site-specific mutagenesis may also be used to carry out alterations to the DNA encoding specific amino acid.
  • the DNA encoding ricin B chain in the region to-be altered is cut using an appropriate endonuclease, the fragment carrying the specific ridn region is removed, ligated into an appropriate vector such as an M13 vector and is mutagenized using a single-stranded oligodeoxyribo ⁇ nucleotide primer synthesized to insert, change, or delete nucleotides from the fragment after replication with an appropriate DNA polymerase.
  • endonuclease restriction sites that are found in the native ricin B chain sequence may be used, or unique restriction sites on either side of the areas of interest are made in the DNA sequence of ricin B.
  • a new site for cleavage by Sail in the area of the amino galactoside binding site is made using site- specific mutagenesis to modify the sequence at Val21 and Asp22.
  • Another site is created for cleavage by PvuII using the same technique to modify the base sequences around Gln47 and Leu48. Both modifications may be made without changing the amino acid sequence of ri in B.
  • Figure 2A illustrates the position of the Sail and PvuII sites that can be created and the oligonucleotide sequences that can be used to mutagenize the sequence of ricin B and retain the amino acid sequence.
  • a new site for cleavage by Xbal in the area of the carboxyl galactoside binding site is constructed by site-specific mutagenesis by modifying the sequence at Val232, Leu233 and Asp234.
  • Figure 2B illustrates the position of the Xbal and SacII sites, and the oligonucleotide sequences that are used to mutagenize the sequence of ricin B and retain the amino acid sequence.
  • the unique restriction sites introduced into the ricin B sequence are produced by site-specific mutagenesis using conventional means.
  • the above mentioned restriction sites are preferred because they do not alter the amino acid sequence -of ricin B.
  • Other unique restriction sites may be Introduced as long as the amino add sequence of ricin B is not changed, or 1f changed, the new sequence does not affect the essential biological properties of ricin B that relate to trans!ocation.
  • various methods may be used to Introduce changes 1n the DNA sequence encoding amino acids of the amino terminal and carboxyl terminal galactoside binding sites.
  • Double stranded oligodeoxyrlbonucleotides having "sticky ends" compatable with the unique restriction site engineered Into the ricin B sequence by site- specific mutagenesis may be used.
  • Such oligonucleotides may be made by conventional comrnercially available oligonucleotide synthesizers.
  • Table 11 shows the double-stranded oligodeoxyribonucleotide spanning the unique Sail to PvuII site engineered into the amino terminal region of the ricin B chain that encompasses the amino galactoside binding site.
  • Table 12 shows the double-stranded oligodeoxyribonucleotide spanning the unique Xbal to SacII sites in the carboxyl region of ricin B chain that encompasses the carboxyl galactoside binding site.
  • Each table shows the nucleotide changes required for the substitution of various amino acids. As mentioned above, the nucleotide change may be made to single or multiple amino acids in this region of the ricin B molecule. In addition, any of the changes may be made independently of all other changes.
  • Deletions of amino acids may be made using essentially the same method, however, instead of changing the nucleotide sequence to encode a substituted amino add, the complete trinucleotlde codon encoding the amino acid to be deleted 1s removed. Such deletions are particularly desirable 1f they do not change the comformation of the protein, though not necessarily preferred for Trp37 and Tyr248.
  • Modifications of the DNA sequence encodinq Asp22 may be made using the double-stranded break and repair method of Mandeckl, Proc. Natl. Acad. Sci. USA 7_: 177-7181 (1986). Briefly, Sail cleaves the sequence 5'GTCGAC-3' at a position immediately 3* of the 5' G of this sequence, and the GAC portion codes for Asp22 in ricin B chain. Briefly, the plas id comprising the ricin B sequence is cleaved at the Sail site, inserted as described above, to convert the circular structure to a linear one.
  • oligonucleotide containing sequences at either end that are identical to the ricin B chain DNA sequence with the site at residue 22 mutated to the desired amino acid is mixed with the linear plasmid. After heating and annealing, the DNA is used to transform cells rendered competent by calcium chloride treatment and incubation on ice followed by incubation at 37C for a short time. Transformed cells containing the
  • the sequence flanking and including the Sail site is as follows (the gap is to illustrate the Sail site): Sail cleavage site
  • oligonucleotides to be used to repair the strand break and insert new amino acids substituting for Asp22 are shown in Table 13. Modifications to the DNA sequence of the carboxyl galactoside binding site encoding Asp234 are made 1n essentially the same manner as described for the modifications of Asn22.
  • sequence flanking and Including the Xbal site is as follows (the gap 1s to Illustrate the Xbal site):
  • ricins D As mentioned above, there are several known isotoxins of ridn B and these include ricins D, and E. Furthermore, ricin E has
  • the isotoxins D and E and muteins thereof are capable 25 of being cloned and expressed by the Instant Invention.
  • the full-length sequences encoding ricin D, putative ricin E, and RCA in precursor form were obtained, using the messenger RNA prepared as described above for ricin A, to obtain a cDNA library, and 30 . then probing the library to retrieve the desired cDNA inserts.
  • the library was prepared using the method of Okayama and Berg (Mol . and Cell Biol. (1983) 3 ⁇ 230-289) and was probed using the same 35-mer used for ricin A-encoding sequences. Out of several thousand transformants with cloning vector, a number of positively hybridizing clones were obtained.
  • the inserts are subcloned into M13 vectors for site- directed mutagenesis to place an ATG start codon and a Hindlll site at the beginning of the mature protein, in a manner analogous to that set forth for ricin A above, or to place a Hindlll site immediately prior t ' o the ATG of the secretory leader sequence where appropriate.
  • the mutagenized DNAs can be retrieved from the M13 vectors by cleaving with PstI. blunt-ending with Klenow, digestion with Hindlll at the newly created site, and isolation of the appropriate length sequence.
  • linker portion modifications may be made, in particular in the linker portion, to provide suitable means for detaching the A and B portions.
  • a variety of strategies are possible. Two convenient ones are: 1) construction of a trypsin cleavage site by creating an "arg- arg n form of the linker wherein the prollne following the arginine residue already present 1s replaced by another arginine; and 2) Insertion of a stop and a start codon in the linker region so that the A and B regions are separately but simultaneously produced.
  • Transformation of t ⁇ . coli cells was done according to procedures set forth in T. Maniatis, E.F. Fritsch and J. Sa ⁇ brook Molecular Cloning: A Laboratory Manual (1982) Cold Spring Harbor Press.
  • Transfections of Sf9 Spodoptera frugiperda cells are accomplished using a modification of the calcium phosphate precipitation technique (Graham, F.L. et al., 1973, Virology 52:456) as modified for insect cells (Burand, J.P. et al. (1980) Virol ., pl_:286; Carstens, E.B. et al . (1980) Virol ., _101_:311) and further described by Summers, M.D, and Smith, G.E. (A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas ASM Press, 1987).
  • Suitable vectors containing the desired coding and control sequences employs standard Hgation and restriction techniques which are well understood in the art and are described in Maniatis, T. et al., supra. Isolated plasmids, DNA sequences, or synthesized oligonucleotides are cleaved, tailored, and religated in the form desired.
  • Site specific DNA cleavage is performed by treating with the suitable restriction enzyme (or enzymes) under conditions which are generally understood in the art, and the particulars of which are specified by the manufacturer of these commercially available restriction enzymes. See, e.g., New England Biolabs, Product Catalog.
  • suitable restriction enzyme or enzymes
  • about 1 yg of plasmid or DNA sequence is cleaved by one unit of enzyme in about 20 ul of buffer solution; in the examples herein, typically, an excess of restriction enzyme is used to Insure complete digestion of the DNA substrate. Incubation times of about one hour to two hours at about 37 ⁇ C are workable, although variations can be tolerated.
  • protein is removed by extraction with phenol/chloroform, and may be followed by ether extraction, and the nucleic add recovered from aqueous fractions by precipitation with ethanol.
  • size separation of the cleaved fragments may be performed by polyacrylamide gel or agarose gel electrophoresis using standard techniques. A general description of size separations is found in Methods in Enzymology (1980) , 65:499-560.
  • Restriction cleaved fragments may be blunt ended by treating with the large fragment of E. coli " DNA polymerase I (Klenow) in the presence of the four deoxynucleotide triphosphates (dNTPs) using incubation times of about 15 to 25 minutes at 20 to 25 ⁇ C in 50 mM Tris pH 7.6, 5 mM MgCl 2 , 10 mM dithiothrei ol (DTT) and about 50 y of each dNTP.
  • the Klenow fragment fills in at 5 1 sticky ends but chews back protruding 3 1 single strands, even though the four dNTPs are present.
  • selective repair can be performed by supplying only one of the, or selected, dNTPs within the limitations dictated by the nature of the sticky ends.
  • the mixture is extracted with pehnol/chloroform and ethanol preci itated.
  • Treatment under appropriate conditions with SI nuclease results 1n hydrolysis of any single-stranded portion.
  • Synthetic oligonucleotides may be prepared by the triester method of Matteucci, et al., J. Am. Chem. Soc. (1981) 103:3185-3191 or . using automated synthesis methods. Kinasing of single strands prior to annealing or for labeling is achieved using an excess, e.g., approximately 10 units of polynucleotide kinase to 1 nM substrate in the presence of 50 M Tris, pH 7.6, 5 mM MgCl 2 , 10 mM DTT, 1-2 irM ATP. If kinasing is for labeling or probe, the ATP will contain high specific activity 32 ⁇ P. Ligations are performed in 15-30 yl volumes under the following standard conditions and temperature: 50 mM Tris-Cl pH 7.5,
  • T4 DNA ligase at 14 ⁇ C Ligations are usually performed at 33-100 ug/ml total DNA concentrations (5-100 nM total end concentration).
  • vector fragment 1s commonly treated with bacterial alkaline phosphatase (BAP) in order to remove the 5* phosphate and prevent religation of the vector.
  • BAP digestions are conducted at pH 8.5 1n approximately 50 mM Tris, 5mM MgCl 2 , using 0.1-1 unit of BAP per yg of vector at 37-55°C for about one hour.
  • religation can be prevented in vectors which have been double digested by additional restriction enzyme digestion of the unwanted fragments.
  • plaques 50% of the new plaques will contain the phage having, as a single strand, the mutated form; 50% will have the original sequence.
  • the plaques are hybridized with kinased synthetic primer at a temperature which permits hybridization of an exact match, but at which the mismatches with the orignal strand are sufficient to prevent hybridization. Plaques which hybridize with the probe are then picked, cultured, and the DNA recovered. Details of site specific mutation procedures are described below in specific examples. C.4. Verification of Construction
  • BamHI cloning sites at various locations in the polyhedrin gene were created as ' described (Smith et al., 1983, supra).
  • One of these, pAc373 has a single BamHI site 50 bp downstream from the polyhedrin cap site I.e., 8 bp before the polyhedrin ATG translation initiation codon (Smith et al., (1985) supra).
  • the transfer vectors, pAc610 and pAc ⁇ ll have the poly ⁇ nker from M13mpl0 and M13 ⁇ npll, respectively, Inserted at this BamHI site of pAc373 (Summers, M.D. et al., personal communication).
  • Isolation of the recombinant virus is achieved through plaque purification of serially infected monolayer cells overlayed with soft agar. After two or three cycles the recombinant virus would be seen as separate plaques showing the characteristic occlusion- negative morphology. The plaques, containing about 10,000 pfu of virus, are picked using a sterile Pasture pipet and transferred to 2 ml of medium.
  • Suspension culture conditions will vary depending on the medium and culture volume and should be determined empirically. Subculturing is required when the cell density reaches 2x10° cells/ml by replacing 80% or more of the culture with an equal volume of fresh medium. With suspension cultures larger than 500 ml it becomes necessary to aerate by either bubbling or diffusion.
  • the immunoconjugate-treated blot was soaked at room temperature without agitation for five minutes in 50 ml of 10 M Na citrate, 10 mM EDTA, pH ⁇ and then for 16 minutes in 60 ml of freshly prepared 10 mM Na citrate, 10 mM EDTA and 1% dextran sulfate.
  • Agarose-containing resins such as Sepharose, treated with dil ute acid to expose gal actose residues
  • Bio-Gel A resins resins such as Sepharose or Bi o-Gel A coupl ed to saccharides such as fetuin
  • ricin with an intact B chain or ri cin B chain alone.
  • Ricin or ricin B chain in whi ch the galactoside binding site or sites thereof has not been modified according to the invention when passed through these columns binds to the column material . If the galactoside-binding site has been altered to produce a ridn B mutein according to the invention, binding to galactoside will be measurably diminished or el iminated.
  • the abil ity of the ricin B mutein to bind galactose is further determined by equil ibrium dialysis using 3H-l abeled gal actose. Fluorescent polarization techniques using methyl u bell if ery! galactose may be used to measure the associati on of the gal actose derivati ve with ri cin B chain.
  • the abil ity of the ricin B mutein to interact with ricin A chain is determined by adding the ridn B mutein to a concentration of ricin A chain, deglycosylated ridn A chain, or recombinant ridn A chain that does not by Itself Inhibit protein synthesis in cells such as MCF-7 or HSB-2 cells.
  • the galactose binding sites on ricin B chain must be capable of binding gal actose-containing receptors on the surface of the target cel l and the two chain must Interact, either covalently through a disulfide bond or non-covalently.
  • the ability of ricin B chain muteins according to the invention encoded by DNA containing alterations in the gal actose binding regions as outl ined above, to convert ricin A chain into a toxin is substantially decreased or absent.
  • the abil ity of ricin B chai n muteins according to the invention to interact with ricin A chain is measured by a competition assay.
  • Native ricin B chain having intact gal actose bindinq sites , interacts with ricin A chain and when the ricin A-ricin B complex is added to cel l s , protein synthesi s is prevented.
  • Ri cin B chain muteins accordi ng to the Invention made from DNA in whi ch the gal actose binding residues have been modified as outl ined above is added to ricin A chain before or at the same time as native ricin B chain.
  • the ricin B chain muteins according to the invention reduce the amount of measurable protein synthesis inhibition because the ri cin B mutein displaces native ricin . B chain in the complex. The extent of reduction 1n protein synthesis 1s proportional to the concentration of the competing mutant ricin B chain.
  • conjugates of ricin in which the B chain thereof 1s a mutein which has reduced binding to galactosides are covalently bound to a binding moiety that can bind to a selected target cell or tissue and which can be Internalized by such target cell or tissue.
  • binding moieties may be selected from a vast number of substance that bind to specific cells or tissues and include lymphokines such as Inter!eukin-1, 2 and 3 and Interferon ⁇ * ⁇ and ⁇ ; cytoklnes such as tumor necrosis factor and colony stimulating factors such as, CSF-1, G-CSF and GM-CSF; hormones that bind to specific hormone receptors associated with specific tissues such as the reproductive hormones that bind to ovarian tissue, e.g., leutinizing hormone; cell growth factors such as transferrin and epidermal growth factor and antibodies that bind specifically to a desired target cell or which bind to an epitope that is expressed at high level on a target cell as compared to other cell or normal cells.
  • lymphokines such as Inter!eukin-1, 2 and 3 and Interferon ⁇ * ⁇ and ⁇
  • cytoklnes such as tumor necrosis factor and colony stimulating factors such as, CSF-1, G-CSF and GM-CSF
  • EXAMPLE I A. Construction of New Baculovirus Transfer Vectors ⁇ .l. Construction of pAcCl pAcCl is similar to pAc401 (described previously in Section C.5.) except that the recognition site for EcoRI endonuclease has been removed. To accomplish this, pAc401 was digested to completion with EcoRI and the ends were made blunt using Klenow fragment. After 11gation and transformation, candidates were screened for the absence of an EcoRI site.
  • pAcC2 pAcC2 is similar to pAc436 (described previously in Section C.5.) except that the recognition site for EcoRI endonuclease has been removed. To accomplish this, pAc436 was digested to completion with EcoRI and the ends were made blunt using Klenow fragment. After ligation and transformation, candidates were screened for the absence of an EcoRI site.
  • A.3. Construction of pAcC3 pAcC3 differs from pAcC2 in that an Ncol restriction site has been introduced at the ATG trans! ational start of the polyhedrin gene. To accomplish this the new transfer vector, pAcC2, was digested to completion with Smal endonuclease.
  • S al digested pAcC2 was dissolved 1n TE buffer (10 mM Tris-HCl pH 7.4; 1 M EDTA).
  • 1n TE buffer 10 mM Tris-HCl pH 7.4; 1 M EDTA.
  • ExoIII buffer 50 mM Tris-HCl pH 8.0; 5 mM MgCl 2 ; 10 mM ⁇ - mercaptoethanol
  • 10 ⁇ g of Smal digested pAcC2 was treated with 50 units of E. coll Exonuclease III (ExoIII) at 30 ⁇ C for 5 minutes. The sample was phenol extracted and ethanol precipitated twice.
  • the extension reaction was performed by adding 20 ⁇ l 2 x Klenow buffer (40 mM Tris-HC! pH 7.5; 20 M MgC12; 2 M ⁇ -mercaptoethanol) containing 1 ⁇ l 10 M dNTPs, 1 ul 10 mMATP, 1 ⁇ l (about 2 units) Klenow fragment and 1 ⁇ l (about 1-2 units) T4 DNA ligase.
  • the reaction was incubated at 16 e C for about 4 hours and then transformed into MM294. Minilysates were screened by analyzing for the presence of an Ncol site. Miniprep DNA was then used to retransform and obtain the desired pure clone.
  • A.4 Construction of pAcC4 and pAcC5 pAcC4 and pAcC ⁇ are derivatives of pAcC3 containing a polyl inker sequence at the Smal site.
  • the polyl inker contains recognition sites for restriction endonucleases Smal, Kpnl, PstI, Ball I, Xbal (cleavable when DNA is unmethylated), EcoRI, BamHI and Bell.
  • pAcC4 contains the sequence in one orientation while pAcC ⁇ contains the polylinker in the opposite orientation (see Figure 4).
  • pAcC3 was digested to completion with Xmal endonuclease and Ugated with two complementary self-annealed oligomers having the sequence: 5'-CCGGGTACCTGCAGATCTAGAATTCGGATCCTGATCA-S' 3*- CATGGACGTCTAGATCTTAAGCCTAGGACTAGTGGCC-5'
  • miniprep DNAs of transformants were analyzed for the presence of restriction sites in the polylinker sequence.
  • the insect host cell line, Sf-9, and ribosomes isolated from this cell line were tested for resistance to ricin toxin and ricin A chain, respectively.
  • the Sf-9 host cells were found to be unaffected by a 4 hour exposure to ricin D at concentrations of up to 10 ⁇ g/ml. After washing, the Sf-9 cells were incubated an additional 20 hours and remained unaffected.
  • a derivative of the mouse 3T3 cell line called psi-2 Mann, R. et al. (1983) Cell, _33_:153), however, was almost completely inhibited/killed by a 4 hour exposure to ricin D at a concentration of 1 ng/ l.
  • the ID50 concentration at which 50% of the cells are inhibited/killed
  • Ribosomes from Sf-9 cells appear to be resistant to ricin A chain.
  • Sf-9 ribosomes were prepared according to Palmiter, R.D. (Biochem (1974) 13_:3606) and tested in an in vitro translation assay (Cawley, D.B. et al. Biochem (1979) 12:2648) for sensitivity to added ricin A chain.
  • a concentration of recombinant ricin A of about 10 yg/ml
  • translation activity was depressed about 50%.
  • 1-10 ng/ml of recombinant ricin A inhibits the rabbit reticulocyte translation system by 50%.
  • the ricin sequence was obtained as a HindUI-Hindlll fragment from a vector in which a Hindlll site had been created at the ATG trans!atlonal start at the beginning of the secretory signal peptide sequence as previously described.
  • the Hindlll site after the ricin gene can be derived from M13 or other suitable vectors carrying polylinker sequences.
  • the Hindlll fragment containing the ricin gene was made blunt ended with Klenow fragment and ligated to Smal digested pAcC3.
  • Recombinants containing the ricin sequence in the correct orientation for expression under polyhedrin promoter control were identified by restriction analysis. Two correct constructs were selected for transfection into baculovirus and were designated oBRT ⁇ and pBRTl ⁇ .
  • the native sequence in this construction is expected to be expressed with additional residues on Its amino-terminus (in this case five) but these would be eliminated along with the signal peptide upon secretion.
  • ricin B subunit The sequence encoding ricin B subunit was taken from pRTB601 on a Hindlll-Hi'ndlll fragment. The fragment was treated with Klenow enzyme and al! 4 dNTP's to blunt repair the sticky ends and was subsequently ligated into Smal-digested pAcC3. Two recombinants containing the ricin B chain sequence in the correct orientation were identified and designated pBIB4 and pBIB24. The expected fusion sequence for expression 1s shown below. polyhedrin 5' leader +1 ricin B chain sequence ⁇ '-AACCTATAAACC ATG GCG GCC CAG CTT ATG GCT GAT
  • the sequence encoding ricin B was taken from pRTB601 on a Hindlll-HindlH fragment. After cloning this fragment into M13, site- specific mutagenesis using the primer, 5'-GTGCCAAGCTTTGCGCAGATGTTTGT- 3' was carried out to introduce an Fspl restriction site (underlined in primer) including the amino-terminal alanine codon (GCA) of the B subunit coding sequence. The B subunit coding sequence was then excised as an FspI-PstI fragment using the PstI site from the M13 vector at the 3' end of the B subunit insert.
  • the 97-mer encodes the CSF-1 secretory signal peptide (Kawasaki, E. et al., 1985, supra) except for four modifications at nucleotides 5, 10, 82 and 97 which were third position codon changes to create restriction recognition sites. Only the change at position 5 resulted in an amino acid coding change (Thr to Ala).
  • the 97-mer having the sequence 5'-CATGGCCGCCCCGGGCGCCGCCGGGCGCTG CCTCCCACGACATGG CTGGGCTCCCTGCTGTTGTTGGTCTGTCTCCTGGCCAGCAGGAGTWTCACG-3 , and its complement when annealed have a 5' Ncol sticky end for insertion Into The transfer vector and a 3 1 blunt end for fusion to the Fspl blunt end at the 5' end of the B subunit coding sequence.
  • the transfer vector, pAcC ⁇ was doubly digested with Ncol and PstI. A three fragment ligation resulted in a baculovirus transfer vector containing a CSF-1 secretory peptide fused to the ricin B subunit. This vector is designated pBSBl.
  • Native ridn B has asparagine at positions 46 and 255. Muteins were generated wherein glydne was substituted for asparagine at either one or both of these positions. Standard M13 cloning techniques were used to realize the 255 mutein, and the techniques described by Mandecki, W., Proc. Natl. Acad. Sci. USA 83. 7177 (1986) were used to produce the 46 mutein.
  • the oligomer used to mutagenize asparagine at position 255 to glydne was GGTGACCCAGGTCAAATATGGTTACC, while the oligomer used to mutagenize the asparagine at position 46 to glycine was GTGGCCATGCAAGTCTAATACAGATGCCGGCCAGCTCTGGACTTTGAAA.
  • GTGGCCATGCAAGTCTAATACAGATGCCGGCCAGCTCTGGACTTTG was previously necessary to introduce a unique restriction site near position 46 using standard mutagenesis techniques and the oligomer GCAAATCAGCTCTGGACTTTG.
  • RB was obtained from pRTB601 as a Hindlll cassette, and using the oligomer shown above, asparagine at position 255 was converted to glycine in M13MP18.
  • M13MP18 containing the mutagenized RTB DNA sequence was digested using Hindlll, and the mutagenized sequence ligated into plasmid pPL231, thereby producing plasmid pPL231-RTB/AE82.
  • the transfer vector, pBG255 was then constructed as shown in Figure 5 using the plasmid pBSBl, and pPL231- RTB/AE82.
  • the plasmid pBSBl was treated with the following enzymes
  • the Bglll-HgiAI fragment was derived from the plasmid pPL231-RTB/AE82 by subjecting the plasmid to HgiAl, Klenow, and BglH treatment, and by gel purifying the BglH- HgiAI fragment. Ligation of the large fragment obtained from pBSBl to the Bglll-HgiAI fragment yields the plasmid, pBG255 as shown 1n Figure 5.
  • a transfer vector, pBG46/255, containing a RB insert having asparagines at positions 46 and 255 mutated to glydne was constructed as shown in Figure 6.
  • a RB construct was generated wherein asparagine at position 46 was mutated to glydne which consisted of inserting RB removed from pRTB601 as a Hindlll cassette Into pDGHl.
  • the "oligomer overlay" technique of Mandeckl, referred to above, was used to perform the mutagensis employing the oligomer also shown above. This procedure requires a restriction site in the vicinity of the sequence to be mutagenized .such that sequences which flank the sequence are complementary to the oligomer.
  • pDG141 Because there is a unique PvuII site near position 46 of RB, and because pDG141 does not have any PvuII restriction sites, it was possible to perform the overlay technique which produced plasmid pDG141 harboring the asparagine to glycine mutation.
  • pDG141 was digested with Hindlll thereby removing the RB cassette containing glycine at position 46. The cassette was inserted into pPL231 thereby providing pPL231-RTB/AE98.
  • This plasmid which contains ridn B having had the asparagine amino add at position 46 mutagenized to glycine, was ligated to the large fragment resulting from BamHI digestion of pBG255 thereby yielding the plasmid pBG46/255 having full length ricin B wherein the amino acids at positions 46 and 255 have been mutagenized from asparagine to glycine. Details of the construction of pBG46/255 are shown in Figure 6. Transfer vector pBG46 was constructed using the same general materials and methods used to produce pBG46/25 ⁇ with the exception that pBSBl was substituted for pBG2S ⁇ .
  • Cytotoxicity assays were run on the first set of supernatants. Aliquots were diluted 1:10 and 1:100 into medium and placed onto RAT-2 cells (this is a tk " variant of the rat cell line, RAT-1) for 4 hours, replaced with fresh medium, and examined 20 hours later. The results are shown in Figure 7.
  • the infected cell supernatants from the BRT15 plaques, 6-1 and 6-2 show definite cytoxicity at both 1:10 and 1:100 dilutions that can be blocked by the addition of 50 mM lactose. Lactose is able to block specific binding of native ricin. Support for this being ricin-like activity comes from the Western blot analysis of the second set of infected supernatants.
  • Lane 5 is the cell supernatant from Sf9 cells infected with wild-type baculovirus.
  • each of the two supernatants (lanes 7 and 8) contain a product that migrates close to the position of intact ricin that is detected by both the ant i -RTA and anti-RTB sera. This may correspond to secreted product that is not processed further into the A and B subunits. ⁇ It represents perhaps 60-70% of the total detected products.
  • the anti-RTA sera also detects two products which migrate approximately with native ricin Al and A2 chains and likely are analogous to those forms of ricin A chain.
  • the anti-RTB sera detects additionally a product that migrates approximately with native ricin B chain. These smaller products collectively comprise the remainder of the 30-40% of the detected material.
  • pBIB4 and pBIB24 DNAs were each cotransfected into Sf9 cells with wild type baculovirus DNA.
  • the initial transfected cells and cells infected with the subsequently plaque-purified viruses were assayed for ricin B chain expression to aid in selecting recombinant viruses.
  • the data discussed below was taken from experiments in which either once or twice plaque-purified virus was used. Infected cells were harvested 4-6 days after infection, when the cultures showed a high percentage of l te -infected cells.
  • Western blot analysis of several pBIB4 and pBIB24 fi rst- round plaqued vi ruses 1t was clear that a ricin B chain protein was expressed In most, but not all , pl aque-pool infections.
  • Fral se recombinant viruses may be attributed to a natural loss of the polyhedrin phenotype as there Is no selection for 1t 1n vitro.
  • the ricin B chain product expressed has a molecular weight of 29 kD (see Figure 9, lane 5), consistent with that expected for a non-secreted, non-glycosyl ated product.
  • the same product was noted by Western blot but could not be visualized in Coomassie stained gels. From a comparison of signal strengths , it was estimated that the ridn B chain is produced at about 2 mi cro gram/ml .
  • the transfer vector, pBSBl, containing the CSF-1 secretory pepti de fused to ricin B was transfected with bacul ovi rus DNA into Sf-9 cel l s and recombinant vi rus was selected.
  • Ricin B was . detected by Western bl ot analysis as described by Towbin et al . , (1979) Proc . Nat! . Acad. Sci . USA, _76_:4350. Rabbit anti -sera to ricin B-chain was util ized.
  • ricin B chain is expressed as two cel l associated proteins, one having a molecul ar wei ght of about 32,000.
  • the 32,000 and 36,000 species accumulated to si gnificant level s in the range of about 10 ⁇ g/ml and 2 mg/ ⁇ l , respecti vely.
  • approximately 10 nanograms/ ⁇ l was acti ve B chai n.
  • ricin B chain was al so expressed as a secreted protein having a molecular weight of about 36,000. This molecule accumulates to significant level in the range of about 2 mg/ml . Of this, approximately 10 nanograms/per ml was active B chain.
  • the cartridge Prior to applying the culture media to the cartridge, the cartridge was acti vated by fi rst passing 0.1 mol ar tribasic sodium phosphate, pH 9, through the cartridge, and then 0.1 mol ar sodi um acetate, pH 3. Next the cartridge was washed with 0.1 mol ar sodi um phosphate, pH 7.2 until the pH fluid eninating from the cartridge was 7.2, at whi ch time it was further washed with 10 mM sodi um phosphate,. pH 7.2, with 40 mM NaCl until the conductivity of buffer entering and leaving the cartridge was about 4 mmisiemens/cm.
  • the culture medium was passed through the cartridge and the cartridge then washed with 10 mM sodium phosphate, pH 7.2, containing 40 mM NaCl until such time that the absorbance reading at 280 nm was 0.
  • the protein which bound to the cartridge was eluted in a single step gradient with 10 M sodium phosphate, pH 7.2, containing 1 M NaCl.
  • Those fractions containing the mutein were Identified by immunoblots using affinity purl fied-anti body raised against naturally occurring ricin B chain. It was calculated that the concentration of the ricin B chain mutein was about 240 nanogra s/per ml.
  • an assay was employed wherein binding of the muteins was compared to binding of native ricin B chain.
  • the assay consisted of determining 1f these molecules bound to asialofetuin which was absorbed to the bottom of a 96-well plastic tissue culture plate.
  • Asialofetuin was obtained from Sigma Corporation, and was dissolved at 1 mg/per ml in phosphate buffered saline containing 0.5% bovine serum albumin, 0.05% Tween-20, and the preservative thi ⁇ ersal at 0.01%.
  • the procedure involved diluting the asialofetuin solution to a concentration of 5 ⁇ g per ml with 0.05 molar sodium carbonate, pH 9.6, and 100 microHters of this solution was added to wells 1n the 96 well plate. The solution was allowed to incubate overnight at 4 ⁇ C so as to provide maximum time for asialofetuin to adhere to the tissue culture plates.
  • the plates were washed with phosphate buffered saline to remove unattached asialofetuin, and then areas on the culture tissue wells which did not bind asialofetuin were blocked with bovine serum albumin in phosphate buffered saline, Tween-20 and thi erisal for one hour at room temperature.
  • the plates were washed a second time with phosphate buffered saline containing Tween-20, and subsequently 100 microl iters of either native ricin B, or the mutein was added to each well .
  • the samples were diluted into phosphate buffered saline containing 0.5% bovine serum albumin before addition to the wells, and where necessary, lactose was also present.
  • the samples were incubated for two hours with moderate shaking at 21 ⁇ C and the plates were washed with phosphate buffered saline containing Tween-20 to remove unbound reactants.
  • 100 microliters of polyclonal rabbit anti -ricin B chain antibody, conjugated to horseradish peroxidase, previously diluted in the range of 1:1000 to 1:5000 was added to each of the wells and incubated for two hours with shaking at 21 ⁇ C.
  • the wells were further washed with

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Botany (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

Clonage et expresssion de toxines de ricine, de mutéines de toxines de ricine ayant une activité réduite de liaison de la galactose, ou des sous-unités. Ces molécules sont clonées dans des vecteurs nouveaux de transfert de baculovirus et sont infectées dans des cellules d'insectes avec le baculovirus pour effectuer la recombinaison avec les vecteurs de tansfert et produire des vecteurs d'expresssion de baculovirus capables d'infecter des cellules d'insectes et d'exprimer les toxines de ricine, les mutéines ou leurs sous-unités.
PCT/US1988/002442 1987-07-24 1988-07-20 Production de toxines de ricine dans un systeme d'expression de cellules d'insectes-baculovirus WO1989001037A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US7712687A 1987-07-24 1987-07-24
US077,126 1987-07-24
US15377888A 1988-02-08 1988-02-08
US153,778 1988-02-08

Publications (1)

Publication Number Publication Date
WO1989001037A1 true WO1989001037A1 (fr) 1989-02-09

Family

ID=26758913

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1988/002442 WO1989001037A1 (fr) 1987-07-24 1988-07-20 Production de toxines de ricine dans un systeme d'expression de cellules d'insectes-baculovirus

Country Status (3)

Country Link
AU (1) AU2136788A (fr)
IL (1) IL87193A0 (fr)
WO (1) WO1989001037A1 (fr)

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997041233A1 (fr) * 1996-04-30 1997-11-06 De Novo Enzyme Corporation Proteines antivirales du type ricin
WO1998018820A1 (fr) * 1996-10-28 1998-05-07 Medical University Of South Carolina Procedes et compositions relatifs a des immunotoxines de la proteine de fusion du ricin, pour le traitement du cancer et de maladies auto-immunes
KR19980043226A (ko) * 1996-12-02 1998-09-05 박영설 에어백이 장착된 뒷굽없는 신발밑창
WO2006069246A2 (fr) 2004-12-22 2006-06-29 Ambrx, Inc. Compositions contenant des acides amines non naturels et des polypeptides, procedes impliquant ces acides amines non naturels et polypeptides, et utilisations desdits acides amines non naturels et polypeptides
WO2008030558A2 (fr) 2006-09-08 2008-03-13 Ambrx, Inc. Polypeptide plasmatique humain modifié ou squelettes de fc et leurs utilisations
WO2009067636A2 (fr) 2007-11-20 2009-05-28 Ambrx, Inc. Polypeptides d'insuline modifiés et leurs utilisations
WO2010011735A2 (fr) 2008-07-23 2010-01-28 Ambrx, Inc. Polypeptides g-csf bovins modifiés et leurs utilisations
WO2010037062A1 (fr) 2008-09-26 2010-04-01 Ambrx, Inc. Vaccins et micro-organismes dépendant de la réplication d'acide aminé non naturels
US7736872B2 (en) 2004-12-22 2010-06-15 Ambrx, Inc. Compositions of aminoacyl-TRNA synthetase and uses thereof
US7816320B2 (en) 2004-12-22 2010-10-19 Ambrx, Inc. Formulations of human growth hormone comprising a non-naturally encoded amino acid at position 35
EP2284191A2 (fr) 2004-12-22 2011-02-16 Ambrx, Inc. Procédé de préparation de hGH
US7947473B2 (en) 2004-12-22 2011-05-24 Ambrx, Inc. Methods for expression and purification of pegylated recombinant human growth hormone containing a non-naturally encoded keto amino acid
EP2327724A2 (fr) 2004-02-02 2011-06-01 Ambrx, Inc. Polypeptides d'hormone de croissance humaine et leur utilisations
US8012931B2 (en) 2007-03-30 2011-09-06 Ambrx, Inc. Modified FGF-21 polypeptides and their uses
US8093356B2 (en) 2005-06-03 2012-01-10 Ambrx, Inc. Pegylated human interferon polypeptides
US8114630B2 (en) 2007-05-02 2012-02-14 Ambrx, Inc. Modified interferon beta polypeptides and their uses
WO2012024452A2 (fr) 2010-08-17 2012-02-23 Ambrx, Inc. Polypeptides de relaxine modifiés et leurs utilisations
US8278418B2 (en) 2008-09-26 2012-10-02 Ambrx, Inc. Modified animal erythropoietin polypeptides and their uses
US8420792B2 (en) 2006-09-08 2013-04-16 Ambrx, Inc. Suppressor tRNA transcription in vertebrate cells
EP2805965A1 (fr) 2009-12-21 2014-11-26 Ambrx, Inc. Polypeptides modifiés de somatotrophine bovine et leurs utilisations
EP2805964A1 (fr) 2009-12-21 2014-11-26 Ambrx, Inc. Polypeptides modifiés de somatotrophine bovine et leurs utilisations
US9133495B2 (en) 2006-09-08 2015-09-15 Ambrx, Inc. Hybrid suppressor tRNA for vertebrate cells
US9175083B2 (en) 2004-06-18 2015-11-03 Ambrx, Inc. Antigen-binding polypeptides and their uses
US9434778B2 (en) 2014-10-24 2016-09-06 Bristol-Myers Squibb Company Modified FGF-21 polypeptides comprising an internal deletion and uses thereof
US9488660B2 (en) 2005-11-16 2016-11-08 Ambrx, Inc. Methods and compositions comprising non-natural amino acids
EP3103880A1 (fr) 2008-02-08 2016-12-14 Ambrx, Inc. Polypeptides d'insuline modifiés et utilisations de ceux-ci
US9567386B2 (en) 2010-08-17 2017-02-14 Ambrx, Inc. Therapeutic uses of modified relaxin polypeptides
US10266578B2 (en) 2017-02-08 2019-04-23 Bristol-Myers Squibb Company Modified relaxin polypeptides comprising a pharmacokinetic enhancer and uses thereof
US11273202B2 (en) 2010-09-23 2022-03-15 Elanco Us Inc. Formulations for bovine granulocyte colony stimulating factor and variants thereof

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2631974B1 (fr) * 1988-05-31 1992-12-11 Agronomique Inst Nat Rech Baculovirus modifie, son procede de preparation et son application en tant que vecteur d'expression de genes

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0127839A2 (fr) * 1983-05-27 1984-12-12 THE TEXAS A&M UNIVERSITY SYSTEM Procédé pour la préparation d'un vecteur recombinant d'expression de baculovirus
EP0145111A1 (fr) * 1983-07-15 1985-06-19 The University Of Warwick Séquence d'ADN codant pour une toxine du type de ricine ou une partie

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0127839A2 (fr) * 1983-05-27 1984-12-12 THE TEXAS A&M UNIVERSITY SYSTEM Procédé pour la préparation d'un vecteur recombinant d'expression de baculovirus
EP0145111A1 (fr) * 1983-07-15 1985-06-19 The University Of Warwick Séquence d'ADN codant pour une toxine du type de ricine ou une partie

Cited By (86)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6333303B1 (en) 1996-04-30 2001-12-25 Twinstrand Therapeutics Inc. Antiviral ricin-like proteins
WO1997041233A1 (fr) * 1996-04-30 1997-11-06 De Novo Enzyme Corporation Proteines antivirales du type ricin
WO1998018820A1 (fr) * 1996-10-28 1998-05-07 Medical University Of South Carolina Procedes et compositions relatifs a des immunotoxines de la proteine de fusion du ricin, pour le traitement du cancer et de maladies auto-immunes
KR19980043226A (ko) * 1996-12-02 1998-09-05 박영설 에어백이 장착된 뒷굽없는 신발밑창
EP2327724A2 (fr) 2004-02-02 2011-06-01 Ambrx, Inc. Polypeptides d'hormone de croissance humaine et leur utilisations
US9260472B2 (en) 2004-02-02 2016-02-16 Ambrx, Inc. Modified human four helical bundle polypeptides and their uses
US8907064B2 (en) 2004-02-02 2014-12-09 Ambrx, Inc. Modified human four helical bundle polypeptides and their uses
US8906676B2 (en) 2004-02-02 2014-12-09 Ambrx, Inc. Modified human four helical bundle polypeptides and their uses
US8232371B2 (en) 2004-02-02 2012-07-31 Ambrx, Inc. Modified human interferon polypeptides and their uses
US8097702B2 (en) 2004-02-02 2012-01-17 Ambrx, Inc. Modified human interferon polypeptides with at least one non-naturally encoded amino acid and their uses
US9175083B2 (en) 2004-06-18 2015-11-03 Ambrx, Inc. Antigen-binding polypeptides and their uses
EP2399893A2 (fr) 2004-12-22 2011-12-28 Ambrx, Inc. Compositions contenant des acides aminés et des polypeptides non naturels, procédés les impliquant et leurs utilisations
US7829310B2 (en) 2004-12-22 2010-11-09 Ambrx, Inc. Compositions of aminoacyl-tRNA synthetase and uses thereof
US7846689B2 (en) 2004-12-22 2010-12-07 Ambrx, Inc. Compositions of aminoacyl-tRNA synthetase and uses thereof
US7858344B2 (en) 2004-12-22 2010-12-28 Ambrx, Inc. Compositions of aminoacyl-tRNA synthetase and uses thereof
US7883866B2 (en) 2004-12-22 2011-02-08 Ambrx, Inc. Compositions of aminoacyl-tRNA synthetase and uses thereof
EP2284191A2 (fr) 2004-12-22 2011-02-16 Ambrx, Inc. Procédé de préparation de hGH
US7736872B2 (en) 2004-12-22 2010-06-15 Ambrx, Inc. Compositions of aminoacyl-TRNA synthetase and uses thereof
US7939496B2 (en) 2004-12-22 2011-05-10 Ambrx, Inc. Modified human growth horomone polypeptides and their uses
US7947473B2 (en) 2004-12-22 2011-05-24 Ambrx, Inc. Methods for expression and purification of pegylated recombinant human growth hormone containing a non-naturally encoded keto amino acid
US8143216B2 (en) 2004-12-22 2012-03-27 Ambrx, Inc. Modified human growth hormone
US7959926B2 (en) 2004-12-22 2011-06-14 Ambrx, Inc. Methods for expression and purification of recombinant human growth hormone mutants
US7838265B2 (en) 2004-12-22 2010-11-23 Ambrx, Inc. Compositions of aminoacyl-tRNA synthetase and uses thereof
US8178494B2 (en) 2004-12-22 2012-05-15 Ambrx, Inc. Modified human growth hormone formulations with an increased serum half-life
US8178108B2 (en) 2004-12-22 2012-05-15 Ambrx, Inc. Methods for expression and purification of recombinant human growth hormone
US8080391B2 (en) 2004-12-22 2011-12-20 Ambrx, Inc. Process of producing non-naturally encoded amino acid containing high conjugated to a water soluble polymer
US8163695B2 (en) 2004-12-22 2012-04-24 Ambrx Formulations of human growth hormone comprising a non-naturally encoded amino acid
WO2006069246A2 (fr) 2004-12-22 2006-06-29 Ambrx, Inc. Compositions contenant des acides amines non naturels et des polypeptides, procedes impliquant ces acides amines non naturels et polypeptides, et utilisations desdits acides amines non naturels et polypeptides
US7816320B2 (en) 2004-12-22 2010-10-19 Ambrx, Inc. Formulations of human growth hormone comprising a non-naturally encoded amino acid at position 35
US8093356B2 (en) 2005-06-03 2012-01-10 Ambrx, Inc. Pegylated human interferon polypeptides
US9488660B2 (en) 2005-11-16 2016-11-08 Ambrx, Inc. Methods and compositions comprising non-natural amino acids
US8053560B2 (en) 2006-09-08 2011-11-08 Ambrx, Inc. Modified human plasma polypeptide or Fc scaffolds and their uses
WO2008030558A2 (fr) 2006-09-08 2008-03-13 Ambrx, Inc. Polypeptide plasmatique humain modifié ou squelettes de fc et leurs utilisations
US8420792B2 (en) 2006-09-08 2013-04-16 Ambrx, Inc. Suppressor tRNA transcription in vertebrate cells
US8022186B2 (en) 2006-09-08 2011-09-20 Ambrx, Inc. Modified human plasma polypeptide or Fc scaffolds and their uses
US7919591B2 (en) 2006-09-08 2011-04-05 Ambrx, Inc. Modified human plasma polypeptide or Fc scaffolds and their uses
US9133495B2 (en) 2006-09-08 2015-09-15 Ambrx, Inc. Hybrid suppressor tRNA for vertebrate cells
US8618257B2 (en) 2006-09-08 2013-12-31 Ambrx, Inc. Modified human plasma polypeptide or Fc scaffolds and their uses
US8012931B2 (en) 2007-03-30 2011-09-06 Ambrx, Inc. Modified FGF-21 polypeptides and their uses
US9517273B2 (en) 2007-03-30 2016-12-13 Ambrx, Inc. Methods of treatment using modified FGF-21 polypeptides comprising non-naturally occurring amino acids
US8383365B2 (en) 2007-03-30 2013-02-26 Ambrx, Inc. Methods of making FGF-21 mutants comprising non-naturally encoded phenylalanine derivatives
US9975936B2 (en) 2007-03-30 2018-05-22 Ambrx, Inc. Nucleic acids encoding modified FGF-21 polypeptides comprising non-naturally occurring amino acids
US10961291B2 (en) 2007-03-30 2021-03-30 Ambrx, Inc. Modified FGF-21 polypeptides and their uses
US10377805B2 (en) 2007-03-30 2019-08-13 Ambrx, Inc. Modified FGF-21 polypeptides comprising non-naturally encoding amino acids and their uses
US11993637B2 (en) 2007-03-30 2024-05-28 Ambrx, Inc. Modified FGF-21 polypeptides with non-naturally encoded amino acids
US9079971B2 (en) 2007-03-30 2015-07-14 Ambrx, Inc. Modified FGF-21 polypeptides comprising non-naturally occurring amino acids
US8114630B2 (en) 2007-05-02 2012-02-14 Ambrx, Inc. Modified interferon beta polypeptides and their uses
US8946148B2 (en) 2007-11-20 2015-02-03 Ambrx, Inc. Modified insulin polypeptides and their uses
WO2009067636A2 (fr) 2007-11-20 2009-05-28 Ambrx, Inc. Polypeptides d'insuline modifiés et leurs utilisations
EP2930182A1 (fr) 2007-11-20 2015-10-14 Ambrx, Inc. Polypeptides d'insuline modifiés et utilisations de ceux-ci
EP3103880A1 (fr) 2008-02-08 2016-12-14 Ambrx, Inc. Polypeptides d'insuline modifiés et utilisations de ceux-ci
US9938333B2 (en) 2008-02-08 2018-04-10 Ambrx, Inc. Modified leptin polypeptides and their uses
WO2010011735A2 (fr) 2008-07-23 2010-01-28 Ambrx, Inc. Polypeptides g-csf bovins modifiés et leurs utilisations
EP3225248A1 (fr) 2008-07-23 2017-10-04 Ambrx, Inc. Polypeptides g-csf bovins modifiés et leurs utilisations
US10138283B2 (en) 2008-07-23 2018-11-27 Ambrx, Inc. Modified bovine G-CSF polypeptides and their uses
US9644014B2 (en) 2008-09-26 2017-05-09 Ambrx, Inc. Modified animal erythropoietin polypeptides and their uses
US8569233B2 (en) 2008-09-26 2013-10-29 Eli Lilly And Company Modified animal erythropoietin polypeptides and their uses
WO2010037062A1 (fr) 2008-09-26 2010-04-01 Ambrx, Inc. Vaccins et micro-organismes dépendant de la réplication d'acide aminé non naturels
US9156899B2 (en) 2008-09-26 2015-10-13 Eli Lilly And Company Modified animal erythropoietin polypeptides and their uses
US9121024B2 (en) 2008-09-26 2015-09-01 Ambrx, Inc. Non-natural amino acid replication-dependent microorganisms and vaccines
US10428333B2 (en) 2008-09-26 2019-10-01 Ambrx Inc. Non-natural amino acid replication-dependent microorganisms and vaccines
US8278418B2 (en) 2008-09-26 2012-10-02 Ambrx, Inc. Modified animal erythropoietin polypeptides and their uses
US9121025B2 (en) 2008-09-26 2015-09-01 Ambrx, Inc. Non-natural amino acid replication-dependent microorganisms and vaccines
EP3216800A1 (fr) 2008-09-26 2017-09-13 Ambrx, Inc. Polypeptides d'érythropoïétine animale modifiés et leurs utilisations
EP2805964A1 (fr) 2009-12-21 2014-11-26 Ambrx, Inc. Polypeptides modifiés de somatotrophine bovine et leurs utilisations
EP2805965A1 (fr) 2009-12-21 2014-11-26 Ambrx, Inc. Polypeptides modifiés de somatotrophine bovine et leurs utilisations
US10253083B2 (en) 2010-08-17 2019-04-09 Ambrx, Inc. Therapeutic uses of modified relaxin polypeptides
US8735539B2 (en) 2010-08-17 2014-05-27 Ambrx, Inc. Relaxin polypeptides comprising non-naturally encoded amino acids
US9962450B2 (en) 2010-08-17 2018-05-08 Ambrx, Inc. Method of treating heart failure with modified relaxin polypeptides
US11786578B2 (en) 2010-08-17 2023-10-17 Ambrx, Inc. Modified relaxin polypeptides and their uses
US9452222B2 (en) 2010-08-17 2016-09-27 Ambrx, Inc. Nucleic acids encoding modified relaxin polypeptides
US11439710B2 (en) 2010-08-17 2022-09-13 Ambrx, Inc. Nucleic acids encoding modified relaxin polypeptides
US11311605B2 (en) 2010-08-17 2022-04-26 Ambrx, Inc. Methods of treating heart failure and fibrotic disorders using modified relaxin polypeptides
US9567386B2 (en) 2010-08-17 2017-02-14 Ambrx, Inc. Therapeutic uses of modified relaxin polypeptides
US10702588B2 (en) 2010-08-17 2020-07-07 Ambrx, Inc. Modified relaxin polypeptides comprising a non-naturally encoded amino acid in the A chain
US10751391B2 (en) 2010-08-17 2020-08-25 Ambrx, Inc. Methods of treatment using modified relaxin polypeptides comprising a non-naturally encoded amino acid
WO2012024452A2 (fr) 2010-08-17 2012-02-23 Ambrx, Inc. Polypeptides de relaxine modifiés et leurs utilisations
US11273202B2 (en) 2010-09-23 2022-03-15 Elanco Us Inc. Formulations for bovine granulocyte colony stimulating factor and variants thereof
US11248031B2 (en) 2014-10-24 2022-02-15 Bristol-Myers Squibb Company Methods of treating diseases associated with fibrosis using modified FGF-21 polypeptides
US10377806B2 (en) 2014-10-24 2019-08-13 Bristol-Myers Squibb Company Methods of treating diseases associated with fibrosis using modified FGF-21 polypeptides and uses thereof
US9631004B2 (en) 2014-10-24 2017-04-25 Bristol-Myers Squibb Company Modified FGF-21 polypeptides comprising an internal deletion and uses thereof
US10189883B2 (en) 2014-10-24 2019-01-29 Bristol-Myers Squibb Company Therapeutic uses of modified FGF-21 polypeptides
US9434778B2 (en) 2014-10-24 2016-09-06 Bristol-Myers Squibb Company Modified FGF-21 polypeptides comprising an internal deletion and uses thereof
US11185570B2 (en) 2017-02-08 2021-11-30 Bristol-Myers Squibb Company Method of treating cardiovascular disease and heart failure with modified relaxin polypeptides
US11364281B2 (en) 2017-02-08 2022-06-21 Bristol-Myers Squibb Company Modified relaxin polypeptides comprising a pharmacokinetic enhancer and pharmaceutical compositions thereof
US10266578B2 (en) 2017-02-08 2019-04-23 Bristol-Myers Squibb Company Modified relaxin polypeptides comprising a pharmacokinetic enhancer and uses thereof

Also Published As

Publication number Publication date
AU2136788A (en) 1989-03-01
IL87193A0 (en) 1988-12-30

Similar Documents

Publication Publication Date Title
WO1989001037A1 (fr) Production de toxines de ricine dans un systeme d'expression de cellules d'insectes-baculovirus
US4879236A (en) Method for producing a recombinant baculovirus expression vector
Boublik et al. Eukaryotic virus display: engineering the major surface glycoprotein of the Autographa californica nuclear polyhedrosis virus (AcNPV) for the presentation of foreign proteins on the virus surface
EP1310558B1 (fr) Produits protéiniques stables bactéricides ou renforcant la perméabilité et compositions pharmaceutiques les contenant
Tessier et al. Enhanced secretion from insect cells of a foreign protein fused to the honeybee melittin signal peptide
KR910009203B1 (ko) 재조합 벡큘로비루스 형질발현 벡터의 제조방법
Maeda et al. Production of human α-interferon in silkworm using a baculovirus vector
AU615654B2 (en) Expression of human proapolipoprotein a-i
KR920001368B1 (ko) 재조합 벡큘로비루스 전이 벡터의 제조방법
EP0789776B1 (fr) Systeme de transfert de l'acide nucleique
AU754619B2 (en) Production of erythropoietin by endogenous gene activation
HUT50870A (en) Process for producing new recombinant and chimeric antibodies against human adenocarcinoma antigene
AU604001B2 (en) Novel vector comprising DNA sequences containing a part of polyhedral structural gene from Bombyx Mori nuclear polyhedrosis virus, and use of said vector to produce gene products by genetic engineering
JPH07507449A (ja) バチルススブチリス（Ｂａｃｉｌｌｕｓｓｕｂｔｉｌｉｓ）からのストレプトアビジンの産生
Van Leen et al. Production of human interleukin-3 using industrial microorganisms
EP0390252A2 (fr) Purification de l'interleukine-3 recombinante humaine
Kimura et al. Varicella-zoster virus glycoproteins E and I expressed in insect cells form a heterodimer that requires the N-terminal domain of glycoprotein I
Taylor et al. Carbohydrate-recognition domains as tools for rapid purification of recombinant eukaryotic proteins
US5629469A (en) Thiol protease inhibitor
WO1997023639A1 (fr) Procede de production de proteines fusionnees biologiquement actives
Blanc et al. Gene II product of an aphid-nontransmissible isolate of cauliflower mosaic virus expressed in a baculovirus system possesses aphid transmission factor activity
CA2137449A1 (fr) Entomopoxvirus recombinant
US7214532B2 (en) Methods for identifying human cell lines useful for endogenous gene activation, isolated human cell lines identified thereby, and uses thereof
FI97549C (fi) Menetelmä vierasproteiinien valmistamiseksi Streptomycessoluissa
JPH02502287A (ja) 改良されたリシン分子およびリシン毒素コンジュゲート

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU DK FI JP NO

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE FR GB IT LU NL SE