US4963665A - Human preproinsulin-like growth factor I - Google Patents

Human preproinsulin-like growth factor I Download PDF

Info

Publication number
US4963665A
US4963665A US06/929,671 US92967186A US4963665A US 4963665 A US4963665 A US 4963665A US 92967186 A US92967186 A US 92967186A US 4963665 A US4963665 A US 4963665A
Authority
US
United States
Prior art keywords
lys
arg
gly
thr
glu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US06/929,671
Other languages
English (en)
Inventor
Peter S. Rotwein
Gwen G. Krivi
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Washington University in St Louis WUSTL
Original Assignee
Washington University in St Louis WUSTL
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US06/929,671 priority Critical patent/US4963665A/en
Application filed by Washington University in St Louis WUSTL filed Critical Washington University in St Louis WUSTL
Priority to EP87870001A priority patent/EP0229750B1/en
Priority to DK004387A priority patent/DK4387A/da
Priority to JP62000969A priority patent/JPH0819158B2/ja
Priority to ES87870001T priority patent/ES2062993T3/es
Priority to NZ218811A priority patent/NZ218811A/xx
Priority to AT87870001T priority patent/ATE104345T1/de
Priority to CA000526772A priority patent/CA1340455C/en
Priority to IL8117587A priority patent/IL81175A/en
Priority to AR87306394A priority patent/AR246765A1/es
Priority to DE3789559T priority patent/DE3789559T2/de
Priority to KR1019870000030A priority patent/KR920005918B1/ko
Priority to AU67151/87A priority patent/AU588072B2/en
Assigned to WASHINGTON UNIVERSITY, A CORP. OF MO reassignment WASHINGTON UNIVERSITY, A CORP. OF MO ASSIGNMENT OF ASSIGNORS INTEREST. Assignors: KRIVI, GWEN G.
Assigned to WASHINGTON UNIVERSITY, A CORP. OF MO. reassignment WASHINGTON UNIVERSITY, A CORP. OF MO. ASSIGNMENT OF ASSIGNORS INTEREST. Assignors: ROTWEIN, PETER S.
Priority to US07/494,050 priority patent/US5070075A/en
Application granted granted Critical
Publication of US4963665A publication Critical patent/US4963665A/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575Hormones
    • C07K14/65Insulin-like growth factors, i.e. somatomedins, e.g. IGF-1, IGF-2
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • A61P15/14Drugs for genital or sexual disorders; Contraceptives for lactation disorders, e.g. galactorrhoea
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Definitions

  • the present invention relates to a novel insulin-like growth factor precursor protein and novel human preproinsulin-like growth factor I genes and DNA sequences.
  • IGF's Insulin-like growth factors
  • IGF insulin-like growth factors
  • proinsulin The designation "insulin-like growth factors” was chosen to express the insulin-like effects and insulin-like structure of these peptides.
  • IGF's share nearly 50% amino acid homology with insulin and in three dimensional structure resemble proinsulin.
  • the structures of IGF's are similar to proinsulin being a single chain peptide, cross-linked by three disulfide bridges and consisting of a B-chain-like amino-terminal part (B domain), a connecting peptide (C domain), and an A-chain-like part (A domain).
  • B domain B-chain-like amino-terminal part
  • C domain connecting peptide
  • a domain A-chain-like part
  • D domain a carboxyl-terminal extension not found in proinsulin is present (D domain).
  • IGF-I Single-chain peptides
  • Somatomedin C IGF-II
  • Somatomedin A Somatomedin A
  • MSA multiplication-stimulating activity
  • This heterologous group of peptides exhibit important growth-promoting effects in vitro, Daughaday (1977); Clemmons and Van Wyk (1981a), and in vivo, van Buul-Offers and Van den Brande (1980), Schoenle et al. (1982).
  • IGF-I insulin growth factor
  • IGF-II insulin growth factor-II
  • a high degree of homology and/or cross-reactivity has been shown by radioimmunoassay and/or radioreceptor assay to exist among IGF-I's and among IGF-II's from different species. Wilson and Hintz (1982).
  • Circulating levels of these peptides appear to be under the control of growth hormone to a greater or lesser extent with IGF-I being controlled to a greater extent than IGF-II.
  • IGF-I for example, plays a fundamental role in postnatal mammalian growth as a major mediator of growth hormone action. See Copeland et al. (1980) and Schoenle et al. (1982).
  • Vassilopoulou-Sellin and Phillips (1982) have estimated, using molecular sieve chromatography, that IGF-I activity, assayed both in vitro and in vivo, extracted from rat liver has a higher molecular weight (approximately 30 kilodaltons) than activity extracted from plasma (approximately 8 kilodaltons).
  • the authors suggested that the higher molecular weight material may represent an IGF-I precursor.
  • metabolic regulation of the higher molecular weight rat liver IGF-I was similar to rat serum-derived IGF-I.
  • Zumstein et al. (1985) isolated a variant pro-form of IGF-II from human serum which they demonstrated to contain IGF-II-like activity in vitro.
  • precursor IGF-I proteins in the treatment and/or potentiation of various growth conditions, the amino acid sequence and DNA coding sequence of such a precursor protein has long been sought.
  • Jansen et al. (1983) provided an amino acid sequence derived from a human IGF-I cDNA clone which supports the suggestion of a larger IGF-I precursor. See also Netherlands Patent Application No. 8302324, published Jan. 16, 1985. The cDNA disclosed by Jansen, however, did not provide sufficient DNA sequence information to teach the precise translational start of the suggested precursor protein. Additionally, Jansen et al. (1983) and Netherlands Patent Application No. 8302324 provide no evidence or teaching that the cDNA sequence is or can be expressed (e. g., that the suggested precursor protein is produced).
  • IGF-I biosynthesis has been hampered by a very low IGF-I content in tissue, Vasilopoulou-Sellin and Phillips (1982) and because, in contrast to IGF-II, no cultured cell lines have been identified which elaborate significant quantities of this peptide. Clemmons and Van Wyk (1981b); Clemmons and Shaw (1983). Additionally, neither the complete human IGF-I gene has been isolated nor the complete DNA sequence determined.
  • IGF-I gene would greatly facilitate studies of IGF-I biosynthesis and provide a means for identifying and producing precursor, mature and/or intermediate IGF-I species and allelic variants thereof.
  • a genomic clone thus facilitates determining which proteins are believed to be active growth promoting peptides.
  • an object of this invention to provide a highly purified gene and/or synthetic DNA sequences encoding an IGF-I precursor protein (preproinsulin-like growth factor-I), and/or peptide fragments thereof and useful in making such a protein and/or fragments.
  • IGF-I precursor protein preproinsulin-like growth factor-I
  • peptide fragments thereof useful in making such a protein and/or fragments.
  • Another object of this invention is to provide the amino acid sequence of a novel preproinsulin-like growth factor-I and methods using such a protein or fragments thereof to promote desirable growth or functionality of cells in animals.
  • the present invention relates to the discovery of a novel preproinsulin-like growth factor-I (ppIGF-I) protein, an essentially pure human IGF-I gene and synthetic DNA sequences which encode the novel ppIGF-I protein.
  • ppIGF-I preproinsulin-like growth factor-I
  • the present invention provides an essentially pure IGF-I gene encoding at least two ppIGF-I proteins and containing the sequence of nucleotides (or their functional equivalents for protein expression) as given in FIG. 4.
  • the invention provides synthetic DNA sequences encoding a novel ppIGF-I protein.
  • One such synthetic DNA sequence contains the sequence of nucleotides (or their functional equivalents for protein expression) as given in FIG. 2.
  • the present invention provides an essentially pure DNA sequence encoding a carboxyl-terminal extension of the novel ppIGF-I protein.
  • One such essentially pure DNA sequence contains the following sequence of nucleotides (or their functional equivalents for peptide expression): 5'TATCAGCCCCCATCTACCAACAAGAACACGAAGTCTCAGAGAAGGAAAGGTT GGCCAAAGACACATCCAGGAGGGGAACAGAAGGAGGGGACAGAAGCAAGTCTGC AGATCAGAGGAAAGAAGAAAGCAGAGGAGGGAGATTGGAAGTAGAAATGCTGAA TGCAGAGGCAAAAAAAAGGAAAATGA3'
  • the invention provides a novel ppIGF-I protein having the amino acid sequence as given in FIG. 6.
  • the present invention provides a novel extension peptide having the following amino acid sequence:
  • This extension peptide represents a carboxyl-terminal extension portion of the novel ppIGF-I protein.
  • the invention provides various methods for promoting growth and/or other desirable functions of cells in animals by administering the novel proteins and/or peptides of this invention to animals in amounts sufficient to cause such effects.
  • the present invention provides methods for producing the essentially pure proteins of this invention by causing expression of the gene and/or synthetic DNA sequences provided herein.
  • amino acid sequences are provided reading from the amino terminus (NH 2 ) to the carboxy terminus (COOH) of the sequence.
  • the DNA sequences are provided in a 5' to 3' orientation. Relevant restriction endonuclease sites are also shown.
  • the DNA regions marked as described below are for purposes of diagrammatic representation only and are not drawn to scale unless otherwise noted.
  • the numbering of the DNA sequences from 5' to 3' and of the amino acid sequences from the amino terminus to carboxy terminus is for diagrammatic purposes only.
  • FIG. 1 depicts a map of a human IGF-1B cDNA clone.
  • the horizontal directional arrows denote the approach to DNA sequencing of the cDNA: the open box denotes the 585 base open reading frame and wherein the cross hatched box denotes the DNA sequence encoding the mature human IGF-I peptide; the thin lines denote the 5' and 3' untranslated regions of the 1136 nucleotide cDNA.
  • Below the map of the human IGF-1B cDNA are representative cDNA clones denoted ⁇ IGF-2 and ⁇ IGF-5.
  • the "A 42 " on the ⁇ IGF-5 clone denotes a poly A coding sequence consisting of 42 adenosine (A) bases.
  • FIG. 2 depicts the DNA sequence of the IGF-1B cDNA clone (1136 nucleotides) and a translation of the 585 base open reading frame starting at nucleotide 183 (e. g. ppIGF-1B amino acid sequence.) Termination codons are denoted by ### and ***.
  • the broken underlined region denotes the nucleotides encoding the mature human IGF-I peptide (nucleotide 327 through nucleotide 536) and attendant amino acid sequence of mature human IGF-I.
  • the solid underlined region denotes the nucleotides encoding the IGF-1B carboxyl-terminal extension peptide and attendant amino acid sequence of said extension peptide.
  • FIG. 3(a) depicts the structure and restriction map of the human IGF-I gene.
  • the 5' to 3'directional arrow indicates the 5' to 3' orientation of the IGF-I gene.
  • the thin lines denote introns and flanking regions; the ⁇ denotes a region of an intron not isolated by molecular cloning; the solid boxes (1, 2, 3, 4, 5) denote coding regions and the cross-hatched boxes denote non-coding regions of the mRNA; the vertical arrows under exons 4 and 5 denote the polyadenylation sites.
  • the regions marked "Alu” denote hybridization to middle repetitive DNA of the Alu type.
  • Below the restriction map are representative genomic clones.
  • (b) depicts detailed restriction maps of IGF-I exons 1 to 5.
  • the horizontal directional arrows denote DNA sequencing strategy; the boxes denote exons wherein the solid regions denote coding regions and the crosshatched regions denote noncoding regions of the mRNA.
  • the vertical arrows under exons 4 and 5 denote the polyadenylation sites.
  • FIG. 4 depicts the DNA sequence of the human IGF-I gene. Exons are in upper case and introns and flanking DNA are in lower case. Translation of the ppIGF-I proteins (e.g. amino acid sequence of ppIGF-1A and ppIGF-1B) are indicated and carboxyl-terminal extensions of the ppIGF-1A and ppIGF-1B are denoted by solid overlines labeled 1A and 1B, respectively. The 70 amino acids of mature IGF-I are denoted by a broken underline. In frame translation termination codons, TGA and TAA, preceding the translation initiation start-signal codon, ATG, are denoted by ***. A putative transcription start site is denoted by ⁇ .
  • TGA and TAA preceding the translation initiation start-signal codon, ATG
  • Polyadenylation signals AATAAA and AATATA are denoted by a solid overline and are followed by poly A addition sites, denoted “poly A ⁇ ", in exons 4 and 5, respectively.
  • the dotted line denotes unsequenced regions the lengths of which are marked thereon in kb (kilobases).
  • FIG. 5 depicts a comparison of the IGF-1A and IGF-1B cDNA sequences.
  • the top line represents IGF-1B.
  • the bottom line represents IGF-1A.
  • the terminal (5' and 3') nucleotides are denoted by an "X”.
  • FIG. 6 depicts the amino acid sequence of the ppIGF-1B protein.
  • amino acids e.g. Ala for alanine
  • nucleotides G,C,A,T
  • gene refers to a region of chromosomal DNA which region contains DNA sequences encoding a given protein.
  • eucaryotic genes contain both introns and exons.
  • exon refers to those gene (e.g. DNA) sequences which are transcribed into RNA.
  • a given exon can, therefore, comprise both protein encoding (coding) and non-coding DNA sequences wherein both the coding and non-coding DNA sequences are transcribed into RNA but only the coding sequences are translated into protein.
  • intron refers to a DNA sequence present in a given gene which is neither transcribed nor translated and is generally found between exons (hence the name "intron”).
  • essentially pure when used herein, to describe a protein, peptide, nucleic acid (DNA or RNA) sequence, gene and/or molecule, means substantially free from proteins, peptides, nucleic acid sequences, genes and/or molecules with which the described protein, peptide, nucleic acid sequence, gene and/or molecule is associated in its natural (e.g. in vivo) state.
  • synthetic when used herein to describe a protein or peptide means a protein or peptide produced by a technique (e.g. chemical or enzymatic synthesis or recombinant DNA expression) other than its natural production in an animal.
  • synthetic proteins or peptides are typically essentially pure (e.g. free from proteins or peptides of natural origin).
  • synthetic means that such DNA sequences or molecules have been made by any technique other than their natural replication in vivo.
  • any DNA sequence of this invention can be prepared by various "synthetic" techniques known to those skilled in the art such as, but not limited to, automated DNA synthesizing equipment, other chemical synthesis procedures, enzymatic isolation, cDNA synthesis or cloning techniques.
  • extension peptide or, alternatively, “extension peptide” as used herein means a peptide encoded in the DNA sequences down stream (3') to the DNA sequence encoding mature IGF-I.
  • one extension peptide of the present invention has the following amino acid sequence:
  • a second extension peptide consists of the underlined amino acids in the above sequence. This second extension peptide is encoded in the novel IGF-I exon 4 of the present invention. These extension peptides are believed to possess and/or confer, to proteins encoded in the IGF-I gene, an enhanced biological activity.
  • references to the proteins of this invention by their respective amino acid sequences embraces various amino acid substitutions, additions and/or deletions so long as the activity of the protein is substantially maintained.
  • the essentially pure and synthetic DNA sequences and genes identified by the present invention are understood to embrace various nucleotide sequence variations such as nucleotide deletions, substitutions, inversions, additions, allelic variations and/or functional equivalents for expression of protein(s) encoded therein so long as the activity of the protein(s) encoded therein is substantially maintained.
  • Such amino acid and nucleotide sequence variations are well known to those of skill in the art and can be created by such conventional techniques as de novo chemical synthesis, enzymatic manipulations and recombinant DNA techniques. It is anticipated, for example, that alterations of the specific DNA sequences and/or genes of the present invention can be made in accordance with known genetic code degeneracies to meet the codon and/or expression preferences of specific host cells or organisms employed to synthesize protein(s) of the present invention.
  • IGF-1B cDNA a novel IGF-I specific cDNA, designated herein as IGF-1B cDNA, was identified and isolated.
  • the nucleotide sequence of this IGF-1B cDNA was determined to be as shown in FIG. 2.
  • Further DNA sequence analysis of the IGF-1B cDNA revealed a 585 nucleotide open reading frame (nucleotides 183 to 767, FIG. 2) which encodes a novel 195 amino acid preproinsulin-like growth factor-1 protein designated herein as ppIGF-1B.
  • the amino acid sequence of the novel ppIGF-1B is as shown in FIG. 6. As described more fully below and shown in FIG.
  • the novel IGF-1B cDNA was demonstrated to be useful in producing ppIGF-1B in vitro and is anticipated to provide a synthetic DNA sequence useful for production of ppIGF-1B, or any portion thereof, in suitable host cells (i.e. bacterial, yeast, mammalian or plant) by conventional recombinant DNA techniques and genetic engineering. It is also anticipated that in selected mammalian cells, the synthetic IGF-1B DNA sequence may be useful in producing mature IGF-I as a result of cellular or post-production processing of the ppIGF-1B to mature IGF-I.
  • the IGF-1B cDNA was isolated from a cDNA library constructed from human liver messenger RNA (mRNA).
  • mRNA human liver messenger RNA
  • the cDNA library was constructed and screened for clones containing IGF-I cDNA in accordance with the methods described by Kwok et al. (1985) and Gubler and Hoffman (1983).
  • the liver is believed to be the major site of IGF production, many other tissues, for example fetal tissues and fibroblasts are believed to synthesize IGF's as well. Thus, such other tissues may alternatively be employed to construct a human cDNA library.
  • an oligonucleotide probe corresponding to a mature IGF-I coding sequence was employed to screen the human cDNA library for the presence analysis of clones containing IGF-I specific cDNA sequences.
  • the probe comprised a 42 nucleotide molecule (42 mer) corresponding to the DNA sequence encoding amino acids 10 through 23 (see amino acids 58-70 in FIG. 6) of mature, human IGF-I.
  • Such a probe can be used to isolate genomic, cDNA and/or RNA sequences encoding all or a portion of mature IGF-I. Any other region of the mature IGF-I DNA coding sequence may alternatively be employed. Additionally, the length (e.g.
  • oligonucleotide probe may vary depending upon the stringency of the hybridization conditions employed. Typically, such an oligonucleotide probe should consist of at least 13 or 14 nucleotides sharing homology with the DNA or RNA sequence(s) sought to be identified.
  • the screening of a cDNA library with a probe directed to mature IGF-I allows for the identification of potentially all IGF-I messenger RNAs (mRNAs) actively expressed in the tissue from which the cDNA library was constructed.
  • mRNAs messenger RNAs
  • the translation of such mRNAs can include, but are not limited to mature IGF-I, IGF-I precursors which contain at least a portion of the mature IGF-I protein, and any other proteins containing at least a portion of the mature IGF-I protein at the mRNA level of said proteins' biosynthesis.
  • the preferred embodiment employed a cDNA analysis of IGF-I gene products, one may alternatively screen cellular mRNA by Northern Blot analysis in accordance with methodologies known to those skilled in the art to identify IGF-I--specific mRNAs. See Thomas, P. S. (1980).
  • IGF-I specific DNA sequences were then isolated and cleaved with various restriction endonucleases to determine both the size and regions of the IGF-I specific cDNA inserts contained therein.
  • Any restriction enzymes may be employed, see Maniatis et al. (1982).
  • IGF-I cDNA inserts ranging from about 800 to about 1150 nucleotide pairs in size were identified and isolated.
  • the subsequent restriction mapping of these DNA inserts unexpectedly revealed that the isolated inserts were of two types, designated herein as IGF-1A cDNA (IGF-1A) and IGF-1B cDNA (IGF-1B), respectively.
  • the IGF-1B cDNA is a novel and distinct, synthetic IGF-I DNA sequence which encodes a ppIGF-I protein, referred to as ppIGF-1B.
  • the IGF-1A cDNA was determined to be equivalent to the cDNA sequence isolated by Jansen et al. (1983).
  • both the IGF-I cDNA's (-1A and -1B) isolated by the methods of the present invention contained additional 5'-end sequences which now enable an accurate determination of all possible translational starts of the precursor protein(s) (ppIGF-I) encoded therein.
  • ATG's translation start-signal codons
  • the novel 5' IGF-1B cDNA sequences of the present invention also indicate the presence of two in-frame translation termination codons (denoted ### and ***) upstream from (5' to) and in-frame with the second ATG codon beginning at nucleotide 183 thereby suggesting that nucleotides 183 to 185 represent the first operable translation start-signal codon (ATG) for the ppIGF-I protein(s). Indeed, as shown more fully in the examples below, nucleotides 183 to 185 do, in fact, constitute an operable translation start-signal codon (ATG) for the ppIGF-I proteins encoded in both the IGF-1A and -1B synthetic DNA sequences.
  • ATG operable translation start-signal codon
  • the IGF-I gene and synthetic DNA sequences provided by the present invention represent the first such delineation of the operable translation start-signal codons for both the newly discovered IGF-1B encoded ppIGF-I protein (ppIGF-1B) and for the IGF-I precursor protein proposed by Jansen et al. (1983). Furthermore, the identification of the translational start for the ppIGF-I protein(s) now enables quantitative and qualitative production of synthetic ppIGF-I protein(s) by such conventional means as chemical, enzymatic and/or recombinant DNA methodologies.
  • ppIGF-I proteins of the present invention can be effectively produced by causing expression of the ppIGF-I cDNAs, identified and isolated herein, in an in vitro cell lysate expression system.
  • ppIGF-1A and -1B proteins and/or fragments thereof can be produced by recombinant DNA (rDNA) techniques.
  • rDNA recombinant DNA
  • Recombinant DNA production methodologies would involve the cloning, by conventional techniques, of at least the protein coding sequences (e.g. at least nucleotides 183 to about 767, FIG. 2, for IGF-1B) into cellular (bacterial, yeast, mammalian and/or plant) expression vectors, available to those of skill in the art, and subsequent production (e.g.
  • the proteins so produced can then be isolated by conventional techniques.
  • the DNA sequence information and synthetic DNA sequences containing all or part of the IGF-1A and IGF-1B cDNA's can be employed to produce essentially pure mature IGF-I, ppIGF-I (e.g. ppIGF-1B) and/or an extension peptide.
  • DNA sequences and genes of the present invention enable those skilled in the art to more effectively study and/or manipulate mature IGF-I biosynthesis and biological regulation. Furthermore, all or portions of the IGF-I gene or DNA sequences of the present invention can be employed to identify equivalent DNA molecules, RNA molecules, gene(s) and/or allelic variations thereof in human and other species (i.e. bovine, porcine and/or avian) wherein sufficient homology in such DNA and/or RNA sequences exists.
  • RNA molecules embraced by the present invention include the 1.7, 3.7 and 6.3 kb (kilobase) polyadenylated IGF-I RNAs identified by hybridization with the IGF-1B cDNA and/or a synthetic DNA encoding the novel extension peptide.
  • the degree of homology necessary to identify such DNA and/or RNA sequences or molecules is well known to those skilled in the art and may, for example, vary depending upon the stringency of the hybridization conditions employed and/or relative sizes of the genes or nucleic acid sequences and probe employed.
  • the (IGF-1A) cDNA of Jansen et al. (1983) was determined to maintain an identity (e.g. precise homology) with the novel IGF-1B for 413 nucleotides, except for one nucleotide difference in the Jansen et al. (1983) cDNA sequence, that difference being a conservative third position change in a glycine codon (nucleotide 452 of the IGF-1B sequence). Such position changes in a given codon may result from and/or exemplify allelic variation.
  • allelic variations as they may occur in the IGF-1B DNA sequences of the present invention are considered to represent equivalents of the IGF-I gene and DNA sequences provided herein.
  • the IGF-1A and IGF-1B DNA's then diverge. Specifically, when analyzed in terms of protein sequence, shown in FIG. 2, the point of divergence follows a lysine residue 16 amino acids after the mature IGF-I region. As described more fully below, the point of divergence corresponds to an exon-intron junction present in the IGF-I gene structure shown in FIG. 3.
  • the IGF-1A cDNA sequence encodes an additional 19 amino acids past the point of the IGF-1A and -1B divergence and thereby encodes a ppIGF-I protein which may be as long as 153 amino acids in length, hereinafter referred to as ppIGF-1A.
  • the IGF-1B cDNA sequence contains an additional 61 amino acids past the point of the IGF-1A and -1B divergence and thereby encodes a ppIGF-I protein which may be as large as about 195 amino acids in length, referred to as ppIGF-1B.
  • the two carboxyl-terminal extensions consisting essentially of the 19 amino acids of IGF- 1A and 61 amino acids of IGF-1B, respectively, show no amino acid homology with each other. Additionally, neither carboxyl-terminal extension peptide showed homology with any other protein in the National Biomedical Research Foundation Protein Sequence Data Bank. Dayhoff et al. (1983) and Wilbur and Lipman (1983).
  • a novel human IGF-I gene was identified and isolated. Unlike the gene identified by Bell et al. (1985), the IGF-I gene of this invention contains 5 exons and encodes at least two ppIGF-I proteins.
  • the gene structure and DNA sequence of the novel IGF-I gene is shown in FIGS. 3 and 4, respectively. While exons 1, 2, 3 and 5 as shown in FIG. 3 were structurally identified by Bell et al. (1985), the complete DNA sequences of these exons were not provided. These sequences are essential for determining the number and amino acid composition(s) of possible ppIGF-I protein(s) encoded in the IGF-I gene. Furthermore, the sequence information is essential for subsequent employment of the gene or portions thereof (e.g. specific exons or intron-exon combinations) in in vitro or in vivo protein production systems.
  • IGF-I gene related proteins and mature IGF-I proteins in, for example, mammalian systems, it may be desirable to employ an essentially pure IGF-I gene, or portions (e.g. exons) thereof. Specifically, it may be desirable to employ IGF-I specific DNA sequences comprising intron and exon regions. Alternatively, employment of essentially intron-free DNA sequences derived from the IGF-I gene provided herein may be desirably employed to produce ppIGF-I proteins or extension peptides. For these reasons and for purpose of positioning the novel DNA sequences of the present invention within the IGF-I gene sequence, we isolated and cloned IGF-I gene sequences.
  • two genomic libraries were screened for IGF-I gene inserts employing IGF-1A and -1B cDNA's or fragments thereof.
  • IGF-1A and -1B cDNA's or fragments thereof we identified five exons whereas only 4 exons had previously been reported. See Bell et al. (1985).
  • the newly discovered exon 4 (see FIGS. 3 and 4) was determined to encode a carboxyl-terminal extension of ppIGF-1B whereas exon 5 encodes a carboxyl-terminal extension of ppIGF-1A.
  • Exon 1 encodes at least 21 amino acids which may comprise a leader peptide enabling secretion of IGF-I.
  • IGF-I is known to be secreted by the cells producing it hence the term "preproinsulin-like growth factor-I" (ppIGF-I) to denote an IGF-I precursor protein.
  • Exon 2 is about 157 nucleotides in length and encodes 52 amino acids and is identical in DNA sequence to an IGF-I exon reported by Ullrich et al. (1984). The initial 27 amino acid residues encoded in exon 2 precede the start of the mature IGF-I B domain and contain two methionine residues which may serve as additional translation start signals. Exon 2 also encodes the beginning 25 amino acids of the B domain of mature IGF-I.
  • Codon 26 was found to be interrupted by a large intron of at least 21 kb.
  • the remainder of the genetic information coding for the mature IGF-I protein resides in exon 3.
  • exon 3 contains 11 nucleotides encoding the rest of the B domain, 12 codons encoding the C domain, 21 codons encoding the A domain and 8 codons encoding the D domain.
  • exon 3 codes for 16 additional amino acids which may represent a newly described E domain and/or a portion of the carboxyl-terminal extension of pIGF-1A and pIGF-1B.
  • the "carboxyl-terminal extension proteins” or “extension peptides” of the present invention can comprise a combination of the last 16 amino acids encoded in exon 3 (e.g. NH 2 --Arg Ser Val Arg Ala Gln Arg His Thr Asp Met Pro Lys Thr Gln Lys--COOH) and the peptide encoded in exon 4.
  • Exons 4 and 5 were found to each encode distinct extension peptides, translation termination codons, 3' nontranslated regions, poly A addition (e.g. adenylation) signals and sites.
  • Exon 4 located 1.5 kb 3' to exon 3 consists of 515 nucleotides and comprises the 3'-end (e.g. carboxyl-terminus) of the IGF-1B coding sequence.
  • the extension peptide encoded in exon 4 comprises a highly basic 61 amino acid peptide with several dibasic an tribasic residues. Based upon analogies with other biosynthetic pathways employing precursor protein intermediates (e.g.
  • these dibasic and tribasic residues may provide for the enzymatic processing of the ppIGF-I protein(s) encoded in the gene or genes of the present invention into, for example, a mature IGF-I protein. Additionally or alternatively these residues may facilitate binding to such negatively charged macromolecules as DNA.
  • these residues may facilitate binding to such negatively charged macromolecules as DNA.
  • Exon 5 located 17 kb downstream (3') from exon 3 is 344 bases long, encodes the 3'-end of the IGF-1A coding sequence and contains a TAG translation termination codon and 284 bases of 3' nontranslated DNA. Additionally, all intron-exon borders contain consensus RNA splicing sequences indicating that any combination of exons may exist within a mRNA molecule and, hence, be translated into an IGF-I gene related protein.
  • genes and DNA sequences provided herein now allow the production, in vitro, by such techniques as recombinant DNA and chemical synthesis, and the detection, in vivo, of proteins comprising a single exon encoded protein and/or any combination of exon encoded proteins.
  • proteins are believed to be biologically active and, specifically, to possess IGF-I-like activity.
  • the attendant biological activities maybe ascertained by those skilled in the art employing in vitro and/or in vivo assays, see Daughaday (1977); Clemmons and Van Wyk (1981a); van Buul-Offers and Van de Brande (1980); Schoenle et al. (1982); and Hylka et al. (1985).
  • the isolation, restriction map and determination of the IGF-I gene structure and sequence is significant as it now provides an opportunity to localize DNA polymorphisms detected by, for example, chromosomal restriction endonuclease analysis. Indeed, we have localized the site polymorphisms for restriction endonucleases Hind III and Pvu II to be linked to one another and to map to exon 5 of the genomic IGF-I gene. Such polymorphisms are useful in establishing familial genetic linkages and have been employed diagnostically for various diseases. Additionally, such IGF-I gene polymorphisms may be employed diagnostically for growth-affected conditions. Furthermore, such polymorphisms are considered to constitute equivalents of the gene sequences provided herein.
  • the present invention further contemplates that the essentially pure IGF-I gene of the present invention or portions (e.g. exons) thereof may now be employed to generate, de novo, and/or amplify, in vivo, IGF-I gene related proteins including but not limited to ppIGF-I proteins, mature IGF-I proteins, variants thereof and/or biosynthetic intermediates thereof.
  • the present invention is directed to a novel ppIGF-I protein (ppIGF-1B) having an amino acid sequence as shown in FIG. 6.
  • ppIGF-1B novel ppIGF-I protein
  • the present invention is directed to novel extension peptides exemplified by a peptide having the amino acid sequence as shown for the extension peptide of mature human IGF-I depicted both above and in claim 4. Based upon the sequences provided herein, these proteins and equivalents thereof can now be made by such conventional means as chemical synthesis, in vitro enzymatic synthesis, rDNA techniques and/or isolation from human tissue.
  • novel DNA sequences and genes provided by the present invention now enable those skilled in the art to identify, isolate and/or produce ppIGF-I proteins and/or biologically active fragments thereof including, but not limited to, mature IGF-I and extension peptides.
  • the biological activity of these proteins may include, but is not limited to, the growth promoting activit(ies) of mature IGF-I and can, therefore, be ascertained in accordance with the in vitro and in vivo assays known to those skilled in the art.
  • IGF-I has been shown to stimulate cell proliferation, skeletal growth, weight gain and mammary gland growth, the latter being a prerequisite for enhanced milk production. It is anticipated that the novel ppIGF-1B protein described herein shares all or some of such growth promoting activities and can exhibit enhanced activity in selected tissue.
  • IGF-I gene related proteins are understood to comprise proteins wherein at least a portion of said protein(s) is encoded in the gene and/or synthetic DNA sequences of the present invention and/or allelic variations thereof.
  • the amino acid sequences of the ppIGF-I e.g. ppIGF-1A and ppIGF-1B proteins and extension peptides thereof were deduced from the DNA sequences of their respective cDNAs and from the novel IGF-I gene provided by the present invention.
  • the ppIGF-1B protein was determined to have the amino acid sequence as given in FIG. 6.
  • the ppIGF-I proteins were identified by employing in vitro systems which provided for expression of the IGF-1A and -1B cDNAs.
  • expression as used herein when referring to a gene or synthetic DNA sequence means transcription of a given gene or DNA sequence into mRNA followed by translation of the mRNA into protein.
  • the proteins so produced can thereafter be isolated by such conventional techniques as polyacrylamide gel electrophoresis, affinity chromatography, ion-exchange, reverse phase HPLC, immuno-precipitation or any other conventional fractionation technique and then sequenced.
  • ppIGF-1B protein and a 153 amino acid ppIGF-1A protein can be produced in vitro, that these proteins corresponded to their respective amino acid sequences deduced from their respective cDNA sequences identified herein and that the first in-frame methionine codon [e.g. base pairs 183-185 for IGF-1B (see FIG.2)] is the major translation start-signal codon for both ppIGF-I proteins.
  • RNA molecules ranging from about 900 to about 1350 nucleotides in length which hybridized to all of the aforementioned probes. These results confirm the active transcription of DNA encoding both the IGF-1A and -1B DNA sequences in vivo. Furthermore, we identified three additional polyadenylated RNAs (mRNAs) approximately 1.7, 3.7 and 6.3 kilobases (kb), respectively, in length. While applicants do not wish to be bound by the following theory of mechanism, we believe that these larger mRNAs represent forms of ppIGF-I precursor mRNAs or mRNAs encoding IGF-I gene related proteins (e.g.
  • IGF-I gene of the present invention elaborates multiple proteins represents a means by which IGF-I biosynthesis and/or maturation may be regulated and/or a means by which IGF-I gene related proteins may be regulated and/or synthesized.
  • IGF-I is required primarily to support linear growth, the levels of gene expression may vary during growth and development and/or may vary in different tissues depending upon the growth requirements of said tissue(s).
  • the ppIGF-I proteins may provide a point of regulation for mature IGF-I production and/or IGF-I gene related protein production during these growth stages and/or in a tissue specific manner.
  • ppIGF-I proteins of the present invention are made in vivo. Although yields are expected to be low, relative to commercially desirable yields, it is anticipated that based upon the DNA and amino acid sequences provided herein, essentially pure ppIGF-I proteins may be isolated from tissue (i.e. fibroblasts, blood, liver, etc.) and/or cells therefrom. Such essentially pure proteins are considered to be part of the present invention.
  • RNA splicing may provide a point of regulation for IGF-I gene expression as has been suggested for other genes, Rosenfeld et al. (1983), in which different combinations of exons function in different tissues. Such possible exon combinations are considered to be embraced by the present invention.
  • the present invention also contemplates that the genes and DNA sequences provided herein may be employed to generate and/or aid in the isolation of said IGF-I gene related proteins. While the present invention describes a specific ppIGF-1B amino acid sequence encoded in such genes and DNA sequences, it is anticipated that alternative open reading frames and thus alternative protein (e.g. amino acid sequences) may be encoded in the gene and DNA sequences provided herein. Such proteins are herein considered to be among the IGF-I gene related proteins provided for by the novel genes and DNA sequences provided herein.
  • the novel ppIGF-I and extension peptides of the present invention are useful for administration to animals for promoting growth, increasing milk production and/or the lean-to-fat ratio or muscle content in animals.
  • one or more proteins or peptides of this invention can be combined with a non-toxic, physiologically acceptable carrier (liquid or solid) to form a composition which can be administered to animals by any suitable technique, e.g. intravenously, subcutaneously, intramuscularly, intranasally, or orally in a form that protects the proteins or peptides from degradation in the digestive tract.
  • compositions can be administered to the animal by injection, infusion or implantation, preferably in a medium (e.g. dispersion in oil or a polymer) which facilitates delivery of the peptide to target cells of the animal at a desired rate.
  • a medium e.g. dispersion in oil or a polymer
  • One such method for administration to an animal is intramammary infusion of the protein or peptide in a vehicle suitable for achieving adequate dispersion in mammary tissue as taught in more detail in copending U.S. Pat. application, Ser. No. 837,477, filed Mar. 7, 1986.
  • the disclosure of said application is incorporated herein by reference.
  • the proportions of carrier and biologically active peptide in such compositions can be any that facilitate the desired effects in animals. Preferred proportions can be readily determined by those skilled in the art.
  • An effective dose of the ppIGF-1B protein and/or extension peptide(s) is from about 60 micrograms ( ⁇ g) to about 6 milligrams (mg) per kilogram (Kg) of animal body weight administered daily for a treatment period of from about one to about three weeks.
  • a more preferred dose is from about 400 ⁇ g to about 800 ⁇ g per Kg per day.
  • a therapeutically effective concentration is defined as a concentration of the particular protein or peptide which provides a satisfactory stimulation in the desired cellular growth and/or functionality.
  • the most preferred amount or dosage most effective for achieving a desired result can be determined by routine experimentation. The preferred dosage may depend on such variables as the size, general health and nutritional status of the specific animal.
  • Bioactive peptides of this invention can be used in an essentially pure form, i.e., free from other proteins or peptides (of whatever origin) having a significant effect on the bioactivity of the proteins or peptide(s) of this invention. This is not essential, however, as in many utilities proteins or peptides of this invention can be used satisfactorily (in many cases, even advantageously) in mixtures or other combinations with different proteins or peptides, e.g. other animal growth factors such as bovine (or other animal) IGF-I, EGF or TGF- ⁇ (alpha-transforming growth factor).
  • other animal growth factors such as bovine (or other animal) IGF-I, EGF or TGF- ⁇ (alpha-transforming growth factor).
  • All enzymes including restriction enconucleases, T 4 DNA ligase, T 4 polynucleotide kinase, DNA polymerase, ribonuclease A, DNA modifying enzymes, wheat germ lysates, rabbit reticulocyte lysates, unlabelled amino acids and proteinase K were purchased from New England Biolabs (Beverly, Mass.) and Bethesda Research Laboratories (BRL) (Gaithersburg, Md.) and used in accordance with manufacturer's specifications. Nitrocellulose filters were obtained from Scheicher and Schuell (Keene, N.H.) and Millipore (Bedford, Mass.).
  • Radionuclides and radiolabelled amino acids were purchased from New England Nuclear (Boston, Mass.) and Amersham (Arlington Heights, Ill.).
  • Deoxyribonucleoside triphosphate, ribonucleoside triphosphates and dideoxyribonucleoside triphosphates were purchased from Pharmacia-PL Biochemicals (Piscataway, N.J.).
  • a 42 base oligonucleotide corresponding to the DNA sequence encoding amino acids 10 to 23 of mature human IGF-I was synthesized in the Department of Biological Sciences, Monsanto Company (St. Louis, Mo.) employing an Applied Biosystems DNA Synthesizer in accordance with the procedure set forth by the manufacturer. Applied Biosystems, Inc. (Foster City, Calif.). The sequence of the 42 mer was as follows:
  • the 42 mer was labeled at the 5' end by using gamma 32 P adenosine triphosphate and T 4 polynucleotide kinase in accordance with the procedure set forth by Maniatis et al. (1982) to achieve a specific activity of about 10 7 dpm per picomole.
  • the radiolabeled 42 mer was then employed to screen for IGF-I containing DNA sequences in a human liver cDNA library made in accordance with the procedures set forth by Kwok, S. C. M. et al. (1985) and Gubler and Hoffman (1983).
  • the human liver cDNA library in lambda gtll was obtained from Drs. S. L. C. Woo and T.
  • Lambda gtll may also be obtained from the American Type Culture Collection (ATCC) (Rockville, Md.) under ATCC accession number 37194 and a human cDNA liver library prepared therein in accordance with the procedure described by Kwok, S. C. M. et al. (1985).
  • E. coli K12 strain Y1088 may be obtained from ATCC under ATCC accession number 37195.
  • the plasmids pGEM1 and pGEM2 were obtained from Promega Biotech (Madison, Wis.).
  • the following example demonstrates the isolation of IGF-1A and IGF-1B cDNA's from a human liver cDNA library.
  • the human liver cDNA library in lambda gt11 was screened as follows. Lambda gt11 was plated on E. coli K12 strain Y1088 in accordance with the method described by Young and Davis (1983). Duplicate nitrocellulose filters were prepared in accordance with the procedure described by Woo, S. L. C. (1979) and hybridized at 42° C.
  • plaques of the human liver cDNA library were screened as just described with the IGF-I-specific 42 mer probe leading to the isolation of 7 positive plaques with DNA inserts ranging from about 800 to about 1150 nucleotide pairs.
  • restriction mapping with EcoRI, BamHI and PstI the cDNA's were found to be of two types. Two of the 7 positive plaques containing inserts of approximately 800 to 850 nucleotide pairs contained internal Bam HI restriction endonuclease sites and were found to correspond to the IGF-I cDNA reported by Jansen et al. (1983). These inserts were designated IGF-1A cDNA.
  • the remaining 5 positive clones shared a restriction endonuclease map that differed from the map of the IGF-1A cDNA. These 5 clones were designated IGF-1B cDNA. The largest two inserts, shown as ⁇ IGF-2 and ⁇ IGF-5 in FIG. 1 were then selected for DNA sequence analysis.
  • DNA sequencing was performed by the dideoxy chain terminating method described by Sanger et al. (1977) and Biggin et al. (1983) after subcloning restriction fragments into M13mp18 and M13mp19 bacteriophage as described by Norrander et al. (1983).
  • the sequencing strategy is shown in FIG. 1.
  • the DNA sequences of the two IGF-1B cDNA isolates were determined in their entirety on both strands and across all restriction enzyme sites used as initiation points except for the extreme 3'-end of one clone ⁇ IGF-5 (see FIG. 3), which was sequenced three times in only one orientation.
  • the DNA sequence and amino acid translation appear in FIG. 2.
  • the aggregate IGF-1B cDNA consists of 1136 nucleotides including 42 deoxyadenosine residues of the poly A tract.
  • the size of the IGF-1B cDNA agrees with the size of the major mRNA (900 to 1350 nucleotides) determined by filter hybridization, described more fully below.
  • the sequence can be divided into three sections: a 5' untranslated region comprising the initial 182 nucleotides; an initiation codon and an open reading frame of about 585 nucleotides (195 codons) followed by an opal (TGA) termination codon; and a 3' untranslated region of about 368 nucleotides ending in a poly A tract.
  • the 585 nucleotide open reading frame begins with the second in phase ATG codon.
  • the first ATG at nucleotides 84 to 86 is followed immediately by an in frame opal terminator.
  • the open reading frame shown in FIG. 2 encodes a ppIGF-I of about 195 amino acids with a molecular weight of about 21,841 daltons assuming that the ATG codon at bases 183 to 185 initiates protein synthesis.
  • the mature IGF-I protein sequence is encoded by nucleotides 327 to 536 denoted by the crosshatched area in FIG. 1 and underlined in FIG. 2.
  • the 70 mature IGF-I codons are followed by a unique and novel carboxyl-terminal extension of 77 amino acids.
  • the first 16 amino acids of this carboxyl-terminal extension are identical to the first 16 amino acids of the IGF-1A carboxyl-terminal extension, the remaining 61 amino acids are unique as determined by lack of homology with the IGF-1A carboxyl-terminal extension or with any other protein in the National Biomedical Research Foundation Protein Sequence Data Bank. Dayhoff et al. (1983) and Wilbur and Lipman (1983).
  • RNA molecules encoding these proteins were identified by identifying messenger RNA molecules encoding these proteins. Specifically, liver polyadenylated RNA was isolated from tissue fresh-frozen at -70° C. by extraction with guanidinium thiocyanate in accordance with the procedure described by Chirgwin et al. (1979) and one round of chromatography on oligo dT cellulose are described by Aviv and Leder (1972).
  • the polyadenylated RNA was denatured with glyoxal as described by McMaster and Carmichael (1977), electrophoresed through a 1.25% (w/v) agarose gel and transferred to a nitrocellulose filter by blotting in accordance with the procedure described by Thomas (1980).
  • Complete IGF-1A and 1B cDNA's or DNA's encoding either, the IGF-1A or -1B carboxyl-terminal extensions were all individually labeled with 32 P by nick translation as described by Rigby et al. (1977) to 8-12 ⁇ 1O 8 dpm per microgram and hybridized to the filters at 42° C.
  • IGF-1A and -1B cDNA's hybridized to RNA transcripts in human liver.
  • Hybridization of either the unique carboxy-terminal extension of IGF-1A or -1B cDNA shows a major band of approximately 900 to about 1350 nucleotides. Other larger bands were seen at 1.7, 3.7 and 6.3 kilobases potentially, respectively, processed precursor mRNA's or alternatively other IGF-I gene related mRNA's.
  • Parallel experiments using entire IGF-1A and -1B cDNA's yielded similar results.
  • This example demonstrates the isolation and mapping of the human IGF-I genomic gene.
  • a human genomic library was prepared using a hybrid vector, ⁇ MG14, Helms et al. (1985), and size-fractionated human leukocyte DNA, partially digested with MboI as described by Maniatis et al. (1982). Genomic libraries may be prepared as described by Maniatis et al. (1982). Approximately 4 ⁇ 10 5 plaques from this library and another derived from human fetal liver, described by Lawn et al. (1978), were screened in accordance with the methods described by Maniatis et al. (1982) using 32 P-labeled IGF-I cDNA's, prepared by nicked translation as described by Rigby et al. (1977), as hybridization probes.
  • DNA from plaque-purified positive isolates Helms et al. (1985) was mapped using Bam HI, Eco RI and Hind III single and double digestions by hybridization to 32 P IGF-I cDNA's and human Alu probes, prepared as described by Schmid and Jelinek (1982). From 15 genomic clones containing IGF-I exons, 8 were selected for further analysis consisting of restriction endonuclease mapping and Southern blotting. The eight clones selected and genomic DNA regions contained therein are shown in FIG. 3(a) and are marked ⁇ IGF- followed by a number.
  • FIG. 3(a) presents a restriction map of the isolated genomic IGF-I gene.
  • Five regions of the isolated DNA hybridized to the cDNA probes and were designated exons 1-5, shown as the numbered boxes in FIG. 3(a).
  • Exons 1, 2, 3 and 5 comprise IGF-1A mRNA (e.g. DNA encoding ppIGF-1A), and exons 1, 2, 3 and 4 comprise IGF-1B mRNA (e.g. DNA encoding ppIGF-1B). From the beginning of exon 1 to the end of exon 5, the gene extends for more than 45 kilobases (kb).
  • the incompletely characterized DNA region between exons 2 and 3 was determined to represent an intron as that sequence interrupts an asparagine codon in the B domain of mature IGF-I and, thus, cannot contain an additional exon.
  • FIG. 3(a) within the genomic IGF-I gene are five regions which hybridize strongly to middle repetitive DNA of the Alu type, Schmid and Jelinek (1982). These Alu type sequences map to intervening and flanking DNA sequences. Schmid and Jelinek (1982).
  • Subclones containing each exon were prepared in pUC18 and pUC19 plasmids in accordance with the procedures described by Norrander et al. (1983) for further restriction mapping, and in M13mp18 and M13mp19 in accordance with the procedures described by Norrander et al. (1983), for DNA sequencing.
  • M13mp18, M13mp19, pUC18 and pUC19 may be obtained from New England Biolabs (Beverly, Mass.).
  • the DNA sequence analysis was performed in accordance with the procedures described by Sanger et al. (1977) and Biggin et al. (1983) using dideoxy chain-terminating inhibitors, 35 S-dATP and both standard and denaturing gel electrophoresis.
  • the DNA sequencing strategy employed is diagramed in FIG. 3(b).
  • Initial DNA sequencing of exons 3 and 4 was obtained after preparing a series of overlapping deletions using Bal 31 exonuclease, described by Poncz et al. (1982), as indicated by the solid circles in the sequencing scheme shown in FIG. 3(b). All other sequence analysis was initiated at specific restriction endonuclease sites as depicted by the short vertical lines in FIG. 3(b). The arrows indicate the extent of sequence determined. Except for 100 nucleotides of the intron preceding exon 2 and a portion of exon 4, all sequences presented in FIG. 4 were verified from both DNA strands, including all restriction endonuclease sites used as initiation points. All exon-intron splice junctions and polyadenylation sites were determined by comparison with IGF-1A and IGF-1B cDNA sequences.
  • Southern blot analysis was conducted briefly as follows. Ten micrograms of DNA from human leukocytes, Maniatis et al. (1982), were digested with various restriction enzymes Hind III, Pvu II, Eco RI, Bam HI and Bgl II and then electrophoresed through 0.8% (w/v) agarose gels at 20-25 volts in buffer containing 0.089 M Tris-borate, 0.089 M boric acid and 0.001M Na 2 EDTA. DNA fragments were transferred to nitrocellulose filters by blotting in accordance with the procedure described by Southern (1975).
  • the complete genomic IGF-I gene sequence is presented In FIG. 4.
  • the region of exon 4 sequenced in one orientation agrees completely with the corresponding cDNA sequence encoding the carboxyl-terminal extension peptide of ppIGF-1B.
  • the DNA sequence of exon 5 agrees completely with the corresponding cDNA sequence encoding the C-terminal extension peptide of ppIGF-1A.
  • the 5'-end of the ppIGF-I mRNA was found to extend 583 nucleotides upstream of the prime annealing site at position 1108, FIG. 4. If the 5' untranslated region of the gene does not contain an intron, transcription must begin at position 525 or 526, FIG. 4. If an intron is contained within the 5' untranslated region, transcription would most likely begin further upstream (5') to positions 525 or 526.
  • FIG. 2 extends 182 nucleotides 5' to the translation initiation codon and contains several upstream in-phase translation termination codons as denoted in FIG. 4.
  • a region of 42 nucleotides further 5' at positions 199 to 241, FIG. 4, in the sequence contains alternating purine and pyrimidine residues with the potential to form Z DNA, indicative of actively transcribed DNA. Nordheim and Rich (1983).
  • This example demonstrates the expression in vitro of IGF-1A and IGF-1B precursor peptides and demonstrates the ability of the first in-frame methionine (ATG) codon to signal the start of ppIGF-I translation.
  • human IGF-1A and IGF-1B cDNAs were separately ligated to the plasmids pGEM1 and pGEM2 to create recombinant plasmids containing an IGF-I cDNA with its 5'- end adjacent to the bacteriophage T 7 promoter contained within the pGEM plasmids.
  • the IGF-1A cDNA was ligated to a PGEM1 plasmid previously digested with EcoRI.
  • the correct orientation of the IGF-1A cDNA in the recombinant plasmid was verified by restriction endonuclease analysis employing BamHI.
  • Recombinant pGEM2 plasmids containing IGF-1B cDNA were constructed by ligating a RsaI digested IGF-1B cDNA containing an EcoRI linker at its 3'-end to a pGEM2 plasmid previously double digested with EcoRI and HincII. The correct orientation of the IGF-1B cDNA with respect to the T 7 promoter in the recombinant plasmid was verified by digest with PstI.
  • each plasmid was linearized at the 3' end of the respective IGF-1 DNA sequences using enzymes HindIII and EcoRI, respectively.
  • Complementary RNAs designated IGF-1A cRNA and IGF-1B cRNA, were prepared by transcription in vitro using T 7 RNA polymerase (Davanloo et al., 1984), according to the method of Melton et al. (1984). In order to increase the efficiency of subsequence translation, each RNA was co-transcriptionally ⁇ capped ⁇ , following the procedure of Hart et al. (1985).
  • IGF-1A and IGF-1 B cRNAs were translated in vitro using both wheat germ and rabbit reticulocyte lysates (Pelham and Jackson, 1976), in the presence of 35 S-methionine or 3 H-leucine and the 19 remaining complement of unlabelled amino acids, with equivalent results.
  • the primary translation products were assessed by polyacrylamide gel electrophoresis (Laemmli, 1970), in 12% (w/v) or 15% (w/v) acrylamide, followed by autoradiography.
  • the experimentally determined primary IGF-1A translation product demonstrated a mobility of approximately 17,000 daltons, in excellent agreement with the predicted molecular weight of the 153 amino acid precursor, 17,026 daltons.
  • IGF-1A was thus synthesized as a 153 amino acid precursor.
  • IGF-1B was produced as a 195 amino acid molecule corresponding to the protein encoded in the synthetic DNA and essentially pure IGF-I gene of the present invention.
  • Tricoli J. V., Rall, L. B., Scott, J., Bell, G. I., and Shows, J. B. (1984) Nature (London) 310:784-786.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Endocrinology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Wood Science & Technology (AREA)
  • Veterinary Medicine (AREA)
  • General Engineering & Computer Science (AREA)
  • Diabetes (AREA)
  • Toxicology (AREA)
  • Public Health (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biotechnology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Gynecology & Obstetrics (AREA)
  • Reproductive Health (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Pregnancy & Childbirth (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
US06/929,671 1986-01-07 1986-11-20 Human preproinsulin-like growth factor I Expired - Lifetime US4963665A (en)

Priority Applications (14)

Application Number Priority Date Filing Date Title
US06/929,671 US4963665A (en) 1986-01-07 1986-11-20 Human preproinsulin-like growth factor I
DE3789559T DE3789559T2 (de) 1986-01-07 1987-01-06 Menschlicher präproinsulinähnlicher Wachstumsfaktor I.
JP62000969A JPH0819158B2 (ja) 1986-01-07 1987-01-06 ヒト−プレプロインスリン様成長因子▲i▼
ES87870001T ES2062993T3 (es) 1986-01-07 1987-01-06 Factor de crecimiento humano i semejante a la preproinsulina.
NZ218811A NZ218811A (en) 1986-01-07 1987-01-06 Insulin-like growth factor-i proteins and dna sequences
AT87870001T ATE104345T1 (de) 1986-01-07 1987-01-06 Menschlicher praeproinsulinaehnlicher wachstumsfaktor i.
CA000526772A CA1340455C (en) 1986-01-07 1987-01-06 Human preproinsulin-like growth factor i
IL8117587A IL81175A (en) 1986-01-07 1987-01-06 Human growth factor I similar to pre-pro-insulin, DNA sequences encoding for its use
EP87870001A EP0229750B1 (en) 1986-01-07 1987-01-06 Human preproinsulin-like growth factor I
DK004387A DK4387A (da) 1986-01-07 1987-01-06 Human-praepo-insulinlignende-vaekstfaktor i samt gener og syntetiske dna-sekvenser, som koder for denne
KR1019870000030A KR920005918B1 (ko) 1986-01-07 1987-01-06 인간 푸리푸로 인슐린-양성장 인자 i
AU67151/87A AU588072B2 (en) 1986-01-07 1987-01-06 Human preproinsulin-like growth factor i
AR87306394A AR246765A1 (es) 1986-01-07 1987-01-06 Novedosos genes y secuencias de adn del factor i del crecimiento del tipo de la preproinsulina humana.
US07/494,050 US5070075A (en) 1986-01-07 1990-03-15 Human preproinsulin-like growth factor I

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US81666286A 1986-01-07 1986-01-07
US06/929,671 US4963665A (en) 1986-01-07 1986-11-20 Human preproinsulin-like growth factor I

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US81666286A Continuation-In-Part 1986-01-07 1986-01-07

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US07/494,050 Division US5070075A (en) 1986-01-07 1990-03-15 Human preproinsulin-like growth factor I

Publications (1)

Publication Number Publication Date
US4963665A true US4963665A (en) 1990-10-16

Family

ID=27124101

Family Applications (1)

Application Number Title Priority Date Filing Date
US06/929,671 Expired - Lifetime US4963665A (en) 1986-01-07 1986-11-20 Human preproinsulin-like growth factor I

Country Status (12)

Country Link
US (1) US4963665A (xx)
EP (1) EP0229750B1 (xx)
JP (1) JPH0819158B2 (xx)
KR (1) KR920005918B1 (xx)
AR (1) AR246765A1 (xx)
AU (1) AU588072B2 (xx)
CA (1) CA1340455C (xx)
DE (1) DE3789559T2 (xx)
DK (1) DK4387A (xx)
ES (1) ES2062993T3 (xx)
IL (1) IL81175A (xx)
NZ (1) NZ218811A (xx)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5070075A (en) * 1986-01-07 1991-12-03 Washington University Human preproinsulin-like growth factor I
US5231178A (en) * 1991-01-16 1993-07-27 The Salk Institute Biotechnology/Industrial Associates, Inc. Method for the purification of intact, correctly-folded insulin-like growth factor-1
US5258287A (en) * 1988-03-22 1993-11-02 Genentech, Inc. DNA encoding and methods of production of insulin-like growth factor binding protein BP53
US5521086A (en) * 1993-09-16 1996-05-28 Cephalon, Inc. Secretion sequence for the production of a heterologous protein in yeast
US5612198A (en) * 1990-09-04 1997-03-18 The Salk Institute Production of insulin-like growth factor-1 in methylotrophic yeast cells
US5643867A (en) * 1992-08-26 1997-07-01 Celtrix Pharmaceuticals, Inc. Method for treating catabolic conditions
US6033875A (en) * 1994-09-08 2000-03-07 Chiron Corporation Method of improved production of insulin-like growth factor
WO2001072959A3 (en) * 2000-03-01 2002-05-10 Univ Auburn Plastid transformation vectors for expressing human proteins in plants
US20030204864A1 (en) * 2001-02-28 2003-10-30 Henry Daniell Pharmaceutical proteins, human therapeutics, human serum albumin, insulin, native cholera toxic b submitted on transgenic plastids
EP1616574A1 (en) 1997-07-24 2006-01-18 The Brigham And Women's Hospital, Inc. Receptor specific transepithelial transport of therapeutics
US7741536B2 (en) 1997-08-07 2010-06-22 University Of Central Florida Research Foundation, Inc. Expression of human serum albumin in plastids
US9657302B2 (en) 1998-05-15 2017-05-23 The Trustees Of The University Of Pennsylvania Expression of human interferon in transgenic chloroplasts

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4885163A (en) * 1987-02-24 1989-12-05 Eli Lilly And Company Topical use of IGF-II for wound healing
US4876242A (en) * 1987-09-21 1989-10-24 Merck & Co., Inc. Human insulin-like growth factor analoges with reduced binding to serum carrier proteins and their production in yeast
SE9002731D0 (sv) * 1990-08-24 1990-08-24 Kabivitrum Ab Product comprising growth factor
SE9201573D0 (sv) * 1992-05-19 1992-05-19 Kabi Pharmacia Ab Use of igf-1
SE9402370D0 (sv) 1994-07-04 1994-07-04 Pharmacia Ab Use of IGF-I
GB9605124D0 (en) 1996-03-11 1996-05-08 Royal Free Hosp School Med Method of treating muscular disorders
AU2000239309A1 (en) * 2000-03-29 2001-10-08 Dgi Biotechnologies Llc Insulin and igf-1 receptor agonists and antagonists
GB0011278D0 (en) 2000-05-10 2000-06-28 Univ London Repair of nerve damage
US7326417B2 (en) 2001-09-11 2008-02-05 Merial Ltd. IGF-1 as feline vaccine adjuvant, in particular against feline retroviruses
FR2829498B1 (fr) * 2001-09-11 2003-11-28 Merial Sas Igf-1 comme adjuvant de vaccin felin, notamment contre les retrovirus felins
GB0202906D0 (en) 2002-02-07 2002-03-27 Univ London Prevention of myocardial damage

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK58285D0 (da) * 1984-05-30 1985-02-08 Novo Industri As Peptider samt fremstilling og anvendelse deraf
DE3581528D1 (de) * 1984-07-13 1991-02-28 Chiron Corp Insulinaehnlicher wachstumsfaktor ii.
JPH0720993B2 (ja) * 1985-08-22 1995-03-08 グロペップ プロプライエタリー リミテッド 生長因子
US4783524A (en) * 1985-09-17 1988-11-08 Monsanto Company Growth factors
AU607209B2 (en) * 1987-04-23 1991-02-28 Monsanto Technology Llc Secretion of insulin-like growth factor-i in e. coli

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
Bell et al., 1985 (Oct.), PNAS 82:6450 6454. *
Bell et al., 1985 (Oct.), PNAS 82:6450-6454.
Ernst Rinderknecht and Rene E. Humbel, J. Biol. Chem., 253:2769 (1978). *
Jansen et al., 1983, Nature, 306:609 611. *
Jansen et al., 1983, Nature, 306:609-611.
Rotwein et al., 1986, J. Biol. Chem., 261:4828 4832. *
Rotwein et al., 1986, J. Biol. Chem., 261:4828-4832.
Rotwein, 1986, PNAS, 83:77 81. *
Rotwein, 1986, PNAS, 83:77-81.

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5070075A (en) * 1986-01-07 1991-12-03 Washington University Human preproinsulin-like growth factor I
US5258287A (en) * 1988-03-22 1993-11-02 Genentech, Inc. DNA encoding and methods of production of insulin-like growth factor binding protein BP53
US5328891A (en) * 1988-03-22 1994-07-12 Genentech, Inc. Insulin-like growth factor binding protein and pharmaceutical compositions
US5612198A (en) * 1990-09-04 1997-03-18 The Salk Institute Production of insulin-like growth factor-1 in methylotrophic yeast cells
US5231178A (en) * 1991-01-16 1993-07-27 The Salk Institute Biotechnology/Industrial Associates, Inc. Method for the purification of intact, correctly-folded insulin-like growth factor-1
US5643867A (en) * 1992-08-26 1997-07-01 Celtrix Pharmaceuticals, Inc. Method for treating catabolic conditions
US5521086A (en) * 1993-09-16 1996-05-28 Cephalon, Inc. Secretion sequence for the production of a heterologous protein in yeast
US6033875A (en) * 1994-09-08 2000-03-07 Chiron Corporation Method of improved production of insulin-like growth factor
EP1616574A1 (en) 1997-07-24 2006-01-18 The Brigham And Women's Hospital, Inc. Receptor specific transepithelial transport of therapeutics
US7741536B2 (en) 1997-08-07 2010-06-22 University Of Central Florida Research Foundation, Inc. Expression of human serum albumin in plastids
US9657302B2 (en) 1998-05-15 2017-05-23 The Trustees Of The University Of Pennsylvania Expression of human interferon in transgenic chloroplasts
WO2001072959A3 (en) * 2000-03-01 2002-05-10 Univ Auburn Plastid transformation vectors for expressing human proteins in plants
US20060117412A1 (en) * 2000-03-01 2006-06-01 Henry Daniell Pharmaceutical proteins, human therapeutics, human serum albumin insulin, native cholera toxic B submitted on transgenic plastids
US20030204864A1 (en) * 2001-02-28 2003-10-30 Henry Daniell Pharmaceutical proteins, human therapeutics, human serum albumin, insulin, native cholera toxic b submitted on transgenic plastids

Also Published As

Publication number Publication date
NZ218811A (en) 1991-07-26
JPS62228285A (ja) 1987-10-07
AU6715187A (en) 1987-07-09
KR920005918B1 (ko) 1992-07-24
EP0229750A3 (en) 1989-10-25
EP0229750A2 (en) 1987-07-22
AR246765A1 (es) 1994-09-30
CA1340455C (en) 1999-03-23
DK4387A (da) 1987-09-18
EP0229750B1 (en) 1994-04-13
DE3789559T2 (de) 1994-10-13
JPH0819158B2 (ja) 1996-02-28
KR880006362A (ko) 1988-07-22
DK4387D0 (da) 1987-01-06
DE3789559D1 (de) 1994-05-19
IL81175A0 (en) 1987-08-31
AU588072B2 (en) 1989-09-07
ES2062993T3 (es) 1995-01-01
IL81175A (en) 1994-08-26

Similar Documents

Publication Publication Date Title
US4963665A (en) Human preproinsulin-like growth factor I
BURNSIDE et al. Molecular cloning of the chicken growth hormone receptor complementary deoxyribonucleic acid: mutation of the gene in sex-linked dwarf chickens
Duckworth et al. Isolation and identification of a cDNA clone of rat placental lactogen II.
Mason et al. Structure of two human ovarian inhibins
Heinrich et al. Gene encoding parathyroid hormone. Nucleotide sequence of the rat gene and deduced amino acid sequence of rat preproparathyroid hormone.
Radovick et al. Isolation and characterization of the human gonadotropin-releasing hormone gene in the hypothalamus and placenta
Hudson et al. Relaxin gene expression in human ovaries and the predicted structure of a human preprorelaxin by analysis of cDNA clones.
Cooke et al. Two distinct species of human growth hormone-variant mRNA in the human placenta predict the expression of novel growth hormone proteins.
AU634517B2 (en) Somatotropin analogs
JP2757982B2 (ja) 卵胞刺激ホルモン
Karathanasis et al. Structure, evolution, and tissue-specific synthesis of human apolipoprotein AIV
IE68889B1 (en) Recombinant techniques for production of novel natriuretic and vasodilator peptides
Nicoll et al. The primary structure of coho salmon growth hormone and its cDNA
JPH0341096A (ja) インシュリン様成長因子類の結合蛋白
Watahiki et al. Primary structure of chicken pituitary prolactin deduced from the cDNA sequence: conserved and specific amino acid residues in the domains of the prolactins
US5268359A (en) Human tachykinins and their precursor
US5599792A (en) Bone-stimulating, non-vasoactive parathyroid hormone variants
Kessler et al. A subfamily of bovine prolactin-related transcripts distinct from placental lactogen in the fetal placenta
US5070075A (en) Human preproinsulin-like growth factor I
US5605815A (en) Nucleic acids encoding and expression of parathyroid hormone-like peptide
US4725549A (en) Human and rat prolactin and preprolactin cloned genes
HU197939B (en) Process for producing deoxyribonucleic acid, or its precursor, determining human growth hormone releasing factor
US5631227A (en) Somatotropin analogs
US6277592B1 (en) Porcine leptin protein, nucleic acid sequences coding therefor and uses thereof
US6692941B1 (en) Bovine growth hormone

Legal Events

Date Code Title Description
AS Assignment

Owner name: WASHINGTON UNIVERSITY, A CORP. OF MO.

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST.;ASSIGNOR:ROTWEIN, PETER S.;REEL/FRAME:004709/0499

Effective date: 19870326

Owner name: WASHINGTON UNIVERSITY, A CORP. OF MO

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST.;ASSIGNOR:KRIVI, GWEN G.;REEL/FRAME:004709/0553

Effective date: 19870318

STCF Information on status: patent grant

Free format text: PATENTED CASE

CC Certificate of correction
FEPP Fee payment procedure

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

FPAY Fee payment

Year of fee payment: 4

FPAY Fee payment

Year of fee payment: 8

FPAY Fee payment

Year of fee payment: 12

REMI Maintenance fee reminder mailed