US20240002540A1 - Bispecific antibody and use thereof - Google Patents

Bispecific antibody and use thereof Download PDF

Info

Publication number
US20240002540A1
US20240002540A1 US18/038,159 US202118038159A US2024002540A1 US 20240002540 A1 US20240002540 A1 US 20240002540A1 US 202118038159 A US202118038159 A US 202118038159A US 2024002540 A1 US2024002540 A1 US 2024002540A1
Authority
US
United States
Prior art keywords
antigen
seq
binding portion
amino acid
light chain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
US18/038,159
Other languages
English (en)
Inventor
Bo Chen
Gang Xu
Changyu Wang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Keymed Biosciences Co Ltd
Original Assignee
Keymed Biosciences Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Keymed Biosciences Co Ltd filed Critical Keymed Biosciences Co Ltd
Assigned to KEYMED BIOSCIENCES CO.,LTD reassignment KEYMED BIOSCIENCES CO.,LTD ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CHEN, BO, WANG, CHANGYU, XU, GANG
Publication of US20240002540A1 publication Critical patent/US20240002540A1/en
Pending legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2809Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against the T-cell receptor (TcR)-CD3 complex
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/46Hybrid immunoglobulins
    • C07K16/468Immunoglobulins having two or more different antigen binding sites, e.g. multifunctional antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2887Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against CD20
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • A61K39/001102Receptors, cell surface antigens or cell surface determinants
    • A61K39/001124CD20
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • A61K40/4214Receptors for cytokines
    • A61K40/4215Receptors for tumor necrosis factors [TNF], e.g. lymphotoxin receptor [LTR], CD30
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • A61K40/4221CD20
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4261Proteoglycans, e.g. glypican, brevican or CSPG4
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6801Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
    • A61K47/6803Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6849Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a receptor, a cell surface antigen or a cell surface determinant
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K51/00Preparations containing radioactive substances for use in therapy or testing in vivo
    • A61K51/02Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus
    • A61K51/04Organic compounds
    • A61K51/08Peptides, e.g. proteins, carriers being peptides, polyamino acids, proteins
    • A61K51/10Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody
    • A61K51/1027Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody against receptors, cell-surface antigens or cell-surface determinants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2878Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/303Liver or Pancreas
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/545Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/31Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the route of administration
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/38Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the dose, timing or administration schedule
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/46Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
    • A61K2239/48Blood cells, e.g. leukemia or lymphoma
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/46Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
    • A61K2239/53Liver
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/31Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/33Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/51Complete heavy chain or Fd fragment, i.e. VH + CH1
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/515Complete light chain, i.e. VL + CL
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52Constant or Fc region; Isotype
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55Fab or Fab'
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/66Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising a swap of domains, e.g. CH3-CH2, VH-CL or VL-CH1
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value

Definitions

  • the present disclosure relates to a bispecific antibody and use thereof, particularly a bispecific antibody that binds CD3 and another antigen, and use thereof.
  • a T-cell bispecific antibody is a specific antibody molecule, through which recognizes a target cell surface antigen (antigen arm) at one end and binds to a T-cell CD3 receptor (CD3 arm) at the other end, CD3 on T-cells may be aggregated in a manner similar to TCR/peptide/HLA, thereby activating T-cells and killing tumors.
  • tumor cells were killed by using bispecific antibodies (Staerz U D., Nature. 1985 Apr. 18-24; 314(6012):628-31; Perez P. et al. Nature. 1985 Jul. 25-31; 316(6026):354-6).
  • bispecific antibody drugs have been successively approved for marketing.
  • these bispecific antibodies show very good therapeutic effects in approved indications, the concomitant side effects and limitations in use preclude widespread applications of these bispecific antibodies in the early days.
  • early-marketed catumaxomab has been withdrawn from the market, because the Fc fragment binds to Fc ⁇ receptor expressed by liver Kupffer cells, which triggers a rapid cytokine release.
  • the biological half-life is only 2 hours, it requires a low-dose continuous intravenous infusion, and is approved by FDA together with a black-box warning on cytokine release syndrome and neurological toxicities.
  • TCR is binded with low affinity (about 1-100 ⁇ M) to foreign peptide-human leukocyte antigen complexes (HLA) on infected or mutated cells
  • HLA foreign peptide-human leukocyte antigen complexes
  • an activation signal is transduced into the nucleus via CD3 signaling complexes (including CD3 ⁇ , CD3 ⁇ and CD3 ⁇ ), activating the expression of transcription factors and their downstream proteins (cytokines, granzymes, perform, etc.), wherein the signal intensity generated by the TCR complexes will determine the fate of T-cells.
  • the early developed CD3 bispecific antibodies mostly based on a small number of murine antibodies such as OKT3, L2K, UCHT1, TR66 and the like, have high affinity, leading to excessive activation of T-cells and release of a large number of cytokines and resulting in cytokine storm syndrome.
  • the high affinity also leads to the enrichment of bispecific antibodies in secondary lymphoid organs, and reduces the exposure to tumor tissue.
  • Fc portion of the antibody to Fc ⁇ receptor is another important factor affecting drug safety. Since Fc ⁇ receptor is expressed in various normal tissues, after the bi-specific antibody binds to Fc ⁇ receptor on cell membrane through Fc, it can result in cross-linking activation of CD3 receptor bound at the other end due to Fc ⁇ receptor aggregation, thereby resulting in severe off-target toxicity.
  • Fc ⁇ receptor is expressed in various normal tissues, after the bi-specific antibody binds to Fc ⁇ receptor on cell membrane through Fc, it can result in cross-linking activation of CD3 receptor bound at the other end due to Fc ⁇ receptor aggregation, thereby resulting in severe off-target toxicity.
  • a human IgG2 subtype or IgG4 subtype which has a weak Fc ⁇ receptor binding ability or further performing amino acid substitutions at the corresponding positions in CH2, for example: positions 233-236 (EU sequence numbering) of IgG1 and IgG4 are substituted with the corresponding sequence of IgG2 by Armour
  • the inventor has unexpectedly discovered that, by combining a humanized anti-CD3 antibody having a ⁇ light chain with a targeting antibody having a ⁇ light chain, the ⁇ light chain of the anti-CD3 antibody is more likely to pair with a heavy chain of a homologous CD3, while the kappa light chain of the targeting antibody is more likely to pair with a heavy chain of a homologous targeting antibody.
  • the efficiency of correct pairing can be improved.
  • the novel T-cell connector constructed by using antibodies having multiple targets such as CD20, BCMA and GPC3, and humanized anti-CD3 antibody may achieve a monomer purity of 98-100% and a very low mismatch ratio ( ⁇ 1%) after three-step purification.
  • the present disclosure provides a novel T-cell linker designed by using bispecific antibodies with different types of light chains ⁇ , and a full-length IgG configuration, wherein in combination with the anti-CD3 antibody arms of target cells and T-cells, kappa light chain and lambda light chain are used to pair with their homologous heavy chains, and complementary charge pairs are introduced to enhance the correct pairing rate.
  • affinity optimization activated T-cells can be recruited at low concentrations of the novel T-cell connector, resulting in effective killing of target cells, while T-cells are not be activated in the absence of target cells.
  • ⁇ ⁇ bispecific antibodies of the novel T-cell do not bind to Fc ⁇ R receptors, reducing the risk of cytokine storm.
  • novel anti-CD20 ⁇ CD3 ⁇ , bispecific antibody, anti-BCMA ⁇ CD3 ⁇ bispecific antibody, and anti-GPC3 ⁇ CD3 ⁇ bispecific antibody constructed using the methods of the present disclosure have high purification yields, which can obtain a purity of >99% purity by three-step purification. Animals have a good tolerance to the novel CD20-CD3 ⁇ bispecific antibody. The efficacy and safety of the novel T-cell connector are superior to similar antibodies.
  • the present disclosure provides a bispecific antibody or antigen-binding portion thereof.
  • the present disclosure provides nucleic acids encoding a bispecific antibody or antigen-binding portion thereof according to the previous aspect.
  • the present disclosure provides a vector comprising a nucleic acid of the previous aspect.
  • the present disclosure provides a cell comprising the vector of the previous aspect.
  • the antibody or antigen-binding portion thereof is humanized.
  • the present disclosure provides a pharmaceutical composition or the kit comprising the antibody or antigen-binding portion thereof, or nucleic acid encoding the same according to any of the preceding aspects, and a pharmaceutically acceptable carrier.
  • the present disclosure provides an antibody-drug conjugate, comprising the antibody or antigen-binding portion thereof, bispecific or multispecific molecule of any of the foregoing aspects which are covalently attached to a therapeutic moiety.
  • the present disclosure provides a method of treating a disease associated therewith, comprising the steps of: administering to the mammal a therapeutically effective amount of the antibody or antigen-binding fragment thereof, the nucleic acid, the vector, the cell and/or the pharmaceutical composition according to any of the preceding aspects.
  • the present disclosure provides a use of the antibody or antigen-binding fragment thereof, nucleic acid, vector, cell and/or pharmaceutical composition according to any of the preceding aspects in preparing a medicament or kit for treating a tumor antigen-related disease in a mammal.
  • the antibodies of the present disclosure can be used in a variety of applications, including detection of tumor antigens, diagnosis, treatment, or prevention of diseases associated with tumor antigens.
  • FIG. 1 shows a first antigen ⁇ CD3 ⁇ bispecific antibodies of the present disclosure.
  • FIG. 2 shows binding of the humanized anti-CD3 antibody to human CD3 ⁇ protein.
  • FIG. 3 shows binding of the humanized anti-CD3 antibody to a Jurkat cell.
  • FIG. 4 shows binding of the humanized anti-CD3 humanized antibody to human CD3 ⁇ and cynomolgus monkey CD3 ⁇ proteins.
  • FIG. 5 shows the structures of ⁇ 001, ⁇ 002, ⁇ 003, ⁇ 004, ⁇ 005 of the present disclosure.
  • FIG. 6 shows the result of purification of Protein A of the anti-CD20 ⁇ CD3 ⁇ bispecific antibody.
  • FIG. 7 shows the result of SEC-HPLC detection of the anti-CD20 ⁇ CD3 ⁇ bispecific antibody.
  • FIG. 8 shows detection results of homodimers of anti-CD20 ⁇ CD3 ⁇ bispecific antibody.
  • FIG. 9 shows binding of the anti-CD20 ⁇ CD3 ⁇ bispecific antibody to a CD20 stably transfected cell.
  • FIG. 10 shows binding of the anti-CD20 ⁇ CD3 ⁇ bispecific antibody to tumor cells SU-DHL-4, Raji and NALM-6.
  • FIG. 11 shows binding of the anti-CD20 ⁇ CD3 ⁇ bispecific antibody to a Jurkat cell.
  • FIG. 12 shows binding of the anti-CD20 ⁇ CD3 ⁇ bispecific antibody to a T-cell in peripheral blood.
  • FIG. 13 shows T-cell dependent cellular cytotoxicity (TDCC) mediated by anti-CD20 ⁇ CD3 ⁇ bispecific antibody
  • FIG. 13 A shows killing of Nalm-6 cells
  • FIG. 13 B shows activation of T-cells.
  • FIG. 14 shows TDCC mediated by anti-CD20 ⁇ CD3 ⁇ bispecific antibody
  • FIG. 14 A shows killing of TMD-8 cells
  • FIG. 14 B shows activation of T-cells.
  • FIG. 15 shows TDCC mediated by anti-CD20 ⁇ CD3 ⁇ bispecific antibody
  • FIG. 15 A shows killing of Toledo cells
  • FIG. 15 B shows activation of T-cells.
  • FIG. 16 shows effect of anti-CD20 ⁇ CD3 ⁇ bispecific antibody on the T-cell NFAT signaling pathway.
  • FIG. 17 shows inhibitory effect of the anti-CD20 ⁇ CD3 ⁇ bispecific antibody in a xenograft model of mouse Raji with immune reconstitution.
  • FIG. 18 shows inhibitory effect of the anti-CD20 ⁇ CD3 ⁇ bispecific antibody in a subcutaneous tumor model grafted by a mixture of murine Raji and human PBMC in immunodeficient mice.
  • FIG. 19 shows efficacy of the anti-CD20 ⁇ CD3 ⁇ bispecific antibody in a cynomolgus monkey.
  • FIG. 20 shows binding of the anti-BCMA ⁇ CD3 ⁇ bispecific antibody to BCMA stably transfected cells.
  • FIG. 21 shows binding of the anti-BCMA ⁇ CD3 ⁇ bispecific antibody to tumor cells NCI-H929 and RPMI-8226.
  • FIG. 22 shows binding of the anti-BCMA ⁇ CD3 ⁇ bispecific antibody to a Jurkat cell.
  • FIG. 23 shows binding of the anti-BCMA ⁇ CD3 ⁇ bispecific antibody to a T-cell in the peripheral blood.
  • FIG. 24 shows TDCC mediated by the anti-BCMA ⁇ CD3 ⁇ bispecific antibody
  • FIG. 24 A shows killing of NCI-H929 cells
  • FIG. 24 B shows activation of T-cells.
  • FIG. 25 shows TDCC mediated by the anti-BCMA ⁇ CD3 ⁇ bispecific antibody
  • FIG. 25 A shows killing of RPMI-8226 cells
  • FIG. 25 B shows activation of T-cells.
  • FIG. 26 shows the effect of the anti-BCMA ⁇ CD3 ⁇ bispecific antibody on the T-cell NFAT signaling pathway.
  • FIG. 27 shows non-specific activation of PBMC by the anti-BCMA ⁇ CD3 ⁇ bispecific antibody.
  • FIG. 28 shows binding of the anti-BCMA ⁇ CD3 ⁇ bispecific antibody to an Fc receptor.
  • FIG. 29 shows inhibitory effect of the anti-BCMA ⁇ CD3 ⁇ bispecific antibody in the xenograft model of subcutaneous NCI-H929 in immunodeficient mice.
  • FIG. 30 shows binding of the anti-GPC3 ⁇ CD3 ⁇ bispecific antibody to the GPC3 stably transfected cell.
  • FIG. 31 shows binding of the anti-GPC3 ⁇ CD3 ⁇ bispecific antibody to a tumor cell HepG2.
  • FIG. 32 shows binding of the anti-GPC3 ⁇ CD3 ⁇ bispecific antibody to the Jurkat cell.
  • FIG. 33 shows binding of the anti-GPC3 ⁇ CD3 ⁇ bispecific antibody to the T-cell in the peripheral blood.
  • FIG. 34 shows TDCC mediated by anti-GPC3 ⁇ CD3 ⁇ antibody
  • FIG. 34 A shows killing of HepG2 cells
  • FIG. 34 B shows activation of T-cells.
  • FIG. 35 shows effect of the anti-GPC3 ⁇ CD3 ⁇ bispecific antibody on the T-cell NFAT signaling pathway.
  • FIG. 36 shows non-specific activation of PBMC by the anti-GPC3 ⁇ CD3 ⁇ bispecific antibody.
  • FIG. 37 shows inhibitory effect of the anti-GPC3 ⁇ CD3 ⁇ bispecific antibody in a xenograft model of a subcutaneous HepG2 in immune-reconstituted mice.
  • FIG. 38 shows inhibitory effect of the anti-GPC3 ⁇ CD3 ⁇ bispecific antibody in the humanized anti-CD3 humanized murine Hepa1-6/human GPC3 xenograft model.
  • tumor antigen preferably refers to any antigen or antigenic determinant present in (or bound to) a tumor cell but not normally present in a normal cell, or an antigen or antigenic determinant present in or bound to a tumor cell in a greater amount than on a normal (non-tumor) cell, or an antigen or antigenic determinant present in a tumor cell in a form other than that found on a normal (non-tumor) cell.
  • tumor-specific antigens including tumor-specific antigens (TSA) or tumor-related antigens (TAA), including tumor-related membrane antigens, embryonic antigens on tumors, growth factor receptors, growth factor ligands and any other types of antigens associated with cancers.
  • TSA tumor-specific antigens
  • TAA tumor-related antigens
  • the tumor antigen can be, for example, a B-cell differentiation antigen (e.g. CD19, CD20, and CD37), a B-cell maturation antigen (B-cell maturation antigen, BCMA), a glypican 3 (GPC3), an epithelial cancer antigen (e.g.
  • prostate-specific cancer antigen PSA
  • prostate-specific membrane antigen PSMA
  • a bladder cancer antigen a lung (e.g. small cell lung) cancer antigen, a colon cancer antigen, an ovarian cancer antigen, a brain cancer antigen, a stomach cancer antigen, a renal cell carcinoma antigen, a pancreatic cancer antigen, a liver cancer antigen, an esophageal cancer antigen, a head and neck cancer antigen, or a colorectal cancer antigen.
  • TSA is (or is believed to be) unique to tumor cells and does not occur on other cells in the body (e.g. does not occur to a significant extent on other cells).
  • TAA is not unique to tumor cells and is instead expressed on normal cells (e.g. under conditions that do not induce immune tolerance to the antigen).
  • TAA may be antigens that are expressed on normal cells during fetal development, or they may be antigens that are normally present at very low levels on normal cells, but are expressed at higher levels on tumor cells.
  • TSA or TAA antigens include: differentiation antigens such as MART-1/MelanA(MART-I), gp100(Pmel 17), tyrosinase, TRP-1, TRP-2 and tumor-specific multilineage antigens such as MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, p15; an overexpressed embryonic antigen, such as CEA; overexpressed oncogenes and mutated tumor suppressor genes such as p53, Ras, HER-2/neu; unique tumor antigens resulted from chromosomal translocations, such as BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR; and viral antigens such as the Epstein Barr virus antigen EBVA and the human HPV antigens E6 and E7.
  • differentiation antigens such as MART-1/MelanA(MART-I), gp100(Pmel 17), tyrosinas
  • tumor antigens include TSP-180, MAGE-4, MAGE-5, MAGE-6, RAGE, NY-ESO, erbB, pl85erbB2, pl80erbB-3, c-met, nm-23H1, PSA, TAG-72, CA 19-9, CA72-4, CAM 17.1, NuMa, K-ras, ⁇ -catenin, CDK4, Mum-1, p15, p16, 43-9F, 5T4, 791Tgp 72, alpha-fetoprotein, ⁇ -HCG, BCA225, BTAA, CA125, CA15-3 ⁇ CA 27.29 ⁇ BCAA, CA195, CA242, CA-50, CAM43, CD68 ⁇ P1, CO-029, FGF-5, G250, Ga733 ⁇ EpCAM, HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB/70K, NY-CO-1, RCAS1, SDCCAG16, TA-90 ⁇ Mac-2 binding protein ⁇ cycl
  • tumor antigens also include CD19, CD20, CD22, CD30, CD72, CD180, CD171 (L1 CAM), CD123, CD133, CD138, CD37, CD70, CD79a, CD79b, CD56, CD74, CD166, CD71, CLL-1/CLECK 12A, ROR1, BCMA, glypican3 (GPC3), mesothelin, CD33/IL3Ra, c-Met, PSCA, PSMA, glycolipid F77, EGFRvIII, GD-2, MY-ESO-1 or MAGEA3.
  • CD20 refers to any native CD20 from any vertebrate source including mammals, such as primates (e.g. humans) and rodents (e.g. mice and rats).
  • anti-CD20 antibody and “antibody that binds CD20” refer to an antibody that is capable of binding CD20 with sufficient affinity such that the antibody is used as a diagnostic and/or therapeutic agent in targeting CD20.
  • the degree of binding of an anti-CD20 antibody to an unrelated non-CD20 protein is less than about 10% of the binding of the antibody to CD20, as measured, for example, by a radioimmunoassay (RIA).
  • RIA radioimmunoassay
  • an antibody that binds CD20 has a dissociation constant (K d ) of ⁇ 1 ⁇ M, ⁇ 100 nM, ⁇ 10 nM, ⁇ 1 nM, ⁇ 0.1 nM, ⁇ 0.01 nM, or ⁇ 0.001 nM (e.g. 10 ⁇ 8 M or less, e.g. 10 ⁇ 8 M to 10 ⁇ 13 M, e.g. 10 ⁇ 9 M to 10 ⁇ 13 M).
  • anti-CD20 antibodies bind to CD20 epitopes conserved among CD20 from different species.
  • BCMA may refer to the concept of BCMA itself and any variants, isoforms and paralogs thereof, which are present together in animals and preferably in humans.
  • human BCMA refers to BCMA of human origin and may preferably have, but is not limited to, the amino acid sequence under Genbank accession number AB052772.1.
  • anti-BCMA antibody and “antibody that binds to BCMA” refer to an antibody that is capable of binding to BCMA with sufficient affinity such that the antibody is used as a diagnostic and/or therapeutic agent in targeting BCMA.
  • the degree of binding of an anti-BCMA antibody to an unrelated non-BCMA protein is less than about 10% of the binding of the antibody to BCMA, as measured, for example, by a radioimmunoassay (RIA).
  • RIA radioimmunoassay
  • an antibody that binds BCMA has a dissociation constant (K d ) of ⁇ 1 ⁇ M, ⁇ 100 nM, ⁇ 10 nM, ⁇ 1 nM, ⁇ 0.1 nM, ⁇ 0.01 nM, or ⁇ 0.001 nM (e.g. 10 ⁇ 8 M or less, e.g. from 10 ⁇ 8 M to 10 ⁇ 13 M, e.g. from 10 ⁇ 9 M to 10 ⁇ 13 M).
  • anti-BCMA antibodies bind BCMA epitopes conserved among BCMA from different species.
  • GPC3 may refer to the concept of GPC3 itself and any variants, isoforms and paralogs thereof, which are present together in animals and preferably in humans.
  • human GPC3 refers to GPC3 of human origin.
  • anti-GPC3 antibody and “antibody that binds GPC3” refer to an antibody that is capable of binding GPC3 with sufficient affinity such that the antibody is used as a diagnostic and/or therapeutic agent in targeting GPC3.
  • the degree of binding of an anti-GPC3 antibody to an unrelated non-GPC3 protein is less than about 10% of the binding of the antibody to GPC3 as measured, for example, by a radioimmunoassay (RIA).
  • RIA radioimmunoassay
  • an antibody that binds GPC3 has a dissociation constant (K d ) of ⁇ 1 ⁇ M, ⁇ 100 nM, ⁇ 10 nM, ⁇ 1 nM, ⁇ 0.1 nM, ⁇ 0.01 nM, or ⁇ 0.001 nM (e.g. 10 ⁇ 8 M or less, e.g. from 10 ⁇ 8 M to 10 ⁇ 13 M, e.g. from 10 ⁇ 9 M to 10 ⁇ 13 M).
  • anti-GPC3 antibodies bind GPC3 epitopes conserved among GPC3 from different species.
  • “CD3” refers to any native CD3 from any vertebrate source, including mammals, such as primates (e.g.
  • CD3 is human CD3, in particular the epsilon subunit (CD3 ⁇ ) of human CD3.
  • the amino acid sequence of human CD3 ⁇ is shown in UniProt (www.uniprot.org) under accession number P07766 (version 144), or NCBI (www.ncbi.nlm.nih.gov/) RefSeq NP_000724.1.
  • the amino acid sequence of Macaca fascicularis CD3 ⁇ is shown in NCBI GenBank no. BAB71849.1.
  • cell surface is in accordance with its normal meaning in the art, and thus includes the exterior of a cell accessible by binding to proteins and other molecules.
  • the term “about” or “approximately” means within plus or minus 10% of a given value or range. in the case that an integer is required, the term refers to rounding up or down to the nearest integer within plus or minus 10% of the given value or range.
  • an antibody chain is understood to mean an antibody chain that exhibits at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to a reference polypeptide sequence.
  • a nucleic acid sequence the term is understood to mean a nucleotide sequence that exhibits at least greater than 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference nucleic acid sequence.
  • Sequence “identity” or “homoousia” has its meanings widely acknowledged in this field, and the percentage of sequence identity between two nucleic acids or polypeptide molecules or regions can be calculated using published techniques. Sequence identity can be measured along the full length of a polynucleotide or polypeptide or along a region of the molecule. Although there are many methods of measuring identity between two polynucleotides or polypeptides, the term “identity” is well known to the skilled artisan (Carrillo, H. & Lipman, D., SIAM J Applied Math 48:1073 (1988)).
  • substitutional variant is a variant in which at least one amino acid residue in the native sequence has been removed and inserted at its same position by a different amino acid.
  • the substitution may be single, wherein only one amino acid in the molecule is substituted; or the substitution may be multiple, wherein the same molecule has two or more amino acids that are substituted. Multiple substitutions may be at consecutive positions.
  • an amino acid may be substituted with multiple residues, wherein such variants include both substitutions and insertions.
  • An “insertional” variant is a variant in which one or more amino acids are inserted immediately adjacent to an amino acid at a particular position in a native sequence. An immediately adjacent amino acid means an amino acid attached to the ⁇ -carboxy or ⁇ -amino functional group of the amino acid.
  • a “deletional” variant is a variant in which one or more amino acids in the native amino acid sequence have been removed. Typically, deletional variants have one or two amino acids deleted in a particular region of the molecule.
  • variable domains of the antibody refers to certain portions of related molecules that differ widely in sequences between antibodies, and are used for specific recognition and binding of a particular antibody to its specific target.
  • variability is not uniformly distributed throughout the variable domain of the antibody.
  • Variability is concentrated in what is known as complementary determinant regions (CDRs, i.e. CDR1, CDR2 and CDR3) or three segments of the hypervariable region, all of which are located in the variable domains of the light and heavy chains.
  • CDRs complementary determinant regions
  • FR framework regions
  • Each variable domain of a native heavy and light chain comprises four FR regions predominantly in a ⁇ -folded configuration, they are joined by three CDRs, and the CDRs forms loops, the loops are joined to the ⁇ -folded structure and in some cases form part of the ⁇ -folded structure.
  • the CDRs of each chain are typically joined together in close proximity by FR regions and aid in the formation of antibody target binding sites (epitopes or determinants) by means of CDRs from other chains.
  • immunoglobulin amino acid residue numbering is performed in accordance with the immunoglobulin amino acid residue numbering system of Kabat et al., unless otherwise indicated.
  • One CDR may have the ability to specifically bind to an associated epitope.
  • an “antibody fragment” or “antigen-binding fragment” of an antibody refers to any portion of a full-length antibody that is less than full-length but comprises at least a portion of the variable region (e.g. one or more CDRs and/or one or more antibody binding sites) of the antibody that binds antigen, and thus retains binding specificity as well as at least a portion of the specific binding capacity of the full-length antibody.
  • an antigen-binding fragment refers to an antibody fragment that comprises an antigen-binding portion that binds the same antigen as the antibody from the antibody fragment derived therefrom.
  • Antibody fragments include antibody derivatives produced by enzymatic treatment of full-length antibodies, as well as synthetically produced derivatives, e.g.
  • Antibodies include antibody fragments.
  • antibody fragments include, but are not limited to, Fab, Fab′, F(ab′) 2 , single chain Fv(scFv), Fv, dsFv, diabodies, Fd and Fd′ fragments and other fragments including modified fragments (see, e.g. Methods in Molecular Biology, Vol 207: Recombinant Antibodies for Cancer Therapy Methods and Protocols (2003); Chapter 1; p 3-25, Kipriyanov).
  • the fragments may comprise multiple chains linked together, for example by disulfide bonds and/or by peptide linkers.
  • Antibody fragments generally comprise at least or about 50 amino acids, and typically at least or about 200 amino acids.
  • Antigen-binding fragments include any antibody fragment that, when inserted into an antibody framework (e.g. by displacement of the corresponding region), results in an antibody that immunospecifically binds (i.e. exhibits a Ka of at least or at least about 10 7 -10 8 M-1) an antigen.
  • a “functional fragment” or “analog of an antibody” is a fragment or analog that prevents or substantially reduces the ability of the receptor to bind a ligand or initiate signal transduction.
  • functional fragments generally have the same meaning as “antibody fragments”, and as far as antibodies are concerned, they may refer to fragments that prevent or substantially reduce the ability of the receptor to bind a ligand or initiate signal transduction, such as Fv, Fab, F(ab′) 2 , and the like.
  • An “Fv” fragment consists of a dimer formed by a variable domain of a heavy chain and a variable domain of a light chain in the manner of a non-covalent association (V H -V L dimer).
  • V H -V L dimer non-covalent association
  • the three CDRs of each variable domain interact to define a target binding site on the surface of the V H -V L dimer, as is the case with intact antibodies.
  • the six CDRs together confer target binding specificity to the intact antibody.
  • bispecific antibody refers to antibodies and/or antigen-binding molecules capable of specifically binding to two different antigenic determinants.
  • a bispecific antibody and/or antigen-binding molecule comprises two antigen-binding sites, each of which is specific for a different antigenic determinant.
  • the bispecific antibody and/or antigen-binding molecule is capable of binding two antigenic determinants simultaneously, particularly two antigenic determinants expressed on two different cells.
  • monoclonal antibody refers to a population of identical antibodies, meaning that each individual antibody molecule in the population of monoclonal antibodies is identical to another antibody molecule. This property is in contrast to the property of a polyclonal population of the antibodies comprising antibodies having a plurality of different sequences. Monoclonal antibodies can be prepared by a number of well known methods (Smith et al. (2004) J. Clin. Pathol. 57, 912-917; and Nelson et al. J Clin Pathol(2000), 53, 111-117).
  • monoclonal antibodies can be prepared by immortalizing B cells, for example by fusion with myeloma cells to produce hybridoma cell lines or by infecting B cells with a virus, such as EBV.
  • Recombinant techniques can also be used to prepare antibodies from clonal populations of host cells in vitro by transforming host cells with plasmids carrying artificial sequences encoding the nucleotides of the antibodies.
  • hybridomas refers to a cell or cell line (typically a myeloma or lymphoma cell) resulted from the fusion of antibody-producing lymphocytes and non-antibody-producing cancer cells.
  • hybridomas can be propagated and continuously supplied to produce a particular monoclonal antibody. Methods for producing hybridomas are known in the art (Harlow&Lane, 1988).
  • hybridomas When referring to the term “hybridoma” or “hybridoma cell”, they also include subclones and progeny cells of hybridomas.
  • a full-length antibody is an antibody having two full-length heavy chains (e.g. VH-CH1-CH2-CH3 or VH-CH1-CH2-CH3-CH4) and two full-length light chains (VL-CL) and a hinge region, e.g. an antibody naturally produced by an antibody secreting B cell as well as a synthetically produced antibody having the same domain.
  • chimeric antibody refers to an antibody in which the variable region sequences are derived from one species and the constant region sequences are derived from another species, for example, an antibody in which the variable region sequences are derived from a mouse antibody and the constant region sequences are derived from a human antibody.
  • a “humanized” antibody refers to a form of non-human (e.g. mouse) antibody that is a chimeric immunoglobulin, immunoglobulin chain or fragment thereof (e.g. Fv, Fab, Fab′, F(ab′) 2 or other antigen-binding subsequence of an antibody) and contains minimal sequence derived from a non-human immunoglobulin.
  • the humanized antibody is a human immunoglobulin (recipient antibody) in which residues of the complementarity-determining region(CDR) of the recipient antibody are replaced by CDR residues from a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
  • the humanized antibodies of the present disclosure also encompass antibodies comprising one or two amino acid mutations in CDR.
  • CDR refers to a complementarity-determining region, it is known that an antibody molecule has three CDR per heavy and three CDR per light chain.
  • CDR is also known as a hypervariable region, is present in the variable region of each of the heavy and light chains of an antibody, and has a very high site of variability in a primary structure of CDR.
  • the CDR of the heavy chain is represented by CDR1, CDR2, CDR3 at the amino terminus of the amino acid sequence of the heavy chain
  • the CDR of the light chain is represented by CDR1, CDR2, CDR3 at the amino terminus of the amino acid sequence of the light chain.
  • epitopic determinants refers to any antigenic determinant on an antigen to which the paratope of an antibody binds.
  • Epitopic determinants usually comprise chemically active surface types of molecules, such as amino acids or sugar side chains, and usually have specific three-dimensional structural properties and specific charge properties.
  • telomere binding or “immunospecifically binding” with respect to an antibody or antigen-binding fragment thereof may be used interchangeably herein and refers to the ability of an antibody or antigen-binding fragment to form one or more non-covalent bonds with the same antigen through non-covalent interactions between the antibody and the antibody binding site of the antigen.
  • the antigen may be an isolated antigen or present in a tumor cell.
  • an antibody that immunospecifically binds (or specifically binds) an antigen is the one that binds the antigen with an affinity constant (Ka) of about or of 1 ⁇ 10 7 M ⁇ 1 or 1 ⁇ 10 8 M ⁇ 1 or greater (or a dissociation constant (Kd) of 1 ⁇ 10 ⁇ 7 M or 1 ⁇ 10 ⁇ 8 M or less).
  • Ka affinity constant
  • Kd dissociation constant
  • Affinity constants can be determined by standard kinetic methods for antibody reactions, e.g. immunoassays, surface plasmon resonance (SPR) (Rich and Myszka (2000) Curr. Opin. Biotechnol 11:54; Englebienne (1998) Analyst.
  • nucleic acid molecule refers to an oligomer or polymer comprising at least two linked nucleotides or nucleotide derivatives, including deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), typically linked together by phosphodiester bonds.
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • nucleic acid molecule is intended to include DNA molecules and RNA molecules.
  • the nucleic acid molecule may be single-stranded or double-stranded, and may be cDNA.
  • an isolated nucleic acid molecule is a nucleic acid molecule isolated from other nucleic acid molecules present in the natural source.
  • An “isolated” nucleic acid molecule such as a cDNA molecule, can be substantially free of other cellular material or culture medium when prepared by recombinant techniques, or substantially free of chemical precursors or other chemical components when chemically synthesized.
  • Exemplary isolated nucleic acid molecules provided herein include isolated nucleic acid molecules encoding an antibody or antigen-binding fragment provided herein.
  • operably linked with respect to a nucleic acid sequence, region, element or domain means that the nucleic acid regions are functionally related to one another.
  • a promoter may be operably linked to a nucleic acid encoding a polypeptide such that the promoter regulates or mediates transcription of the nucleic acid.
  • conservative sequence modifications in the sequences set forth in the sequence listings described herein, i.e. nucleotide and amino acid sequence modifications that do not eliminate binding of an antibody encoded by or containing an amino acid sequence to an antigen.
  • conservative sequence modifications include conservative nucleotide and amino acid substitutions, and nucleotide and amino acid additions and deletions.
  • modifications can be introduced into the sequence listings described herein by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis.
  • Conservative sequence modifications include conservative amino acid substitutions in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art.
  • amino acids with basic side chains e.g. lysine, arginine, histidine
  • amino acids with acidic side chains e.g. aspartic acid, glutamic acid
  • amino acids with uncharged polar side chains e.g. glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan
  • amino acids with nonpolar side chains e.g. alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine
  • amino acids with ⁇ -branched side chains e.g. threonine, valine, isoleucine
  • amino acids with aromatic side chains e.g.
  • a predicted nonessential amino acid residue in an anti-CD20, BCMA or GPC3 antibody is preferably replaced with another amino acid residue from the same side chain family.
  • Methods for identifying conservative substitutions of nucleotides and amino acids that do not eliminate antigen-binding are well known in the art (see, e.g. Brumnell et al. Biochem. 32: 1180-1187 (1993); Kobayashi et al. Protein Eng. 12(10): 879-884 (1999); Burks et al. Proc. Natl. Acad. Sci. USA 94: 412-417 (1997)).
  • mutations can be randomly introduced along all or a portion of the anti-GCD20, BCMA or PC3 antibody coding sequence by, for example, saturation mutagenesis, and the resulting modified anti-CD20, BCMA or GPC3 antibodies can be screened for improved binding activity.
  • expression refers to a process of producing a polypeptide by transcription and translation of a polynucleotide.
  • the level of expression of a polypeptide can be assessed using any method known in the art, including, for example, methods of determining the amount of polypeptide produced from a host cell. Such methods may include, but are not limited to, quantitation of polypeptides in cell lysates by ELISA, gel electrophoresis followed by Coomassie blue staining, Lowry protein assay, and Bradford protein assay.
  • a “host cell” is a cell for receiving, maintaining, replicating and expanding a vector. Host cells may also be used to express the polypeptide encoded by the vector. when the host cell divides, the nucleic acid contained in the vector replicates, thereby amplifying the nucleic acid.
  • the host cell may be a eukaryotic cell or a prokaryotic cell. Suitable host cells include, but are not limited to, CHO cells, various COS cells, HeLa cells, HEK cells such as HEK 293 cells.
  • a “vector” is a replicable nucleic acid from which one or more heterologous proteins can be expressed when the vector is transformed into an appropriate host cell.
  • vectors include those vectors into which a nucleic acid encoding a polypeptide or fragment thereof may be introduced typically by restriction digestion and ligation.
  • Vectors also include those comprising a nucleic acid encoding a polypeptide.
  • Vectors are used to introduce a nucleic acid encoding a polypeptide into a host cell, to amplify the nucleic acid, or to express/display the polypeptide encoded by the nucleic acid.
  • the vector usually remains episomal, but can be designed such that the gene or part thereof is integrated into the chromosome of the genome.
  • vectors for artificial chromosomes such as yeast artificial vectors and mammalian artificial chromosomes. The selection and use of such vehicles are well known to those skilled in the art.
  • a vector also includes a “virus vector” or a “viral vector”.
  • a viral vector is an engineered virus operably linked to a foreign gene to transfer (as a vehicle or shuttle) the foreign gene into a cell.
  • an “expression vector” includes a vector capable of expressing a DNA, the DNA is operably linked to regulatory sequences such as a promoter region, and is capable of affecting the expression of such a DNA fragment.
  • additional segments may include promoter and terminator sequences, and optionally may include one or more origins of replication, one or more selectable markers, enhancers, polyadenylation signals, and the like.
  • Expression vectors are typically derived from plasmid or viral DNA, or may contain elements of both.
  • an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, phage, recombinant virus or other vectors, when introduced into an appropriate host cell, it results in expression of a cloned DNA.
  • Suitable expression vectors are well known to those skilled in the art and include expression vectors that are replicable in eukaryotic and/or prokaryotic cells and expression vectors that remain episomal or that are integrated into the host cell genome.
  • treating means that the subject's symptoms are partially or completely alleviated or remain unchanged after treatments.
  • the treatment includes prophylaxis, treatment and/or cure.
  • Prevention refers to preventing the underlying disease and/or preventing the worsening of symptoms or the progression of the disease.
  • Treatment also includes any antibody or antigen-binding fragment thereof provided and any pharmaceutical use of the compositions provided herein.
  • therapeutic effect refers to an effect resulted from treatment of a subject that alters, typically ameliorates or ameliorates a symptom of a disease or condition, or cures a disease or condition.
  • a “therapeutically effective amount” or “therapeutically effective dose” refers to an amount of a substance, compound, material, or composition comprising a compound that is at least sufficient to produce a therapeutic effect after administration to a subject. Thus, it is an amount necessary to prevent, cure, ameliorate, block, or partially block the symptoms of a disease or condition.
  • a “prophylactically effective amount” or “prophylactically effective dose” refers to an amount of a substance, compound, material, or composition comprising a compound that, when administered to a subject, it has a desired prophylactic effect, e.g. preventing or delaying the occurrence or recurrence of a disease or condition, and reduces the likelihood of the occurrence or recurrence of a disease or condition.
  • a fully prophylactically effective dose does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses. Thus, a prophylactically effective amount can be administered in one or more administrations.
  • the term “patient” refers to a mammal, such as a human.
  • the present disclosure provides a bispecific antibody or antigen-binding fragment thereof, comprising:
  • the second antigen is a CD3 antigen.
  • a second light chain variable region of the second antigen-binding portion has a Gln 40 Glu mutation (V ⁇ CD3 : Gln 40 Glu); and a second heavy chain variable region of the second antigen-binding portion has a Gln 39 Lys mutation (VH CD3 : Gln 39 Lys).
  • the second binding domain comprises second light chain CDRs selected from amino acid sequences of SEQ ID NOs: 7-9, 14, 15, 20, 21 or any variant thereof; and/or second heavy chain CDRs selected from amino acid sequences of SEQ ID NOs: 26-28, 31, 34, 40, 43, 46, 47 or any variant thereof.
  • the second binding domain comprises a second light chain CDR1 selected from any of amino acid sequences of SEQ ID NOs: 7, 14 or any variant thereof, a second light chain CDR2 selected from any of amino acid sequences of SEQ ID NOs: 8, 15, 20 or any variant thereof, a second light chain CDR3 selected from any of amino acid sequences of SEQ ID NOs: 9, 21 or any variant thereof; and/or a second heavy chain CDR1 selected from any of amino acid sequences of SEQ ID NOs: 26, 31, 46 or any variant thereof, a second heavy chain CDR2 selected from any of amino acid sequences of SEQ ID NOs: 27, 47 or any variant thereof, a second heavy chain CDR3 selected from any of amino acid sequences of SEQ ID NOs: 28, 34, 37, 40, 43 of or any variant thereof.
  • the second light chain CDRs of the second binding domain are selected from: the second light chain CDR1, CDR2 and CDR3 respectively comprising the amino acid sequences of SEQ ID NOs: 7, 8, 9; the second light chain CDR1, CDR2 and CDR3 respectively comprising the amino acid sequences of SEQ ID NOs: 14, 15, 9; the second light chain CDR1, CDR2 and CDR3 respectively comprising the amino acid sequences of SEQ ID NOs: 7, 8, 21; the second light chain CDR1, CDR2 and CDR3 respectively comprising the amino acid sequences of SEQ ID NOs: 7, 20, 21; and/or the heavy chain CDRs of the second binding domain are selected from: the second heavy chain CDR1, CDR2 and CDR3 respectively comprising the amino acid sequences of SEQ ID NOs: 26, 27, 28; the second heavy chain CDR1, CDR2 and CDR3 respectively comprising the amino acid sequences of SEQ ID NOs: 31, 27, 28; the second heavy chain CDR1, CDR2 and CDR3 respectively comprising the
  • the second binding domain comprises a second light chain variable region selected from any of amino acid sequences of SEQ ID NOs: 5, 10, 12, 16, 18, 22 or any variant thereof; and/or a second heavy chain variable region selected from any of amino acid sequences of SEQ ID NOs: 24, 29, 32, 35, 38, 41, 44, 48, 50, 52 or any variant thereof.
  • the second binding domain comprises a second light chain variable region of the amino acid sequence of SEQ ID NO: 18 or any variant thereof; and a second heavy chain variable region of the amino acid sequence of SEQ ID NO: 24 or any variant thereof.
  • the second binding domain comprises a second light chain variable region of the amino acid sequence of SEQ ID NO: 5 or any variant thereof; and a second heavy chain variable region of the amino acid sequence of SEQ ID NO: 48 or any variant thereof.
  • the second binding domain comprises a second light chain variable region of the amino acid sequence of SEQ ID NO: 18 or any variant thereof; and a second heavy chain variable region of the amino acid sequence of SEQ ID NO: 48 or any variant thereof.
  • the second binding domain comprises a second light chain variable region of the amino acid sequence of SEQ ID NO: 5 or any variant thereof; and a second heavy chain variable region of the amino acid sequence of SEQ ID NO: 50 or any variant thereof.
  • the second binding domain comprises a second light chain variable region of the amino acid sequence of SEQ ID NO: 10 or any variant thereof; and a second heavy chain variable region of the amino acid sequence of SEQ ID NO: 50 or any variant thereof.
  • the second binding domain comprises a second light chain variable region of the amino acid sequence of SEQ ID NO: 12 or any variant thereof; and a second heavy chain variable region of the amino acid sequence of SEQ ID NO: 50 or any variant thereof.
  • the second binding domain comprises a second light chain variable region of the amino acid sequence of SEQ ID NO: 18 or any variant thereof; and a second heavy chain variable region of the amino acid sequence of SEQ ID NO: 50 or any variant thereof.
  • the second light chain of the second antigen-binding portion is selected from any of amino acid sequences of SEQ ID NOs: 58 and 66; and/or the second heavy chain of the second antigen-binding portion is selected from any of amino acid sequences of SEQ ID NOs: 60 and 68.
  • the second light chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 58; and the second heavy chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 60.
  • the second light chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 66; and the second heavy chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 68.
  • the first antigen is a tumor antigen.
  • the tumor antigen is selected from the group consisting of: CD19, CD20, CD22, CD30, CD38, CD72, CD180, CD171 (LI CAM), CD123, CD133, CD138, CD37, CD70, CD79a, CD79b, CD56, CD74, CD166, CD71, CLL-1/CLECK12A, ROR1, BCMA, GPC3, mesothelin, CD33/IL3Ra, c-Met, PSCA, PSMA, glycolipid F77, EGFRvIII, GD-2, MY-ESO-1, Her2, Her3, MUC1, MUC17, Claudin18 or MAGEA3.
  • the tumor-related antigen is selected from CD20, BCMA and GPC3.
  • the first antigen is a CD20 antigen.
  • the first light chain variable region of the first antigen-binding portion has a Gln 38 Lys mutation (V ⁇ CD20 : Gln 38 Lys). In some preferred embodiments, the first heavy chain variable region of the first antigen-binding portion has a Gln 39 Glu mutation (VH CD20 : Gln 39 Glu).
  • the first light chain variable region of the first antigen-binding portion has a Gln 38 Lys mutation (V ⁇ CD20 : Gln 38 Lys), and the first light chain constant region has Glu 123 Lys and Gln 124 Lys mutations (V ⁇ -Ck CD20 : Gln 38 Lys ⁇ Glu ⁇ Lys ⁇ Gln 24 Lys).
  • the first heavy chain variable region of the first antigen-binding portion has a Gln 39 Glu mutation (VH CD20 : Gln 39 Glu), and the first heavy chain constant region has Lys 152 Glu and Lys 218 Glu mutations (V H -C H I CD20 : Gln 39 Glu ⁇ Lys 152 Glu ⁇ Lys 218 Glu).
  • the first light chain of the first antigen-binding portion is selected from any of amino acid sequences of SEQ ID NOs: 54, 62, and 70; and/or the first heavy chain of the first antigen-binding portion is selected from any of amino acid sequences of SEQ ID NOs: 56, 64, and 72.
  • the first light chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 54
  • the first heavy chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 56.
  • the first light chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 62
  • the first heavy chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 64.
  • the first light chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 70
  • the first heavy chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 72.
  • the first light chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 54
  • the first heavy chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 56
  • the second light chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 58
  • the second heavy chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 60.
  • the first light chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 62
  • the first heavy chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 64
  • the second light chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 66
  • the second heavy chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 68
  • the second light chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 58
  • the second heavy chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 60.
  • the first light chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 70
  • the first heavy chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 72
  • the second light chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 66
  • the second heavy chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 68.
  • the first light chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 62
  • the first heavy chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 64
  • the second light chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 58
  • the second heavy chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 60.
  • the first light chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 54
  • the first heavy chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 56
  • the second light chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 66
  • the second heavy chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 68.
  • the first antigen is a BCMA antigen.
  • the first light chain variable region of the first antigen-binding portion has a Gln 42 Lys mutation (V ⁇ BCMA : Gln 42 Lys). In some preferred embodiments, the first heavy chain variable region of the first antigen-binding portion has a Gln 39 Glu mutation (VH BCMA : Gln 39 Glu).
  • the first light chain of the first antigen-binding portion is selected from the amino acid sequences of SEQ ID NOs: 80, and 84; and/or the first heavy chain of the first antigen-binding portion is selected from the amino acid sequences of SEQ ID NOs: 82 and 86.
  • the first light chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 80; and the first heavy chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 82.
  • the first light chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 84; and the first heavy chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 82.
  • the first light chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 80; and the first heavy chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 86.
  • the first light chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 84; and the first heavy chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 86.
  • the first light chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 80
  • the first heavy chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 82
  • the second light chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 66
  • the second heavy chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 68.
  • the first light chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 84
  • the first heavy chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 82
  • the second light chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 66
  • the second heavy chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 68.
  • the first light chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 80
  • the first heavy chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 86
  • the second light chain of the second antigen-binding portion is the amino acid sequence of amino acid sequence of SEQ ID NO: 66
  • the second heavy chain of the second antigen-binding portion is the amino acid sequence of amino acid sequence of SEQ ID NO: 68.
  • the first light chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 84
  • the first heavy chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 86
  • the second light chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 66
  • the second heavy chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 68.
  • the first antigen is a GPC3 antigen.
  • the first light chain variable region of the first antigen-binding portion has Gln 43 Lys and Gln 39 Glu mutations (V ⁇ GPC3 : Gln 43 Lys; VH GPC3 : Gln 39 Glu).
  • the first light chain of the first antigen-binding portion is selected from the amino acid sequences of SEQ ID NOs: 88 and 92; and/or the first heavy chain of the first antigen-binding portion is selected from the amino acid sequences of SEQ ID NOs: 90 and 94.
  • the first light chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 88
  • the first heavy chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 90.
  • the first light chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 92
  • the first heavy chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 94.
  • the first light chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 88
  • the first heavy chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 90
  • the second light chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 66
  • the second heavy chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 68.
  • the first light chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 92
  • the first heavy chain of the first antigen-binding portion is the amino acid sequence of SEQ ID NO: 94
  • the second light chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 66
  • the second heavy chain of the second antigen-binding portion is the amino acid sequence of SEQ ID NO: 68.
  • the Fc portion of the first antigen-binding portion and/or the second antigen-binding portion of the bispecific antibody adopts a knob-into-hole structure.
  • the human IgG4 knob-into-hole structure is used.
  • the first antigen-binding portion and/or the second antigen-binding portion of the bispecific antibody further has a Ser 228 Pro mutation, Leu 235 Glu mutation and/or Pro 329 Ala mutation.
  • the present disclosure provides a nucleic acid encoding the bispecific antibody or antigen-binding portion thereof described in the above.
  • the second antigen-binding portion binds to a CD3 antigen
  • the nucleic acid encoding the second light chain variable region of the second antigen-binding portion is selected from any of nucleotide sequences of SEQ ID NOs: 6, 11, 13, 17, 19 and 23
  • the nucleic acid encoding the second heavy chain variable region of the second antigen-binding portion is selected from any of nucleotide sequences of SEQ ID NOs: 25, 30, 33, 36, 39, 42, 45, 49, 51 and 53.
  • the nucleic acid encoding the second light chain of the second antigen-binding portion is selected from any of nucleotide sequences of SEQ ID NOs: 59 and 67; and/or the nucleic acid encoding the second heavy chain of the second antigen-binding portion is selected from any of nucleotide sequences of SEQ ID NOs: 61 and 69.
  • the nucleic acid encoding the second light chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 59, and the nucleic acid encoding the second heavy chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 61.
  • the nucleic acid encoding the second light chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 67, and the nucleic acid encoding the second heavy chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 69.
  • the first antigen-binding portion binds to a CD20 antigen
  • the nucleic acid encoding the first light chain variable region of the first antigen-binding portion is selected from any of nucleotide sequences of SEQ ID NOs: 55, 63 and 71
  • the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from any of nucleotide sequences of SEQ ID NOs: 57, 65, and 73.
  • the nucleic acid encoding the first light chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 55, and the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 57. In some preferred embodiments, the nucleic acid encoding the first light chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 63, and the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 65.
  • the nucleic acid encoding the first light chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 71, and the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from a nucleotide sequence of SEQ ID NO: 73.
  • the first antigen-binding portion binds to a BCMA antigen
  • the nucleic acid encoding the first light chain variable region of the first antigen-binding portion is selected from any of nucleotide sequences of SEQ ID NOs: 81 and 85
  • the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from any of nucleotide sequences of SEQ ID NOs: 83 and 87.
  • the nucleic acid encoding the first light chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 81, and the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 83. In some preferred embodiments, the nucleic acid encoding the first light chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 85, and the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 83.
  • the nucleic acid encoding the first light chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 81, and the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 87. In some preferred embodiments, the nucleic acid encoding the first light chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 85, and the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 87.
  • the first antigen-binding portion binds to a GPC3 antigen
  • the nucleic acid encoding the first light chain variable region of the first antigen-binding portion is selected from any of nucleotide sequences of SEQ ID NOs: 89 and 93
  • the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from any of nucleotide sequences of SEQ ID NOs: 91 and 95.
  • the nucleic acid encoding the first light chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 89, and the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 91. In some preferred embodiments, the nucleic acid encoding the first light chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 93, and the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 95.
  • the first antigen-binding portion of the bispecific antibody binds to the CD20 antigen
  • the second antigen binds to the CD3 antigen
  • the nucleic acid encoding the first light chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 55
  • the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 57
  • the nucleic acid encoding the second light chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 59
  • the nucleic acid encoding the second heavy chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 61.
  • the nucleic acid encoding the first light chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 63, and the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 65, the nucleic acid encoding the second light chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 67, and the nucleic acid encoding the second heavy chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 69, the nucleic acid encoding the second light chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 59, and the nucleic acid encoding the second heavy chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 61.
  • the nucleic acid encoding the first light chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 71, and the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 73, the nucleic acid encoding the second light chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 67, and the nucleic acid encoding the second heavy chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 69.
  • the nucleic acid encoding the first light chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 63, and the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 65, the nucleic acid encoding the second light chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 59, and the nucleic acid encoding the second heavy chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 61.
  • the nucleic acid encoding the first light chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 55, and the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 57, the nucleic acid encoding the second light chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 67, and the nucleic acid encoding the second heavy chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 69.
  • the first antigen-binding portion of the bispecific antibody binds to the BCMA antigen
  • the second antigen binds to the CD3 antigen
  • the nucleic acid encoding the first light chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 81
  • the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 83
  • the nucleic acid encoding the second light chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 67
  • the nucleic acid encoding the second heavy chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 69.
  • the nucleic acid encoding the first light chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 85, and the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 83, the nucleic acid encoding the second light chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 67, and the nucleic acid encoding the second heavy chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 69.
  • the nucleic acid encoding the first light chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 81, and the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 87, the nucleic acid encoding the second light chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 67, and the nucleic acid encoding the second heavy chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 69.
  • the nucleic acid encoding the first light chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 85, and the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 87, the nucleic acid encoding the second light chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 67, and the nucleic acid encoding the second heavy chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 69.
  • the first antigen-binding portion of the bispecific antibody binds to the GPC3 antigen
  • the second antigen binds to the CD3 antigen
  • the nucleic acid encoding the first light chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 89
  • the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 91
  • the nucleic acid encoding the second light chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 67
  • the nucleic acid encoding the second heavy chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 69.
  • the nucleic acid encoding the first light chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 93, and the nucleic acid encoding the first heavy chain of the first antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 95, the nucleic acid encoding the second light chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 67, and the nucleic acid encoding the second heavy chain of the second antigen-binding portion is selected from the nucleotide sequence of SEQ ID NO: 69.
  • the present disclosure provides a vector comprising the nucleic acid described in the above.
  • the present disclosure provides a cell comprising the nucleic acid or vector described in the above.
  • the present disclosure provides a composition comprising the bispecific antibody or antigen-binding portion thereof, the nucleic acid, the vector and/or the cell described in the above.
  • the present disclosure provides an antibody-drug conjugate comprising the bispecific antibody or antigen-binding portions thereof covalently attached to a therapeutic moiety described in the above.
  • the therapeutic moiety is selected from a cytotoxic moiety, a chemotherapeutic agent, a cytokine, an immunosuppressant, an immunostimulant, a lytic peptide, or a radioisotope;
  • the antibody of the present disclosure is used as a therapeutic or diagnostic tool in diseases in which various tumor antigens are adversely expressed or found.
  • the expression of the tumor antigen in cells of the diseased tissue or organ is increased compared to the state in a healthy tissue or organ.
  • An increase means an increase of at least 10%, in particular at least 20%, at least 50%, at least 100%, at least 200%, at least 500%, at least 1000%, at least 10000% or even more.
  • the expression is found only in diseased tissues, whereas the expression in corresponding healthy tissues is suppressed.
  • the diseases associated with tumor antigens include tumors.
  • the disease associated with a tumor antigen is a CD20-related disease.
  • the CD20-related disease comprises a B-cell disease, for example, a B cell proliferative disorder, in particular a CD20-positive B-cell disorder; preferably, the disease is selected from non-Hodgkin's lymphoma (NHL), acute lymphocytic leukemia (ALL), chronic lymphocytic leukemia (CLL), diffuse large B-cell lymphoma (DLBCL), follicular lymphoma (FL), mantle cell lymphoma (MCL), marginal zone lymphoma (MZL), and multiple myeloma (MM) and Hodgkin's lymphoma (HL).
  • NHL non-Hodgkin's lymphoma
  • ALL acute lymphocytic leukemia
  • CLL chronic lymphocytic leukemia
  • DLBCL diffuse large B-cell lymphoma
  • FL mantle cell lymphoma
  • MZL marginal
  • the tumor antigen-related disease is a BCMA-related disease; preferably, the BCMA-related disease includes B-cell disease; preferably, the disease is a cancer; more preferably, the cancer is a B-cell related cancer selected from multiple myeloma, malignant plasmacytoma, hodgkin's lymphoma, nodular lymphocyte-predominant Hodgkin's lymphoma, Kahler's disease and myeloid leukemia, plasma cell leukemia, plasmacytoma, B-cell prolymphocytic leukemia, hairy cell leukemia, B-cell non-Hodgkin's lymphoma (NHL), acute myelogenous leukemia (AML), chronic lymphocytic leukemia (CLL), acute lymphocytic leukemia (ALL), chronic myelogenous leukemia (CML), follicular lymphoma, burkitt lymphoma, marginal zone lymphoma, mantle cell lymphom
  • the therapeutic agent comprises an antibody that specifically binds to an activated T-cell antigen.
  • the therapeutic agent comprises an antibody that specifically binds CD3, particularly CD3 epsilon.
  • a method of treating diseases and conditions by using bispecific antibodies of the present disclosure include the steps of: administering to the mammal a therapeutically effective amount of the antibody or antigen-binding fragment thereof or the nucleic acid molecule or vector or cell or pharmaceutical composition according to any of the preceding aspects.
  • the disclosure provides a method of treating or preventing a cancer disease comprising administering to a patient an antibody capable of binding to GPC3, wherein the antibody is administered to provide a serum level of at least 40 ⁇ g/ml.
  • the antibody is administered to provide a serum level of at least 50 ⁇ g/ml, at least 150 ⁇ g/ml, at least 300 ⁇ g/ml, at least 400 ⁇ g/ml, or at least 500 ⁇ g/ml.
  • the antibody is administered to provide a serum level of no more than 800 ⁇ g/ml, 700 ⁇ g/ml, 600 ⁇ g/ml, 550 ⁇ g/ml, or 500 ⁇ g/ml.
  • the serum level provided is from 40 ⁇ g/ml to 700 ⁇ g/ml, preferably from 40 ⁇ g/ml to 600 ⁇ g/ml, preferably from 50 ⁇ g/ml to 500 ⁇ g/ml, such as from 150 ⁇ g/ml to 500 ⁇ g/ml or from 300 ⁇ g/ml to 500 ⁇ g/ml.
  • serum level as used in the present description means the concentration of the discussed substance in serum.
  • serum levels are provided for at least 7 days or at least 14 days.
  • the method comprises administering a dose of antibody of at least 300 mg/m 2 , for example, at least 600 mg/m 2 , and preferably at most 1500 mg/m 2 , at most 1200 mg/m 2 or at most 1000 mg/m 2 .
  • the disclosure provides a method of treating or preventing a cancer disease comprising administering to a patient an antibody capable of binding to GPC3, wherein the antibody is administered at a dose of at least 300 mg/m 2 , such as at least 600 mg/m 2 , and preferably at most 1500 mg/m 2 , at most 1200 mg/m 2 , or at most 1000 mg/m 2 .
  • the disclosure provides a method of treating or preventing a cancer disease comprising administering to a patient an antibody capable of binding to GPC3, wherein at least 50%, preferably 60%, 70%, 80% or 90% of the cancer cells of the patient are positive for GPC3, and/or at least 40%, preferably 50% or 60% of the cancer cells of the patient are positive for surface expression of GPC3.
  • the present disclosure also provides a method of treating or preventing a cancer disease, the method comprising: a. identifying patients showing at least 50%, preferably 60%, 70%, 80% or 90% of GPC3-positive cancer cells and/or at least 40%, preferably 50% or 60% of cancer cells that are positive for surface expression of GPC3; and b.
  • At least 95% or at least 98% of the cancer cells of the patient are GPC3-positive. In one embodiment, at least 70%, at least 80%, or at least 90% of the cancer cells of the patient are positive for surface expression of GPC3.
  • the therapeutic outcome of the cancer disease is to achieve stable disease conditions.
  • stable disease condition is achieved for at least 2 months, at least 3 months, or at least 6 months.
  • the present disclosure provides methods of achieving stable disease condition in a cancer patient comprising administering to the patient an antibody capable of binding GPC3.
  • stable disease condition is achieved for at least 2 months, at least 3 months, or at least 6 months.
  • the antibody is administered in a single dose or multiple doses.
  • the disclosure provides a method of treating or preventing a cancer disease comprising administering to a patient an antibody capable of binding to GPC3, wherein the antibody is administered in multiple doses.
  • the antibody is preferably administered in at least 3 doses, at least 4 doses, at least 5 doses, at least 6 doses, at least 7 doses, at least 8 doses, at least 9 doses, or at least 10 doses and preferably at most 30 doses, 25 doses, 20 doses, 15 doses, or 10 doses.
  • the dose of antibody is administered at intervals of at least 7 days, at least 10 days, at least 14 days, or at least 20 days.
  • the dose of antibody is preferably administered at intervals of from 7 to 30 days, from 10 to 20 days and preferably about 14 days.
  • the antibody is administered so as to provide a serum level of at least 40 ⁇ g/ml. In various embodiments, the antibody is administered to provide a serum level of at least 50 ⁇ g/ml, at least 150 ⁇ g/ml, at least 300 ⁇ g/ml, at least 400 ⁇ g/ml, or at least 500 ⁇ g/ml. In various embodiments, the antibody is administered to provide a serum level of no more than 800 ⁇ g/ml, 700 ⁇ g/ml, 600 ⁇ g/ml, 550 ⁇ g/ml, or 500 ⁇ g/ml.
  • the serum level provided is from 40 ⁇ g/ml to 700 ⁇ g/ml, preferably from 40 ⁇ g/ml to 600 ⁇ g/ml, preferably from 50 ⁇ g/ml to 500 ⁇ g/ml, such as from 150 ⁇ g/ml to 500 ⁇ g/ml or from 300 ⁇ g/ml to 500 ⁇ g/ml.
  • serum levels are provided for at least 7 days or at least 14 days.
  • the method comprises administering a dose of at least 300 mg/m 2 , such as at least 600 mg/m 2 and preferably at most 1500 mg/m 2 , at most 1200 mg/m 2 or at most 1000 mg/m 2 of the antibody.
  • the antibody is conjugated to other drugs, such as a labeled or cytotoxic conjugate.
  • kits comprising the antibodies, fragments thereof, homologues, derivatives thereof, nucleic acids, vectors, cells, compositions, etc. of the disclosure, e.g. a labeled or cytotoxic conjugate, as well as instructions for use of the antibody, a conjugate that kills a particular type of cell, etc.
  • the instructions can include directions for using the antibody, conjugate, etc. in vitro, in vivo, or ex vivo.
  • the antibody may be in liquid form or in solid form, usually lyophilized.
  • the kit may contain other suitable reagents, such as buffers, reconstitution solutions and other necessary components for the intended uses.
  • kits can include a substrate and cofactors required for the enzyme (e.g. a substrate precursor providing a detectable chromophore or fluorophore).
  • a substrate precursor providing a detectable chromophore or fluorophore
  • other additives such as stabilizers, buffers (e.g. blocking buffers or lysis buffers), and the like may also be included.
  • the relative amounts of the various reagents can be varied to provide a concentrate of a reagent solution, which provides user flexibility, space savings, reagent savings, etc.
  • These reagents may also be provided in dry powder form, usually in lyophilized form, including excipients which, when dissolved, provide a reagent solution having the appropriate concentration.
  • antibodies of the present disclosure can be used in immunoassays, purification methods, and other methods using immunoglobulins or fragments thereof. Such uses are well known in the art.
  • compositions comprising the anti-GPC3 antibodies of the present disclosure, or fragments thereof, conveniently combined with a pharmaceutically acceptable carrier, diluent or excipient, as is conventional in the art.
  • composition refers to formulations of various preparations.
  • Formulations containing therapeutically effective amounts of multivalent antibodies are in sterile liquid solution, liquid suspension, or lyophilized form, optionally containing stabilizers or excipients.
  • the antibodies of the present disclosure can be used as a composition administered alone, or can be used in combination with other active agents.
  • the humanized antibodies of the disclosure are conjugated to a therapeutic moiety (i.e. a drug).
  • a therapeutic moiety i.e. a drug
  • the therapeutic moiety can be, for example, a cytotoxin, a chemotherapeutic agent, a cytokine, an immunosuppressant, an immunostimulant, a lytic peptide, or a radioisotope.
  • conjugates are referred to herein as “antibody-drug conjugates” or “ADC”.
  • the antibody is conjugated to a cytotoxic moiety.
  • the cytotoxic moiety may for example be selected from: paclitaxel; cytochalasin B; gramicidin D; ethidium bromide; emetine; mitomycin; etoposide; teniposide; vincristine; vinblastine; colchicine; doxorubicin; daunorubicin; dihydroxy anthracenedione; tubulin inhibitors such as maytansine or analogs or derivatives thereof; antimitotic agents such as monomethyl auristatin E or F or analogues or derivatives thereof; hareotoxin 10 or 15 or an analogue thereof; irinotecan or an analog thereof; mitoxantrone; mithramycin; actinomycin D; 1-dehydrotestosterone; glucocorticoids; procaine; tetracaine; lidocaine; propranolol; puromycin; calicheamic
  • the antibody is conjugated to auristatin or a peptide analog, derivative or prodrug thereof. It has been shown that auristatin interferes with microtubule dynamics, GTP hydrolysis and nuclear and cell division and has anti-cancer and anti-fungal activity. For example, auristatin E can be reacted with p-acetylbenzoic acid or benzoylpentanoic acid to produce AEB and AEVB, respectively.
  • Other typical auristatin derivatives include AFP, MMAF (monomethyl auristatin F) and MMAE (monomethyl auristatin E).
  • Suitable auristatins and analogs, derivatives, and prodrugs of auristatins, as well as suitable linkers for conjugating auristatins to Ab are described, for example, in U.S. Pat. Nos. 5,635,483, 5,780,588, and 6,214,345, and International Patent Application Publication Nos. WO02088172, WO2004010957, WO2005081711, WO2005084390, WO2006132670, WO03026577, WO200700860, WO207011968, and WO205082023.
  • the antibody is conjugated to a pyrrolo [2, 1-c] [1, 4]-benzodiazepine (PDB) or a peptide analog, derivative or prodrug thereof.
  • PDB pyrrolo [2, 1-c] [1, 4]-benzodiazepine
  • Suitable PDB and PDB derivatives and related art are described, for example, in Hartley J. A. et al. Cancer Res 2010; 70(17): 6849-6858; antonow D. et al. Cancer J 2008; 14(3): 154-169; howard P. W. et al. Bioorg Med Chem Lett 2009; 19: 6463-6466 and Sagnou et al. Bioorg MedChem Lett 2000; 10(18): 2083-2086.
  • the antibody is conjugated to a cytotoxic moiety selected from: anthracyclines, maytansinoids, calicheamicins, duocarmycins, rapamycin (CC-1065), dolastatin 10, dolastatin 15, irinotecan, monomethyl auristatin E, monomethyl auristatin F, PDB, or any analog, derivative or prodrug thereof.
  • a cytotoxic moiety selected from: anthracyclines, maytansinoids, calicheamicins, duocarmycins, rapamycin (CC-1065), dolastatin 10, dolastatin 15, irinotecan, monomethyl auristatin E, monomethyl auristatin F, PDB, or any analog, derivative or prodrug thereof.
  • the antibody is conjugated to an anthracycline or an analog, derivative or prodrug thereof. In some embodiments, the antibody is conjugated to maytansine or an analog, derivative or prodrug thereof. In some embodiments, the antibody is conjugated to a calicheamicin or an analog, derivative or prodrug thereof. In some embodiments, the antibody is conjugated to a duocarmycin or an analog, derivative or prodrug thereof. In some embodiments, the antibody is conjugated to rapamycin (CC-1065) or an analog, derivative or prodrug thereof. In some embodiments, the antibody is conjugated to haremomycin 10 or an analog, derivative or prodrug thereof.
  • the antibody is conjugated to haremomycin 15 or an analog, derivative or prodrug thereof. In some embodiments, the antibody is conjugated to monomethyl auristatin E or an analog, derivative or prodrug thereof. In some embodiments, the antibody is conjugated to monomethyl auristatin F or an analog, derivative or prodrug thereof. In some embodiments, the antibody is conjugated to a pyrrolo [2, 1-c] [1, 4]-benzodiazepine or an analog, derivative or prodrug thereof. In some embodiments, the antibody is conjugated to irinotecan or an analog, derivative or prodrug thereof.
  • the antibody is conjugated to a cytokine (e.g. IL-2, IL-4, IL-6, IL-7, IL-10, IL-12, IL-13, IL-15, IL-18, IL-23, IL-24, IL-27, IL-28a, IL-28b, IL-29, KGF, IFNa, IFN3, IFNy, GM-CSF, CD40L, Flt3 ligand, stem cell factor, ancestine, and TNFa).
  • a cytokine e.g. IL-2, IL-4, IL-6, IL-7, IL-10, IL-12, IL-13, IL-15, IL-18, IL-23, IL-24, IL-27, IL-28a, IL-28b, IL-29, KGF, IFNa, IFN3, IFNy, GM-CSF, CD40L, Flt3 ligand, stem cell factor, ancestine, and TNFa
  • the antibody is conjugated to a radioisotope or a chelate containing a radioisotope.
  • the antibody can be conjugated to a chelator linker (e.g. DOTA, DTPA, or tixistan) that allows the antibody to complex with the radioisotope.
  • the antibody may also or alternatively comprise or be conjugated to one or more radiolabeled amino acids or other radiolabeled molecules.
  • radioisotopes include 3 H, 14 C, 15 N, 35 S, 90Y 99 Tc, 125 I, 131 I, 186 Re, 213 Bi, 225 Ac, and 227 Th.
  • radioisotopes emitting ⁇ or ⁇ particle radiation may be used, such as 131 I, 90 Y, 211 At, 212 Bi, 67 Cu, 186 Re, 188 Re and 212 Pb.
  • the nucleic acid molecule is covalently linked to a lysine or cysteine on the antibody via an N-hydroxysuccinimide ester or maleimide functional group, respectively.
  • Conjugation methods using engineered cysteines or incorporating unnatural amino acids have been reported to improve homogeneity of conjugates.
  • one skilled in the art may also contemplate generating reactive endogenous glutamine-engineered Fc-containing polypeptides with acyl donor glutamine-containing tags (e.g. Gin peptide-containing tags or Q-tags) or by polypeptide engineering (e.g. by amino acid deletions, insertions, substitutions, or mutations in the polypeptide).
  • Transglutaminase can then be covalently cross-linked with an amine donor agent (e.g. a small molecule comprising or linked to a reactive amine) to form a stable and homogeneous population of engineered Fc-containing polypeptide conjugates, wherein the amine donor agent is site-specifically conjugated to the Fc-containing polypeptide through an acyl-donor glutamine-containing tag or an accessible/exposed/reactive endogenous glutamine (WO2012059882).
  • an amine donor agent e.g. a small molecule comprising or linked to a reactive amine
  • the therapeutic agents according to the foregoing embodiments will be administered with suitable pharmaceutically acceptable carriers, excipients, and other agents incorporated into the formulation to provide improved transfer, delivery, tolerability, etc.
  • suitable pharmaceutically acceptable carriers include, for example, powders, pastes, ointments, gels, waxes, oils, lipids, lipid-containing (cationic or anionic) carriers (e.g. LipofectinTM), DNA conjugates, anhydrous syrups, oil-in-water and water-in-oil emulsions, emulsion polyethylene glycols (polyethylene glycols of various molecular weights), semi-solid gels, and semi-solid mixtures containing polyethylene glycol. Any of the foregoing mixtures may be suitable for treatment or therapy according to the present disclosure, provided that the active ingredients in the formulation are not inactivated by the formulation and that the formulation is physiologically compatible and tolerates the route of administration.
  • the antibodies described above can be used as therapeutic agents. Such agents will generally be used to treat, alleviate and/or prevent a disease or pathology associated with abnormal tumor antigen expression, activity and/or signaling in a subject.
  • a treatment regimen can be performed using standard methods by identifying a subject, e.g. a human patient, having (or at risk of or developing) a disease or disorder associated with aberrant tumor antigen expression, activity, and/or signaling, e.g. a tumor antigen-related disorder.
  • An antibody preparation preferably one with high specificity and affinity for its target antigen, is administered to a subject and will generally have an effect due to its binding to the target.
  • the administered antibody can eliminate or inhibit or interfere with the expression, activity and/or signaling function of the target (e.g. tumor antigen).
  • the administered antibody can eliminate or inhibit or interfere with the binding of the target (e.g. tumor antigen) to its endogenous ligand to which it naturally binds.
  • an antibody binds to a target and modulates, blocks, inhibits, reduces, antagonizes, neutralizes, and/or otherwise interferes with tumor antigen expression, activity, and/or signaling.
  • antibodies having heavy and light chain CDR can be administered to a subject.
  • antibodies directed against tumor antigens can be used in methods known in the art to correlate tumor antigen localization and/or quantitation (e.g. for determining tumor antigen and/or levels of tumor antigen in an appropriate physiological sample, for diagnostic methods, for protein imaging, etc.).
  • an antibody having specificity for a tumor antigen or a derivative, fragment, analog and comprising an antigen-binding domain derived from the antigen is used as a pharmaceutically active compound (hereinafter referred to as “therapeutic agent”).
  • antibodies specific for tumor antigens can be used to isolate tumor antigen polypeptides by standard techniques such as immunoaffinity, chromatography or immunoprecipitation.
  • Antibodies (or fragments thereof) directed against a tumor antigen protein can be used to detect the protein in a biological sample.
  • tumor antigens can be detected in a biological sample as part of a clinical testing procedure, for example, to determine the efficacy of a given treatment regimen. Detection may be facilitated by conjugating (i.e. physically linking) the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials and radioactive materials.
  • suitable enzymes include horseradish peroxidase, alkaline phosphatase, ⁇ -galactosidase or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazine aminofluorescein, dansyl chloride, or phycoerythrin; one example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin and aequorin, and examples of suitable radioactive materials include 125 I, 131 I, 35 S or 3 H.
  • antibodies according to the present disclosure can be used as reagents for detecting the presence of tumor antigens or protein fragments thereof in a sample.
  • the antibody comprises a detectable label.
  • the antibody is a polyclonal antibody, or more preferably a monoclonal antibody. Whole antibodies or fragments thereof (e.g. Fab, scFv or F(ab′) 2 ) are used.
  • labeling in reference to an antibody is intended to encompass direct labeling of the antibody by conjugating (i.e. physically linking) a detectable substance to the antibody, as well as indirect labeling of the antibody by reaction with another reagent that is directly labeled.
  • Examples of indirect labeling include detection of the first antibody using a fluorescently labeled second antibody, and end-labeling of the antibody with biotin to enable detection with fluorescently labeled streptavidin.
  • bio sample is intended to include tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present in a subject.
  • biological sample as used includes blood and fractions or components of blood, including serum, plasma, or lymph.
  • the detection method of the foregoing embodiments can be used to detect the analyte mRNA, protein or genomic DNA in a biological sample in vitro as well as in vivo.
  • analyte mRNA in vitro detection techniques include Northern hybridization and in situ hybridization.
  • In vitro techniques for detection of analyte proteins include enzyme-linked immunosorbent assays (ELISA), Western blots, immunoprecipitations, and immunofluorescence.
  • Analyte genomic DNA in vitro detection techniques include Southern hybridization. Procedures for performing immunoassays are described, for example, in “ELISA: Theory and Practice: Methods in Molecular Biology, vol. 42, J. R. Crowther (ed.) Human Press, totowa, N. J. 1995.
  • in vivo techniques for detection of an analyte protein include introducing into a subject a labeled anti-analyte protein antibody.
  • an antibody can be labeled with a radiolabel, and the presence and location of the radiolabel in the subject can then be detected by standard imaging techniques.
  • compositions suitable for administration can be incorporated into pharmaceutical compositions suitable for administration.
  • the principles and considerations involved in preparing such compositions and guidelines for selecting components are well known in the art.
  • compositions typically comprise the antibody and a pharmaceutically acceptable carrier.
  • antibody fragments When antibody fragments are used, minimal inhibitory fragments that specifically bind to the target protein binding domain may be preferred.
  • peptide molecules can be designed that retain the ability to bind to a target protein sequence.
  • Such peptides can be chemically synthesized and/or produced by recombinant DNA techniques (see, e.g. Marasco et al. Proc. Natl. Acad. Sci. USA, 90: 7889-7893 (1993)).
  • the term “pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Suitable pharmaceutically acceptable carriers are described in the latest edition of Remington's Pharmaceutical Sciences, a standard reference text in the art, which is incorporated herein by reference. Preferred examples of such carriers or diluents include, but are not limited to, water, saline, ringer's solution, dextrose solution, and 5% human serum albumin. Liposomes and non-aqueous vehicles such as fixed oils can also be used. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the antibody, its use in the compositions is contemplated.
  • compositions of the foregoing embodiments are formulated to be compatible with their intended route of administration.
  • routes of administration include parenteral, e.g. intravenous, intradermal, subcutaneous, oral (e.g. inhalation), transdermal (i.e. topical), transmucosal, and rectal administration.
  • Solutions or suspensions for parenteral, intradermal or subcutaneous administration may include the following components: sterile diluents for injection such as water, saline solutions, fixed oils, polyethylene glycols, glycerol, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl paraben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as Ethylene Diamine Tetraacetic Acid (EDTA); buffers, such as acetates, citrates or phosphates, and agents to adjust the osmotic pressure, such as sodium chloride or dextrose.
  • the pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • the parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
  • compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • suitable pharmaceutically acceptable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS).
  • the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (such as glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions can be prepared by incorporating the antibody in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the antibody into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • methods of preparation are vacuum drying and freeze-drying that yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution of such ingredients.
  • the compounds are delivered in the form of an aerosol spray from pressurized container or dispenser that contains a suitable propellant, such as a gas, for example carbon dioxide, or a nebulizer.
  • a suitable propellant such as a gas, for example carbon dioxide, or a nebulizer.
  • Systemic administration may also be by transmucosal or transdermal means.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.
  • Transmucosal administration can be accomplished through the use of nasal sprays or suppositories.
  • one or more of the antibodies can be formulated into ointments, salves, gels, or creams as generally known in the art.
  • the compounds may also be prepared in the form of suppositories (e.g. with conventional suppository bases such as cocoa butter or other glycerides) or retention enemas for rectal delivery.
  • suppositories e.g. with conventional suppository bases such as cocoa butter or other glycerides
  • retention enemas for rectal delivery.
  • the antibody may be prepared with carriers that prevent rapid elimination from the body, such as sustained/controlled release formulations, including implants and microencapsulated delivery systems.
  • sustained/controlled release formulations including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparing such formulations will be apparent to those skilled in the art.
  • Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit contains a predetermined quantity of one or more antibodies calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • the specification for the dosage unit forms of the foregoing embodiments are dictated by and directly dependent on: the unique characteristics of antibodies and the specific therapeutic effects to be achieved, and the limitations inherent in the art of formulating such antibodies for treating individuals.
  • compositions can be presented in a container, pack, or dispenser together with instructions for administration.
  • compositions described herein may also contain more than one antibody depending on the particular situation to be treated, preferably those which have complementary activities but do not adversely affect each other.
  • the composition may, for example, comprise an agent that enhances its function, such as a cytotoxic agent, a cytokine, a chemotherapeutic agent, or a growth inhibitor.
  • agents that enhances its function such as a cytotoxic agent, a cytokine, a chemotherapeutic agent, or a growth inhibitor.
  • Such molecules are suitably present in combination in amounts effective for the intended purpose. For example, they may be present in combination in a kit or in combination for use.
  • one or more antibodies can be administered in combination therapy, i.e. in combination with other agents such as therapeutic agents that can be used to treat pathological conditions or disorders, such as various forms of cancer, autoimmune disorders, and inflammatory diseases.
  • the term “in combination” means herein that the agents are administered substantially synchronously, simultaneously or sequentially. If administered sequentially, the first of the two compounds is still preferably detected at an effective concentration at the treatment site when the second compound is initially administered.
  • a “combination” can also include both an antibody of the present disclosure and another therapeutic agent in a kit.
  • combination therapy can comprise coformulation and/or coadministration of one or more antibodies described herein with one or more additional therapeutic agents (e.g. one or more cytokine and growth factor inhibitors, immunosuppressants, anti-inflammatory agents, metabolic inhibitors, enzyme inhibitors, and/or cytotoxic or cytostatic agents, as described in more detail below).
  • additional therapeutic agents e.g. one or more cytokine and growth factor inhibitors, immunosuppressants, anti-inflammatory agents, metabolic inhibitors, enzyme inhibitors, and/or cytotoxic or cytostatic agents, as described in more detail below.
  • additional therapeutic agents e.g. one or more cytokine and growth factor inhibitors, immunosuppressants, anti-inflammatory agents, metabolic inhibitors, enzyme inhibitors, and/or cytotoxic or cytostatic agents, as described in more detail below.
  • the treatment regimen is effective to reduce cytokine release associated with administration of the T-cell activating therapeutic agent in the subject as compared to a corresponding treatment regimen without administration of an anti-tumor antigen antibody.
  • FIG. 1 shows the structure of a novel primary antigen ⁇ CD3 ⁇ bispecific antibody.
  • the Fc portion of the anti-CD20 ⁇ CD3 ⁇ bispecific antibody adopts the human IgG4 knob-into-hole structure, and stabilizes the hinge region and reduces interaction with Fc ⁇ receptors as well as C1q by mutating Ser 228 Pro, Leu 235 Glu and Pro 329 Ala.
  • the nucleotide sequences of the extracellular regions of human CD3 ⁇ (UniProt P09693, gln23-Asn116) and CD3 ⁇ (UniProt P07766, gln23-Asp126) were synthesized, fused with human IgG Fc hole or Fc knob respectively at the C-terminus, and expressed to form a human CD3 ⁇ -Fc heterodimer (the amino acid sequence of human CD3 ⁇ IgG Fc (hole) is shown in SEQ ID NO. 1, and the amino acid sequence of human CD3 ⁇ IgG Fc (knob) is shown in SEQ ID NO.
  • Cynomolgus monkey CD3 ⁇ (UniProt Q 95LI7, gln23-Asn110) and CD3 ⁇ (UniProt Q 95LI5, gln22-Asp117) were also synthesized, C-terminally fused to Cynomolgus monkey IgG Fc hole or Fc knob, respectively, and expressed to form a Cynomolgus monkey CD3 ⁇ -Fc heterodimer (the amino acid sequence of Cynomolgus monkey CD3 ⁇ IgG Fc (hole) is shown in SEQ ID NO. 3, and the amino acid sequence of Cynomolgus monkey CD3 ⁇ IgG Fc (knob) is shown in SEQ ID NO. 4).
  • Recombinant plasmids expressing CD3 ⁇ -Fc and CD3 ⁇ -Fc were mixed with 3 mg/mL PEI (Polysciences, #24765-2) and co-transfected into HEK 293E cells (culture medium OPM-293 CD03 DPM). After 7 days at 37° C. in 120 rpm 5% CO 2 , the supernatant of culture medium was collected and purified by Protein A affinity chromatography to obtain recombinant CD3 ⁇ -Fc protein of human or cynomolgus monkeys.
  • amino acid sequence of the light chain of anti-CD3 murine monoclonal antibody (SEQ ID NO. 96): QAVVTQESALTTSPGETVTLTCR SSTGAVTTSNYAN WVQQKPDHLFTGLIG GTNKRAP GVPARFSGSLIGDK AALTITGAQTEDEAIYFCA LWYSNLWV FGGGTKLTVL
  • amino acid sequence of the heavy chain of anti-CD3 murine monoclonal antibody SEQ ID NO.
  • the anti-CD3 murine monoclonal antibody was humanized, the human germline gene IMGT_hVL7-43 with the highest homology was selected for light chain CDR transplantation, and human IGLJ3*02 was selected for FM4; human IMGT hVH3-73 was selected for heavy chain CDR grafting and human IGHJ4*01 for FM4. Different heavy and light chain variants were designed (Table 1).
  • amino acid sequence of hVL1 is shown in SEQ ID NO. 5, nucleic acid encoding the same is shown in SEQ ID NO. 6, and LCDR1, LCDR2 and LCDR3 thereof are shown in SEQ ID NOs. 7, 8 and 9 respectively.
  • amino acid sequence of hVL2 is shown in SEQ ID NO. 10
  • nucleic acid encoding the same is shown in SEQ ID NO. 11
  • LCDR1, LCDR2 and LCDR3 thereof are shown in SEQ ID NOs. 7, 8 and 9, respectively.
  • hVL3 The amino acid sequence of hVL3 is shown in SEQ ID NO. 12, its encoding nucleic acid is shown in SEQ ID NO. 13, and its LCDR1, LCDR2 and LCDR3 are shown in SEQ ID NOs. 14, 15 and 9, respectively.
  • EAVVTQEPSLTVSPGGTVTLTC ESSDGAVTTSNYAN WVQE KPGQAPRGLI G GTNKEAP WTPARFSGSLLGGKAALTLSGA QPEDEAEYYC ALWYSNLWV FGGGTKLTVL Nucleic acid sequence GAGGCTGTGGTCACACAAGAGCCTAGCCTGACAGTGTCTC CTGGCGGCACAGTGACCCTGACCTGTGAGTCTTCTGACGG CGCCGTGACCACCAGCAACTACGCTAATTGGGTGCAGGAG AAGCCCGGCCAGGCTCCTAGAGGACTGATCGGCGGAACAA ACAAGGAGGCCCCTTGGACACCCGCCAGATTCTCTGGATC TCTGCTCGGCGGAAAGGCCGCTCTGACACTTTCTGGTGCT CAGCCTGAGGACGAGGCCGAGTACTATTGTGCCCTGGT ACAGCAACCTGTGGGTGTTCGGCGGAGGCACCAAACTGAC AGTTCTG
  • amino acid sequence of hVL4 is shown in SEQ ID NO. 16, nucleic acid encoding the same is shown in SEQ ID NO. 17, and LCDR1, LCDR2 and LCDR3 thereof are shown in SEQ ID NOs. 14, 15 and 9, respectively.
  • amino acid sequence of hVL5 is shown in SEQ ID NO. 18, nucleic acid encoding the same is shown in SEQ ID NO. 19, and LCDR1, LCDR2 and LCDR3 thereof are shown in SEQ ID NOs. 7, 8 and 21, respectively.
  • amino acid sequence of hVL6 is shown in SEQ ID NO. 22, nucleic acid encoding the same is shown in SEQ ID NO. 23, and LCDR1, LCDR2 and LCDR3 thereof are shown in SEQ ID NOs. 7, 20 and 21, respectively.
  • amino acid sequence of hVH1 is shown in SEQ ID NO. 24, nucleic acid encoding the same is shown in SEQ ID NO. 25, and HCDR1, HCDR2 and HCDR3 thereof are shown in SEQ ID NOs. 26, 27 and 28, respectively.
  • amino acid sequence of hVH2 is shown in SEQ ID NO. 29, nucleic acid encoding the same is shown in SEQ ID NO. 30, and HCDR1, HCDR2 and HCDR3 thereof are shown in SEQ ID NOs. 31, 27 and 28, respectively.
  • amino acid sequence of hVH3 is shown in SEQ ID NO. 32, nucleic acid encoding the same is shown in SEQ ID NO. 33, and HCDR1, HCDR2 and HCDR3 thereof are shown in SEQ ID NOs. 31, 27 and 34, respectively.
  • amino acid sequence of hVH4 is shown in SEQ ID NO. 35, nucleic acid encoding the same is shown in SEQ ID NO. 36, and HCDR1, HCDR2 and HCDR3 thereof are shown in SEQ ID NOs. 31, 27 and 37, respectively.
  • amino acid sequence of hVH5 is shown in SEQ ID NO. 38, nucleic acid encoding the same is shown in SEQ ID NO. 39, and HCDR1, HCDR2 and HCDR3 thereof are shown in SEQ ID NOs. 31, 27 and 40, respectively.
  • amino acid sequence of hVH6 is shown in SEQ ID NO. 41, nucleic acid encoding the same is shown in SEQ ID NO. 42, and HCDR1, HCDR2 and HCDR3 thereof are shown in SEQ ID NOs. 31, 27 and 43, respectively.
  • amino acid sequence of hVH7 is shown in SEQ ID NO. 44, nucleic acid encoding the same is shown in SEQ ID NO. 45, and HCDR1, HCDR2 and HCDR3 thereof are shown in SEQ ID NOs. 46, 47 and 28, respectively.
  • amino acid sequence of hVH8 is shown in SEQ ID NO. 48, nucleic acid encoding the same is shown in SEQ ID NO. 49, and HCDR1, HCDR2 and HCDR3 thereof are shown in SEQ ID NOs. 26, 27 and 28, respectively.
  • amino acid sequence of hVH9 is shown in SEQ ID NO. 50, nucleic acid encoding the same is shown in SEQ ID NO. 51, and HCDR1, HCDR2 and HCDR3 thereof are shown in SEQ ID NOs. 26, 27 and 28, respectively.
  • amino acid sequence of hVH10 is shown in SEQ ID NO. 52, nucleic acid encoding the same is shown in SEQ ID NO. 53, and HCDR1, HCDR2 and HCDR3 thereof are shown in SEQ ID NOs. 26, 27 and 28, respectively.
  • humanized variants of light and heavy chain After the humanized variants of light and heavy chain have been respectively subjected to full sequence synthesis, they are cloned into the eukaryotic expression vector containing the constant region of light chain of antibody ⁇ or the constant region CH1-CH3 of heavy chain of human IgG4, co-transfected into HEK 293E cells, and cultured at 37° C. under 120 rpm of 5% CO 2 for 5-6 days, and then the culture supernatant is collected and purified by Protein A chromatography column.
  • Human CD3 ⁇ recombinant protein was coated overnight at 4° C. After blocking with 2% skim milk, different dilutions of CD3 antibody were added to each well and incubated for 1 hour. After the secondary antibody was developed by adding HPR-labeled goat anti-human IgG Fc and TMB solution, the reaction was stopped with concentrated sulfuric acid and the absorbance was read at 450 nm.
  • FIG. 1 Human CD3 ⁇ recombinant protein was coated overnight at 4° C. After blocking with 2% skim milk, different dilutions of CD3 antibody were added to each well and incubated for 1 hour. After the secondary antibody was developed by adding HPR-labeled goat anti-human IgG Fc and TMB solution, the reaction was stopped with concentrated sulfuric acid and the absorbance was read at 450 nm.
  • FIG. 2 shows the binding of humanized anti-CD3 antibodies (including aCD3-hVH1/VL5, aCD3-hVH8/VL1, aCD3-hVH8/VL5, aCD3-hVH9/VL1, aCD3-hVH9/VL2, aCD3-hVH9/VL3, aCD3-hVH9/VL5) to human CD3 ⁇ protein, where humanized CD3 antibodies bind with high affinity to CD3 ⁇ recombinant protein.
  • humanized anti-CD3 antibodies including aCD3-hVH1/VL5, aCD3-hVH8/VL1, aCD3-hVH8/VL5, aCD3-hVH9/VL1, aCD3-hVH9/VL2, aCD3-hVH9/VL3, aCD3-hVH9/VL5
  • Jurkat cells in logarithmic growth phase were blocked with 3% BSA for 30 min, added to 96-well U-plate at 5 ⁇ 104 cells per well, centrifuged to discard the supernatant, and added with 50 ⁇ L of gradient diluted antibody (antibody concentration: from 30 ⁇ g/mL, with 3-fold dilution for 5 gradients) per well, and incubated at 4° C. for 1 hour.
  • antibody concentration from 30 ⁇ g/mL, with 3-fold dilution for 5 gradients
  • Table 2 shows the affinity of the humanized CD3 antibody to CD3 recombinant protein and Jurkat cells.
  • FIG. 4 shows that both humanized anti-CD3 antibodies hVH9/VL5 (aCD3-hVH9/VL5) and hVH9/VL2 (aCD3-hVH9/VL2) can bind both human CD3 ⁇ and cynomolgus monkey CD3 ⁇ proteins.
  • a novel T-cell ⁇ bispecific antibody with the native IgG configuration was constructed with the humanized CD3 antibody hVH9/VL5 ( ⁇ light chain and paired heavy chain) and the humanized CD20 antibody ( ⁇ light chain and paired heavy chain).
  • CD20 ⁇ CD3 bispecific antibodies were designed and constructed:
  • control antibody CD20 ⁇ CD3-crossFab was constructed by reference to the CrossFab method (Schaefer W et al. PNAS 2011).
  • CHO-S cells were performed with co-transfect, culture in 500 mL CD CHO AGT medium (Gibco #12490-001) at 37° C., 5% CO2, 150 rpm, and addon of 4% CHO Feed C+supplement (Gibco #A25031-05) at transient day 2, 4 and 6, respectively.
  • the fermentation broth was harvested, filtered and purified by Protein A affinity chromatography.
  • the monomer purity after one-step purification of Protein A was close to or higher than 90%, while the monomer purity of the control antibody CD20 ⁇ CD3-crossFab was lower than 80% (Table 4), and the ratio of ⁇ light chains was close to 1:1 ( FIG. 6 ).
  • the anti-CD20 ⁇ CD3 ⁇ bispecific antibody was further purified by purification using Capto S ImpAct ion exchange chromatography, eluting through a 50-300 mM NaCl, 50 mM phosphate, pH6.4 gradient, pooling the elution peaks and showing greater than 99% SEC-HPLC monomer content ( FIG. 7 ).
  • the light chain mismatch ratio was very low ( ⁇ 1%) and no CD3 homodimers or CD20 homodimers were detected ( FIG. 8 ).
  • the affinity of the bispecific antibody CD20 antigen arm was determined by measuring binding to CD20 over-expressing stably transfected cells or CD20+ tumor cells, respectively, and the affinity of the bispecific antibody CD3 arm was determined by measuring binding to CD3 recombinant antigen, Jurkat cells, or freshly isolated peripheral blood T-cells. The results showed that the affinity of the novel anti-CD20 ⁇ CD3 ⁇ bispecific antibody to tumor cells was about 3-5 times higher than that to T-cells.
  • the positive control antibody bsAB1 was synthesized and expressed as described in US20170174781.
  • CHO-human CD20 and CHO-cynomolgus monkey CD20 stably transfected cells prepared in Example 1 in logarithmic growth phase were adjusted to 5 ⁇ 105 cells/ml with 4% calf serum (Hyclone, SH30626.06), 100 ⁇ l/well cell suspension was added to 96-well U-plate, 300 g thereof was centrifuged for 5 min, the supernatant was discarded, and 100 ⁇ L of gradient diluted antibody (with starting concentration of 1800 nM, 3-fold dilution, 10 gradients) was added to each well and incubated at 4° C. for 60 min.
  • 4% calf serum Hyclone, SH30626.06
  • 100 ⁇ l/well cell suspension was added to 96-well U-plate, 300 g thereof was centrifuged for 5 min, the supernatant was discarded, and 100 ⁇ L of gradient diluted antibody (with starting concentration of 1800 nM, 3-fold dilution, 10 gradients) was added to each
  • FIG. 9 and Table 5 show that the anti-CD20 ⁇ CD3 ⁇ bispecific antibody binds with high affinity to the cellular CD20 receptor with comparable affinity on human and cynomolgus monkey CD20 stably transfected cells.
  • the SU-DHL-4, Raji and NALM-6 cells were taken in logarithmic growth phase, added with 200 ⁇ g/mL murine IgG (Jackson ImmunoResearch, 115-005-03) to ice bath for blocking for 30 min, the cells were adjusted to 5 ⁇ 10 5 cells/mL with 4% calf serum, and 100 ⁇ L/well was added to 96-well U-plate, 300 g was centrifuged for 5 min, discarding the supernatant. 100 ⁇ L/well of gradient diluted antibody (initial concentration: 1800 nM, 3-fold dilution, 10 gradients) was added, and incubated at 4° C. for 60 min.
  • the primary antibody was washed off, 50 ⁇ L/well Alexa Fluro647-labeled goat anti-human IgG Fc (1: 300 dilution) was added and incubated on ice for 20 min. 50 ⁇ L/well PI was added after washing once, incubated for 5 min, and detected with flow cytometer.
  • the results are shown in FIG. 10 and Table 6.
  • the anti-CD20 ⁇ CD3 ⁇ bispecific antibody binds with high affinity to CD20+ tumor cells SU-DHL-4, Raji and NALM-6.
  • Jurkat cells in logarithmic growth phase were added with 200 ⁇ g/mL murine IgG (Jackson ImmunoResearch, 115-005-03) and incubated on ice for 30 minutes.
  • the cells were adjusted to 5 ⁇ 10 5 cells/mL with 4% calf serum, 100 ⁇ L/well was added to 96-well U-plate, 300 g was centrifuged to removed the supernatant, 100 ⁇ L/well of gradient diluted antibody (initial concentration: 1800 nM, 3-fold dilution, 10 gradients) was added and incubated at 4° C. for 60 min.
  • the anti-CD20 ⁇ CD3 ⁇ bispecific antibody binds with moderate affinity to human leukemia T-cell line Jurkat cells with an EC 50 of about 71-120 nM, which is about 10-fold lower than the binding of the CD20 antigen arm to the CD20 receptor.
  • PBMC Human fresh peripheral blood was taken and PBMC was isolated by Ficoll. Paque Plu (GE, 17-1440-03). PBMC was adjusted to 5 ⁇ 10 5 cells/mL with 4% calf serum (Hyclone, SH30626.06), 100 ⁇ L/well was added to a 96-well U-plate, the supernatant was centrifuged off and 100 ⁇ L of gradient diluted antibody (with starting concentration of 1800 nM, 3-fold dilution, 10 gradients) was added to each well and incubated for 60 min at 4° C.
  • 4% calf serum Hyclone, SH30626.06
  • the anti-CD20 ⁇ CD3 ⁇ bispecific antibody recognizes human peripheral blood CD4 + T and CD8 + T-cells, has an affinity of about 65-98 nM with human T-cells, is weaker than the binding force of CD20 antigen arm with CD20 receptor by about 10 times, and favors the preferential enrichment of the bispecific antibody to tumor cells.
  • Binding capacity (nM) of anti-CD20 ⁇ CD3 ⁇ bispecific antibodies to human cells EC 50 ( nM) SU-DHL-4 Raji NALM-6 Jurkat CD4T CD8T CD20 ⁇ CD3 ⁇ 002 7 23 10 71 73 98 CD20 ⁇ CD3 ⁇ 003 6 25 8 120 69 65 bsAB1 19 115 48 ND 25 22 KLH ⁇ CD3 — — — 33 62 65 ND: not saturated at high concentration
  • 50 ⁇ L of gradient diluted antibody (antibody concentration from 66.7 nM, 10-fold dilution, 7 gradients) was added to each well, and incubated for 24 h at 37° C. in 5% CO 2 .
  • 50 ⁇ L of the supernatant was transferred to a new black elisa plate, 50 ⁇ L/well of LDH detection substrate was added, the reaction was stopped after 10 minutes and LDH release was detected.
  • FIGS. 13 A, 13 B show the killing of human B-lymphoblastic leukemia cells Nalm-6 by the anti-CD20 ⁇ CD3 ⁇ bispecific antibody and the activation of T-cells, respectively.
  • FIGS. 13 A, 13 B show the killing of human B-lymphoblastic leukemia cells Nalm-6 by the anti-CD20 ⁇ CD3 ⁇ bispecific antibody and the activation of T-cells, respectively.
  • FIGS. 15 A, 15 B show killing of TMD-8 cells and activation of T-cells by the anti-CD20 ⁇ CD3 ⁇ bispecific antibody, respectively.
  • FIGS. 15 A, 15 B show killing of Toledo cells and activation of T-cells by a CD20 ⁇ CD3 ⁇ bispecific antibody, respectively.
  • both CD20 ⁇ CD3 ⁇ 002 and CD20 ⁇ CD3 ⁇ 003 could mediate effective killing of T-cells, with killing activity comparable to or slightly stronger than that of control antibody bsAB1, and the activation of T-cells was milder than the latter. 5.
  • 50p/well of the target cells were inoculated into a 96-well plate, the supernatant was discarded by centrifugation at 300 g for 5 minutes, and 50l/well of the Jurkat-NFAT-luc reporter cells were inoculated into a 96-well plate, and 50 ⁇ l of gradient-diluted CD20 ⁇ CD30, bispecific antibody or control antibody KLH ⁇ CD3 (initial concentration of 20 ⁇ g/ml, 10-fold dilution, 10 gradients) was added to each well, and incubated at 37° C. for 6 hours in 5% CO 2 .
  • His-Tag antibody 50 Mg/ml was amino-conjugated to a CM5 chip to capture the His-tagged Fc ⁇ RI, Fc ⁇ RIIA H131 and Fc ⁇ RIIIA V158 recombinant proteins (Sino Biological, #10256-H08H/10374-H08H1/10389-H08H1), respectively, with a capture time of 40 seconds and a flow rate of 10 ⁇ L/min.
  • the gradient diluted antibody (with starting concentration of 37.5 ⁇ g/mL, 2-fold dilution) was flowed through the chip at a flow rate of 30 ⁇ L/min, with an association time of 120 seconds and a dissociation time of 200 seconds, and affinity constants were obtained by fitting with Biacore evaluation software.
  • the CD20 ⁇ CD3 ⁇ bispecific antibody did not bind to Fc ⁇ RI, Fc ⁇ RIIA H131 and Fc ⁇ RIIIA V158 ; the wild-type IgG4 control antibody bound Fc ⁇ RI with high affinity and weakly bound to Fc ⁇ RIIA H131 .
  • mice Six to eight-week-old female B-NGD mice (Bio-Tech Co. Ltd.) were subcutaneously inoculated with 3 ⁇ 10 6 Raji cells. When the tumors grew to 60 mm 3 , they were randomly divided into treatment group 3.0 mg/kg, treatment group 0.6 mg/kg, treatment group 0.12 mg/kg and a negative control group with KLH ⁇ CD3 of 3 mg/kg. Each mouse received 1 ⁇ 10 7 PBMC cells via tail vein injection. Three days later, the first dose was administered to the mouse once every 5 days for a total of 3 doses. The tumor volume and body weight of the mice were monitored. At the end of the experiment, the mice were killed by cervical dislocation and the tumors were collected and weighed. The results are shown in FIG. 17 .
  • mice 6-8 week female B-NGD mice (Bio-Oracle Bio-Tech Co. Ltd.) were selected, Raji (3 ⁇ 10 6 ) and human PBMC (5 ⁇ 10 6 ) were mixed and inoculated subcutaneously.
  • the dose groups were respectively set as dose group of 3.0 mg/mL, dose group of 0.6 mg/mL, dose group of 0.12 mg/mL and negative control group of KLH ⁇ CD3 of 3 mg/kg.
  • the dosing interval was once every 5 days for a total of 2 doses.
  • the tumor volume and body weight of the mice were monitored. At the end of the experiment, the mice were killed by cervical dislocation and the tumors were collected and weighed.
  • the results are shown in FIG. 18 .
  • the in vivo efficacy of anti-CD20 ⁇ CD3 ⁇ , bispecific antibody was dose-related, with tumor inhibition rates of 65%, 98% and 162% at low, medium and high doses, respectively.
  • the tumor was completely inhibited or subsided in high and medium dose groups.
  • each dose group consisted of 2 monkeys, half males and half females. Each dose group received doses of 0.3, 1 and 3 mg/kg (once a week for 3 weeks, a total of 4 doses) and 1 mg/kg (single dose) of CD20 ⁇ CD3 ⁇ 002 bispecific antibody. See Table 9 for dosing schedule. During the administration period and recovery period, all monkeys in each group were in good general condition, without toxic reaction or death or moribund. No significant abnormal change in body temperature was observed in each dose group, and lead II ECG waveform was normal.
  • CD20 ⁇ CD3 ⁇ bispecific antibody dosing regimen Route and frequency of Animal Group Dose administration Gender Number Low dose 0.3 mg/kg IV, one time per week/3 Male 2016221 group weeks, D 1, D 8, D 15, Female 2016222 D 22 Medium 1 mg/kg IV, one time per week/3 Male 2016223 dose weeks, D 1, D 8, D 15, Female 2016224 group D 22 High 3 mg/kg IV, one time per week/3 Male 2016225 dose weeks, D 1, D 8, D 15, Female 2016226 group D 22 Medium 1 mg/kg IV, Single dose on D 1 Female 2016227 dose Male 2016228 group
  • a novel BCMA-CD3 ⁇ humanized bispecific antibody having the native IgG configuration was constructed with a ⁇ light chain-containing BCMA humanized antibody, and a ⁇ light chain-containing humanized CD3 antibody, with reference to example 2, while charge variants are introduced in the BCMA antigen and the CD3 arm(V ⁇ BCMA : Gln 42 Lys; VH BCMA : Gln 39 Glu; V ⁇ CD3 : Gln 40 Glu; VH CD3 : Gln 39 Lys) (see Table 10 for sequence); the Fc portion of the bispecific antibody adopts the human IgG4 knob-into-hole structure to achieve heterodimer pairing, and through mutation of Ser 228 Pro, Leu 235 Glu and Pro 329 Ala, the hinge region remains stable and interaction with Fc ⁇ R receptor and Clq is reduced.
  • BCMA ⁇ CD3 ⁇ bispecific antibodies light chain of heavy chain of light chain of heavy chain of Protein sequence BCMA arm BCMA arm CD3 arm CD3 arm BCMA ⁇ CD3 SEQ ID NO. 80 SEQ ID NO. 82 SEQ ID NO. 66 SEQ ID NO. 68 ⁇ 003 BCMA ⁇ CD3 SEQ ID NO. 84 SEQ ID NO. 82 SEQ ID NO. 66 SEQ ID NO. 68 ⁇ 004 BCMA ⁇ CD3 SEQ ID NO. 80 SEQ ID NO. 86 SEQ ID NO. 66 SEQ ID NO. 68 ⁇ 005 BCMA ⁇ CD3 SEQ ID NO. 84 SEQ ID NO. 86 SEQ ID NO. 66 SEQ ID NO.
  • ⁇ light chain light chain
  • CHO-hBCMA Logarithmically growing CHO-human BCMA stably transfected cells
  • CHO-cynomolgus monkey BCMA stably transfected cells CHO-cynoBCMA
  • tumor cells NCI-H929 and RPMI-8226, respectively.
  • FIG. 20 shows that the BCMA ⁇ CD3 ⁇ bispecific antibody binds with high affinity to human, cynomolgus monkey BCMA stably transfected cells.
  • FIG. 21 shows that the BCMA ⁇ CD3 ⁇ bispecific antibody binds with high affinity to BCMA+ tumor cells NCI-H929 and RPMI-8226.
  • the binding constants EC 50 of the BCMA ⁇ CD3 ⁇ bispecific antibody to cells are shown in Table 13.
  • BCMA ⁇ CD3 ⁇ bispecific antibodies to BCMA stably transfected cells Cynomolgus Human monkey NCI- RPMI- EC 50 (nM) BCMA-CHO BCMA-CHO H929 8226 BCMA ⁇ CD3 16 3 34 34 ⁇ 003 BCMA ⁇ CD3 22 3 36 39 ⁇ 004 BCMA ⁇ CD3 24 3 33 38 ⁇ 005 BCMA ⁇ CD3 16 3 32 19 ⁇ 006 KLH ⁇ CD3 — — — — —
  • Jurkat cells in logarithmic growth phase were added with 200 ⁇ g/mL murine IgG (Jackson ImmunoResearch, 115-005-03) and incubated on ice for 30 minutes.
  • the cells were adjusted to 5 ⁇ 105 cells/mL with 4% calf serum, 100 ⁇ L/well was added to 96-well U-plate, 300 g was centrifuged to removed the supernatant, 100 ⁇ L/well of gradient diluted antibody (initial concentration: 1800 nM, 3-fold dilution, 10 gradients) was added and incubated at 4° C. for 60 min.
  • PBMC peripheral blood was taken and PBMC was isolated by Ficoll. Paque Plu (GE, 17-1440-03). PBMC was adjusted to 5 ⁇ 10 5 cells/mL with 4% calf serum (Hyclone, SH30626.06), 100 ⁇ L/well was added to a 96-well U-plate, the supernatant was centrifuged off and 100 ⁇ L of gradient diluted antibody (with starting concentration of 1800 nM, 3-fold dilution, 10 gradients) was added to each well and incubated for 60 min at 4° C.
  • 4% calf serum Hyclone, SH30626.06
  • the control antibody REGN5458 was synthesized and prepared according to US20200024356. As shown in FIG. 23 and Table 14.
  • the BCMA ⁇ CD3 ⁇ bispecific antibody recognizes human peripheral blood CD4+T and CD8+T-cells with an affinity of about 60-97 nM, which is weaker than the binding force of the BCMA antigen arm to the BCMA receptor, so that the bispecific antibody preferentially enriches into tumor cells.
  • 50 ⁇ L of gradient diluted antibody (antibody concentration from 66.7 nM, 10-fold dilution, 7 gradients) was added to each well and incubated for 24 h at 37° C. in 5% CO 2 .
  • 50 ⁇ L of the supernatant was transferred to a new black elisa plate, 50 ⁇ L/well of LDH detection substrate was added, the reaction was stopped after 10 minutes and LDH release was detected.
  • FIGS. 24 A, 24 B show killing of NCI-H929 cells and activation of T-cells, respectively, by BCMA ⁇ CD3 ⁇ bispecific antibody.
  • 25 A, 25 B show killing of RPMI-8226 cells and activation of T-cells by CMA ⁇ CD3 ⁇ bispecific antibody, respectively.
  • the BCMA ⁇ CD3 ⁇ bispecific antibody can mediate effective killing of T-cells, and the killing activity is equivalent to that of control antibody REGN5458.
  • the BCMA ⁇ CD3 ⁇ bispecific antibody can activate the NFAT signaling pathway of T-cells when RPMI-8226 tumor cells are used as target cells. In the absence of target cells, the NFAT signaling pathway is not activated.
  • Freshly isolated PBMC was taken and 50 ⁇ L of gradient diluted antibody (with antibody concentration from 66.7 nM, 10-fold dilution, 7 gradients) was added to each well and incubated at 37° C. in 5% CO 2 for 24 hours. At the end of the incubation, 50 ⁇ L of the supernatant was transferred to a new black elisa plate, 50 ⁇ L/well of LDH detection substrate was added, the reaction was stopped after 10 minutes and LDH release was detected.
  • gradient diluted antibody with antibody concentration from 66.7 nM, 10-fold dilution, 7 gradients
  • the remaining cells in the wells were washed twice with 4% calf blood, incubated with 100 ⁇ g/mL human IgG for 10 minutes, followed by T-cell activation detection antibodies (CD25-PE, CD4-APC, CD69-FITC and CD8-APC) and incubated on ice for 20 minutes. The supernatant was washed and discarded, 60 ⁇ L/well PI was added, incubated on ice for 5 minutes and detected by flow cytometry. The results are shown in FIG. 27 . In the absence of target cells, the BCMA ⁇ CD3 ⁇ bispecific antibody had no activation of peripheral blood T-cells, comparable to the negative control KLH ⁇ CD3.
  • the BCMA ⁇ CD30, bispecific antibody did not bind to Fc ⁇ RI, Fc ⁇ RIIA H131 and Fc ⁇ RIIIA V158 ; the wild-type IgG4 control antibody bound Fc ⁇ RI with high affinity and weakly bound to Fc ⁇ RIIA H131 .
  • mice Six to eight-week-old female B-NGD mice (Bio-Tech Co. Ltd.) were subcutaneously inoculated with 2 ⁇ 10 6 NCI-H929 cells (mixed with Matrigel 1: 1). When the tumors grew to 60 mm 3 , they were randomly divided into dose group (3.0 mg/kg), dose group (0.6 mg/kg) and negative control group (KLH ⁇ CD3 3 mg/kg). Each mouse received 1 ⁇ 10 7 PBMC cells via tail vein injection. Three days later, the first dose was administered to the mouse once every 5 days for a total of 2 doses. The tumor volume and body weight of the mice were monitored every 2 days. At the end of the experiment, the mice were killed by cervical dislocation and the tumors were collected and weighed.
  • the results are shown in FIG. 29 .
  • the in vivo efficacy of BCMA ⁇ CD3 ⁇ bispecific antibody was dose-related.
  • the tumor inhibition rates in 3.0 mg/kg group and 0.6 mg/kg group were 95% and 108% (BCMA ⁇ CD3 ⁇ 005) and 94% and 108% (BCMA ⁇ CD3 ⁇ 006), respectively.
  • the tumor-bearing mice tolerated the foregoing doses well, without weight loss and other adverse reactions.
  • a GPC3 antibody containing a ⁇ light chain and a humanized anti-CD3 antibody containing k light chain were used to construct a novel GPC3-CD3 ⁇ humanized bispecific antibody having the native IgG configuration, while introduction in the GPC3 antigen arm and the CD3 arm is made of charge variants (V ⁇ GPC3 : Gln 43 Lys; VH GPC3 : Gln 39 Glu; V ⁇ CD3 : Gln 40 Glu; VH CD3 : Gln 39 Lys) (see Table 15 for sequence).
  • the Fc portion of the bispecific antibody adopts the human IgG4 knob-into-hole structure to achieve heterodimer pairing, and through mutation of Ser 228 Pro, Leu 235 Glu, and Pro 329 Ala, the hinge region remains stable and interaction with Fey receptor and Clq is reduced.
  • GPC3 ⁇ CD3 ⁇ 002 SEQ ID NO.
  • SEQ ID NO. 90 SEQ ID NO. 66 SEQ ID NO. 88 68
  • GPC3 ⁇ CD3 ⁇ 003 SEQ ID NO.
  • SEQ ID NO. 94 SEQ ID NO. 66 SEQ ID NO. 92 68
  • the fermentation broth was harvested, filtered and purified by Protein A affinity chromatography, and the SEC-HPLC monomer content was higher than 92%.
  • the monomer content was further increased to above 99.5% by Butyl HP hydrophobic chromatography and Capto Q anion chromatography (Table 16).
  • CHO-human GPC3, CHO-Cynomolgus monkey GPC3 stably transfected cells or human hepatocellular carcinoma HepG2 tumor cells in logarithmic growth phase were taken. After blocking, the cells were adjusted to 5 ⁇ 10 5 cells/ml, and 100 ⁇ l/well cell suspension was added to 96-well U-shaped plate and centrifuged at 300 g for 5 min. The supernatant was discarded, 100 ⁇ L of gradient diluted antibody (with a starting concentration of 1800 nM, 3-fold dilution, 10 gradients) was added to each well, and incubated at 4° C. for 60 min.
  • gradient diluted antibody with a starting concentration of 1800 nM, 3-fold dilution, 10 gradients
  • Jurkat cells in logarithmic growth phase were added with 200 ⁇ g/mL murine IgG (Jackson ImmunoResearch, 115-005-03) and incubated on ice for 30 minutes.
  • the cells were adjusted to 5 ⁇ 10 5 cells/mL with 4% calf serum, 100 ⁇ L/well was added to 96-well U-plate, 300 g was centrifuged to removed the supernatant, 100 ⁇ L/well of gradient diluted antibody (initial concentration: 1800 nM, 3-fold dilution, 10 gradients) was added and incubated at 4° C. for 60 min.
  • the GPC3 ⁇ CD3 ⁇ bispecific antibody binds with moderate affinity to human leukemia T-cell line Jurkat cells with an EC 50 of about 20-40 nM.
  • PBMC peripheral blood was taken and PBMC was isolated by Ficoll. Paque Plus (GE, 17-1440-03). PBMC was adjusted to 5 ⁇ 10 5 cells/mL with 4% calf serum (Hyclone, SH30626.06), 100 ⁇ L/well was added to a 96-well U-plate, the supernatant was centrifuged off and 100 ⁇ L of gradient diluted antibody (with starting concentration of 1800 nM, 3-fold dilution, 10 gradients) was added to each well and incubated for 60 min at 4° C.
  • 4% calf serum Hyclone, SH30626.06
  • Freshly isolated PBMC was mixed with target cells in logarithmic growth phase, hepG2 cells, respectively, at an effector/target cell ratio of 10:1.
  • 50 ⁇ L of gradient diluted antibody (with antibody concentration from 66.7 nM, 10-fold dilution, 7 gradients) was added to each well and incubated for 24 h at 37° C. in 5% CO 2 .
  • 50 ⁇ L of the supernatant was transferred to a new black ELISA plate, 50 ⁇ L/well of LDH detection substrate was added, the reaction was stopped after 10 minutes and LDH release was detected.
  • FIGS. 34 A and 34 B show killing of HepG2 cells and activation of T-cells, respectively, by the GPC3 ⁇ CD3 ⁇ bispecific antibody.
  • Target cells CHO-human GPC3 in logarithmic growth phase were harvested, centrifuged, the supernatant discarded and resuspended to 2 ⁇ 10 5 cells/ml. 50l/well of target cells were seeded into 96-well plates and incubated overnight at 37° C. in 5% CO 2 . The Jurkat-NFAT-luc reporter cells in logarithmic growth phase were taken and performed with centrifugation at 300 g for 5 min. The supernatant was discarded, and it resuspended to 4 ⁇ 10 6 cells/ml.
  • the 96-well plate was taken out, the supernatant, inoculate Jurkat-NFAT-luc reporter cells were 4 ⁇ 10 6 into the 96-well plate at 25 ⁇ L/well and added with 25 ⁇ L of gradient diluted GPC3 ⁇ CD3 ⁇ bispecific antibody or control antibody KLH ⁇ CD3 (with an initial concentration of 20 ⁇ g/ml, 3-fold dilution, 10 gradients) into each well, with was incubated at 37° C. for 6 h. After the incubation, 100 ⁇ L of detection reagent was added to each well according to ONE-Glo Luciferase Assay System instructions for detection in a microplate reader (MD SpectraMax i 3x). The detection results are shown in FIG. 35 .
  • the GPC3 ⁇ CD3 ⁇ bispecific antibody can activate the NFAT signaling pathway of T-cell when CHO-human GPC3 is used as the target cell.
  • Freshly isolated PBMC was added with 100 ⁇ L of antibody (10 ⁇ g/mL) and incubated at 37° C. in 5% CO 2 for 24 hours.
  • the cells in the wells were washed twice with 4% calf blood, incubated with 100 ⁇ g/mL human IgG for 10 minutes, followed by T-cell activation detection antibodies (CD25-BV421, CD4-FITC, CD69-BV605 and CD8-APC) and incubated on ice for 20 minutes.
  • the supernatant was washed and discarded, 60 ⁇ L/well PI was added, incubated on ice for 5 minutes and detected by flow cytometry.
  • the positive control antibody ERY974 was prepared according to US20170267783. The results are shown in FIG. 36 . In the absence of target cells, GPC3 ⁇ CD3 ⁇ bispecific antibody had no activation of peripheral blood T-cells, comparable to the negative control KLH ⁇ CD3.
  • mice Six to eight-week-old female B-NGD mice (Bio-Tech Co. Ltd.) were subcutaneously inoculated with HepG2 cells (7 ⁇ 10 6 /mouse). When the tumors grew to 60-100 mm 3 , they were randomly divided into high dose group (3.0 mg/kg), medium dose group (1.0 mg/kg), low dose group (0.3 mg/kg), positive control group (ERY974) and negative control group (KLH ⁇ CD3). Each mouse was injected intravenously with 1 ⁇ 10 7 PBMC cells via the tail vein. Three days later, the first dose was given to the mouse once every 5 days for a total of 2 doses. The tumor volume and body weight of the mice were monitored.
  • mice were killed by cervical dislocation and the tumors were collected and weighed.
  • the results are shown in FIG. 37 .
  • the in vivo efficacy of GPC3 ⁇ CD3 ⁇ bispecific antibody was dose-related, and the tumor inhibition rates (low-dose to high-dose) were: 76.7%, 81.3% and 95.9%.
  • the tumor-bearing mice tolerated the foregoing doses well, without weight loss and other adverse reactions.
  • mice Six-week-old female C57/BL6-hCD3 mice (Bio-tech Bio-tech Co. Ltd.) were selected and inoculated with Hepa1-6/human GPC3 (6 ⁇ 106/mouse) subcutaneously. When the tumor volume reached 60-100 mm3, the mice were randomly divided into groups. The dose was set as 10 mg/mL in high dose group, 3 mg/mL in medium dose group low dose group 1 mg/mL, positive control group ERY974 and negative control group KLH ⁇ CD3 10 mg/kg. The dosing interval was once every 3 days for a total of 3 doses. The tumor volume and body weight of the mice were monitored. At the end of the experiment, the mice were killed by cervical dislocation and the tumors were collected and weighed. The results are shown in FIG. 38 . The GPC3 ⁇ CD3 ⁇ bispecific antibody significantly mediated immune cells to kill tumor cells and reduce tumor-bearing volume. Its 10 mg/kg dose was comparable to ERY974.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Cell Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Oncology (AREA)
  • Mycology (AREA)
  • Optics & Photonics (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicinal Preparation (AREA)
US18/038,159 2020-11-23 2021-11-22 Bispecific antibody and use thereof Pending US20240002540A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
CN202011325843.0A CN114524878B (zh) 2020-11-23 2020-11-23 一种双特异性抗体及其用途
CN202011325843.0 2020-11-23
PCT/CN2021/132195 WO2022105924A1 (zh) 2020-11-23 2021-11-22 一种双特异性抗体及其用途

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2021/132195 A-371-Of-International WO2022105924A1 (zh) 2020-11-23 2021-11-22 一种双特异性抗体及其用途

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US19/229,907 Continuation US20250346685A1 (en) 2020-11-23 2025-06-05 Bispecific antibody and use thereof

Publications (1)

Publication Number Publication Date
US20240002540A1 true US20240002540A1 (en) 2024-01-04

Family

ID=81618526

Family Applications (2)

Application Number Title Priority Date Filing Date
US18/038,159 Pending US20240002540A1 (en) 2020-11-23 2021-11-22 Bispecific antibody and use thereof
US19/229,907 Pending US20250346685A1 (en) 2020-11-23 2025-06-05 Bispecific antibody and use thereof

Family Applications After (1)

Application Number Title Priority Date Filing Date
US19/229,907 Pending US20250346685A1 (en) 2020-11-23 2025-06-05 Bispecific antibody and use thereof

Country Status (8)

Country Link
US (2) US20240002540A1 (https=)
EP (3) EP4691565A2 (https=)
JP (3) JP7846110B2 (https=)
KR (2) KR20230117160A (https=)
CN (4) CN114524878B (https=)
AU (2) AU2021383901B2 (https=)
CA (1) CA3199721A1 (https=)
WO (1) WO2022105924A1 (https=)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114573703A (zh) * 2020-12-02 2022-06-03 康诺亚生物医药科技(成都)有限公司 一种t细胞衔接器治疗剂的开发和应用
CN114573702A (zh) * 2020-12-02 2022-06-03 康诺亚生物医药科技(成都)有限公司 一种新型肿瘤衔接器治疗药物的开发和应用
US11912771B2 (en) 2021-03-09 2024-02-27 Cdr-Life Ag MAGE-A4 peptide-MHC antigen binding proteins
EP4304725A1 (en) 2021-03-09 2024-01-17 CDR-Life AG Rabbit-derived antigen binding protein nucleic acid libraries
KR20250067130A (ko) 2022-09-14 2025-05-14 씨디알-라이프 아게 Mage-a4 펩티드 이중 t 세포 연결체
CN120712345A (zh) * 2022-12-30 2025-09-26 上药生物治疗(香港)有限公司 表达趋化因子受体的细胞及其用途
AU2024239034A1 (en) * 2023-03-18 2025-09-25 Xadcera Biopharmaceutical (Suzhou) Co., Ltd. Anti-her3/muc1 antibodies and uses thereof

Family Cites Families (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5635483A (en) 1992-12-03 1997-06-03 Arizona Board Of Regents Acting On Behalf Of Arizona State University Tumor inhibiting tetrapeptide bearing modified phenethyl amides
US5780588A (en) 1993-01-26 1998-07-14 Arizona Board Of Regents Elucidation and synthesis of selected pentapeptides
US6214345B1 (en) 1993-05-14 2001-04-10 Bristol-Myers Squibb Co. Lysosomal enzyme-cleavable antitumor drug conjugates
US7229619B1 (en) 2000-11-28 2007-06-12 Medimmune, Inc. Methods of administering/dosing anti-RSV antibodies for prophylaxis and treatment
US6884869B2 (en) 2001-04-30 2005-04-26 Seattle Genetics, Inc. Pentapeptide compounds and uses related thereto
WO2003026577A2 (en) 2001-09-24 2003-04-03 Seattle Genetics, Inc. P-amidobenzylethers in drug delivery agents
SI1545613T1 (sl) 2002-07-31 2011-11-30 Seattle Genetics Inc Avristatinski konjugati in njihova uporaba za zdravljenje raka avtoimunske bolezni ali infekcijskebolezni
US7498298B2 (en) 2003-11-06 2009-03-03 Seattle Genetics, Inc. Monomethylvaline compounds capable of conjugation to ligands
AU2005218642B2 (en) 2004-03-02 2011-04-28 Seagen Inc. Partially loaded antibodies and methods of their conjugation
WO2006132670A2 (en) 2004-11-12 2006-12-14 Seattle Genetics, Inc. Auristatins having an aminobenzoic acid unit at the n terminus
EP1898529A1 (en) 2005-06-28 2008-03-12 Pioneer Corporation Broadcast receiving apparatus, interference detecting apparatus and interference detecting method
SI2501817T2 (sl) 2010-02-08 2021-09-30 Regeneron Pharmaceuticals, Inc. Miš z navadno lahko verigo
EP2552747A1 (de) 2010-03-30 2013-02-06 Behr GmbH & Co. KG Temperierelement und temperiervorrichtung für ein fahrzeug
PL2606064T3 (pl) * 2010-08-16 2015-07-31 Novimmune Sa Sposoby wytwarzania wieloswoistych i wielowartościowych przeciwciał
US9676871B2 (en) 2010-11-05 2017-06-13 Pfizer Inc. Engineered polypeptide conjugates and methods for making thereof using transglutaminase
JOP20200236A1 (ar) 2012-09-21 2017-06-16 Regeneron Pharma الأجسام المضادة لمضاد cd3 وجزيئات ربط الأنتيجين ثنائية التحديد التي تربط cd3 وcd20 واستخداماتها
CN105121467B (zh) * 2012-12-03 2019-07-05 诺夫免疫股份有限公司 抗cd47抗体及其使用方法
MA40764A (fr) 2014-09-26 2017-08-01 Chugai Pharmaceutical Co Ltd Agent thérapeutique induisant une cytotoxicité
EP3778640A1 (en) 2015-05-01 2021-02-17 Genentech, Inc. Masked anti-cd3 antibodies and methods of use
US20180171017A1 (en) 2015-06-05 2018-06-21 Chugai Seiyaku Kabushiki Kaisha Combined use of immune activators
US10072088B2 (en) 2015-08-17 2018-09-11 Janssen Pharmaceutica, Nv Anti-BCMA antibodies and uses thereof
AU2016378573A1 (en) 2015-12-22 2018-07-19 Regeneron Pharmaceuticals, Inc. Bispecific anti-CD20/anti-CD3 antibodies to treat acute lymphoblastic leukemia
US11072666B2 (en) * 2016-03-14 2021-07-27 Chugai Seiyaku Kabushiki Kaisha Cell injury inducing therapeutic drug for use in cancer therapy
CN111201031B (zh) * 2017-08-25 2024-11-01 诺夫免疫股份有限公司 抗CD47 x抗间皮素抗体及其使用方法
JPWO2019244973A1 (ja) * 2018-06-20 2021-07-08 中外製薬株式会社 標的細胞に対する免疫反応を活性化する方法およびその組成物
TWI838389B (zh) * 2018-07-19 2024-04-11 美商再生元醫藥公司 雙特異性抗-BCMAx抗-CD3抗體及其用途
CN111454357B (zh) 2019-08-14 2022-03-15 康诺亚生物医药科技(成都)有限公司 一种含有抗体的肿瘤治疗剂的开发和应用
CN112062855B (zh) * 2020-08-26 2024-08-30 北京天诺健成医药科技有限公司 一种含有衔接器的药物治疗剂的开发和应用
CN114573702A (zh) * 2020-12-02 2022-06-03 康诺亚生物医药科技(成都)有限公司 一种新型肿瘤衔接器治疗药物的开发和应用
CN114573703A (zh) * 2020-12-02 2022-06-03 康诺亚生物医药科技(成都)有限公司 一种t细胞衔接器治疗剂的开发和应用

Also Published As

Publication number Publication date
CA3199721A1 (en) 2022-05-27
CN118878693A (zh) 2024-11-01
CN118878694A (zh) 2024-11-01
AU2021383901A1 (en) 2023-07-06
EP4591941A2 (en) 2025-07-30
JP7846110B2 (ja) 2026-04-14
KR20250060324A (ko) 2025-05-07
JP2025016538A (ja) 2025-02-04
KR20230117160A (ko) 2023-08-07
EP4691565A2 (en) 2026-02-11
CN114524878B (zh) 2024-08-02
AU2025203320A1 (en) 2025-05-29
EP4249514A1 (en) 2023-09-27
JP2023550171A (ja) 2023-11-30
CN114524878A (zh) 2022-05-24
JP2025016537A (ja) 2025-02-04
AU2021383901B2 (en) 2026-02-05
WO2022105924A1 (zh) 2022-05-27
CN116490614A (zh) 2023-07-25
EP4591941A3 (en) 2025-11-12
EP4249514A4 (en) 2024-10-16
US20250346685A1 (en) 2025-11-13

Similar Documents

Publication Publication Date Title
US20250346685A1 (en) Bispecific antibody and use thereof
JP6679762B2 (ja) 抗gpr20抗体及び抗gpr20抗体−薬物コンジュゲート
JPWO2018212136A1 (ja) 抗cdh6抗体及び抗cdh6抗体−薬物コンジュゲート
US20240247072A1 (en) Development and use of function-enhanced antibody blocking agent
JP7736783B2 (ja) エンゲージャを含む薬物治療剤の開発及び応用
US20240043568A1 (en) Development of new tumor engager therapeutic drug and use thereof
US20250270315A1 (en) Novel anti-sirpa antibodies
JP2026027375A (ja) T細胞アダプター治療剤の開発及び使用
TW202509084A (zh) 抗grp78抗體及其應用
JPWO2022117045A5 (https=)
WO2021170146A1 (zh) 新型抗cd19抗体和cd19-car-t细胞的制备及其应用

Legal Events

Date Code Title Description
AS Assignment

Owner name: KEYMED BIOSCIENCES CO.,LTD, CHINA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CHEN, BO;XU, GANG;WANG, CHANGYU;REEL/FRAME:063837/0746

Effective date: 20230519

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION COUNTED, NOT YET MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED